WorldWideScience

Sample records for voltage-dependent calcium currents

  1. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  2. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  3. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  4. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  5. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  6. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  7. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  8. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  9. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  10. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  11. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  12. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef

    2009-01-01

    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  13. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  15. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  16. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  17. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  18. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  19. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  20. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  1. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  2. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  3. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  4. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  5. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  6. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  7. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  8. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  9. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  10. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  11. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  12. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  13. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  14. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  15. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  16. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  17. 5-HT modulation of hyperpolarization-activated inward current and calcium- dependent outward current in a crustacean motor neuron

    DEFF Research Database (Denmark)

    Kiehn, O.; Harris-Warrick, R. M.

    1992-01-01

    1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...

  18. Bone morphogenetic protein 4 inhibits insulin secretion from rodent beta cells through regulation of calbindin1 expression and reduced voltage-dependent calcium currents

    DEFF Research Database (Denmark)

    Christensen, Gitte L.; Jacobsen, Maria L. B.; Wendt, Anna

    2015-01-01

    AIMS/HYPOTHESIS: Type 2 diabetes is characterised by progressive loss of pancreatic beta cell mass and function. Therefore, it is of therapeutic interest to identify factors with the potential to improve beta cell proliferation and insulin secretion. Bone morphogenetic protein 4 (BMP4) expression...

  19. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  20. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  1. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  2. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes.

    Science.gov (United States)

    Samigullin, Dmitry; Fatikhov, Nijaz; Khaziev, Eduard; Skorinkin, Andrey; Nikolsky, Eugeny; Bukharaeva, Ellya

    2014-01-01

    At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers-which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal-has hitherto been technically impossible. With the aim of quantifying both Ca(2+) currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 pA and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 μM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  3. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes

    Directory of Open Access Journals (Sweden)

    Dmitry eSamigullin

    2015-01-01

    Full Text Available At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers—which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal—has hitherto been technically impossible. With the aim of quantifying both Ca2+ currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 рА and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 µM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  4. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  5. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  6. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  7. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  8. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  9. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  10. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  11. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  12. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  13. Calcium Transient and Sodium-Calcium Exchange Current in Human versus Rabbit Sinoatrial Node Pacemaker Cells

    Directory of Open Access Journals (Sweden)

    Arie O. Verkerk

    2013-01-01

    Full Text Available There is an ongoing debate on the mechanism underlying the pacemaker activity of sinoatrial node (SAN cells, focusing on the relative importance of the “membrane clock” and the “Ca2+ clock” in the generation of the small net membrane current that depolarizes the cell towards the action potential threshold. Specifically, the debate centers around the question whether the membrane clock-driven hyperpolarization-activated current, If, which is also known as the “funny current” or “pacemaker current,” or the Ca2+ clock-driven sodium-calcium exchange current, INaCa, is the main contributor to diastolic depolarization. In our contribution to this journal’s “Special Issue on Cardiac Electrophysiology,” we present a numerical reconstruction of If and INaCa in isolated rabbit and human SAN pacemaker cells based on experimental data on action potentials, If, and intracellular calcium concentration ([Ca2+]i that we have acquired from these cells. The human SAN pacemaker cells have a smaller If, a weaker [Ca2+]i transient, and a smaller INaCa than the rabbit cells. However, when compared to the diastolic net membrane current, INaCa is of similar size in human and rabbit SAN pacemaker cells, whereas If is smaller in human than in rabbit cells.

  14. Direct interaction of CaVβ with actin up-regulates L-type calcium currents in HL-1 cardiomyocytes.

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-02-20

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Direct Interaction of CaVβ with Actin Up-regulates L-type Calcium Currents in HL-1 Cardiomyocytes*

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E.; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-01-01

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. PMID:25533460

  16. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  17. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  18. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  19. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  20. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  1. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  2. Phencyclidine block of calcium current in isolated guinea-pig hippocampal neurones.

    Science.gov (United States)

    Ffrench-Mullen, J M; Rogawski, M A

    1992-10-01

    1. Phencyclidine (PCP) block of Ca2+ channel current in enzymatically dissociated neurones from the CA1 region of the adult guinea-pig hippocampus was studied using whole-cell voltage clamp techniques. Ca2+ channel current was recorded with 3 mM-Ba2+ as the charge carrier. Na+ currents were blocked with tetrodotoxin and K+ currents were eliminated by using tetraethylammonium and N-methyl-D-glucamine as the predominant extracellular and intracellular cations, respectively. 2. Peak Ca2+ channel current evoked by depolarization from -80 to -10 mV was reduced in a use-dependent fashion by PCP. The apparent forward and reverse rate constants for block at the depolarized voltage were 10(6) s-1 M-1 and 11-14 s-1, respectively. These values were at least 60 times faster than the corresponding rates at the resting voltage. The steady-state block produced by PCP increased in a concentration-dependent fashion with an IC50 of 7 microM. Other dissociative anaesthetic drugs were substantially weaker inhibitors of the current (tiletamine > dizocilpine (MK-801) > ketamine). 3. The Ca2+ channel current recorded under identical conditions in rat dorsal root ganglion neurones was less sensitive to blockade by PCP (IC50, 90 microM). 4. PCP block of the hippocampal Ca2+ channel current occurred in a voltage-dependent fashion with the fractional block decreasing at positive membrane potentials. Analysis indicated that the PCP blocking site senses 56% of the transmembrane electric field. 5. Analysis of tail currents recorded at -80 mV demonstrated that PCP does not affect the voltage-dependent or time-dependent activation or deactivation of the Ca2+ channel current. 6. The rate and extent of inactivation of the Ca2+ channel current was maximal at -10 mV and diminished at more positive potentials. Experiments with Ba(2+)-free external solution demonstrated that inactivation of the Ca2+ channels is largely voltage-dependent and is not affected by Ba2+ influx. 7. PCP markedly increased the

  3. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  4. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  5. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  6. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  7. Calcium

    Science.gov (United States)

    ... You can get decent amounts of calcium from baked beans, navy beans, white beans, and others. Canned fish. You're in luck if you like sardines and canned salmon with bones. Almond milk. Working Calcium Into Your ...

  8. Calcium currents in a fast-twitch skeletal muscle of the rat.

    Science.gov (United States)

    Donaldson, P L; Beam, K G

    1983-10-01

    Slow ionic currents were measured in the rat omohyoid muscle with the three-microelectrode voltage-clamp technique. Sodium and delayed rectifier potassium currents were blocked pharmacologically. Under these conditions, depolarizing test pulses elicited an early outward current, followed by a transient slow inward current, followed in turn by a late outward current. The early outward current appeared to be a residual delayed rectifier current. The slow inward current was identified as a calcium current on the basis that (a) its magnitude depended on extracellular calcium concentration, (b) it was blocked by the addition of the divalent cations cadmium or nickel, and reduced in magnitude by the addition of manganese or cobalt, and (c) barium was able to replace calcium as an inward current carrier. The threshold potential for inward calcium current was around -20 mV in 10mM extracellular calcium and about -35 mV in 2 mM calcium. Currents were net inward over part of their time course for potentials up to at least +30 mV. At temperatures of 20-26 degrees C, the peak inward current (at approximately 0 mV) was 139 +/- 14 microA/cm2 (mean +/- SD), increasing to 226 +/- 28 microA/cm2 at temperatures of 27-37 degrees C. The late outward current exhibited considerable fiber-to-fiber variability. In some fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it appeared to be the sum of both leak and a slowly activated outward current. The rate of activation of inward calcium current was strongly temperature dependent. For example, in a representative fiber, the time-to-peak inward current for a +10-mV test pulse decreased from approximately 250 ms at 20 degrees C to 100 ms at 30 degrees C. At 37 degrees C, the time-to-peak current was typically approximately 25 ms. The earliest phase of activation was difficult to quantify because the ionic current was partially

  9. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  10. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  11. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  12. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  13. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  14. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  15. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  16. Separation of calcium isotopes by counter-current electromigration in molten salts (1962)

    International Nuclear Information System (INIS)

    Menes, F.; Dirian, G.; Roth, E.

    1962-01-01

    The method of counter-current electromigration in molten salts has been applied to calcium bromide with an alkali metal bromide added to the cathode compartment. Enrichments on calcium-46 greater than a factor of two were obtained at the anode. The mass effect was found to be about 0.06. An estimation of the cost of energy for a process based on this method has been made. (authors) [fr

  17. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  18. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  19. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  20. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  1. Single cell wound generates electric current circuit and cell membrane potential variations that requires calcium influx.

    Science.gov (United States)

    Luxardi, Guillaume; Reid, Brian; Maillard, Pauline; Zhao, Min

    2014-07-24

    Breaching of the cell membrane is one of the earliest and most common causes of cell injury, tissue damage, and disease. If the compromise in cell membrane is not repaired quickly, irreversible cell damage, cell death and defective organ functions will result. It is therefore fundamentally important to efficiently repair damage to the cell membrane. While the molecular aspects of single cell wound healing are starting to be deciphered, its bio-physical counterpart has been poorly investigated. Using Xenopus laevis oocytes as a model for single cell wound healing, we describe the temporal and spatial dynamics of the wound electric current circuitry and the temporal dynamics of cell membrane potential variation. In addition, we show the role of calcium influx in controlling electric current circuitry and cell membrane potential variations. (i) Upon wounding a single cell: an inward electric current appears at the wound center while an outward electric current is observed at its sides, illustrating the wound electric current circuitry; the cell membrane is depolarized; calcium flows into the cell. (ii) During cell membrane re-sealing: the wound center current density is maintained for a few minutes before decreasing; the cell membrane gradually re-polarizes; calcium flow into the cell drops. (iii) In conclusion, calcium influx is required for the formation and maintenance of the wound electric current circuitry, for cell membrane re-polarization and for wound healing.

  2. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  3. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  4. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  5. Calcium current homeostasis and synaptic deficits in hippocampal neurons from Kelch-like 1 knockout mice

    Directory of Open Access Journals (Sweden)

    Paula Patricia Perissinotti

    2015-01-01

    Full Text Available Kelch-like 1 (KLHL1 is a neuronal actin-binding protein that modulates voltage-gated CaV2.1 (P/Q-type and CaV3.2 (α1H T-type calcium channels; KLHL1 knockdown experiments (KD cause down-regulation of both channel types and altered synaptic properties in cultured rat hippocampal neurons (Perissinotti et al., 2014. Here, we studied the effect of ablation of KLHL1 on calcium channel function and synaptic properties in cultured hippocampal neurons from KLHL1 knockout (KO mice. Western blot data showed the P/Q-type channel α1A subunit was less abundant in KO hippocampus compared to wildtype (WT; and PQ-type calcium currents were smaller in KO neurons than WT during early days in vitro, although this decrease was compensated for at late stages by increases in L-type calcium current. In contrast, T-type currents did not change in culture. However, biophysical properties and western blot analysis revealed a differential contribution of T-type channel isoforms in the KO, with CaV3.2 α1H subunit being down-regulated and CaV3.1 α1G up-regulated. Synapsin I levels were reduced in the KO hippocampus; cultured neurons displayed a concomitant reduction in synapsin I puncta and decreased miniature excitatory postsynaptic current (mEPSC frequency. In summary, genetic ablation of the calcium channel modulator resulted in compensatory mechanisms to maintain calcium current homeostasis in hippocampal KO neurons; however, synaptic alterations resulted in a reduction of excitatory synapse number, causing an imbalance of the excitatory-inhibitory synaptic input ratio favoring inhibition.

  6. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  7. Citalopram inhibits L-type calcium channel current in rat cardiomyocytes in culture

    Czech Academy of Sciences Publication Activity Database

    Hamplová-Peichlová, J.; Krůšek, Jan; Paclt, I.; Slavíček, J.; Lisá, Věra; Vyskočil, František

    2002-01-01

    Roč. 51, č. 3 (2002), s. 317-321 ISSN 0862-8408 R&D Projects: GA AV ČR IAA7011902; GA ČR GA305/02/1333 Institutional research plan: CEZ:AV0Z5011922 Keywords : citalopram * amitriptyline * L-type calcium channel current Subject RIV: ED - Physiology Impact factor: 0.984, year: 2002

  8. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  9. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  10. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  11. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  12. Voltage-dependent potassium currents in hypertrophied rat astrocytes after a cortical stab wound

    Czech Academy of Sciences Publication Activity Database

    Anděrová, Miroslava; Antonova, Tatiana; Petřík, David; Neprašová, Helena; Chvátal, Alexandr; Syková, Eva

    2004-01-01

    Roč. 48, - (2004), s. 311-326 ISSN 0894-1491 R&D Projects: GA ČR GA305/03/1172; GA ČR GA305/02/1528; GA MŠk LN00A065 Institutional research plan: CEZ:AV0Z5039906 Keywords : CNS injury * astrogliosis Subject RIV: FH - Neurology Impact factor: 4.781, year: 2004

  13. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  14. Inhibition of large conductance calcium-dependent potassium ...

    African Journals Online (AJOL)

    conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

  15. A cyclic GMP-dependent calcium-activated chloride current in smooth-muscle cells from rat mesenteric resistance arteries

    DEFF Research Database (Denmark)

    Matchkov, Vladimir; Aalkjær, Christian; Nilsson, Holger

    2004-01-01

    We have previously demonstrated the presence of a cyclic GMP (cGMP)-dependent calcium-activated inward current in vascular smooth-muscle cells, and suggested this to be of importance in synchronizing smooth-muscle contraction. Here we demonstrate the characteristics of this current. Using......M) in the pipette solution. The current was found to be a calcium-activated chloride current with an absolute requirement for cyclic GMP (EC50 6.4 microM). The current could be activated by the constitutively active subunit of PKG. Current activation was blocked by the protein kinase G antagonist Rp-8-Br-PET-cGMP...... differed from those of the calcium-activated chloride current in pulmonary myocytes, which was cGMP-independent, exhibited a high sensitivity to inhibition by niflumic acid, was unaffected by zinc ions, and showed outward current rectification as has previously been reported for this current. Under...

  16. Attenuated response of L-type calcium current to nitric oxide in atrial fibrillation.

    Science.gov (United States)

    Rozmaritsa, Nadiia; Christ, Torsten; Van Wagoner, David R; Haase, Hannelore; Stasch, Johannes-Peter; Matschke, Klaus; Ravens, Ursula

    2014-03-01

    Nitric oxide (NO) synthesized by cardiomyocytes plays an important role in the regulation of cardiac function. Here, we studied the impact of NO signalling on calcium influx in human right atrial myocytes and its relation to atrial fibrillation (AF). Right atrial appendages (RAAs) were obtained from patients in sinus rhythm (SR) and AF. The biotin-switch technique was used to evaluate endogenous S-nitrosylation of the α1C subunit of L-type calcium channels. Comparing SR to AF, S-nitrosylation of Ca(2+) channels was similar. Direct effects of the NO donor S-nitroso-N-acetyl-penicillamine (SNAP) on L-type calcium current (ICa,L) were studied in cardiomyocytes with standard voltage-clamp techniques. In SR, ICa,L increased with SNAP (100 µM) by 48%, n/N = 117/56, P < 0.001. The SNAP effect on ICa,L involved activation of soluble guanylate cyclase and protein kinase A. Specific inhibition of phosphodiesterase (PDE)3 with cilostamide (1 µM) enhanced ICa,L to a similar extent as SNAP. However, when cAMP was elevated by PDE3 inhibition or β-adrenoceptor stimulation, SNAP reduced ICa,L, pointing to cGMP-cAMP cross-regulation. In AF, the stimulatory effect of SNAP on ICa,L was attenuated, while its inhibitory effect on isoprenaline- or cilostamide-stimulated current was preserved. cGMP elevation with SNAP was comparable between the SR and AF group. Moreover, the expression of PDE3 and soluble guanylate cyclase was not reduced in AF. NO exerts dual effects on ICa,L in SR with an increase of basal and inhibition of cAMP-stimulated current, and in AF NO inhibits only stimulated ICa,L. We conclude that in AF, cGMP regulation of PDE2 is preserved, but regulation of PDE3 is lost.

  17. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  18. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  19. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  20. Improved critical current densities and compressive strength in porous superconducting structures containing calcium

    International Nuclear Information System (INIS)

    Walsh, D; Hall, S R; Wimbush, S C

    2008-01-01

    Templated control of crystallization by biopolymers is a new technique in the synthesis of high temperature superconducting phases. By controlling the way YBa 2 Cu 3 O 7-δ (Y123) materials crystallize and are organized in three dimensions, the critical current density can be improved. In this work, we present the results of doping superconducting sponges with calcium ions, which result in higher critical current densities (J c ) and improved compressive strength compared to that of commercially available Y123, in spite of minor reductions in T c . Y123 synthesis using the biopolymer dextran achieves not only an extremely effective oxygenation of the superconductor but also an in situ template-directing of the crystal morphology producing high J c , homogeneous superconducting structures with nano-scale crystallinity

  1. Calcium Homeostasis Modulator 1-Like Currents in Rat Fungiform Taste Cells Expressing Amiloride-Sensitive Sodium Currents.

    Science.gov (United States)

    Bigiani, Albertino

    2017-05-01

    Salt reception by taste cells is still the less understood transduction process occurring in taste buds, the peripheral sensory organs for the detection of food chemicals. Although there is evidence suggesting that the epithelial sodium channel (ENaC) works as sodium receptor, yet it is not clear how salt-detecting cells signal the relevant information to nerve endings. Taste cells responding to sweet, bitter, and umami substances release ATP as neurotransmitter through a nonvesicular mechanism. Three different channel proteins have been proposed as conduit for ATP secretion: pannexin channels, connexin hemichannels, and calcium homeostasis modulator 1 (CALHM1) channels. In heterologous expression systems, these channels mediate outwardly rectifying membrane currents with distinct biophysical and pharmacological properties. I therefore tested whether also salt-detecting taste cells were endowed with these currents. To this aim, I applied the patch-clamp techniques to single cells in isolated taste buds from rat fungiform papillae. Salt-detecting cells were functionally identified by exploiting the effect of amiloride, which induces a current response by shutting down ENaCs. I looked for the presence of outwardly rectifying currents by using appropriate voltage-clamp protocols and specific pharmacological tools. I found that indeed salt-detecting cells possessed these currents with properties consistent with the presence, at least in part, of CALHM1 channels. Unexpectedly, CALHM1-like currents in taste cells were potentiated by known blockers of pannexin, suggesting a possible inhibitory action of this protein on CALMH1. These findings indicate that communication between salt-detecting cells and nerve endings might involve ATP release by CALMH1 channels. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  3. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  5. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  6. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  7. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  8. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  9. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  10. Current and calcium responses to local activation of axonal NMDA receptors in developing cerebellar molecular layer interneurons.

    Directory of Open Access Journals (Sweden)

    Bénédicte Rossi

    Full Text Available In developing cerebellar molecular layer interneurons (MLIs, NMDA increases spontaneous GABA release. This effect had been attributed to either direct activation of presynaptic NMDA receptors (preNMDARs or an indirect pathway involving activation of somato-dendritic NMDARs followed by passive spread of somatic depolarization along the axon and activation of axonal voltage dependent Ca(2+ channels (VDCCs. Using Ca(2+ imaging and electrophysiology, we searched for preNMDARs by uncaging NMDAR agonists either broadly throughout the whole field or locally at specific axonal locations. Releasing either NMDA or glutamate in the presence of NBQX using short laser pulses elicited current transients that were highly sensitive to the location of the spot and restricted to a small number of varicosities. The signal was abolished in the presence of high Mg(2+ or by the addition of APV. Similar paradigms yielded restricted Ca(2+ transients in interneurons loaded with a Ca(2+ indicator. We found that the synaptic effects of NMDA were not inhibited by blocking VDCCs but were impaired in the presence of the ryanodine receptor antagonist dantrolene. Furthermore, in voltage clamped cells, bath applied NMDA triggers Ca(2+ elevations and induces neurotransmitter release in the axonal compartment. Our results suggest the existence of preNMDARs in developing MLIs and propose their involvement in the NMDA-evoked increase in GABA release by triggering a Ca(2+-induced Ca(2+ release process mediated by presynaptic Ca(2+ stores. Such a mechanism is likely to exert a crucial role in various forms of Ca(2+-mediated synaptic plasticity.

  11. Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

    Science.gov (United States)

    Naranjo, David; Wen, Hua; Brehm, Paul

    2015-01-01

    The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

  12. Evaluation of calcium alginate gel as electrode material for alternating current iontophoresis of lidocaine using excised rat skin.

    Science.gov (United States)

    Ebisawa, Tomoko; Nakajima, Atsushi; Haida, Haruka; Wakita, Ryo; Ando, Shizuka; Yoshioka, Tomohiko; Ikoma, Toshiyuki; Tanaka, Junzo; Fukayama, Haruhisa

    2014-06-27

    Iontophoresis (IOP) is a noninvasive method of delivering medication transcutaneously through the skin. The electrodes used in this method should tightly fit to rough and irregular surfaces and be biologically safe, easy to handle and prepare, and cost-effective. To satisfy these requirements, calcium alginate gel can be a candidate electrode for IOP. Using calcium alginate gel electrodes, we examined whether lidocaine can be effectively transported across an excised rat skin by squarewave alternating current (AC) application. A squarewave AC with either a 70% or 80% duty cycle was continuously applied to 0.5% calcium alginate gel electrodes containing 10% lidocaine at 10 V and 1 kHz for 60 min. Lidocaine concentration was measured using a spectrophotometer and the temperature of the gel was determined. The lidocaine concentrations for AC-IOP at the 70% and 80% duty cycles were significantly higher than that without AC-IOP. Furthermore, the group with the 80% duty cycle showed higher lidocaine concentrations than the group with the 70% duty cycle. The temperatures of all the groups were lower than 28 °C throughout the procedure. In conclusion, the calcium alginate gel can be used as a possible matrix for IOP electrodes.

  13. Azadirachtin blocks the calcium channel and modulates the cholinergic miniature synaptic current in the central nervous system of Drosophila.

    Science.gov (United States)

    Qiao, Jingda; Zou, Xiaolu; Lai, Duo; Yan, Ying; Wang, Qi; Li, Weicong; Deng, Shengwen; Xu, Hanhong; Gu, Huaiyu

    2014-07-01

    Azadirachtin is a botanical pesticide, which possesses conspicuous biological actions such as insecticidal, anthelmintic, antifeedancy, antimalarial effects as well as insect growth regulation. Deterrent for chemoreceptor functions appears to be the main mechanism involved in the potent biological actions of Azadirachtin, although the cytotoxicity and subtle changes to skeletal muscle physiology may also contribute to its insecticide responses. In order to discover the effects of Azadirachtin on the central nervous system (CNS), patch-clamp recording was applied to Drosophila melanogaster, which has been widely used in neurological research. Here, we describe the electrophysiological properties of a local neuron located in the suboesophageal ganglion region of D. melanogaster using the whole brain. The patch-clamp recordings suggested that Azadirachtin modulates the properties of cholinergic miniature excitatory postsynaptic current (mEPSC) and calcium currents, which play important roles in neural activity of the CNS. The frequency of mEPSC and the peak amplitude of the calcium currents significantly decreased after application of Azadirachtin. Our study indicates that Azadirachtin can interfere with the insect's CNS via inhibition of excitatory cholinergic transmission and partly blocking the calcium channel. © 2013 Society of Chemical Industry.

  14. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  15. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  16. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  17. THE CURRENT STATE OF CALCIUM SILICATE CEMENTS IN RESTORATIVE DENTISTRY: A REVIEW

    OpenAIRE

    Corral-Núñez, Camila; Fernández-Godoy, Eduardo; Casielles, Javier Martín; Estay, Juan; Bersezio-Miranda, Cristian; Cisternas-Pinto, Patricia; Batista-de Oliveira Jr, Osmir

    2016-01-01

    ABSTRACT Calcium silicate cements have been used as dental materials for more than twenty years; however, their use in restorative dentistry is more recent. Better mechanical properties and shorter curing times make them suitable for a variety of applications in which they are used as a substitute of dentin, including direct/indirect pulp capping and as cavity base/liner. These materials may also be used to restore enamel temporarily. This article seeks to review the available scientific evid...

  18. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  20. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

    Science.gov (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

    2017-05-01

    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  1. Calcium currents in a fast-twitch skeletal muscle of the rat

    OpenAIRE

    1983-01-01

    Slow ionic currents were measured in the rat omohyoid muscle with the three-microelectrode voltage-clamp technique. Sodium and delayed rectifier potassium currents were blocked pharmacologically. Under these conditions, depolarizing test pulses elicited an early outward current, followed by a transient slow inward current, followed in turn by a late outward current. The early outward current appeared to be a residual delayed rectifier current. The slow inward current was identified as a calci...

  2. Accelerated inactivation of the L-type calcium current due to a mutation in CACNB2b underlies Brugada syndrome

    DEFF Research Database (Denmark)

    Cordeiro, Jonathan M; Marieb, Mark; Pfeiffer, Ryan

    2009-01-01

    S in which loss of function is caused by accelerated inactivation of I(Ca). The proband, a 32 year old male, displayed a Type I ST segment elevation in two right precordial ECG leads following a procainamide challenge. EP study was positive with induction of polymorphic VT/VF. Interrogation of implanted ICD...... significantly faster in mutant channels between 0 and + 20 mV. Action potential voltage clamp experiments showed that total charge was reduced by almost half compared to WT. We report the first BrS mutation in CaCNB2b resulting in accelerated inactivation of L-type calcium channel current. Our results suggest...

  3. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  4. The RF voltage dependence of the electron sheath heating in low pressure capacitively coupled rf discharges

    International Nuclear Information System (INIS)

    Buddemeier, U.; Kortshagen, U.; Pukropski, I.

    1995-01-01

    In low pressure capacitively coupled RF discharges two competitive electron heating mechanisms have been discussed for some time now. At low pressures the stochastic sheath heating and for somewhat higher pressures the Joule heating in the bulk plasma have been proposed. When the pressure is increased at constant RF current density a transition from concave electron distribution functions (EDF) with a pronounced cold electron group to convex EDFs with a missing strong population of cold electrons is found. This transition was interpreted as the transition from dominant stochastic to dominant Joule heating. However, a different interpretation has been given by Kaganovich and Tsendin, who attributed the concave shaped EDFs to the spatially inhomogeneous RF field in combination with the nonlocality of the EDF

  5. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  6. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  8. Catalytic applications of calcium rich waste materials for biodiesel: Current state and perspectives

    International Nuclear Information System (INIS)

    Shan, Rui; Zhao, Che; Lv, Pengmei; Yuan, Haoran; Yao, Jingang

    2016-01-01

    Highlights: • This review presents information related to waste derived Ca-based catalysts. • The materials described include eggshells, mollusk shells, bones, and so on. • The mechanism, future challenges and prospects of those catalysts are discussed. - Abstract: The synthesis of heterogeneous catalysts from waste materials has become increasingly popular over the past two decades. Among them, Ca-based catalysts have widely been tested in the transesterification reaction because of their relatively high catalytic activity and the large amount of feedstock (calcium rich waste materials) available. Those Ca-based catalysts can be simply prepared via the high temperature calcination and using these waste materials to generate the catalyst in addition to the target product makes the system more cost effective and environmentally friendly. This review presents general information related to the recent progress in the development of various Ca-based catalysts derived from waste materials for biodiesel production. The materials described include eggshells, mollusk shells, bones, large-scale industrial wastes and so on. Meanwhile, based on this collection of data and information, the catalytic activity mechanism, future challenges and prospects of renewable resources derived catalysts are also discussed.

  9. Calcium sensing in exocytosis

    DEFF Research Database (Denmark)

    Gustavsson, Natalia; Wu, Bingbing; Han, Weiping

    2012-01-01

    an increase in intracellular calcium levels. Besides the triggering role, calcium signaling modulates the precise amount and kinetics of vesicle release. Thus, it is a central question to understand the molecular machineries responsible for calcium sensing in exocytosis. Here we provide an overview of our...... current understanding of calcium sensing in neurotransmitter release and hormone secretion....

  10. Ursodeoxycholic acid prevents ventricular conduction slowing and arrhythmia by restoring T-type calcium current in fetuses during cholestasis

    Science.gov (United States)

    Adeyemi, Oladipupo; Alvarez-Laviada, Anita; Schultz, Francisca; Ibrahim, Effendi; Trauner, Michael; Williamson, Catherine; Glukhov, Alexey V.

    2017-01-01

    Background Increased maternal serum bile acid concentrations in intrahepatic cholestasis of pregnancy (ICP) are associated with fetal cardiac arrhythmias. Ursodeoxycholic acid (UDCA) has been shown to demonstrate anti-arrhythmic properties via preventing ICP-associated cardiac conduction slowing and development of reentrant arrhythmias, although the cellular mechanism is still being elucidated. Methods High-resolution fluorescent optical mapping of electrical activity and electrocardiogram measurements were used to characterize effects of UDCA on one-day-old neonatal and adult female Langendorff-perfused rat hearts. ICP was modelled by perfusion of taurocholic acid (TC, 400μM). Whole-cell calcium currents were recorded from neonatal rat and human fetal cardiomyocytes. Results TC significantly prolonged the PR interval by 11.0±3.5% (P<0.05) and slowed ventricular conduction velocity (CV) by 38.9±5.1% (P<0.05) exclusively in neonatal and not in maternal hearts. A similar CV decline was observed with the selective T-type calcium current (ICa,T) blocker mibefradil 1μM (23.0±6.2%, P<0.05), but not with the L-type calcium current (ICa,L) blocker nifedipine 1μM (6.9±6.6%, NS). The sodium channel blocker lidocaine (30μM) reduced CV by 60.4±4.5% (P<0.05). UDCA co-treatment was protective against CV slowing induced by TC and mibefradil, but not against lidocaine. UDCA prevented the TC-induced reduction in the ICa,T density in both isolated human fetal (−10.2±1.5 versus −5.5±0.9 pA/pF, P<0.05) and neonatal rat ventricular myocytes (−22.3±1.1 versus −9.6±0.8 pA/pF, P<0.0001), whereas UDCA had limited efficacy on the ICa,L. Conclusion Our findings demonstrate that ICa,T plays a significant role in ICP-associated fetal cardiac conduction slowing and arrhythmogenesis, and is an important component of the fetus-specific anti-arrhythmic activity of UDCA. PMID:28934223

  11. Ursodeoxycholic acid prevents ventricular conduction slowing and arrhythmia by restoring T-type calcium current in fetuses during cholestasis.

    Directory of Open Access Journals (Sweden)

    Oladipupo Adeyemi

    Full Text Available Increased maternal serum bile acid concentrations in intrahepatic cholestasis of pregnancy (ICP are associated with fetal cardiac arrhythmias. Ursodeoxycholic acid (UDCA has been shown to demonstrate anti-arrhythmic properties via preventing ICP-associated cardiac conduction slowing and development of reentrant arrhythmias, although the cellular mechanism is still being elucidated.High-resolution fluorescent optical mapping of electrical activity and electrocardiogram measurements were used to characterize effects of UDCA on one-day-old neonatal and adult female Langendorff-perfused rat hearts. ICP was modelled by perfusion of taurocholic acid (TC, 400μM. Whole-cell calcium currents were recorded from neonatal rat and human fetal cardiomyocytes.TC significantly prolonged the PR interval by 11.0±3.5% (P<0.05 and slowed ventricular conduction velocity (CV by 38.9±5.1% (P<0.05 exclusively in neonatal and not in maternal hearts. A similar CV decline was observed with the selective T-type calcium current (ICa,T blocker mibefradil 1μM (23.0±6.2%, P<0.05, but not with the L-type calcium current (ICa,L blocker nifedipine 1μM (6.9±6.6%, NS. The sodium channel blocker lidocaine (30μM reduced CV by 60.4±4.5% (P<0.05. UDCA co-treatment was protective against CV slowing induced by TC and mibefradil, but not against lidocaine. UDCA prevented the TC-induced reduction in the ICa,T density in both isolated human fetal (-10.2±1.5 versus -5.5±0.9 pA/pF, P<0.05 and neonatal rat ventricular myocytes (-22.3±1.1 versus -9.6±0.8 pA/pF, P<0.0001, whereas UDCA had limited efficacy on the ICa,L.Our findings demonstrate that ICa,T plays a significant role in ICP-associated fetal cardiac conduction slowing and arrhythmogenesis, and is an important component of the fetus-specific anti-arrhythmic activity of UDCA.

  12. Simultaneous mapping of membrane voltage and calcium in zebrafish heart in vivo reveals chamber-specific developmental transitions in ionic currents

    Directory of Open Access Journals (Sweden)

    Jennifer H Hou

    2014-09-01

    Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.

  13. Bradykinin induced a positive chronotropic effect via stimulation of T- and L-type calcium currents in heart cells.

    Science.gov (United States)

    El-Bizri, Nesrine; Bkaily, Ghassan; Wang, Shimin; Jacques, Danielle; Regoli, Domenico; D'Orléans-Juste, Pedro; Sukarieh, Rami

    2003-03-01

    Using Fluo-3 calcium dye confocal microscopy and spontaneously contracting embryonic chick heart cells, bradykinin (10(-10) M) was found to induce positive chronotropic effects by increasing the frequency of the transient increase of cytosolic and nuclear free Ca2+. Pretreatment of the cells with either B1 or B2 receptor antagonists (R126 and R817, respectively) completely prevented bradykinin (BK) induced positive chronotropic effects on spontaneously contracting single heart cells. Using the whole-cell voltage clamp technique and ionic substitution to separate the different ionic current species, our results showed that BK (10(-6) M) had no effect on fast Na+ inward current and delayed outward potassium current. However, both L- and T-type Ca2+ currents were found to be increased by BK in a dose-dependent manner (10(-10)-10(-7) M). The effects of BK on T- and L-type Ca2+ currents were partially blocked by the B1 receptor antagonist [Leu8]des-Arg9-BK (R592) (10(-7) M) and completely reversed by the B2 receptor antagonist D-Arg[Hyp3,D-Phe7,Leu8]BK (R-588) (10(-7) M) or pretreatment with pertussis toxin (PTX). These results demonstrate that BK induced a positive chronotropic effect via stimulation of T- and L-type Ca2+ currents in heart cells mainly via stimulation of B2 receptor coupled to PTX-sensitive G-proteins. The increase of both types of Ca2+ current by BK in heart cells may explain the positive inotropic and chronotropic effects of this hormone.

  14. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  15. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  16. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  17. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  18. Separation of calcium isotopes by counter-current electromigration in molten salts (1962); Separation des isotopes du calcium par electro-migration a contre-courant en sels fondus (1962)

    Energy Technology Data Exchange (ETDEWEB)

    Menes, F; Dirian, G; Roth, E [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1962-07-01

    The method of counter-current electromigration in molten salts has been applied to calcium bromide with an alkali metal bromide added to the cathode compartment. Enrichments on calcium-46 greater than a factor of two were obtained at the anode. The mass effect was found to be about 0.06. An estimation of the cost of energy for a process based on this method has been made. (authors) [French] La methode d'electro-migration a contre-courant en sels fondus a ete appliquee au bromure de calcium additionne dans le compartiment cathodique d'un bromure alcalin. On a pu ainsi obtenir avec surete des enrichissements anodiques superieurs a 2 sur l'isotope 46, determiner l'effet de masse (environ 0,06) et faire une estimation sommaire du cout energetique d'un procede base sur cette methode. (auteurs)

  19. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  20. The Hyperpolarization-Activated Current Determines Synaptic Excitability, Calcium Activity and Specific Viability of Substantia Nigra Dopaminergic Neurons

    Directory of Open Access Journals (Sweden)

    Carmen Carbone

    2017-06-01

    Full Text Available Differential vulnerability between Substantia Nigra pars compacta (SNpc and Ventral Tegmental Area (VTA dopaminergic (DAergic neurons is a hallmark of Parkinson’s disease (PD. Understanding the molecular bases of this key histopathological aspect would foster the development of much-needed disease-modifying therapies. Non-heterogeneous DAergic degeneration is present in both toxin-based and genetic animal models, suggesting that cellular specificity, rather than causing factors, constitutes the background for differential vulnerability. In this regard, we previously demonstrated that MPP+, a neurotoxin able to cause selective nigrostriatal degeneration in animal rodents and primates, inhibits the Hyperpolarization-activated current (Ih in SNpc DAergic neurons and that pharmacological Ih antagonism causes potentiation of evoked Excitatory post-synaptic potentials (EPSPs. Of note, the magnitude of such potentiation is greater in the SNpc subfield, consistent with higher Ih density. In the present work, we show that Ih block-induced synaptic potentiation leads to the amplification of somatic calcium responses (SCRs in vitro. This effect is specific for the SNpc subfield and largely mediated by L-Type calcium channels, as indicated by sensitivity to the CaV 1 blocker isradipine. Furthermore, Ih is downregulated by low intracellular ATP and determines the efficacy of GABAergic inhibition in SNpc DAergic neurons. Finally, we show that stereotaxic administration of Ih blockers causes SNpc-specific neurodegeneration and hemiparkinsonian motor phenotype in rats. During PD progression, Ih downregulation may result from mitochondrial dysfunction and, in concert with PD-related disinhibition of excitatory inputs, determine a SNpc-specific disease pathway.

  1. Calcium Electroporation

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; Gibot, Laure; Madi, Moinecha

    2015-01-01

    BACKGROUND: Calcium electroporation describes the use of high voltage electric pulses to introduce supraphysiological calcium concentrations into cells. This promising method is currently in clinical trial as an anti-cancer treatment. One very important issue is the relation between tumor cell kill...... efficacy-and normal cell sensitivity. METHODS: Using a 3D spheroid cell culture model we have tested the effect of calcium electroporation and electrochemotherapy using bleomycin on three different human cancer cell lines: a colorectal adenocarcinoma (HT29), a bladder transitional cell carcinoma (SW780......), and a breast adenocarcinoma (MDA-MB231), as well as on primary normal human dermal fibroblasts (HDF-n). RESULTS: The results showed a clear reduction in spheroid size in all three cancer cell spheroids three days after treatment with respectively calcium electroporation (p

  2. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  3. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Orexin-A potentiates L-type calcium/barium currents in rat retinal ganglion cells.

    Science.gov (United States)

    Liu, F; Weng, S-J; Yang, X-L; Zhong, Y-M

    2015-10-01

    Two neuropeptides, orexin-A and orexin-B (also called hypocretin-1 and -2), have been implicated in sleep/wake regulation, feeding behaviors via the activation of two subtypes of G-protein-coupled receptors: orexin 1 and orexin 2 receptors (OX1R and OX2R). While the expression of orexins and orexin receptors is immunohistochemically revealed in retinal neurons, the function of these peptides in the retina is largely unknown. Using whole-cell patch-clamp recordings in rat retinal slices, we demonstrated that orexin-A increased L-type-like barium currents (IBa,L) in ganglion cells (GCs), and the effect was blocked by the selective OX1R antagonist SB334867, but not by the OX2R antagonist TCS OX2 29. The orexin-A effect was abolished by intracellular dialysis of GDP-β-S/GPAnt-2A, a Gq protein inhibitor, suggesting the mediation of Gq. Additionally, during internal dialysis of the phosphatidylinositol (PI)-phospholipase C (PLC) inhibitor U73122, orexin-A did not change the IBa,L of GCs, whereas the orexin-A effect persisted in the presence of the phosphatidylcholine (PC)-PLC inhibitor D609. The orexin-A-induced potentiation was not seen with internal infusion of Ca(2+)-free solution or when inositol 1,4,5-trisphosphate (IP3)-sensitive Ca(2+) release from intracellular stores was blocked by heparin/xestospongins-C. Moreover, the orexin-A effect was mimicked by the protein kinase C (PKC) activator phorbol 12-myristate 13-acetate, but was eliminated when PKC was inhibited by bisindolylmaleimide IV (Bis-IV)/Gö6976. Neither adenosine 3',5'-cyclic monophosphate (cAMP)-protein kinase A (PKA) nor guanosine 3',5'-cyclic monophosphate (cGMP)-protein kinase G (PKG) signaling pathway was likely involved, as orexin-A persisted to potentiate the IBa,L of GCs no matter these two pathways were activated or inhibited. These results suggest that, by activating OX1R, orexin-A potentiates the IBa,L of rat GCs through a distinct Gq/PI-PLC/IP3/Ca(2+)/PKC signaling pathway. Copyright

  6. Neurotensin effects on N-type calcium currents among rat pallidal neurons: an electrophysiological and immunohistochemical study.

    Science.gov (United States)

    Martorana, Alessandro; Martella, Giuseppina; D'Angelo, Vincenza; Fusco, Francesca Romana; Spadoni, Francesca; Bernardi, Giorgio; Stefani, Alessandro

    2006-10-01

    The tridecapeptide neurotensin (NT) is involved in the modulation of dopamine (DA)-mediated functions in the nigrostriatal and mesocorticolimbic pathways. Its relevance in mammalian globus pallidus (GP) is questioned. A recent electrophysiological study on GP slices described NT-mediated robust membrane depolarization, depending upon the suppression of potassium conductance and/or the activation of cation current. Here, we have studied whether NT also affected high-voltage-activated calcium (Ca(2+)) currents, by means of whole-cell recordings on isolated GP neurons. In our hands, the full peptide and the segment NT8-13 reversibly inhibited N-like Ca(2+) current in about 60% of the recorded dissociated neurons, irrespective of their capacitance. The NT-mediated modulation showed no desensitization and was antagonized by the NT1 antagonists SR48692 and SR142948. These results imply an abundant expression of NTS(1) on GP cell somata. Then, we performed a light and immunofluorescence-confocal microscopy study of NTS(1) localization among GP neurons. We found that NTS(1) is localized in about 56% of GP neurons in both subpopulations of neurons, namely parvalbumin positive and negative. We conclude that NT, likely released from the striatal terminals in GP, acts through the postsynaptic NTS(1) preferentially localized in the lateral aspects of the GP. These data suggest a new implication (neither merely presynaptic nor simply "excitatory") for NT in the modulation of GP firing pattern. In addition, NT might have a role in affecting the interplay among the endogenous release of GABA/glutamate and DA. This hypothesis might have implications on both sensori-motor and associative functions of the GP and should be tested in DA-denervated disease models.

  7. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  8. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  9. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  10. High-voltage-activated calcium current subtypes in mouse DRG neurons adapt in a subpopulation-specific manner after nerve injury.

    Science.gov (United States)

    Murali, Swetha S; Napier, Ian A; Mohammadi, Sarasa A; Alewood, Paul F; Lewis, Richard J; Christie, MacDonald J

    2015-03-01

    Changes in ion channel function and expression are characteristic of neuropathic pain. Voltage-gated calcium channels (VGCCs) are integral for neurotransmission and membrane excitability, but relatively little is known about changes in their expression after nerve injury. In this study, we investigate whether peripheral nerve ligation is followed by changes in the density and proportion of high-voltage-activated (HVA) VGCC current subtypes in dorsal root ganglion (DRG) neurons, the contribution of presynaptic N-type calcium channels in evoked excitatory postsynaptic currents (EPSCs) recorded from dorsal horn neurons in the spinal cord, and the changes in expression of mRNA encoding VGCC subunits in DRG neurons. Using C57BL/6 mice [8- to 11-wk-old males (n = 91)] for partial sciatic nerve ligation or sham surgery, we performed whole cell patch-clamp recordings on isolated DRG neurons and dorsal horn neurons and measured the expression of all VGCC subunits with RT-PCR in DRG neurons. After nerve injury, the density of P/Q-type current was reduced overall in DRG neurons. There was an increase in the percentage of N-type and a decrease in that of P/Q-type current in medium- to large-diameter neurons. No changes were found in the contribution of presynaptic N-type calcium channels in evoked EPSCs recorded from dorsal horn neurons. The α2δ-1 subunit was upregulated by 1.7-fold and γ-3, γ-2, and β-4 subunits were all downregulated 1.7-fold in injured neurons compared with sham-operated neurons. This comprehensive characterization of HVA VGCC subtypes in mouse DRG neurons after nerve injury revealed changes in N- and P/Q-type current proportions only in medium- to large-diameter neurons. Copyright © 2015 the American Physiological Society.

  11. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  12. Calcium supplements

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007477.htm Calcium supplements To use the sharing features on this page, please enable JavaScript. WHO SHOULD TAKE CALCIUM SUPPLEMENTS? Calcium is an important mineral for the ...

  13. Current concepts in combination therapy for the treatment of hypertension: combined calcium channel blockers and RAAS inhibitors

    Directory of Open Access Journals (Sweden)

    Alberto F Rubio-Guerra

    2009-11-01

    Full Text Available Alberto F Rubio-Guerra1, David Castro-Serna2, Cesar I Elizalde Barrera2, Luz M Ramos-Brizuela21Metabolic and Research Clinic, 2Internal Medicine Department, Hospital General de Ticomán SS DF, MéxicoAbstract: Recent guidelines for the management of hypertension recommend target blood pressures <140/90 mmHg in hypertensive patients, or <130/80 mmHg in subjects with diabetes, chronic kidney disease, or coronary artery disease. Despite the availability and efficacy of antihypertensive drugs, most hypertensive patients do not reach the recommended treatment targets with monotherapy, making combination therapy necessary to achieve the therapeutic goal. Combination therapy with 2 or more agents is the most effective method for achieving strict blood pressure goals. Fixed-dose combination simplifies treatment, reduces costs, and improves adherence. There are many drug choices for combination therapy, but few data are available about the efficacy and safety of some specific combinations. Combination therapy of calcium antagonists and inhibitors of the renin-angiotensin-aldosterone system (RAAS are efficacious and safe, and have been considered rational by both the JNC 7 and the 2007 European Society of Hypertension – European Society of Cardiology guidelines for the management of arterial hypertension. The aim of this review is to discuss some relevant issues about the use of combinations with calcium channel blockers and RAAS inhibitors in the treatment of hypertension.Keywords: hypertension, calcium channel blockers, renin-angiotensin-aldosterone system inhibitors, fixed-dose combination, adherence

  14. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  15. Calcium absorption

    International Nuclear Information System (INIS)

    Carlmark, B.; Reizenstein, P.; Dudley, R.A.

    1976-01-01

    The methods most commonly used to measure the absorption and retention of orally administered calcium are reviewed. Nearly all make use of calcium radioisotopes. The magnitude of calcium absorption and retention depends upon the chemical form and amount of calcium administered, and the clinical and nutritional status of the subject; these influences are briefly surveyed. (author)

  16. Adrenomedullin increases the short-circuit current in the rat prostate: Receptors, chloride channels, the effects of cAMP and calcium ions and implications on fluid secretion.

    Science.gov (United States)

    Liao, S B; Cheung, K H; Cheung, M P L; Wong, P F; O, W S; Tang, F

    2014-05-01

    In this study, we have investigated the effects of adrenomedullin on chloride and fluid secretion in the rat prostate. The presence of adrenomedullin (ADM) in rat prostate was confirmed using immunostaining, and the molecular species was determined using gel filtration chromatography coupled with an enzyme-linked assay for ADM. The effects of ADM on fluid secretion were studied by short-circuit current technique in a whole mount preparation of the prostate in an Ussing chamber. The results indicated that the ADM level was higher in the ventral than the dorso-lateral prostate and the major molecular species was the active peptide. ADM increased the short-circuit current through both the cAMP- and calcium-activated chloride channels in the ventral lobe, but only through the calcium-activated channels in the dorso-lateral lobe. These stimulatory effects were blocked by the calcitonin gene-related peptide (CGRP) receptor antagonist, hCGRP8-37. We conclude that ADM may regulate prostatic fluid secretion through the chloride channels, which may affect the composition of the seminal plasma bathing the spermatozoa and hence fertility. © 2014 American Society of Andrology and European Academy of Andrology.

  17. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  18. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  19. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  20. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  1. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  2. Calcium current activation kinetics in isolated pyramidal neurones of the Ca1 region of the mature guinea-pig hippocampus.

    Science.gov (United States)

    Kay, A R; Wong, R K

    1987-11-01

    1. Neurones were isolated from the CA1 region of the guinea-pig hippocampus and subjected to the whole-cell mode of voltage clamping, to determine the kinetics of voltage-gated Ca2+ channel activation. 2. Isolated neurones had an abbreviated morphology, having lost most of the distal dendritic tree during the isolation procedure. The electrical compactness of the cells facilitates voltage clamp analysis. 3. Block of sodium and potassium currents revealed a persistent current activated on depolarization above -40 mV, which inactivated slowly when the intracellular medium contained EGTA. The current was blocked by Co2+ and Cd2+, augmented by increases in Ca2+ and could be carried by Ba2+, suggesting that the current is borne by Ca2+. 4. Steady-state activation of the Ca2+ current was found to be well described by the Boltzman equation raised to the second power. 5. The open channel's current-voltage (I-V) relationship rectified in the inward direction and was consistent with the constant-field equation. 6. The kinetics of Ca2+ current onset followed m2 kinetics throughout the range of its activation. Tail current kinetics were in accord with this model. A detailed Hodgkin-Huxley model was derived, defining the activation of this current. 7. The kinetics of the currents observed in this regionally and morphologically defined class of neurones were consistent with the existence of a single kinetic class of channels.

  3. Current perspectives of bio-ceramic technology in endodontics: calcium enriched mixture cement - review of its composition, properties and applications

    Science.gov (United States)

    Nawal, Ruchika Roongta; Talwar, Sangeeta; Verma, Mahesh

    2015-01-01

    Advancements in bio-ceramic technology has revolutionised endodontic material science by enhancing the treatment outcome for patients. This class of dental materials conciliates excellent biocompatibility with high osseoconductivity that render them ideal for endodontic care. Few recently introduced bio-ceramic materials have shown considerable clinical success over their early generations in terms of good handling characteristics. Calcium enriched mixture (CEM) cement, Endosequence sealer, and root repair materials, Biodentine and BioAggregate are the new classes of bio-ceramic materials. The aim of this literature review is to present investigations regarding properties and applications of CEM cement in endodontics. A review of the existing literature was performed by using electronic and hand searching methods for CEM cement from January 2006 to December 2013. CEM cement has a different chemical composition from that of mineral trioxide aggregate (MTA) but has similar clinical applications. It combines the biocompatibility of MTA with more efficient characteristics, such as significantly shorter setting time, good handling characteristics, no staining of tooth and effective seal against bacterial leakage. PMID:25671207

  4. Ca(2+) currents and voltage responses in Type I and Type II hair cells of the chick embryo semicircular canal.

    Science.gov (United States)

    Masetto, Sergio; Zampini, Valeria; Zucca, Giampiero; Valli, Paolo

    2005-11-01

    Type I and Type II hair cells, and Type II hair cells located in different zones of the semicircular canal crista, express different patterns of voltage-dependent K channels, each one specifically shaping the hair cell receptor potential. We report here that, close to hatching, chicken embryo semicircular canal Type I and Type II hair cells express a similar voltage-dependent L-type calcium current (I(Ca)), whose main features are: activation above -60 mV, fast activation kinetics, and scarce inactivation. I(Ca) should be already active at rest in Zone 1 Type II hair cells, whose resting membrane potential was on average slightly less negative than -60 mV. Conversely, I(Ca) would not be active at rest in Type II hair cells from Zone 2 and 3, nor in Type I hair cells, since their resting membrane potential was significantly more negative than -60 mV. However, even small depolarising currents would activate I(Ca) steadily in Zone 2 and 3 Type II hair cells, but not in Type I hair cells because of the robust repolarising action of their specific array of K(+) currents. The implications of the present findings in the afferent discharge are discussed.

  5. Calcium - ionized

    Science.gov (United States)

    ... diuretics Thrombocytosis (high platelet count) Tumors Vitamin A excess Vitamin D excess Lower-than-normal levels may be due to: Hypoparathyroidism Malabsorption Osteomalacia Pancreatitis Renal failure Rickets Vitamin D deficiency Alternative Names Free calcium; Ionized calcium ...

  6. Calcium Carbonate

    Science.gov (United States)

    ... Calcium is needed by the body for healthy bones, muscles, nervous system, and heart. Calcium carbonate also ... to your pharmacist or contact your local garbage/recycling department to learn about take-back programs in ...

  7. Progesterone treatment inhibits and dihydrotestosterone (DHT) treatment potentiates voltage-gated calcium currents in gonadotropin-releasing hormone (GnRH) neurons.

    Science.gov (United States)

    Sun, Jianli; Moenter, Suzanne M

    2010-11-01

    GnRH neurons are central regulators of fertility, and their activity is modulated by steroid feedback. In normal females, GnRH secretion is regulated by estradiol and progesterone (P). Excess androgens present in hyperandrogenemic fertility disorders may disrupt communication of negative feedback signals from P and/or independently stimulate GnRH release. Voltage-gated calcium channels (VGCCs) are important in regulating excitability and hormone release. Estradiol alters VGCCs in a time-of-day-dependent manner. To further elucidate ovarian steroid modulation of GnRH neuron VGCCs, we studied the effects of dihydrotestosterone (DHT) and P. Adult mice were ovariectomized (OVX) or OVX and treated with implants containing DHT (OVXD), estradiol (OVXE), estradiol and DHT (OVXED), estradiol and P (OVXEP), or estradiol, DHT, and P (OVXEDP). Macroscopic calcium current (I(Ca)) was recorded in the morning or afternoon 8-12 d after surgery using whole-cell voltage-clamp. I(Ca) was increased in afternoon vs. morning in GnRH neurons from OVXE mice but this increase was abolished in cells from OVXEP mice. I(Ca) in cells from OVXD mice was increased regardless of time of day; there was no additional effect in OVXED mice. P reduced N-type and DHT potentiated N- and R-type VGCCs; P blocked the DHT potentiation of N-type-mediated current. These data suggest P and DHT have opposing actions on VGCCs in GnRH neurons, but in the presence of both steroids, P dominates. VGCCs are targets of ovarian steroid feedback modulation of GnRH neuron activity and, more specifically, a potential mechanism whereby androgens could activate GnRH neuronal function.

  8. Calcium regulates caveolin-1 expression at the transcriptional level

    International Nuclear Information System (INIS)

    Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

    2012-01-01

    Highlights: ► Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. ► An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. ► Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. ► Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca 2+ /calcineurin/NFAT.

  9. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  10. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. The Glycolytic Metabolite, Fructose-1,6-bisphosphate, Blocks Epileptiform Bursts by Attenuating Voltage-Activated Calcium Currents in Hippocampal Slices

    Directory of Open Access Journals (Sweden)

    Li-Rong Shao

    2018-06-01

    Full Text Available Manipulation of metabolic pathways (e.g., ketogenic diet (KD, glycolytic inhibition alters neural excitability and represents a novel strategy for treatment of drug-refractory seizures. We have previously shown that inhibition of glycolysis suppresses epileptiform activity in hippocampal slices. In the present study, we aimed to examine the role of a “branching” metabolic pathway stemming off glycolysis (i.e., the pentose-phosphate pathway, PPP in regulating seizure activity, by using a potent PPP stimulator and glycolytic intermediate, fructose-1,6-bisphosphate (F1,6BP. Employing electrophysiological approaches, we investigated the action of F1,6BP on epileptiform population bursts, intrinsic neuronal firing, glutamatergic and GABAergic synaptic transmission and voltage-activated calcium currents (ICa in the CA3 area of hippocampal slices. Bath application of F1,6BP (2.5–5 mM blocked epileptiform population bursts induced in Mg2+-free medium containing 4-aminopyridine, in ~2/3 of the slices. The blockade occurred relatively rapidly (~4 min, suggesting an extracellular mechanism. However, F1,6BP did not block spontaneous intrinsic firing of the CA3 neurons (when synaptic transmission was eliminated with DNQX, AP-5 and SR95531, nor did it significantly reduce AMPA or NMDA receptor-mediated excitatory postsynaptic currents (EPSCAMPA and EPSCNMDA. In contrast, F1,6BP caused moderate reduction (~50% in GABAA receptor-mediated current, suggesting it affects excitatory and inhibitory synapses differently. Finally and unexpectedly, F1,6BP consistently attenuated ICa by ~40% without altering channel activation or inactivation kinetics, which may explain its anticonvulsant action, at least in this in vitro seizure model. Consistent with these results, epileptiform population bursts in CA3 were readily blocked by the nonspecific Ca2+ channel blocker, CdCl2 (20 μM, suggesting that these bursts are calcium dependent. Altogether, these data

  12. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  13. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  15. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  16. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  17. Calcium fluoride

    International Nuclear Information System (INIS)

    King, C.W.; Nestor, O.H.

    1989-01-01

    A new process for producing large, single, oriented crystals of calcium fluoride (CaF 2 ) has been developed which overcomes the limitations of current growing methods. This process has been reduced to practice and has yielded oriented crystals 17.5 x 17.5 x 5 cm 3 . Currently nearing completion is a system for producing 35 x 35 x 7.5 cm 3 single crystals. A scale up to one-meter-square is considered feasible. This crystal growing process makes possible the fabrication of very large CaF 2 windows. Suitability for very high power lasers, however, requires attention to properties beyond mere size. A process to generate higher purity growth stock (starting material) was also developed. The additional purification of the growth stock contributes to lower bulk absorption, the absence of color centers and increased radiation hardness. Also identified were several specific impurities which correlate with radiation hardness. A correlation was found between color centers induced by laser radiation and ionizing radiation. Other CaF 2 crystal properties such as tensile strength, absorption and laser damage thresholds were studied and are discussed

  18. Calcium waves.

    Science.gov (United States)

    Jaffe, Lionel F

    2008-04-12

    Waves through living systems are best characterized by their speeds at 20 degrees C. These speeds vary from those of calcium action potentials to those of ultraslow ones which move at 1-10 and/or 10-20 nm s(-1). All such waves are known or inferred to be calcium waves. The two classes of calcium waves which include ones with important morphogenetic effects are slow waves that move at 0.2-2 microm s(-1) and ultraslow ones. Both may be propagated by cycles in which the entry of calcium through the plasma membrane induces subsurface contraction. This contraction opens nearby stretch-sensitive calcium channels. Calcium entry through these channels propagates the calcium wave. Many slow waves are seen as waves of indentation. Some are considered to act via cellular peristalsis; for example, those which seem to drive the germ plasm to the vegetal pole of the Xenopus egg. Other good examples of morphogenetic slow waves are ones through fertilizing maize eggs, through developing barnacle eggs and through axolotl embryos during neural induction. Good examples of ultraslow morphogenetic waves are ones during inversion in developing Volvox embryos and across developing Drosophila eye discs. Morphogenetic waves may be best pursued by imaging their calcium with aequorins.

  19. Lipoxin A4 stimulates calcium-activated chloride currents and increases airway surface liquid height in normal and cystic fibrosis airway epithelia.

    LENUS (Irish Health Repository)

    2012-01-01

    Cystic Fibrosis (CF) is a genetic disease characterised by a deficit in epithelial Cl(-) secretion which in the lung leads to airway dehydration and a reduced Airway Surface Liquid (ASL) height. The endogenous lipoxin LXA(4) is a member of the newly identified eicosanoids playing a key role in ending the inflammatory process. Levels of LXA(4) are reported to be decreased in the airways of patients with CF. We have previously shown that in normal human bronchial epithelial cells, LXA(4) produced a rapid and transient increase in intracellular Ca(2+). We have investigated, the effect of LXA(4) on Cl(-) secretion and the functional consequences on ASL generation in bronchial epithelial cells obtained from CF and non-CF patient biopsies and in bronchial epithelial cell lines. We found that LXA(4) stimulated a rapid intracellular Ca(2+) increase in all of the different CF bronchial epithelial cells tested. In non-CF and CF bronchial epithelia, LXA(4) stimulated whole-cell Cl(-) currents which were inhibited by NPPB (calcium-activated Cl(-) channel inhibitor), BAPTA-AM (chelator of intracellular Ca(2+)) but not by CFTRinh-172 (CFTR inhibitor). We found, using confocal imaging, that LXA(4) increased the ASL height in non-CF and in CF airway bronchial epithelia. The LXA(4) effect on ASL height was sensitive to bumetanide, an inhibitor of transepithelial Cl(-) secretion. The LXA(4) stimulation of intracellular Ca(2+), whole-cell Cl(-) currents, conductances and ASL height were inhibited by Boc-2, a specific antagonist of the ALX\\/FPR2 receptor. Our results provide, for the first time, evidence for a novel role of LXA(4) in the stimulation of intracellular Ca(2+) signalling leading to Ca(2+)-activated Cl(-) secretion and enhanced ASL height in non-CF and CF bronchial epithelia.

  20. Regulation of granule cell excitability by a low-threshold calcium spike in turtle olfactory bulb

    DEFF Research Database (Denmark)

    Pinato, Giulietta; Midtgaard, Jens

    2003-01-01

    of the cell usually increased their amplitude so that they more easily boosted Na spike initiation. The LTS persisted in the presence of TTX but was antagonized by blockers of T-type calcium channels. The voltage dependence, kinetics, and inactivation properties of the LTS were characteristic of a low......-threshold calcium spike. The threshold of the LTS was slightly above the resting potential but well below the Na spike threshold, and the LTS was often evoked in isolation in normal medium. Tetraethylammonium (TEA) and 4-aminopyridine (4-AP) had only minimal effects on the LTS but revealed the presence of a high...

  1. Computational model based approach to analysis ventricular arrhythmias: Effects of dysfunction calcium channels

    Science.gov (United States)

    Gulothungan, G.; Malathi, R.

    2018-04-01

    Disturbed sodium (Na+) and calcium (Ca2+) handling is known to be a major predisposing factor for life-threatening cardiac arrhythmias. Cardiac contractility in ventricular tissue is prominent by Ca2+ channels like voltage dependent Ca2+ channels, sodium-calcium exchanger (Na+-Ca2+x) and sacroplasmicrecticulum (SR) Ca2+ pump and leakage channels. Experimental and clinical possibilities for studying cardiac arrhythmias in human ventricular myocardium are very limited. Therefore, the use of alternative methods such as computer simulations is of great importance. Our aim of this article is to study the impact on action potential (AP) generation and propagation in single ventricular myocyte and ventricular tissue under different dysfunction Ca2+ channels condition. In enhanced activity of Na+-Ca2+x, single myocyte produces AP duration (APD90) and APD50 is significantly smaller (266 ms and 235 ms). Its Na+-Ca2+x current at depolarization is increases 60% from its normal level and repolarization current goes more negative (nonfailing= -0.28 pA/pF and failing= -0.47 pA/pF). Similarly, same enhanced activity of Na+-Ca2+x in 10 mm region of ventricular sheet, raises the plateau potential abruptly, which ultimately affects the diastolic repolarization. Compare with normal ventricular sheet region of 10 mm, 10% of ventricular sheet resting state is reduces and ventricular sheet at time 250 ms is goes to resting state very early. In hypertrophy condition, single myocyte produces APD90 and APD50 is worthy of attention smaller (232 mS and 198 ms). Its sodium-potassium (Na+-K+) pump current is 75% reduces from its control conditions (0.13 pA/pF). Hypertrophy condition, 50% of ventricular sheet is reduces to minimum plateau potential state, that starts the repolarization process very early and reduces the APD. In a single failing SR Ca2+ channels myocyte, recovery of Ca2+ concentration level in SR reduces upto 15% from its control myocytes. At time 290 ms, 70% of ventricular sheet

  2. CaV3.1 isoform of T-type calcium channels supports excitability of rat and mouse ventral tegmental area neurons.

    Science.gov (United States)

    Tracy, Matthew E; Tesic, Vesna; Stamenic, Tamara Timic; Joksimovic, Srdjan M; Busquet, Nicolas; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M

    2018-03-23

    Recent data have implicated voltage-gated calcium channels in the regulation of the excitability of neurons within the mesolimbic reward system. While the attention of most research has centered on high voltage L-type calcium channel activity, the presence and role of the low voltage-gated T-type calcium channel (T-channels) has not been well explored. Hence, we investigated T-channel properties in the neurons of the ventral tegmental area (VTA) utilizing wild-type (WT) rats and mice, Ca V 3.1 knock-out (KO) mice, and TH-eGFP knock-in (KI) rats in acute horizontal brain slices of adolescent animals. In voltage-clamp experiments, we first assessed T-channel activity in WT rats with characteristic properties of voltage-dependent activation and inactivation, as well as characteristic crisscrossing patterns of macroscopic current kinetics. T-current kinetics were similar in WT mice and WT rats but T-currents were abolished in Ca V 3.1 KO mice. In ensuing current-clamp experiments, we observed the presence of hyperpolarization-induced rebound burst firing in a subset of neurons in WT rats, as well as dopaminergic and non-dopaminergic neurons in TH-eGFP KI rats. Following the application of a pan-selective T-channel blocker TTA-P2, rebound bursting was significantly inhibited in all tested cells. In a behavioral assessment, the acute locomotor increase induced by a MK-801 (Dizocilpine) injection in WT mice was abolished in Ca V 3.1 KO mice, suggesting a tangible role for 3.1 T-type channels in drug response. We conclude that pharmacological targeting of Ca V 3.1 isoform of T-channels may be a novel approach for the treatment of disorders of mesolimbic reward system. Copyright © 2018. Published by Elsevier Ltd.

  3. Aqueous leaf extract of Averrhoa carambola L. (Oxalidaceae reduces both the inotropic effect of BAY K 8644 on the guinea pig atrium and the calcium current on GH3cells

    Directory of Open Access Journals (Sweden)

    Carla M. L. Vasconcelos

    Full Text Available It was previously showed that aqueous leaf extract (AqEx of Averrhoa carambola depresses the guinea pig atrial inotropism. Therefore, experiments were carried out on guinea pig left atrium and on pituitary GH3 cells in order to evaluate the effect of AqEx on the cellular calcium influx. The atrium was mounted in an organ chamber (5 mL, Tyrode, 27 ± 0.1 ºC, 95 % O2, 5 % CO2, stretched to 10 mN, and paced at 2 Hz (0.5 ms, 400 V and GH3 cells were submitted to a whole cell voltage clamp configuration. In the atrium, the AqEx (1500 µg/mL shifted to the right the concentration-effect curve of the positive inotropic effect produced by (± BAY K 8644, an L-type calcium channel agonist. The AqEx increased EC50 (concentration required to promote 50% of the maximum effect of the inotropic effect of BAY K 8644 from 7.8 ± 0.38 to 115.1 ± 0.44 nM (N = 3; p < 0.05. In GH3 cells assayed with 500 µg/mL of AqEx, the L-type calcium inward current declined 30 % (from 282 to 190 pA. Nevertheless, the extract did not change the voltage correspondent to the peak current. These data suggest that, at least in part, the negative inotropic effect of AqEx on the guinea pig atrium is due to a reduction of the L-type calcium current.

  4. Differential calcium sensitivity in NaV 1.5 mixed syndrome mutants.

    Science.gov (United States)

    Abdelsayed, Mena; Baruteau, Alban-Elouen; Gibbs, Karen; Sanatani, Shubhayan; Krahn, Andrew D; Probst, Vincent; Ruben, Peter C

    2017-09-15

    SCN5a mutations may express gain-of-function (Long QT Syndrome-3), loss-of-function (Brugada Syndrome 1) or both (mixed syndromes), depending on the mutation and environmental triggers. One such trigger may be an increase in cytosolic calcium, accompanying exercise. Many mixed syndromes mutants, including ∆KPQ, E1784K, 1795insD and Q1909R, are found in calcium-sensitive regions. Elevated cytosolic calcium attenuates gain-of-function properties in ∆KPQ, 1795insD and Q1909R, but not in E1784K. By contrast, elevated cytosolic calcium further exacerbates gain-of-function in E1784K by destabilizing slow inactivation. Action potential modelling, using a modified O'Hara Rudy model, suggests that elevated heart rate rescues action potential duration in ∆KPQ, 1795insD and Q1909R, but not in E1784K. Action potential simulations suggest that E1784K carriers have an increased intracellular sodium-to-calcium ratio under bradycardia and tachycardia conditions. Elevated cytosolic calcium, which is common during high heart rates, ameliorates or exacerbates the mixed syndrome phenotype depending on the genetic signature. Inherited arrhythmias may arise from mutations in the gene for SCN5a, which encodes the cardiac voltage-gated sodium channel, Na V 1.5. Mutants in Na V 1.5 result in Brugada Syndrome (BrS1), Long-QT Syndrome (LQT3) or mixed syndromes (an overlap of BrS1/LQT3). Exercise is a potential arrhythmogenic trigger in mixed syndromes. We aimed to determine the effects of elevated cytosolic calcium, which is common during exercise, in mixed syndrome Na V 1.5 mutants. We used whole-cell patch clamp to assess the biophysical properties of Na V 1.5 wild-type (WT), ∆KPQ, E1784K, 1795insD and Q1909R mutants in human embryonic kidney 293 cells transiently transfected with the Na V 1.5 α subunit (WT or mutants), β1 subunit and enhanced green fluorescent protein. Voltage-dependence and kinetics were measured at cytosolic calcium levels of approximately 0, 500 and 2500

  5. Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro

    International Nuclear Information System (INIS)

    Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.

    1989-01-01

    The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)

  6. Calcium channel blockers and Alzheimer's disease★

    Science.gov (United States)

    Tan, Yi; Deng, Yulin; Qing, Hong

    2012-01-01

    Alzheimer's disease is characterized by two pathological hallmarks: amyloid plaques and neurofibrillary tangles. In addition, calcium homeostasis is disrupted in the course of human aging. Recent research shows that dense plaques can cause functional alteration of calcium signals in mice with Alzheimer's disease. Calcium channel blockers are effective therapeutics for treating Alzheimer's disease. This review provides an overview of the current research of calcium channel blockers involved in Alzheimer's disease therapy. PMID:25767489

  7. Get Enough Calcium

    Science.gov (United States)

    ... Calcium Print This Topic En español Get Enough Calcium Browse Sections The Basics Overview Foods and Vitamins ... women, don't get enough calcium. How much calcium do I need every day? Women: If you ...

  8. Calcium - urine

    Science.gov (United States)

    ... Female urinary tract Male urinary tract Calcium urine test References Bringhurst FR, Demay MB, Kronenberg HM. Hormones and disorders of mineral metabolism. In: Melmed S, Polonsky KS, Larsen PR, Kronenberg HM, eds. Williams Textbook of Endocrinology . 13th ed. Philadelphia, PA: Elsevier; ...

  9. Membrane Currents in Airway Smooth Muscle: Mechanisms and Therapeutic Implications

    Directory of Open Access Journals (Sweden)

    Luke J Janssen

    1997-01-01

    Full Text Available Electrophysiological and pharmacological techniques were used to characterize the membrane conductance changes underlying spasmogen-evoked depolarization in airway smooth muscle (ASM. Changes included a transient activation of chloride ion channels and prolonged suppression of potassium ion channels; both changes are triggered by release of internally sequestered calcium ion and in turn cause opening of voltage-dependent calcium channels. The resultant influx of calcium ions contributes to contraction as well as to refilling of the internal calcium ion pool. Bronchodilators, on the other hand, act in part through activation of potassium channels, with consequent closure of calcium channels. The tools used to study ion channels in ASM are described, and the investigations of the roles of ion channels in ASM physiology (autacoid-evoked depolarization and hyperpolarization and pathophysiology (airway hyperresponsiveness are summarized. Finally, how the relationship between ion channels and ASM function/dysfunction may relate to the treatment of asthma and related breathing disorders is discussed.

  10. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  11. Reconstruction of Cell Surface Densities of Ion Pumps, Exchangers, and Channels from mRNA Expression, Conductance Kinetics, Whole-Cell Calcium, and Current-Clamp Voltage Recordings, with an Application to Human Uterine Smooth Muscle Cells.

    Directory of Open Access Journals (Sweden)

    Jolene Atia

    2016-04-01

    Full Text Available Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the 'conductance repertoire' being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations.

  12. Calcium paradox and calcium entry blockers

    NARCIS (Netherlands)

    Ruigrok, T.J.C.; Slade, A.M.; Nayler, W.G.; Meijler, F.L.

    1984-01-01

    Reperfusion of isolated hearts with calcium-containing solution after a short period of calcium-free perfusion results in irreversible cell damage (calcium paradox). This phenomenon is characterized by an excessive influx of calcium into the cells, the rapid onset of myocardial contracture,

  13. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  14. Calcium Balance in Chronic Kidney Disease.

    Science.gov (United States)

    Hill Gallant, Kathleen M; Spiegel, David M

    2017-06-01

    The kidneys play a critical role in the balance between the internal milieu and external environment. Kidney failure is known to disrupt a number of homeostatic mechanisms that control serum calcium and normal bone metabolism. However, our understanding of calcium balance throughout the stages of chronic kidney disease is limited and the concept of balance itself, especially with a cation as complex as calcium, is often misunderstood. Both negative and positive calcium balance have important implications in patients with chronic kidney disease, where negative balance may increase risk of osteoporosis and fracture and positive balance may increase risk of vascular calcification and cardiovascular events. Here, we examine the state of current knowledge about calcium balance in adults throughout the stages of chronic kidney disease and discuss recommendations for clinical strategies to maintain balance as well as future research needs in this area. Recent calcium balance studies in adult patients with chronic kidney disease show that neutral calcium balance is achieved with calcium intake near the recommended daily allowance. Increases in calcium through diet or supplements cause high positive calcium balance, which may put patients at risk for vascular calcification. However, heterogeneity in calcium balance exists among these patients. Given the available calcium balance data in this population, it appears clinically prudent to aim for recommended calcium intakes around 1000 mg/day to achieve neutral calcium balance and avoid adverse effects of either negative or positive calcium balance. Assessment of patients' dietary calcium intake could further equip clinicians to make individualized recommendations for meeting recommended intakes.

  15. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  16. Calcium blood test

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003477.htm Calcium blood test To use the sharing features on this page, please enable JavaScript. The calcium blood test measures the level of calcium in the blood. ...

  17. Calcium source (image)

    Science.gov (United States)

    Getting enough calcium to keep bones from thinning throughout a person's life may be made more difficult if that person has ... as a tendency toward kidney stones, for avoiding calcium-rich food sources. Calcium deficiency also effects the ...

  18. Calcium Pyrophosphate Deposition (CPPD)

    Science.gov (United States)

    ... Patient / Caregiver Diseases & Conditions Calcium Pyrophosphate Deposition (CPPD) Calcium Pyrophosphate Deposition (CPPD) Fast Facts The risk of ... young people, too. Proper diagnosis depends on detecting calcium pyrophosphate crystals in the fluid of an affected ...

  19. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Products that contain calcium carbonate are certain: Antacids (Tums, Chooz) Mineral supplements Hand lotions Vitamin and mineral supplements Other products may also contain ...

  20. Calcium and bones (image)

    Science.gov (United States)

    Calcium is one of the most important minerals for the growth, maintenance, and reproduction of the human ... body, are continually being re-formed and incorporate calcium into their structure. Calcium is essential for the ...

  1. Calcium hydroxide poisoning

    Science.gov (United States)

    Hydrate - calcium; Lime milk; Slaked lime ... Calcium hydroxide ... These products contain calcium hydroxide: Cement Limewater Many industrial solvents and cleaners (hundreds to thousands of construction products, flooring strippers, brick cleaners, cement ...

  2. Calcium in Urine Test

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Calcium, Serum; Calcium and Phosphates, Urine; ...

  3. Transcellular transport of calcium

    Energy Technology Data Exchange (ETDEWEB)

    Terepka, A R; Coleman, J R; Armbrecht, H J; Gunter, T E

    1976-01-01

    Studies of two calcium transporting epithelia, embryonic chick chorioallantoic membrane and the small intestine of rat and chick, have strongly suggested that the transfer of calcium across a cell involves processes distinctly different from intracellular calcium ion regulation. In the proposed model, transcellular calcium transport is considered as a specialized process developed only by certain cells in those tissues charged with bulk transfer of calcium. The overall effect of the endocytotic mechanism is bulk calcium movement across a cell, protection of mitochondria from exposure to high concentrations of calcium, and the avoidance of wide and potentially toxic fluctuations in cytosol ionic calcium levels. (MFB)

  4. Biphasic calcium phosphate–casein bone graft fortified with Cassia

    Indian Academy of Sciences (India)

    Biphasic calcium phosphate; bone graft; Cassia occidentalis; simulated body fluid; SaOS-2 cell line. ... The study investigates the efficacy of CO extract incorporated biphasic calcium phosphate as an osteoinductive material. ... Current Issue

  5. Calcium Signals from the Vacuole

    Directory of Open Access Journals (Sweden)

    Gerald Schönknecht

    2013-10-01

    Full Text Available The vacuole is by far the largest intracellular Ca2+ store in most plant cells. Here, the current knowledge about the molecular mechanisms of vacuolar Ca2+ release and Ca2+ uptake is summarized, and how different vacuolar Ca2+ channels and Ca2+ pumps may contribute to Ca2+ signaling in plant cells is discussed. To provide a phylogenetic perspective, the distribution of potential vacuolar Ca2+ transporters is compared for different clades of photosynthetic eukaryotes. There are several candidates for vacuolar Ca2+ channels that could elicit cytosolic [Ca2+] transients. Typical second messengers, such as InsP3 and cADPR, seem to trigger vacuolar Ca2+ release, but the molecular mechanism of this Ca2+ release still awaits elucidation. Some vacuolar Ca2+ channels have been identified on a molecular level, the voltage-dependent SV/TPC1 channel, and recently two cyclic-nucleotide-gated cation channels. However, their function in Ca2+ signaling still has to be demonstrated. Ca2+ pumps in addition to establishing long-term Ca2+ homeostasis can shape cytosolic [Ca2+] transients by limiting their amplitude and duration, and may thus affect Ca2+ signaling.

  6. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  7. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  8. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  9. Effects of new-generation TMEM16A inhibitors on calcium-activated chloride currents in rabbit urethral interstitial cells of Cajal.

    Science.gov (United States)

    Fedigan, Stephen; Bradley, Eamonn; Webb, Timothy; Large, Roddy J; Hollywood, Mark A; Thornbury, Keith D; McHale, Noel G; Sergeant, Gerard P

    2017-11-01

    Interstitial cells of Cajal (ICC) isolated from the rabbit urethra exhibit Ca 2+ -activated Cl - currents (I ClCa ) that are important for the development of urethral tone. Here, we examined if TMEM16A (ANO1) contributed to this activity by examining the effect of "new-generation" TMEM16A inhibitors, CACC inh -A01 and T16A inh -A01, on I ClCa recorded from freshly isolated rabbit urethral ICC (RUICC) and on contractions of intact strips of rabbit urethra smooth muscle. Real-time quantitative PCR experiments demonstrated that TMEM16A was highly expressed in rabbit urethra smooth muscle, in comparison to TMEM16B and TMEM16F. Single-cell RT-PCR experiments revealed that only TMEM16A was expressed in freshly isolated RUICC. Depolarization-evoked I ClCa in isolated RUICC, recorded using voltage clamp, were inhibited by CACC inh -A01 and T16A inh -A01 with IC 50 values of 1.2 and 3.4 μM, respectively. Similarly, spontaneous transient inward currents (STICs) recorded from RUICC voltage clamped at -60 mV and spontaneous transient depolarizations (STDs), recorded in current clamp, were also inhibited by CACC inh -A01 and T16A inh -A01. In contrast, spontaneous Ca 2+ waves in isolated RUICC were only partially reduced by CACC inh -A01 and T16A inh -A01. Finally, neurogenic contractions of strips of rabbit urethra smooth muscle (RUSM), evoked by electric field stimulation (EFS), were also significantly reduced by CACC inh -A01 and T16A inh -A01. These data are consistent with the idea that TMEM16A is involved with CACCs in RUICC and in contraction of rabbit urethral smooth muscle.

  10. Production of precipitated calcium carbonate from calcium silicates and carbon dioxide

    International Nuclear Information System (INIS)

    Teir, Sebastian; Eloneva, Sanni; Zevenhoven, Ron

    2005-01-01

    The possibilities for reducing carbon dioxide emissions from the pulp and paper industry by calcium carbonation are presented. The current precipitated calcium carbonate (PCC) production uses mined, crushed calcium carbonate as raw materials. If calcium silicates were used instead, carbon dioxide emissions from the calcination of carbonates would be eliminated. In Finland, there could, thus, be a potential for eliminating 200 kt of carbon dioxide emissions per year, considering only the PCC used in the pulp and paper industry. A preliminary investigation of the feasibility to produce PCC from calcium silicates and the potential to replace calcium carbonate as the raw material was made. Calcium carbonate can be manufactured from calcium silicates by various methods, but only a few have been experimentally verified. The possibility and feasibility of these methods as a replacement for the current PCC production process was studied by thermodynamic equilibrium calculations using HSC software and process modelling using Aspen Plus[reg]. The results from the process modelling showed that a process that uses acetic acid for extraction of the calcium ions is a high potential option for sequestering carbon dioxide by mineral carbonation. The main obstacle seems to be the limited availability and relatively high price of wollastonite, which is a mineral with high calcium silicate content. An alternative is to use the more common, but also more complex, basalt rock instead

  11. Mechanisms of mineral membrane fouling growth modulated by pulsed modes of current during electrodialysis: evidences of water splitting implications in the appearance of the amorphous phases of magnesium hydroxide and calcium carbonate.

    Science.gov (United States)

    Cifuentes-Araya, Nicolás; Astudillo-Castro, Carolina; Bazinet, Laurent

    2014-07-15

    Experiments revealed the fouling nature evolutions along different electrodialysis (ED) trials, and how it disappears when current pulsation acts repetitively on the interfaces of ion-exchange membranes (IEMs). Fouling was totally controlled on the diluate side of cation-exchange membrane (CEM) by the repetitive pulsation frequency of the higher on-duty ratios applied. They created steady water splitting proton-barriers that neutralized OH(-) leakage through the membrane, decreasing the interfacial pH, and fouling of the concentrate side. The anion-exchange membrane (AEM) on the diluate side was similarly protected, but it was fouled once water splitting OH(-) generation became either intense enough or excessively weak. Interestingly, amorphous magnesium hydroxide (AMH) stemmed on the CEM-diluate side from brucite under intense water splitting OH(-) generation, and/or strong OH(-) leakage electromigration through the membrane. Water dissociation and overlimiting current regimes triggered drastic water molecule removal from crystal lattices through an accelerated cascade water splitting reaction. Also, amorphous calcium carbonate (ACC) appeared on CEM under intense water splitting reaction, and disappeared once intense OH(-) leakage was allowed by the water splitting proton-barrier dissipation. Our findings have implications for membrane fouling control, as well as for the understanding of the growth behavior of CaCO3 and Mg(OH)2 species on electromembrane interfaces. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro

    DEFF Research Database (Denmark)

    Rekling, J C; Feldman, J L

    1997-01-01

    Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro. J. Neurophysiol. 78: 2483-2492, 1997. The nucleus ambiguus contains vagal and glossopharyngeal motoneurons and preganglionic neurons involved in respiration, swallowing, vocalization......-stimulus orthodromic activation, using an electrode placed in the dorsomedial slice near the nucleus tractus solitarius, evoked single excitatory postsynaptic potentials (EPSPs) or short trains of EPSPs (500 ms to 1 s). However, tetanic stimulation (5 pulses, 10 Hz) induced voltage-dependent afterdepolarizations...

  13. Calcium and magnesium determination

    International Nuclear Information System (INIS)

    Bhattacharya, S.K.

    1982-01-01

    The roles of calcium and magnesium in human health and disease have been extensively studied. Calcium and magnesium have been determined in biological specimens by atomic absorption spectroscopy using stiochiometric nitrous oxide-acetylene flame

  14. Fenoprofen calcium overdose

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002649.htm Fenoprofen calcium overdose To use the sharing features on this page, please enable JavaScript. Fenoprofen calcium is a type of medicine called a nonsteroidal ...

  15. Calcium channel blocker overdose

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002580.htm Calcium-channel blocker overdose To use the sharing features on this page, please enable JavaScript. Calcium-channel blockers are a type of medicine used ...

  16. Calcium and Mitosis

    Science.gov (United States)

    Hepler, P.

    1983-01-01

    Although the mechanism of calcium regulation is not understood, there is evidence that calcium plays a role in mitosis. Experiments conducted show that: (1) the spindle apparatus contains a highly developed membrane system that has many characteristics of sarcoplasmic reticulum of muscle; (2) this membrane system contains calcium; and (3) there are ionic fluxes occurring during mitosis which can be seen by a variety of fluorescence probes. Whether the process of mitosis can be modulated by experimentally modulating calcium is discussed.

  17. Single Nisoldipine-Sensitive Calcium Channels in Smooth Muscle Cells Isolated from Rabbit Mesenteric Artery

    Science.gov (United States)

    Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.

    1986-08-01

    Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.

  18. Calcium en cardioplegie

    NARCIS (Netherlands)

    Ruigrok, T.J.C.; Meijler, F.L.

    1985-01-01

    Coronary perfusion with a calcium-free solution, followed by reperfusion with a calcium containing solution, may result in acute myocardial cell death and in irreversible loss of the e1ectrical and mechanical activity of the heart. This phenomenon is known as the calcium paradox. A number of

  19. Calcium spikes and calcium plateaux evoked by differential polarization in dendrites of turtle motoneurones in vitro

    DEFF Research Database (Denmark)

    Hounsgaard, J; Kiehn, O

    1993-01-01

    The ability of dendrites in turtle motoneurones to support calcium spikes and calcium plateaux was investigated using differential polarization by applied electric fields. 2. Electric fields were generated by passing current through transverse slices of the turtle spinal cord between two plate......+ spikes and Ca2+ plateaux are present in dendrites of spinal motoneurones of the turtle....

  20. Rapid pH and PO2 changes in the tissue recording chamber during stoppage of a gas-equilibrated perfusate: effects on calcium currents in ventral horn neurons.

    Science.gov (United States)

    Carlin, K P; Brownstone, R M

    2006-09-01

    In vitro studies often use bicarbonate-buffered saline solutions to mimic the normal extracellular environment of tissues. These solutions are typically equilibrated with gaseous O2 and CO2, the latter interacting with bicarbonate ions to maintain a physiological pH. In vitro tissue chambers, like those used for electrophysiology, are usually continually perfused with the gassed buffer, but stopping the perfusion to add expensive chemicals or acquire imaging data is a common practice. The present study demonstrates that this procedure leads to rapid (PO2 of the detained solution in the tissue chamber. During the first 200 s, pH increased by 0.4 units and resulted in a 25% PO2 reduction of the detained solution. The rates of these changes were dependent on the volume of solution in the chamber. In experiments using acute transverse slices from the lumbar spinal cord of neonatal (postnatal day 0-10) mice, perfusion stoppage of the same duration was accompanied by a 34.7% enhancement of the peak voltage-gated calcium current recorded from ventral horn neurons. In these cells both low voltage-activated and high voltage-activated currents were affected. These currents were unaffected by decreasing PO2 when a CO2-independent buffer was used, suggesting that changes in pH were responsible for the observed effects. It is concluded that the procedure of stopping a bicarbonate/CO2-buffered perfusate results in rapid changes in pH and PO2 of the solution detained in the tissue chamber, and that these changes have the potential to covertly influence experimental results.

  1. Application of Calcium Phosphate Materials in Dentistry

    Directory of Open Access Journals (Sweden)

    Jabr S. Al-Sanabani

    2013-01-01

    Full Text Available Calcium phosphate materials are similar to bone in composition and in having bioactive and osteoconductive properties. Calcium phosphate materials in different forms, as cements, composites, and coatings, are used in many medical and dental applications. This paper reviews the applications of these materials in dentistry. It presents a brief history, dental applications, and methods for improving their mechanical properties. Notable research is highlighted regarding (1 application of calcium phosphate into various fields in dentistry; (2 improving mechanical properties of calcium phosphate; (3 biomimetic process and functionally graded materials. This paper deals with most common types of the calcium phosphate materials such as hydroxyapatite and tricalcium phosphate which are currently used in dental and medical fields.

  2. Adrenomedullin increased the short-circuit current in the pig oviduct through chloride channels via the CGRP receptor: mediation by cAMP and calcium ions but not by nitric oxide.

    Science.gov (United States)

    Liao, S B; Cheung, K H; Cheung, M P L; To, Y T; O, W S; Tang, F

    2013-10-01

    The oviduct serves as a site for the fertilization of the ovum and the transport of the conceptus down to the uterus for implantation. In this study, we investigated the presence of adrenomedullin (ADM) and its receptor component proteins in the pig oviduct. The effect of ADM on oviductal secretion, the specific receptor, and the mechanisms involved were also investigated. The presence of ADM and its receptor component proteins in the pig oviduct were confirmed using immunostaining. Short-circuit current (I(sc)) technique was employed to study chloride ion secretion in the oviductal epithelium. ADM increased I(sc) through cAMP- and calcium-activated chloride channels, and this effect could be inhibited by the CGRP receptor antagonist, hCGRP8-37. In contrast, the nitric oxide synthase inhibitor, L-NG-nitroarginine methyl ester (L-NAME), could not block the effect of ADM on I(sc). In summary, ADM may increase oviductal fluid secretion via chloride secretion independent of the nitric oxide pathway for the transport of sperm and the conceptus.

  3. Calcium absorption and achlorhydria

    International Nuclear Information System (INIS)

    Recker, R.R.

    1985-01-01

    Defective absorption of calcium has been thought to exist in patients with achlorhydria. The author compared absorption of calcium in its carbonate form with that in a pH-adjusted citrate form in a group of 11 fasting patients with achlorhydria and in 9 fasting normal subjects. Fractional calcium absorption was measured by a modified double-isotope procedure with 0.25 g of calcium used as the carrier. Mean calcium absorption (+/- S.D.) in the patients with achlorhydria was 0.452 +/- 0.125 for citrate and 0.042 +/- 0.021 for carbonate (P less than 0.0001). Fractional calcium absorption in the normal subjects was 0.243 +/- 0.049 for citrate and 0.225 +/- 0.108 for carbonate (not significant). Absorption of calcium from carbonate in patients with achlorhydria was significantly lower than in the normal subjects and was lower than absorption from citrate in either group; absorption from citrate in those with achlorhydria was significantly higher than in the normal subjects, as well as higher than absorption from carbonate in either group. Administration of calcium carbonate as part of a normal breakfast resulted in completely normal absorption in the achlorhydric subjects. These results indicate that calcium absorption from carbonate is impaired in achlorhydria under fasting conditions. Since achlorhydria is common in older persons, calcium carbonate may not be the ideal dietary supplement

  4. Calcium channel blocker poisoning

    Directory of Open Access Journals (Sweden)

    Miran Brvar

    2005-04-01

    Full Text Available Background: Calcium channel blockers act at L-type calcium channels in cardiac and vascular smooth muscles by preventing calcium influx into cells with resultant decrease in vascular tone and cardiac inotropy, chronotropy and dromotropy. Poisoning with calcium channel blockers results in reduced cardiac output, bradycardia, atrioventricular block, hypotension and shock. The findings of hypotension and bradycardia should suggest poisoning with calcium channel blockers.Conclusions: Treatment includes immediate gastric lavage and whole-bowel irrigation in case of ingestion of sustainedrelease products. All patients should receive an activated charcoal orally. Specific treatment includes calcium, glucagone and insulin, which proved especially useful in shocked patients. Supportive care including the use of catecholamines is not always effective. In the setting of failure of pharmacological therapy transvenous pacing, balloon pump and cardiopulmonary by-pass may be necessary.

  5. The Marine Guanidine Alkaloid Crambescidin 816 Induces Calcium Influx and Cytotoxicity in Primary Cultures of Cortical Neurons through Glutamate Receptors.

    Science.gov (United States)

    Mendez, Aida G; Juncal, Andrea Boente; Silva, Siguara B L; Thomas, Olivier P; Martín Vázquez, Víctor; Alfonso, Amparo; Vieytes, Mercedes R; Vale, Carmen; Botana, Luís M

    2017-07-19

    Crambescidin 816 is a guanidine alkaloid produced by the sponge Crambe crambe with known antitumoral activity. While the information describing the effects of this alkaloid in central neurons is scarce, Cramb816 is known to block voltage dependent calcium channels being selective for L-type channels. Moreover, Cramb816 reduced neuronal viability through an unknown mechanism. Here, we aimed to describe the toxic activity of Cramb816 in cortical neurons. Since calcium influx is considered the main mechanism responsible for neuronal cell death, the effects of Cramb816 in the cytosolic calcium concentration of cortical neurons were studied. The alkaloid decreased neuronal viability and induced a dose-dependent increase in cytosolic calcium that was also related to the presence of calcium in the extracellular media. The increase in calcium influx was age dependent, being higher in younger neurons. Moreover, this effect was prevented by glutamate receptor antagonists, which did not fully block the cytotoxic effect of Cramb816 after 24 h of treatment but completely prevented Cramb816 cytotoxicity after 10 min exposure. Therefore, the findings presented herein provide new insights into the cytotoxic effect of Cramb816 in cortical neurons.

  6. Dengue and Calcium

    OpenAIRE

    Shivanthan, Mitrakrishnan C; Rajapakse, Senaka

    2014-01-01

    Dengue is potentially fatal unless managed appropriately. No specific treatment is available and the mainstay of treatment is fluid management with careful monitoring, organ support, and correction of metabolic derangement. Evidence with regards to the role of calcium homeostasis in dengue is limited. Low blood calcium levels have been demonstrated in dengue infection and hypocalcemia maybe more pronounced in more severe forms. The cause of hypocalcemia is likely to be multifactorial. Calcium...

  7. Calcium Channel Blockers

    Science.gov (United States)

    ... Certain calcium channel blockers interact with grapefruit products. Kaplan NM, et al. Treatment of hypertension: Drug therapy. In: Kaplan's Clinical Hypertension. 11th ed. Philadelphia, Pa.: Wolters Kluwer ...

  8. Regulation of calcium homeostasis in activated human neutrophils ...

    African Journals Online (AJOL)

    Objectives. The objectives of the current study were to: (i) present an integrated model for the restoration of calcium homeostasis in activated human neutrophils based on current knowledge and recent research; and (ii) identify potential targets for the modulation of calcium fluxes in activated neutrophils based on this model ...

  9. Effect of HeNe laser on calcium signals in sperm cells

    Science.gov (United States)

    Lubart, Rachel; Friedmann, Harry; Cohen, Natalie; Brietbart, Haim

    1998-12-01

    Irradiation of mouse spermatozoa by 630 nm HeNe laser was found to enhance calcium transport in these cells. The change in Ca transport was investigated through two approaches, the first employing the fluorescent Ca indicator, Fluo-3 AM and a fluorescence microscopic system, and the second the radiolabeled Ca uptake. In both approaches the effect of light on Ca transport was abrogated in the absence of Ca during the irradiation time, indicating that the effect of light is Ca-dependent. The stimulatory effect of light on Ca uptake was inhibited by treatment with catalase, suggesting H2O2 to be involved in light stimulated Ca2+ uptake. The stimulatory effect of light on Ca uptake was abolished in the presence of a voltage-dependent Ca-channel inhibitor, nifedipine, indicating the involvement of a plasma membrane, voltage- dependent Ca-channel. In contrast, addition of nifedipine prior to the HeNe laser irradiation did not affect the light-induced rise in intracellular Ca levels, as measured with Fluo-3 loaded sperm cells. Therefore, it can be concluded that this Ca influx occurs via a voltage- insensitive Ca-channel. The stimulatory effect of light on Ca uptake was almost completely abolished by the mitochondrial uncoupler FCCP. These data imply that light affects the mitochondrial Ca transport mechanisms. It is well known that Ca influx from an extracellular environment is an essential component of a signaling cascade leading to fertilization.

  10. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  11. Acidosis and Urinary Calcium Excretion

    DEFF Research Database (Denmark)

    Alexander, R Todd; Cordat, Emmanuelle; Chambrey, Régine

    2016-01-01

    Metabolic acidosis is associated with increased urinary calcium excretion and related sequelae, including nephrocalcinosis and nephrolithiasis. The increased urinary calcium excretion induced by metabolic acidosis predominantly results from increased mobilization of calcium out of bone and inhibi...

  12. Calcium D-saccharate

    DEFF Research Database (Denmark)

    Garcia, André Castilho; Hedegaard, Martina Vavrusova; Skibsted, Leif Horsfelt

    2016-01-01

    Molar conductivity of saturated aqueous solutions of calcium d-saccharate, used as a stabilizer of beverages fortified with calcium d-gluconate, increases strongly upon dilution, indicating complex formation between calcium and d-saccharate ions, for which, at 25 °C, Kassoc = 1032 ± 80, ΔHassoc......° = -34 ± 6 kJ mol-1, and ΔSassoc° = -55 ± 9 J mol-1 K-1, were determined electrochemically. Calcium d-saccharate is sparingly soluble, with a solubility product, Ksp, of (6.17 ± 0.32) × 10-7 at 25 °C, only moderately increasing with the temperature: ΔHsol° = 48 ± 2 kJ mol-1, and ΔSassoc° = 42 ± 7 J mol-1...... K-1. Equilibria in supersaturated solutions of calcium d-saccharate seem only to adjust slowly, as seen from calcium activity measurements in calcium d-saccharate solutions made supersaturated by cooling. Solutions formed by isothermal dissolution of calcium d-gluconate in aqueous potassium d...

  13. Calcium metabolism in birds.

    Science.gov (United States)

    de Matos, Ricardo

    2008-01-01

    Calcium is one of the most important plasma constituents in mammals and birds. It provides structural strength and support (bones and eggshell) and plays vital roles in many of the biochemical reactions in the body. The control of calcium metabolism in birds is highly efficient and closely regulated in a number of tissues, primarily parathyroid gland, intestine, kidney, and bone. The hormones with the greatest involvement in calcium regulation in birds are parathyroid hormone, 1,25-dihydroxyvitamin D(3) (calcitriol), and estrogen, with calcitonin playing a minor and uncertain role. The special characteristics of calcium metabolism in birds, mainly associated with egg production, are discussed, along with common clinical disorders secondary to derangements in calcium homeostasis.

  14. Mean field strategies induce unrealistic nonlinearities in calcium puffs

    Directory of Open Access Journals (Sweden)

    Guillermo eSolovey

    2011-08-01

    Full Text Available Mean field models are often useful approximations to biological systems, but sometimes, they can yield misleading results. In this work, we compare mean field approaches with stochastic models of intracellular calcium release. In particular, we concentrate on calcium signals generated by the concerted opening of several clustered channels (calcium puffs. To this end we simulate calcium puffs numerically and then try to reproduce features of the resulting calcium distribution using mean field models were all the channels open and close simultaneously. We show that an unrealistic nonlinear relationship between the current and the number of open channels is needed to reproduce the simulated puffs. Furthermore, a single channel current which is five times smaller than the one of the stochastic simulations is also needed. Our study sheds light on the importance of the stochastic kinetics of the calcium release channel activity to estimate the release fluxes.

  15. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  16. HYPERTHERMIA, INTRACELLULAR FREE CALCIUM AND CALCIUM IONOPHORES

    NARCIS (Netherlands)

    STEGE, GJJ; WIERENGA, PK; KAMPINGA, HH; KONINGS, AWT

    1993-01-01

    It is shown that heat-induced increase of intracellular calcium does not correlate with hyperthermic cell killing. Six different cell lines were investigated; in four (EAT, HeLa S3, L5178Y-R and L5178Y-S) heat treatments killing 90% of the cells did not affect the levels of intracellular free

  17. DIHYDROPYRIDINE CALCIUM- CHANNELBLOCKERSFOR ...

    African Journals Online (AJOL)

    Furthermore, the controversy over the role of calci~-channel blockers as first-line ..... group trials while fully accounting for placebo effects as well as interindividual ..... Reducing calcium overload in the ischemic brain. N Engl JMed. 1999; 341 ...

  18. Calcium and Your Child

    Science.gov (United States)

    ... calcium-set tofu edamame (soybeans) broccoli, collard greens, kale, chard, Chinese cabbage, and other leafy greens almonds ... more dark green, leafy vegetables (such as broccoli, kale, collard greens, or Chinese cabbage) with meals. Kids ...

  19. Calcium in the prevention of postmenopausal osteoporosis: EMAS clinical guide.

    Science.gov (United States)

    Cano, Antonio; Chedraui, Peter; Goulis, Dimitrios G; Lopes, Patrice; Mishra, Gita; Mueck, Alfred; Senturk, Levent M; Simoncini, Tommaso; Stevenson, John C; Stute, Petra; Tuomikoski, Pauliina; Rees, Margaret; Lambrinoudaki, Irene

    2018-01-01

    Postmenopausal osteoporosis is a highly prevalent disease. Prevention through lifestyle measures includes an adequate calcium intake. Despite the guidance provided by scientific societies and governmental bodies worldwide, many issues remain unresolved. To provide evidence regarding the impact of calcium intake on the prevention of postmenopausal osteoporosis and critically appraise current guidelines. Literature review and consensus of expert opinion. The recommended daily intake of calcium varies between 700 and 1200mg of elemental calcium, depending on the endorsing source. Although calcium can be derived either from the diet or supplements, the former source is preferred. Intake below the recommended amount may increase fragility fracture risk; however, there is no consistent evidence that calcium supplementation at, or above, recommended levels reduces risk. The addition of vitamin D may minimally reduce fractures, mainly among institutionalised people. Excessive intake of calcium, defined as higher than 2000mg/day, can be potentially harmful. Some studies demonstrated harm even at lower dosages. An increased risk for cardiovascular events, urolithiasis and even fractures has been found in association with excessive calcium intake, but this issue remains unresolved. In conclusion, an adequate intake of calcium is recommended for general bone health. Excessive calcium intake seems of no benefit, and could possibly be harmful. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Calcium binding by dietary fibre

    International Nuclear Information System (INIS)

    James, W.P.T.; Branch, W.J.; Southgate, D.A.T.

    1978-01-01

    Dietary fibre from plants low in phytate bound calcium in proportion to its uronic-acid content. This binding by the non-cellulosic fraction of fibre reduces the availability of calcium for small-intestinal absorption, but the colonic microbial digestion of uronic acids liberates the calcium. Thus the ability to maintain calcium balance on high-fibre diets may depend on the adaptive capacity on the colon for calcium. (author)

  1. A model of propagating calcium-induced calcium release mediated by calcium diffusion

    NARCIS (Netherlands)

    Backx, P. H.; de Tombe, P. P.; van Deen, J. H.; Mulder, B. J.; ter Keurs, H. E.

    1989-01-01

    The effect of sudden local fluctuations of the free sarcoplasmic [Ca++]i in cardiac cells on calcium release and calcium uptake by the sarcoplasmic reticulum (SR) was calculated with the aid of a simplified model of SR calcium handling. The model was used to evaluate whether propagation of calcium

  2. [Calcium suppletion for patients who use gastric acid inhibitors: calcium citrate or calcium carbonate?].

    NARCIS (Netherlands)

    Jonge, H.J. de; Gans, R.O.; Huls, G.A.

    2012-01-01

    Various calcium supplements are available for patients who have an indication for calcium suppletion. American guidelines and UpToDate recommend prescribing calcium citrate to patients who use antacids The rationale for this advice is that water-insoluble calcium carbonate needs acid for adequate

  3. Receptor model for the molecular basis of tissue selectivity of 1,4-dihydropyridine calcium channel drugs

    Science.gov (United States)

    Langs, David A.; Strong, Phyllis D.; Triggle, David J.

    1990-09-01

    Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.

  4. Calcium in plant cells

    Directory of Open Access Journals (Sweden)

    V. V. Schwartau

    2014-04-01

    Full Text Available The paper gives the review on the role of calcium in many physiological processes of plant organisms, including growth and development, protection from pathogenic influences, response to changing environmental factors, and many other aspects of plant physiology. Initial intake of calcium ions is carried out by Ca2+-channels of plasma membrane and they are further transported by the xylem owing to auxins’ attractive ability. The level of intake and selectivity of calcium transport to ove-ground parts of the plant is controlled by a symplast. Ca2+enters to the cytoplasm of endoderm cells through calcium channels on the cortical side of Kaspary bands, and is redistributed inside the stele by the symplast, with the use of Ca2+-АТPases and Ca2+/Н+-antiports. Owing to regulated expression and activity of these calcium transporters, calclum can be selectively delivered to the xylem. Important role in supporting calcium homeostasis is given to the vacuole which is the largest depo of calcium. Regulated quantity of calcium movement through the tonoplast is provided by a number of potential-, ligand-gated active transporters and channels, like Ca2+-ATPase and Ca2+/H+ exchanger. They are actively involved in the inactivation of the calcium signal by pumping Ca2+ to the depo of cells. Calcium ATPases are high affinity pumps that efficiently transfer calcium ions against the concentration gradient in their presence in the solution in nanomolar concentrations. Calcium exchangers are low affinity, high capacity Ca2+ transporters that are effectively transporting calcium after raising its concentration in the cell cytosol through the use of protons gradients. Maintaining constant concentration and participation in the response to stimuli of different types also involves EPR, plastids, mitochondria, and cell wall. Calcium binding proteins contain several conserved sequences that provide sensitivity to changes in the concentration of Ca2+ and when you

  5. Calcium Absorption in Infants and Small Children: Methods of Determination and Recent Findings

    Directory of Open Access Journals (Sweden)

    Steven A. Abrams

    2010-04-01

    Full Text Available Determining calcium bioavailability is important in establishing dietary calcium requirements. In infants and small children, previously conducted mass balance studies have largely been replaced by stable isotope-based studies. The ability to assess calcium absorption using a relatively short 24-hour urine collection without the need for multiple blood samples or fecal collections is a major advantage to this technique. The results of these studies have demonstrated relatively small differences in calcium absorption efficiency between human milk and currently available cow milk-based infant formulas. In older children with a calcium intake typical of Western diets, calcium absorption is adequate to meet bone mineral accretion requirements.

  6. Risk of High Dietary Calcium for Arterial Calcification in Older Adults

    Directory of Open Access Journals (Sweden)

    Philip J. Klemmer

    2013-09-01

    Full Text Available Concern has recently arisen about the potential adverse effects of excessive calcium intakes, i.e., calcium loading from supplements, on arterial calcification and risks of cardiovascular diseases (CVD in older adults. Published reports that high calcium intakes in free-living adults have relatively little or no beneficial impact on bone mineral density (BMD and fracture rates suggest that current recommendations of calcium for adults may be set too high. Because even healthy kidneys have limited capability of eliminating excessive calcium in the diet, the likelihood of soft-tissue calcification may increase in older adults who take calcium supplements, particularly in those with age or disease-related reduction in renal function. The maintenance of BMD and bone health continues to be an important goal of adequate dietary calcium consumption, but eliminating potential risks of CVDs from excessive calcium intakes needs to be factored into policy recommendations for calcium by adults.

  7. Biocompatibility of bio based calcium carbonate nanocrystals ...

    African Journals Online (AJOL)

    Background: Currently, there has been extensive research interest for inorganic nanocrystals such as calcium phosphate, iron oxide, silicone, carbon nanotube and layered double hydroxide as a drug delivery system especially in cancer therapy. However, toxicological screening of such particles is paramount importance ...

  8. Intact calcium signaling in adrenergic-deficient embryonic mouse hearts.

    Science.gov (United States)

    Peoples, Jessica N; Taylor, David G; Katchman, Alexander N; Ebert, Steven N

    2018-01-22

    Mouse embryos that lack the ability to produce the adrenergic hormones, norepinephrine (NE) and epinephrine (EPI), due to disruption of the dopamine beta-hydroxylase (Dbh -/- ) gene inevitably perish from heart failure during mid-gestation. Since adrenergic stimulation is well-known to enhance calcium signaling in developing as well as adult myocardium, and impairments in calcium signaling are typically associated with heart failure, we hypothesized that adrenergic-deficient embryonic hearts would display deficiencies in cardiac calcium signaling relative to adrenergic-competent controls at a developmental stage immediately preceding the onset of heart failure, which first appears beginning or shortly after mouse embryonic day 10.5 (E10.5). To test this hypothesis, we used ratiometric fluorescent calcium imaging techniques to measure cytosolic calcium transients, [Ca 2+ ] i in isolated E10.5 mouse hearts. Our results show that spontaneous [Ca 2+ ] i oscillations were intact and robustly responded to a variety of stimuli including extracellular calcium (5 mM), caffeine (5 mM), and NE (100 nM) in a manner that was indistinguishable from controls. Further, we show similar patterns of distribution (via immunofluorescent histochemical staining) and activity (via patch-clamp recording techniques) for the major voltage-gated plasma membrane calcium channel responsible for the L-type calcium current, I Ca,L , in adrenergic-deficient and control embryonic cardiac cells. These results demonstrate that despite the absence of vital adrenergic hormones that consistently leads to embryonic lethality in vivo, intracellular and extracellular calcium signaling remain essentially intact and functional in embryonic mouse hearts through E10.5. These findings suggest that adrenergic stimulation is not required for the development of intracellular calcium oscillations or extracellular calcium signaling through I Ca,L and that aberrant calcium signaling does not likely contribute

  9. Calcium ferrite formation from the thermolysis of calcium tris (maleato)

    Indian Academy of Sciences (India)

    For preparing calcium ferrite, calcium tris (maleato) ferrate(III) precursor was prepared by mixing aqueous solutions of iron(III) maleate, calcium maleate and maleic acid. Various physico-chemical techniques i.e. TG, DTG, DTA, Mössbauer, XRD, IR etc have been used to study the decomposition behaviour from ambient to ...

  10. A sensor for calcium uptake

    Science.gov (United States)

    Collins, Sean; Meyer, Tobias

    2011-01-01

    Mitochondria — the cell’s power plants — increase their energy production in response to calcium signals in the cytoplasm. A regulator of the elusive mitochondrial calcium channel has now been identified. PMID:20844529

  11. Children's Bone Health and Calcium

    Science.gov (United States)

    ... Twitter Pinterest Email Print Children's Bone Health and Calcium: Condition Information What is bone health and how ... straight, walk, run, and lead an active life. Calcium is one of the key dietary building blocks ...

  12. Calcium – how and why?

    Indian Academy of Sciences (India)

    Unknown

    biological processes because of its unusual physical and chemical properties. 1. History of calcium ... cellular roles of calcium has established the importance of this ion ..... Ca2+ ion, for example in regulating enzyme activity (Price. 1975 ...

  13. Solar Imagery - Chromosphere - Calcium

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset consists of full-disk images of the sun in Calcium (Ca) II K wavelength (393.4 nm). Ca II K imagery reveal magnetic structures of the sun from about 500...

  14. Antenatal calcium intake in Malaysia.

    Science.gov (United States)

    Mahdy, Zaleha Abdullah; Basri, Hashimah; Md Isa, Zaleha; Ahmad, Shuhaila; Shamsuddin, Khadijah; Mohd Amin, Rahmah

    2014-04-01

    To determine the adequacy of antenatal calcium intake in Malaysia, and the influencing factors. A cross-sectional study was conducted among postnatal women who delivered in two tertiary hospitals. Data were collected from antenatal cards, hospital documents and diet recall on daily milk and calcium intake during pregnancy. SPSS version 19.0 was used for statistical analyses. A total of 150 women were studied. The total daily calcium intake was 834 ± 43 mg (mean ± standard error of the mean), but the calcium intake distribution curve was skewed to the right with a median intake of 725 mg daily. When calcium intake from milk and calcium supplements was excluded, the daily dietary calcium intake was only 478 ± 25 mg. Even with inclusion of milk and calcium supplements, more than a third (n=55 or 36.7%) of the women consumed less than 600 mg calcium in their daily diet. The adequacy of daily calcium intake was not influenced by maternal age, ethnicity, income or maternal job or educational status as well as parity. The daily dietary calcium intake of the Malaysian antenatal population is far from adequate without the addition of calcium supplements and milk. © 2013 The Authors. Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology.

  15. The Plasma Membrane Calcium Pump

    Science.gov (United States)

    Rasmussen, H.

    1983-01-01

    Three aspect of cellular calcium metabolism in animal cells was discussed including the importance of the plasma membrane in calcium homeostasis, experiments dealing with the actual mechanism of the calcium pump, and the function of the pump in relationship to the mitochondria and to the function of calmodulin in the intact cell.

  16. Dietary Calcium Intake and Calcium Supplementation in Hungarian Patients with Osteoporosis

    Directory of Open Access Journals (Sweden)

    Gábor Speer

    2013-01-01

    Full Text Available Purpose. Adequate calcium intake is the basis of osteoporosis therapy—when this proves insufficient, even specific antiosteoporotic agents cannot exert their actions properly. Methods. Our representative survey analyzed the dietary intake and supplementation of calcium in 8033 Hungarian female and male (mean age: 68 years (68.01 (CI95: 67.81–68.21 patients with osteoporosis. Results. Mean intake from dietary sources was 665±7.9 mg (68.01 (CI95: 67.81–68.21 daily. A significant positive relationship could be detected between total dietary calcium intake and lumbar spine BMD (P=0.045, whereas such correlation could not be demonstrated with femoral T-score. Milk consumption positively correlated with femur (P=0.041, but not with lumbar BMD. The ingestion of one liter of milk daily increased the T-score by 0.133. Average intake from supplementation was 558±6.2 mg (68.01 (CI95: 67.81–68.21 daily. The cumulative dose of calcium—from both dietary intake and supplementation—was significantly associated with lumbar (r=0.024, P=0.049, but not with femur BMD (r=0.021, P=0.107. The currently recommended 1000–1500 mg total daily calcium intake was achieved in 34.5% of patients only. It was lower than recommended in 47.8% of the cases and substantially higher in 17.7% of subjects. Conclusions. We conclude that calcium intake in Hungarian osteoporotic patients is much lower than the current recommendation, while routinely applied calcium supplementation will result in inappropriately high calcium intake in numerous patients.

  17. A computational model of the ionic currents, Ca2+ dynamics and action potentials underlying contraction of isolated uterine smooth muscle.

    Directory of Open Access Journals (Sweden)

    Wing-Chiu Tong

    2011-04-01

    Full Text Available Uterine contractions during labor are discretely regulated by rhythmic action potentials (AP of varying duration and form that serve to determine calcium-dependent force production. We have employed a computational biology approach to develop a fuller understanding of the complexity of excitation-contraction (E-C coupling of uterine smooth muscle cells (USMC. Our overall aim is to establish a mathematical platform of sufficient biophysical detail to quantitatively describe known uterine E-C coupling parameters and thereby inform future empirical investigations of physiological and pathophysiological mechanisms governing normal and dysfunctional labors. From published and unpublished data we construct mathematical models for fourteen ionic currents of USMCs: Ca2+ currents (L- and T-type, Na+ current, an hyperpolarization-activated current, three voltage-gated K+ currents, two Ca2+-activated K+ current, Ca2+-activated Cl current, non-specific cation current, Na+-Ca2+ exchanger, Na+-K+ pump and background current. The magnitudes and kinetics of each current system in a spindle shaped single cell with a specified surface area:volume ratio is described by differential equations, in terms of maximal conductances, electrochemical gradient, voltage-dependent activation/inactivation gating variables and temporal changes in intracellular Ca2+ computed from known Ca2+ fluxes. These quantifications are validated by the reconstruction of the individual experimental ionic currents obtained under voltage-clamp. Phasic contraction is modeled in relation to the time constant of changing [Ca2+]i. This integrated model is validated by its reconstruction of the different USMC AP configurations (spikes, plateau and bursts of spikes, the change from bursting to plateau type AP produced by estradiol and of simultaneous experimental recordings of spontaneous AP, [Ca2+]i and phasic force. In summary, our advanced mathematical model provides a powerful tool to

  18. Non-calcium desulphurisation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Qian Zhu [IEA Clean Coal Centre, London (United Kingdom)

    2010-06-15

    Flue gas desulphurisation (FGD) is traditionally based on limestone/lime sorbent. The majority of the installed FGD systems worldwide use limestone or lime as sorbent. However, technologies are rapidly evolving that allow desulphurisation in regions where there are limited resources of lime or limestone. These technologies provide alternatives to limestone/lime scrubbers for efficient and cost effective control of SO{sub 2} emissions from coal combustion. This report reviews the existing and emerging non-calcium based FGD processes as well as FGD technologies currently under development that apply new concepts and different approaches. It looks at the fundamentals and features of these processes, the recent technical advances and their applications in coal-fired power plants. The capital and operating costs of the processes are evaluated where information available. 66 refs., 15 figs., 10 tabs.

  19. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  20. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  1. Calcium, essential for health

    Science.gov (United States)

    Martínez de Victoria, Emilio

    2016-07-12

    Calcium (Ca) is the most abundant mineral element in our body. It accounts for about 2% of body weight. The functions of calcium are: a) functions skeletal and b) regulatory functions. Bone consists of a protein matrix that mineralizes mainly with calcium (the most abundant), phosphate and magnesium, for it is essential an adequate dietary intake of Ca, phosphorus and vitamin D. The ionic Ca (Ca2+) is essential to maintain and / or perform different specialized functions of, virtually, all body cells cellular. Because of its important functions Ca2+ must be closely regulated, keeping plasma concentrations within narrow ranges. For this reason there is an accurate response against hypocalcemia or hypercalcemia in which the parathormone, calcitriol, calcitonin and vitamin K are involved. Ca intakes in the Spanish population are low in a significant percentage of the older adult’s population, especially in women. The main source of Ca in the diet is milk and milk derivatives. Green leafy vegetables, fruits and legumes can be important sources of Ca in a Mediterranean dietary pattern. The bioavailability of dietary Ca depends on physiological and dietary factors. Physiological include age, physiological status (gestation and lactation) Ca and vitamin D status and disease. Several studies relate Ca intake in the diet and various diseases, such as osteoporosis, cancer, cardiovascular disease and obesity.

  2. Models of calcium signalling

    CERN Document Server

    Dupont, Geneviève; Kirk, Vivien; Sneyd, James

    2016-01-01

    This book discusses the ways in which mathematical, computational, and modelling methods can be used to help understand the dynamics of intracellular calcium. The concentration of free intracellular calcium is vital for controlling a wide range of cellular processes, and is thus of great physiological importance. However, because of the complex ways in which the calcium concentration varies, it is also of great mathematical interest.This book presents the general modelling theory as well as a large number of specific case examples, to show how mathematical modelling can interact with experimental approaches, in an interdisciplinary and multifaceted approach to the study of an important physiological control mechanism. Geneviève Dupont is FNRS Research Director at the Unit of Theoretical Chronobiology of the Université Libre de Bruxelles;Martin Falcke is head of the Mathematical Cell Physiology group at the Max Delbrück Center for Molecular Medicine, Berlin;Vivien Kirk is an Associate Professor in the Depar...

  3. Determination of percent calcium carbonate in calcium chromate

    International Nuclear Information System (INIS)

    Middleton, H.W.

    1979-01-01

    The precision, accuracy and reliability of the macro-combustion method is superior to the Knorr alkalimetric method, and it is faster. It also significantly reduces the calcium chromate waste accrual problem. The macro-combustion method has been adopted as the official method for determination of percent calcium carbonate in thermal battery grade anhydrous calcium chromate and percent calcium carbonate in quicklime used in the production of calcium chromate. The apparatus and procedure can be used to measure the percent carbonate in inorganic materials other than calcium chromate. With simple modifications in the basic apparatus and procedure, the percent carbon and hydrogen can be measured in many organic material, including polymers and polymeric formulations. 5 figures, 5 tables

  4. Calcium oxalate stone and gout.

    Science.gov (United States)

    Marickar, Y M Fazil

    2009-12-01

    Gout is well known to be produced by increased uric acid level in blood. The objective of this paper is to assess the relationship between gout and calcium oxalate stone formation in the humans. 48 patients with combination of gout and calcium oxalate stone problem were included. The biochemical values of this group were compared with 38 randomly selected uric acid stone patients with gout, 43 stone patients with gout alone, 100 calcium oxalate stone patients without gout and 30 controls, making a total of 259 patients. Various biochemical parameters, namely serum calcium, phosphorus and uric acid and 24-h urine calcium, phosphorus, uric acid, oxalate, citrate and magnesium were analysed. ANOVA and Duncan's multiple-range tests were performed to assess statistical significance of the variations. The promoters of stone formation, namely serum calcium (P stone patients and gouty calcium oxalate stone patients compared to the non-gouty patients and controls. Urine oxalate (P stones patients. The inhibitor urine citrate (P stone gouty patients, followed by the gouty uric acid stone formers and gouty calcium oxalate stone patients. The high values of promoters, namely uric acid and calcium in the gouty stone patients indicate the tendency for urinary stone formation in the gouty stone patients. There is probably a correlation between gout and calcium oxalate urinary stone. We presume this mechanism is achieved through the uric acid metabolism. The findings point to the summation effect of metabolic changes in development of stone disease.

  5. Calcium Signaling in Taste Cells

    Science.gov (United States)

    Medler, Kathryn F.

    2014-01-01

    The sense of taste is a common ability shared by all organisms and is used to detect nutrients as well as potentially harmful compounds. Thus taste is critical to survival. Despite its importance, surprisingly little is known about the mechanisms generating and regulating responses to taste stimuli. All taste responses depend on calcium signals to generate appropriate responses which are relayed to the brain. Some taste cells have conventional synapses and rely on calcium influx through voltage-gated calcium channels. Other taste cells lack these synapses and depend on calcium release to formulate an output signal through a hemichannel. Beyond establishing these characteristics, few studies have focused on understanding how these calcium signals are formed. We identified multiple calcium clearance mechanisms that regulate calcium levels in taste cells as well as a calcium influx that contributes to maintaining appropriate calcium homeostasis in these cells. Multiple factors regulate the evoked taste signals with varying roles in different cell populations. Clearly, calcium signaling is a dynamic process in taste cells and is more complex than has previously been appreciated. PMID:25450977

  6. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

    Science.gov (United States)

    Minor, Daniel L; Findeisen, Felix

    2010-01-01

    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  7. Alteração do teor de cálcio no banho de DP para 2,5 mEq/L é eficaz no reestabelecimento dos valores preconizados por diretrizes atuais em pacientes com PTH < 150 pg/dL Low-calcium peritoneal dialysis solution is effective in bringing PTH levels to the range recommended by current guidelines in patients with PTH levels < 150 pg/dL

    Directory of Open Access Journals (Sweden)

    Thyago Proença de Moraes

    2010-09-01

    Full Text Available INTRODUÇÃO/OBJETIVO: A doença óssea adinâmica (DOA é um achado comum em diálise peritoneal (PD e é considerada fator de risco para desenvolvimento de fraturas e doença cardiovascular. Dados do BRAZPD apontam as soluções de cálcio a 3,5 mEq/L presentes na maioria das prescrições no país, que possui quase 9.000 pacientes em PD. É comum o balanço positivo de cálcio com concentrações a 3,5 mEq/L contribuindo para o desenvolvimento de DOA. Diretrizes atuais recomendam um PTHi na DRC V em diálise entre 2 e 9 vezes (150-500 pg/mL o valor máximo da normalidade. O objetivo deste estudo foi avaliar a resposta em 6 meses do PTH-i após a conversão para solução de cálcio a 2,5 mEq/L de pacientes que usavam soluções com cálcio a 3,5 mEq/L e com PTH-i basal INTRODUCTION/OBJECTIVE: Adinamic bone disease (ABD is a common finding in peritoneal dialysis (PD and is associated with higher risk of developing cardiovascular and bone disease. Data from BRAZPD indicates that 3.5 mEq/L calcium PD solutions represents the majority of PD prescriptions in the country. A positive calcium balance can contribute to ABD development. Currently guidelines suggest that PTH-i levels in end stage renal disease should be kept from 150-300 pg/mL. The purpose of this study is to evaluate 6 month PTH-i response after conversion to 2.5 mEq/L calcium PD solution in patients with baseline PTH-i levels < 150 pg/mL. METHODS: Prospective, observational study of all prevalent patients (at least 90 days on therapy on PD of a single Brazilian center from January 2008 to May 2009. Inclusion criteria (1 be in use of a PD solution with 3.5mEq/L of calcium; (2 baseline PTH leves < 150 pg/ mL. According to clinical practice patients could be switched to PD solutions with 2.5 mEq/L of calcium. RESULTS: 35 patients (age 62 ± 17 years were included. Of these 22 were converted to 2.5 mEq/L calcium solutions. Diabetic nephropathy (36% was the main cause of renal disease

  8. Recovery of calcium from the effluent of direct oxide reduction process

    International Nuclear Information System (INIS)

    Ferro, P.; Mishra, B.; Olson, D.L.; Moore, J.J.; Averill, W.A.

    1992-01-01

    This paper reports that the production of plutonium by Direct Oxide Reduction [DOR] process using calcium generates significant amount of contaminated waste as calcium oxide saturated calcium chloride salt mix with calcium oxide content of up to 15 wt. pct. Fused salt electrolysis of a simulated slat mix [CaCl 2 + 15 wt. pct. CaO] is being carried out to election calcium, which can be recycled to the DOR rector along with the calcium chloride salt or may be used in-situ in an combined DOR and electrowinning process. The technology will resolve a major contaminated waste disposal problem, besides improving the cost and process efficiency in radioactive metal production. The process is being optimized in terms of the calcium solubility, cell temperature, current density and cell design to maximize the current efficiency. Scattered information is available regarding the solubility of calcium in calcium chloride salt in the present of calcium oxide. The solubility has also been found to depend on the use of graphite as the anode material. A porous ceramic sheath is being used around the anode to prevent the dissolution of electrowon calcium as oxide or carbonate and to prevent the contamination of salt by the anodic carbon. The electrode reactions are affected by the electrolyte composition and its viscosity which varies with time in this process and, therefore, electrochemical impedance is being measured to understand this time-dependent mechanisms

  9. Cardiovascular Effects of Calcium Supplements

    Directory of Open Access Journals (Sweden)

    Ian R. Reid

    2013-07-01

    Full Text Available Calcium supplements reduce bone turnover and slow the rate of bone loss. However, few studies have demonstrated reduced fracture incidence with calcium supplements, and meta-analyses show only a 10% decrease in fractures, which is of borderline statistical and clinical significance. Trials in normal older women and in patients with renal impairment suggest that calcium supplements increase the risk of cardiovascular disease. To further assess their safety, we recently conducted a meta-analysis of trials of calcium supplements, and found a 27%–31% increase in risk of myocardial infarction, and a 12%–20% increase in risk of stroke. These findings are robust because they are based on pre-specified analyses of randomized, placebo-controlled trials and are consistent across the trials. Co-administration of vitamin D with calcium does not lessen these adverse effects. The increased cardiovascular risk with calcium supplements is consistent with epidemiological data relating higher circulating calcium concentrations to cardiovascular disease in normal populations. There are several possible pathophysiological mechanisms for these effects, including effects on vascular calcification, vascular cells, blood coagulation and calcium-sensing receptors. Thus, the non-skeletal risks of calcium supplements appear to outweigh any skeletal benefits, and are they appear to be unnecessary for the efficacy of other osteoporosis treatments.

  10. SR calcium handling and calcium after-transients in a rabbit model of heart failure

    NARCIS (Netherlands)

    Baartscheer, Antonius; Schumacher, Cees A.; Belterman, Charly N. W.; Coronel, Ruben; Fiolet, Jan W. T.

    2003-01-01

    Objective: After-depolarization associated arrhythmias are frequently observed in heart failure and associated with spontaneous calcium release from sarcoplasmic reticulum (SR), calcium after-transients. We hypothesize that disturbed SR calcium handling underlies calcium after-transients in heart

  11. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  12. 21 CFR 573.240 - Calcium periodate.

    Science.gov (United States)

    2010-04-01

    ... with calcium hydroxide or calcium oxide to form a substance consisting of not less than 60 percent by... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium periodate. 573.240 Section 573.240 Food... Additive Listing § 573.240 Calcium periodate. The food additive calcium periodate may be safely used in...

  13. 21 CFR 573.260 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium silicate. 573.260 Section 573.260 Food and... Listing § 573.260 Calcium silicate. Calcium silicate, including synthetic calcium silicate, may be safely used as an anticaking agent in animal feed, provided that the amount of calcium silicate does not...

  14. Impairment of mitochondrial calcium handling in a mtSOD1 cell culture model of motoneuron disease

    Directory of Open Access Journals (Sweden)

    Zippelius Annette

    2009-06-01

    Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons (MN in the brain stem and spinal cord. Intracellular disruptions of cytosolic and mitochondrial calcium have been associated with selective MN degeneration, but the underlying mechanisms are not well understood. The present evidence supports a hypothesis that mitochondria are a target of mutant SOD1-mediated toxicity in familial amyotrophic lateral sclerosis (fALS and intracellular alterations of cytosolic and mitochondrial calcium might aggravate the course of this neurodegenerative disease. In this study, we used a fluorescence charged cool device (CCD imaging system to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations in individual cells in an established cellular model of ALS. Results To gain insights into the molecular mechanisms of SOD1G93A associated motor neuron disease, we simultaneously monitored cytosolic and mitochondrial calcium concentrations in individual cells. Voltage – dependent cytosolic Ca2+ elevations and mitochondria – controlled calcium release mechanisms were monitored after loading cells with fluorescent dyes fura-2 and rhod-2. Interestingly, comparable voltage-dependent cytosolic Ca2+ elevations in WT (SH-SY5YWT and G93A (SH-SY5YG93A expressing cells were observed. In contrast, mitochondrial intracellular Ca2+ release responses evoked by bath application of the mitochondrial toxin FCCP were significantly smaller in G93A expressing cells, suggesting impaired calcium stores. Pharmacological experiments further supported the concept that the presence of G93A severely disrupts mitochondrial Ca2+ regulation. Conclusion In this study, by fluorescence measurement of cytosolic calcium and using simultaneous [Ca2+]i and [Ca2+]mito measurements, we are able to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations

  15. Calcium Occupancy of N-terminal Sites within Calmodulin Induces Inhibition of the Ryanodine Receptor Calcium Release Channel

    Energy Technology Data Exchange (ETDEWEB)

    Boschek, Curt B; Jones, Terry E; Squier, Thomas C; Bigelow, Diana J

    2007-08-01

    Calmodulin (CaM) regulates calcium release from intracellular stores in skeletal muscle through its association with the ryanodine receptor (RyR1) calcium release channel, where CaM association enhances channel opening at resting calcium levels and its closing at micromolar calcium levels associated with muscle contraction. A high-affinity CaM-binding sequence (RyRp) has been identified in RyR1, which corresponds to a 30-residue sequence (i.e., K3614 – N3643) located within the central portion of the primary sequence. However, it is currently unclear whether the identified CaM-binding sequence a) senses calcium over the physiological range of calcium-concentrations associated with RyR1 regulation or b) plays a structural role unrelated to the calcium-dependent modulation of RyR1 function. Therefore, we have measured the calcium-dependent activation of the individual domains of CaM in association with RyRp and their relationship to the CaM-dependent regulation of RyR1. These measurements utilize an engineered CaM, permitting the site-specific incorporation of N-(1-pyrene) maleimide at either T34C (PyN-CaM) or T110C (PyC-CaM) in the N- and C-domains, respectively. Consistent with prior measurements, we observe a high-affinity association between both apo- and calcium-activated CaM and RyRp. Upon association with RyRp, fluorescence changes in PyN-CaM or PyC-CaM permit the measurement of the calcium-activation of these individual domains. Fluorescence changes upon calcium-activation of PyC-CaM in association with RyRp are indicative of high-affinity calcium-dependent activation of the C-terminal domain of CaM bound to RyRp at resting calcium levels and the activation of the N-terminal domain at levels of calcium associated cellular activation. In comparison, occupancy of calcium-binding sites in the N-domain of CaM mirrors the calcium-dependence of RyR1 inhibition observed at activating calcium levels, where [Ca]1/2 = 4.3 0.4 μM, suggesting a direct regulation of Ry

  16. Presynaptic muscarinic receptors, calcium channels, and protein kinase C modulate the functional disconnection of weak inputs at polyinnervated neonatal neuromuscular synapses.

    Science.gov (United States)

    Santafe, M M; Garcia, N; Lanuza, M A; Tomàs, M; Besalduch, N; Tomàs, J

    2009-04-01

    We studied the relation among calcium inflows, voltage-dependent calcium channels (VDCC), presynaptic muscarinic acetylcholine receptors (mAChRs), and protein kinase C (PKC) activity in the modulation of synapse elimination. We used intracellular recording to determine the synaptic efficacy in dually innervated endplates of the levator auris longus muscle of newborn rats during axonal competition in the postnatal synaptic elimination period. In these dual junctions, the weak nerve terminal was potentiated by partially reducing calcium entry (P/Q-, N-, or L-type VDCC-specific block or 500 muM magnesium ions), M1- or M4-type selective mAChR block, or PKC block. Moreover, reducing calcium entry or blocking PKC or mAChRs results in unmasking functionally silent nerve endings that now recover neurotransmitter release. Our results show interactions between these molecules and indicate that there is a release inhibition mechanism based on an mAChR-PKC-VDCC intracellular cascade. When it is fully active in certain weak motor axons, it can depress ACh release and even disconnect synapses. We suggest that this mechanism plays a central role in the elimination of redundant neonatal synapses, because functional axonal withdrawal can indeed be reversed by mAChRs, VDCCs, or PKC block.

  17. 21 CFR 172.330 - Calcium pantothenate, calcium chloride double salt.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium pantothenate, calcium chloride double salt... FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.330 Calcium pantothenate, calcium chloride double salt. The food additive calcium chloride double salt of calcium pantothenate may...

  18. The Effects of Dietary Calcium and/or Iron Deficiency upon Murine Intestinal Calcium Binding Protein Activity and Calcium Absorption

    OpenAIRE

    McDonald, Catherine M.

    1980-01-01

    Iron deficiency has been shown to impair calcium absorption, leading to decreased bone mass. Vitamin D3-dependent calcium binding protein (CaBP) has been demonstrated to be necessary for the active transport of calcium in the intestine of numerous species. Iron deficiency might affect the activity of the calcium binding protein. Four experimental diets were formulated as follows: Diet 1, iron adequate, calcium adequate; Diet 2, iron deficient, calcium adequate; Diet 3, iron adequate, calci...

  19. Serum calcium and incident diabetes: an observational study and meta-analysis.

    Science.gov (United States)

    Sing, C W; Cheng, V K F; Ho, D K C; Kung, A W C; Cheung, B M Y; Wong, I C K; Tan, K C B; Salas-Salvadó, J; Becerra-Tomas, N; Cheung, C L

    2016-05-01

    The study aimed to prospectively evaluate if serum calcium is related to diabetes incidence in Hong Kong Chinese. The results showed that serum calcium has a significant association with increased risk of diabetes. The result of meta-analysis reinforced our findings. This study aimed to evaluate the association of serum calcium, including serum total calcium and albumin-corrected calcium, with incident diabetes in Hong Kong Chinese. We conducted a retrospective cohort study in 6096 participants aged 20 or above and free of diabetes at baseline. Serum calcium was measured at baseline. Incident diabetes was determined from several electronic databases. We also searched relevant databases for studies on serum calcium and incident diabetes and conducted a meta-analysis using fixed-effect modeling. During 59,130.9 person-years of follow-up, 631 participants developed diabetes. Serum total calcium and albumin-corrected calcium were associated with incident diabetes in the unadjusted model. After adjusting for demographic and clinical variables, the association remained significant only for serum total calcium (hazard ratio (HR), 1.32 (95 % confidence interval (CI), 1.02-1.70), highest vs. lowest quartile). In a meta-analysis of four studies including the current study, both serum total calcium (pooled risk ratio (RR), 1.38 (95 % CI, 1.15-1.65); I (2) = 5 %, comparing extreme quantiles) and albumin-corrected calcium (pooled RR, 1.29 (95 % CI, 1.03-1.61); I (2) = 0 %, comparing extreme quantiles) were associated with incident diabetes. Penalized regression splines showed that the association of incident diabetes with serum total calcium and albumin-correlated calcium was non-linear and linear, respectively. Elevated serum calcium concentration is associated with incident diabetes. The mechanism underlying this association warrants further investigation.

  20. Calcium, vitamin D, and your bones

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000490.htm Calcium, vitamin D, and your bones To use the sharing ... and maintain strong bones. How Much Calcium and Vitamin D do I Need? Amounts of calcium are ...

  1. Calcium Supplements: Do Men Need Them Too?

    Science.gov (United States)

    ... Lifestyle Nutrition and healthy eating Should men take calcium supplements? Answers from Katherine Zeratsky, R.D., L. ... Most healthy men don't need to take calcium supplements. Calcium is important for men for optimal ...

  2. Calcium transport in turtle bladder

    International Nuclear Information System (INIS)

    Sabatini, S.; Kurtzman, N.A.

    1987-01-01

    Unidirectional 45 Ca fluxes were measured in the turtle bladder under open-circuit and short-circuit conditions. In the open-circuited state net calcium flux (J net Ca ) was secretory (serosa to mucosa). Ouabain reversed J net Ca to an absorptive flux. Amiloride reduced both fluxes such that J net Ca was not significantly different from zero. Removal of mucosal sodium caused net calcium absorption; removal of serosal sodium caused calcium secretion. When bladders were short circuited, J net Ca decreased to approximately one-third of control value but remained secretory. When ouabain was added under short-circuit conditions, J net Ca was similar in magnitude and direction to ouabain under open-circuited conditions (i.e., absorptive). Tissue 45 Ca content was ≅30-fold lower when the isotope was placed in the mucosal bath, suggesting that the apical membrane is the resistance barrier to calcium transport. The results obtained in this study are best explained by postulating a Ca 2+ -ATPase on the serosa of the turtle bladder epithelium and a sodium-calcium antiporter on the mucosa. In this model, the energy for calcium movement would be supplied, in large part, by the Na + -K + -ATPase. By increasing cell sodium, ouabain would decrease the activity of the mucosal sodium-calcium exchanger (or reverse it), uncovering active calcium transport across the serosa

  3. Calcium chromate process related investigations

    International Nuclear Information System (INIS)

    Dillard, B.M.

    1979-01-01

    A pilot plant for production of calcium chromate has been scaled up to a small production facility at the General Electric Neutron Devices Department. In preparation for this scale-up, the process and final product were studied in order to evaluate problems not considered previously. The variables and processes studied included: (1) the determination of optimum drying temperature and time for product analysis; (2) the effect of the grade of lime used as the precipitating agent on the purity of the calcium chromate; (3) product purity when calcium chromate is precipitated by the addition of ammonium chromate to slaked lime; (4) the reagents best suited for cleaning calcium chromate spills; and (5) methods for determining hydroxide ion concentration in calcium chromate. The optimum drying time for the product before analysis is four hours at 600 0 C. Gases evolved at various temperatures during the drying process were carbon dioxide and water vapor. Technical grade lime produced calcium chromate of the highest purity. Both nitric and acetic acids were efficient dissolvers of calcium chromate spills. Direct titration of hydroxide ion with sulfuric acid gave an average recovery of 93% for samples spiked with calcium hydroxide. 1 figure, 17 tables

  4. L-type calcium channels play a crucial role in the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Wen, Li [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Wang, Yu [Department of Oncology, Xijing Hospital, Fourth Military Medical University, Xi' an 710032 (China); Wang, Huan [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Kong, Lingmin [Department of Fundamental Medicine, Cell Engineering Research Centre, Fourth Military Medical University, Xi' an 710032 (China); Zhang, Liang [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Chen, Xin [Department of General Dentistry, The 174th Hospital of Chinese PLA, Xiamen 361003 (China); Ding, Yin, E-mail: dingyin@fmmu.edu.cn [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China)

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer We detect the functional Ca{sup 2+} currents and mRNA expression of VDCC{sub L} in rMSCs. Black-Right-Pointing-Pointer Blockage of VDCC{sub L} exert antiproliferative and apoptosis-inducing effects on rMSCs. Black-Right-Pointing-Pointer Inhibiting VDCC{sub L} can suppress the ability of rMSCs to differentiate into osteoblasts. Black-Right-Pointing-Pointer {alpha}1C of VDCC{sub L} may be a primary functional subunit in VDCC{sub L}-regulating rMSCs. -- Abstract: L-type voltage-dependent Ca{sup 2+} channels (VDCC{sub L}) play an important role in the maintenance of intracellular calcium homeostasis, and influence multiple cellular processes. They have been confirmed to contribute to the functional activities of osteoblasts. Recently, VDCC{sub L} expression was reported in mesenchymal stem cells (MSCs), but the role of VDCC{sub L} in MSCs is still undetermined. The aim of this study was to determine whether VDCC{sub L} may be regarded as a new regulator in the proliferation and osteogenic differentiation of rat MSC (rMSCs). In this study, we examined functional Ca{sup 2+} currents (I{sub Ca}) and mRNA expression of VDCC{sub L} in rMSCs, and then suppressed VDCC{sub L} using nifedipine (Nif), a VDCC{sub L} blocker, to investigate its role in rMSCs. The proliferation and osteogenic differentiation of MSCs were analyzed by MTT, flow cytometry, alkaline phosphatase (ALP), Alizarin Red S staining, RT-PCR, and real-time PCR assays. We found that Nif exerts antiproliferative and apoptosis-inducing effects on rMSCs. ALP activity and mineralized nodules were significantly decreased after Nif treatment. Moreover, the mRNA levels of the osteogenic markers, osteocalcin (OCN), bone sialoprotein (BSP), and runt-related transcription factor 2 (Runx2), were also down-regulated. In addition, we transfected {alpha}1C-siRNA into the cells to further confirm the role of VDCC{sub L} in rMSCs, and a similar effect on osteogenesis was found. These

  5. Calcium addition in straw gasification

    DEFF Research Database (Denmark)

    Risnes, H.; Fjellerup, Jan Søren; Henriksen, Ulrik Birk

    2003-01-01

    The present work focuses on the influence of calcium addition in gasification. The inorganic¿organic element interaction as well as the detailed inorganic¿inorganic elements interaction has been studied. The effect of calcium addition as calcium sugar/molasses solutions to straw significantly...... affected the ash chemistry and the ash sintering tendency but much less the char reactivity. Thermo balance test are made and high-temperature X-ray diffraction measurements are performed, the experimental results indicate that with calcium addition major inorganic¿inorganic reactions take place very late...... in the char conversion process. Comprehensive global equilibrium calculations predicted important characteristics of the inorganic ash residue. Equilibrium calculations predict the formation of liquid salt if sufficient amounts of Ca are added and according to experiments as well as calculations calcium binds...

  6. First Quantification of Calcium Intake from Calcium-Dense Dairy Products in Dutch Fracture Patients (The Delft Cohort Study

    Directory of Open Access Journals (Sweden)

    Peter van den Berg

    2014-06-01

    Full Text Available Recommendations for daily calcium intake from dairy products are variable and based on local consensus. To investigate whether patients with a recent fracture complied with these recommendations, we quantified the daily dairy calcium intake including milk, milk drinks, pudding, yoghurt, and cheese in a Dutch cohort of fracture patients and compared outcomes with recent data of a healthy U.S. cohort (80% Caucasians. An observational study analyzed dairy calcium intakes of 1526 female and 372 male Dutch fracture patients older than 50. On average, participants reported three dairy servings per day, independently of age, gender or population density. Median calcium intake from dairy was 790 mg/day in females and males. Based on dairy products alone, 11.3% of women and 14.2% of men complied with Dutch recommendations for calcium intake (adults ≤ 70 years: 1100 mg/day and >70 years: 1200 mg/day. After including 450 mg calcium from basic nutrition, compliance raised to 60.5% and 59.1%, respectively, compared to 53.2% in the U.S. cohort. Daily dairy calcium intake is not associated with femoral neck bone mineral density (BMD T-scores or WHO Fracture Assessment Tool (FRAX risk scores for major fracture or hip fracture. However, when sub analyzing the male cohort, these associations were weakly negative. The prevalence of maternal hip fracture was a factor for current fracture risks, both in women and men. While daily dairy calcium intake of Dutch fracture patients was well below the recommended dietary intake, it was comparable to intakes in a healthy U.S. cohort. This questions recommendations for adding more additional dairy products to preserve adult skeletal health, particularly when sufficient additional calcium is derived from adequate non-dairy nutrition.

  7. First quantification of calcium intake from calcium-dense dairy products in Dutch fracture patients (the Delft cohort study).

    Science.gov (United States)

    van den Berg, Peter; van Haard, Paul M M; van den Bergh, Joop P W; Niesten, Dieu Donné; van der Elst, Maarten; Schweitzer, Dave H

    2014-06-23

    Recommendations for daily calcium intake from dairy products are variable and based on local consensus. To investigate whether patients with a recent fracture complied with these recommendations, we quantified the daily dairy calcium intake including milk, milk drinks, pudding, yoghurt, and cheese in a Dutch cohort of fracture patients and compared outcomes with recent data of a healthy U.S. cohort (80% Caucasians). An observational study analyzed dairy calcium intakes of 1526 female and 372 male Dutch fracture patients older than 50. On average, participants reported three dairy servings per day, independently of age, gender or population density. Median calcium intake from dairy was 790 mg/day in females and males. Based on dairy products alone, 11.3% of women and 14.2% of men complied with Dutch recommendations for calcium intake (adults ≤ 70 years: 1100 mg/day and >70 years: 1200 mg/day). After including 450 mg calcium from basic nutrition, compliance raised to 60.5% and 59.1%, respectively, compared to 53.2% in the U.S. cohort. Daily dairy calcium intake is not associated with femoral neck bone mineral density (BMD) T-scores or WHO Fracture Assessment Tool (FRAX) risk scores for major fracture or hip fracture. However, when sub analyzing the male cohort, these associations were weakly negative. The prevalence of maternal hip fracture was a factor for current fracture risks, both in women and men. While daily dairy calcium intake of Dutch fracture patients was well below the recommended dietary intake, it was comparable to intakes in a healthy U.S. cohort. This questions recommendations for adding more additional dairy products to preserve adult skeletal health, particularly when sufficient additional calcium is derived from adequate non-dairy nutrition.

  8. Activation of L-type calcium channels is required for gap junction-mediated intercellular calcium signaling in osteoblastic cells

    DEFF Research Database (Denmark)

    Jørgensen, Niklas Rye; Teilmann, Stefan Cuoni; Henriksen, Zanne

    2003-01-01

    The propagation of mechanically induced intercellular calcium waves (ICW) among osteoblastic cells occurs both by activation of P2Y (purinergic) receptors by extracellular nucleotides, resulting in "fast" ICW, and by gap junctional communication in cells that express connexin43 (Cx43), resulting...... in "slow" ICW. Human osteoblastic cells transmit intercellular calcium signals by both of these mechanisms. In the current studies we have examined the mechanism of slow gap junction-dependent ICW in osteoblastic cells. In ROS rat osteoblastic cells, gap junction-dependent ICW were inhibited by removal...... of extracellular calcium, plasma membrane depolarization by high extracellular potassium, and the L-type voltage-operated calcium channel inhibitor, nifedipine. In contrast, all these treatments enhanced the spread of P2 receptor-mediated ICW in UMR rat osteoblastic cells. Using UMR cells transfected to express Cx...

  9. Single channel recording of a mitochondrial calcium uniporter.

    Science.gov (United States)

    Wu, Guangyan; Li, Shunjin; Zong, Guangning; Liu, Xiaofen; Fei, Shuang; Shen, Linda; Guan, Xiangchen; Yang, Xue; Shen, Yuequan

    2018-01-29

    Mitochondrial calcium uniporter (MCU) is the pore-forming subunit of the entire uniporter complex and plays an important role in mitochondrial calcium uptake. However, the single channel recording of MCU remains controversial. Here, we expressed and purified different MCU proteins and then reconstituted them into planar lipid bilayers for single channel recording. We showed that MCU alone from Pyronema omphalodes (pMCU) is active with prominent single channel Ca 2+ currents. In sharp contrast, MCU alone from Homo sapiens (hMCU) is inactive. The essential MCU regulator (EMRE) activates hMCU, and therefore, the complex (hMCU-hEMRE) shows prominent single channel Ca 2+ currents. These single channel currents are sensitive to the specific MCU inhibitor Ruthenium Red. Our results clearly demonstrate that active MCU can conduct large amounts of calcium into the mitochondria. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Evolution of the Calcium Paradigm: The Relation between Vitamin D, Serum Calcium and Calcium Absorption

    Directory of Open Access Journals (Sweden)

    Borje E. Christopher Nordin

    2010-09-01

    Full Text Available Osteoporosis is the index disease for calcium deficiency, just as rickets/osteomalacia is the index disease for vitamin D deficiency, but there is considerable overlap between them. The common explanation for this overlap is that hypovitaminosis D causes malabsorption of calcium which then causes secondary hyperparathyroidism and is effectively the same thing as calcium deficiency. This paradigm is incorrect. Hypovitaminosis D causes secondary hyperparathyroidism at serum calcidiol levels lower than 60 nmol/L long before it causes malabsorption of calcium because serum calcitriol (which controls calcium absorption is maintained until serum calcidiol falls below 20 nmol/L. This secondary hyperparathyroidism, probably due to loss of a “calcaemic” action of vitamin D on bone first described in 1957, destroys bone and explains why vitamin D insufficiency is a risk factor for osteoporosis. Vitamin D thus plays a central role in the maintenance of the serum (ionised calcium, which is more important to the organism than the preservation of the skeleton. Bone is sacrificed when absorbed dietary calcium does not match excretion through the skin, kidneys and bowel which is why calcium deficiency causes osteoporosis in experimental animals and, by implication, in humans.

  11. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  12. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Fault current limiter using bulk oxides superconductors

    International Nuclear Information System (INIS)

    Belmont, O.; Ferracci, P.; Porcar, L.; Barbut, J.M.; Tixador, P.; Noudem, J.G.; Bourgault, D.; Tournier, R.

    1998-01-01

    We study the limitation possibilities of bulk Bi high T c materials. For this we test these materials with AC or DC currents above their critical currents. We study particularly the evolution of the voltage with time or with current. The material, the value of the current and the time duration play important parts. For sintered Bi samples the voltage depends only on the current even for values much larger than the critical current. With textured samples the V(I) curves shows an hysteretic behaviour due to a warming up. The textured materials are more interesting than sintered ones in terms of required volume for the current limitation. In both cases the superconductors are in a dissipative state but not in the normal state. This state is nevertheless reached if the dissipated energy inside the sample is sufficient. We have tried to apply a magnetic field on the samples in order to trigger a more effective limitation. The voltage increases but with a limited effect for currents much higher (3-4 times) than the critical zero field current. We think that the dissipative state is due mainly to the grain boundaries which become resistive above the critical current. (orig.)

  15. Natural variations in calcium isotope composition as a monitor of bone mineral balance in humans.

    Science.gov (United States)

    Skulan, J.; Anbar, A.; Thomas, B.; Smith, S.

    2004-12-01

    The skeleton is the largest reservoir of calcium in the human body and is responsible for the short term control of blood levels of this element. Accurate measurement of changes in bone calcium balance is critical to understanding how calcium metabolism responds to physiological and environmental changes and, more specifically, to diagnosing and evaluating the effectiveness of treatments for osteoporosis and other serious calcium-related disorders. It is very difficult to measure bone calcium balance using current techniques, however, because these techniques rely either on separate estimates of bone resorption and formation that are not quantitatively comparable, or on complex and expensive studies of calcium kinetics using administered isotopic tracers. This difficulty is even more apparent and more severe for measurements of short-term changes in bone calcium balance that do not produce detectable changes in bone mineral density. Calcium isotopes may provide a novel means of addressing this problem. The foundation of this isotope application is the ca. 1.3 per mil fractionation of calcium during bone formation, favoring light calcium in the bone. This fractionation results in a steady-state isotopic offset between calcium in bone and calcium in soft tissues, blood and urine. Perturbations to this steady state due to changes in the net formation or resorption of bone should be reflected in changes in the isotopic composition of soft tissues and fluids. Here we present evidence that easily detectable shifts in the natural calcium isotope composition of human urine rapidly reflect changes in bone calcium balance. Urine from subjects in a 17-week bed rest study was analyzed for calcium isotopic composition. Bed rest promotes net resorption of bone, shifting calcium from bone to soft tissues, blood and urine. The calcium isotope composition of patients in this study shifted toward lighter values during bed rest, consistent with net resorption of isotopically

  16. Altered sarco(endo)plasmic reticulum calcium adenosine triphosphatase 2a content: Targets for heart failure therapy.

    Science.gov (United States)

    Liu, Gang; Li, Si Qi; Hu, Ping Ping; Tong, Xiao Yong

    2018-05-01

    Sarco(endo)plasmic reticulum calcium adenosine triphosphatase is responsible for transporting cytosolic calcium into the sarcoplasmic reticulum and endoplasmic reticulum to maintain calcium homeostasis. Sarco(endo)plasmic reticulum calcium adenosine triphosphatase is the dominant isoform expressed in cardiac tissue, which is regulated by endogenous protein inhibitors, post-translational modifications, hormones as well as microRNAs. Dysfunction of sarco(endo)plasmic reticulum calcium adenosine triphosphatase is associated with heart failure, which makes sarco(endo)plasmic reticulum calcium adenosine triphosphatase a promising target for heart failure therapy. This review summarizes current approaches to ameliorate sarco(endo)plasmic reticulum calcium adenosine triphosphatase function and focuses on phospholamban, an endogenous inhibitor of sarco(endo)plasmic reticulum calcium adenosine triphosphatase, pharmacological tools and gene therapies.

  17. Calcium release-dependent inactivation precedes formation of the tubular system in developing rat cardiac myocytes.

    Science.gov (United States)

    Macková, Katarina; Zahradníková, Alexandra; Hoťka, Matej; Hoffmannová, Barbora; Zahradník, Ivan; Zahradníková, Alexandra

    2017-12-01

    Developing cardiac myocytes undergo substantial structural and functional changes transforming the mechanism of excitation-contraction coupling from the embryonic form, based on calcium influx through sarcolemmal DHPR calcium channels, to the adult form, relying on local calcium release through RYR calcium channels of sarcoplasmic reticulum stimulated by calcium influx. We characterized day-by-day the postnatal development of the structure of sarcolemma, using techniques of confocal fluorescence microscopy, and the development of the calcium current, measured by the whole-cell patch-clamp in isolated rat ventricular myocytes. We characterized the appearance and expansion of the t-tubule system and compared it with the appearance and progress of the calcium current inactivation induced by the release of calcium ions from sarcoplasmic reticulum as structural and functional measures of direct DHPR-RYR interaction. The release-dependent inactivation of calcium current preceded the development of the t-tubular system by several days, indicating formation of the first DHPR-RYR couplons at the surface sarcolemma and their later spreading close to contractile myofibrils with the growing t-tubules. Large variability of both of the measured parameters among individual myocytes indicates uneven maturation of myocytes within the growing myocardium.

  18. TRIENNIAL LACTATION SYMPOSIUM/BOLFA: Serotonin and the regulation of calcium transport in dairy cows.

    Science.gov (United States)

    Hernandez, L L

    2017-12-01

    The mammary gland regulates maternal metabolism during lactation. Numerous factors within the tissue send signals to shift nutrients to the mammary gland for milk synthesis. Serotonin is a monoamine that has been well documented to regulate several aspects of lactation among species. Maintenance of maternal calcium homeostasis during lactation is a highly evolved process that is elegantly regulated by the interaction of the mammary gland with the bone, gut, and kidney tissues. It is well documented that dietary calcium is insufficient to maintain maternal calcium concentrations during lactation, and mammals must rely on bone resorption to maintain normocalcemia. Our recent work focused on the ability of the mammary gland to function as an accessory parathyroid gland during lactation. It was demonstrated that serotonin acts to stimulate parathyroid hormone-related protein (PTHrP) in the mammary gland during lactation. The main role of mammary-derived PTHrP during mammalian lactation is to stimulate bone resorption to maintain maternal calcium homeostasis during lactation. In addition to regulating PTHrP, it was shown that serotonin appears to directly affect calcium transporters and pumps in the mammary gland. Our current working hypothesis regarding the control of calcium during lactation is as follows: serotonin directly stimulates PTHrP production in the mammary gland through interaction with the sonic hedgehog signaling pathway. Simultaneously, serotonin directly increases calcium movement into the mammary gland and, subsequently, milk. These 2 direct actions of serotonin combine to induce a transient maternal hypocalcemia required to further stimulate PTHrP production and calcium mobilization from bone. Through these 2 routes, serotonin is able to improve maternal calcium concentrations. Furthermore, we have shown that Holstein and Jersey cows appear to regulate calcium in different manners and also respond differently to serotonergic stimulation of the calcium

  19. Calcium phosphate cement scaffolds with PLGA fibers.

    Science.gov (United States)

    Vasconcellos, Letícia Araújo; dos Santos, Luís Alberto

    2013-04-01

    The use of calcium phosphate-based biomaterials has revolutionized current orthopedics and dentistry in repairing damaged parts of the skeletal system. Among those biomaterials, the cement made of hydraulic grip calcium phosphate has attracted great interest due to its biocompatibility and hardening "in situ". However, these cements have low mechanical strength compared with the bones of the human body. In the present work, we have studied the attainment of calcium phosphate cement powders and their addition to poly (co-glycolide) (PLGA) fibers to increase mechanical properties of those cements. We have used a new method that obtains fibers by dripping different reagents. PLGA fibers were frozen after lyophilized. With this new method, which was patented, it was possible to obtain fibers and reinforcing matrix which furthered the increase of mechanical properties, thus allowing the attainment of more resistant materials. The obtained materials were used in the construction of composites and scaffolds for tissue growth, keeping a higher mechanical integrity. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Calcium and Calcium Supplements: Achieving the Right Balance

    Science.gov (United States)

    ... may have on heart attack risk. A similar controversy surrounds calcium and prostate cancer. Some studies have ... your agreement to the Terms and Conditions and Privacy Policy linked below. Terms and Conditions Privacy Policy ...

  1. Fast calcium transients translate the distribution and conduction of neural activity in different regions of a single sensory neuron.

    Science.gov (United States)

    Purali, Nuhan

    2017-09-01

    In the present study, cytosolic calcium concentration changes were recorded in response to various forms of excitations, using the fluorescent calcium indicator dye OG-BAPTA1 together with the current or voltage clamp methods in stretch receptor neurons of crayfish. A single action potential evoked a rise in the resting calcium level in the axon and axonal hillock, whereas an impulse train or a large saturating current injection would be required to evoke an equivalent response in the dendrite region. Under voltage clamp conditions, amplitude differences between axon and dendrite responses vanished completely. The fast activation time and the modulation of the response by extracellular calcium concentration changes indicated that the evoked calcium transients might be mediated by calcium entry into the cytosol through a voltage-gated calcium channel. The decay of the responses was slow and sensitive to extracellular sodium and calcium concentrations as well as exposure to 1-10 mM NiCl 2 and 10-500 µM lanthanum. Thus, a sodium calcium exchanger and a calcium ATPase might be responsible for calcium extrusion from the cytosol. Present results indicate that the calcium indicator OG-BAPTA1 might be an efficient but indirect way of monitoring regional membrane potential differences in a single neuron.

  2. Calcium signals in olfactory neurons.

    Science.gov (United States)

    Tareilus, E; Noé, J; Breer, H

    1995-11-09

    Laser scanning confocal microscopy in combination with the fluorescent calcium indicators Fluo-3 and Fura-Red was employed to estimate the intracellular concentration of free calcium ions in individual olfactory receptor neurons and to monitor temporal and spatial changes in the Ca(2+)-level upon stimulation. The chemosensory cells responded to odorants with a significant increase in the calcium concentration, preferentially in the dendritic knob. Applying various stimulation paradigma, it was found that in a population of isolated cells, subsets of receptor neurons display distinct patterns of responsiveness.

  3. Why Calcium? How Calcium Became the Best Communicator*

    OpenAIRE

    Carafoli, Ernesto; Krebs, Joachim

    2016-01-01

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations,...

  4. Isomorfic Substitutions of Calcium by Strontium in Calcium Hydroxyapatite

    International Nuclear Information System (INIS)

    Christensen, Hilbert

    1962-12-01

    By means of homogeneous precipitation it has been possible to synthesize crystalline solid solutions of calcium strontium hydroxyapatite from aqueous solutions. The lattice constants for the solid solutions were measured in the range Ca 9 Sr(PO 4 ) 6 (OH) 2 - CaSr 9 (PO 4 ) 6 (OH) 2 . The investigations show that the discrimination of strontium against calcium is considerably smaller than reported elsewhere (1). Strontium is preferentially built into the c-axis direction of the apatite lattice

  5. Influence of dietary calcium on bone calcium utilization

    International Nuclear Information System (INIS)

    Farmer, M.; Roland, D.A. Sr.; Clark, A.J.

    1986-01-01

    In Experiment 1, 10 microCi 45 Ca/day were administered to 125 hens for 10 days. Hens were then allocated to five treatments with calcium levels ranging from .08 to 3.75% of the diet. In Experiment 2, hens with morning oviposition times were randomly allocated to 11 treatments that were periods of time postoviposition ranging from 6 hr to 24 hr, in 2-hr increments (Experiment 2). At the end of each 2-hr period, eggs from 25 hens were removed from the uterus. The 18-, 20-, and 22-hr treatments were replicated three times. In Experiment 3, hens were fed either ad libitum or feed was withheld the last 5 or 6 hr before oviposition. In Experiment 4, hens were fed 10 microCi of 45 Ca for 15 days to label skeletal calcium. Hens were divided into two groups and fed a .08 or 3.75% calcium diet for 2 days. On the second day, 25 hens fed the 3.75% calcium diet were intubated with 7 g of the same diet containing .5 g calcium at 1700, 2100, 0100, 0500, and 0700 hr. The measurements used were egg weight, shell weight, and 45 Ca content of the egg shell. Results indicated a significant linear or quadratic regression of dietary calcium levels on 45 Ca accumulation in eggshells and eggshell weight (Experiment 1). As the calcium level of the diet increased, eggshell weight increased and 45 Ca recovery decreased. Utilization of skeletal calcium for shell formation ranged from 28 to 96%. In Experiment 2, the rate of shell calcification was not constant throughout the calcification process but varied significantly

  6. Anodic Behavior of Alloy 22 in Calcium Chloride and in Calcium Chloride Plus Calcium Nitrate Brines

    International Nuclear Information System (INIS)

    Evans, K.J.; Day, S.D.; Ilevbare, G.O.; Whalen, M.T.; King, K.J.; Hust, G.A.; Wong, L.L.; Estill, J.C.; Rebak, R.B.

    2003-01-01

    Alloy 22 (UNS N60622) is a nickel-based alloy, which is extensively used in aggressive industrial applications, especially due to its resistance to localized corrosion and stress corrosion cracking in high chloride environments. The purpose of this work was to characterize the anodic behavior of Alloy 22 in concentrated calcium chloride (CaCl 2 ) brines and to evaluate the inhibitive effect of nitrate, especially to localized corrosion. Standard electrochemical tests such as polarization resistance and cyclic polarization were used. Results show that the corrosion potential of Alloy 22 was approximately -360 mV in the silver-silver chloride (SSC) scale and independent of the tested temperature. Cyclic polarization tests showed that Alloy 22 was mainly susceptible to localized attack in 5 M CaCl 2 at 75 C and higher temperatures. The addition of nitrate in a molar ratio of chloride to nitrate equal to 10 increased the onset of localized corrosion to approximately 105 C. The addition of nitrate to the solution also decreased the uniform corrosion rate and the passive current of the alloy

  7. Gynura procumbens Merr. decreases blood pressure in rats by vasodilatation via inhibition of calcium channels

    Directory of Open Access Journals (Sweden)

    See-Ziau Hoe

    2011-01-01

    Full Text Available INTRODUCTION: Gynura procumbens has been shown to decrease blood pressure via inhibition of the angiotensinconverting enzyme. However, other mechanisms that may contribute to the hypotensive effect have not been studied. OBJECTIVES: To investigate the cardiovascular effects of a butanolic fraction of Gynura procumbens in rats. METHODS: Anaesthetized rats were given intravenous bolus injections of butanolic fraction at doses of 2.5-20 mg/kg in vivo. The effect of butanolic fraction on vascular reactivity was recorded in isolated rat aortic rings in vitro. RESULTS: Intravenous administrations of butanolic fraction elicited significant (p<0.001 and dose-dependent decreases in the mean arterial pressure. However, a significant (p<0.05 decrease in the heart rate was observed only at the higher doses (10 and 20 mg/kg. In isolated preparations of rat aortic rings, phenylephrine (1×10-6 M- or potassium chloride (8×10-2 M-precontracted endothelium-intact and -denuded tissue; butanolic fraction (1×10-6-1×10-1 g/ml induced similar concentration-dependent relaxation of the vessels. In the presence of 2.5×10-3 and 5.0×10-3 g/ml butanolic fraction, the contractions induced by phenylephrine (1×10-9-3×10-5 M and potassium chloride (1×10-2-8×10-2 M were significantly antagonized. The calcium-induced vasocontractions (1×10-4-1×10-2 M were antagonized by butanolic fraction concentration-dependently in calcium-free and high potassium (6×10-2 M medium, as well as in calcium- and potassium-free medium containing 1×10-6 M phenylephrine. However, the contractions induced by noradrenaline (1×10-6 M and caffeine (4.5×10-2 M were not affected by butanolic fraction. CONCLUSION: Butanolic fraction contains putative hypotensive compounds that appear to inhibit calcium influx via receptor-operated and/or voltage-dependent calcium channels to cause vasodilation and a consequent fall in blood pressure.

  8. Anodic and cathodic reactions in molten calcium chloride

    International Nuclear Information System (INIS)

    Fray, D.J.

    2002-01-01

    Calcium chloride is a very interesting electrolyte in that it is available, virtually free, in high purity form as a waste product from the chemical industry. It has a very large solubility for oxide ions, far greater than many alkali halides and other divalent halides and has the same toxicity as sodium chloride and also a very high solubility in water. Intuitively, on the passage of current, it is expected that calcium would be deposited at the cathode and chlorine would evolve at the anode. However, if calcium oxide is added to the melt, it is possible to deposit calcium and evolve oxygen containing gases at the anode, making the process far less polluting than when chlorine is evolved. This process is discussed in terms of the addition of calcium to molten lead. Furthermore, these reactions can be altered dramatically depending upon the electrode materials and the other ions dissolved in the calcium chloride. As calcium is only deposited at very negative cathodic potentials, there are several interesting cathodic reactions that can occur and these include the decomposition of the carbonate ion and the ionization of oxygen, sulphur, selenium and tellurium. For example, if an oxide is used as the cathode in molten calcium chloride, the favoured reaction is shown to be the ionization of oxygen O + 2e - → O 2- rather than Ca 2+ + 2 e- → Ca. The oxygen ions dissolve in the salt leaving the metal behind, and this leads to the interesting hypothesis that metal oxides can be reduced directly to the metal purely by the use of electrons. Examples are given for the reduction of titanium dioxide, zirconium dioxide, chromium oxide and niobium oxide and by mixing oxide powders together and reducing the mixed compact, alloys and intermetallic compounds are formed. Preliminary calculations indicate that this new process should be much cheaper than conventional metallothermic reduction for these elements. (author)

  9. 21 CFR 172.410 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium silicate. 172.410 Section 172.410 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Agents § 172.410 Calcium silicate. Calcium silicate, including synthetic calcium silicate, may be safely...

  10. A Crash Course in Calcium Channels.

    Science.gov (United States)

    Zamponi, Gerald W

    2017-12-20

    Much progress has been made in understanding the molecular physiology and pharmacology of calcium channels. Recently, there have been tremendous advances in learning about calcium channel structure and function through crystallography and cryo-electron microscopy studies. Here, I will give an overview of our knowledge about calcium channels, and highlight two recent studies that give important insights into calcium channel structure.

  11. Calcium-sensing beyond neurotransmitters

    DEFF Research Database (Denmark)

    Gustavsson, Natalia; Han, Weiping

    2009-01-01

    Neurotransmitters, neuropeptides and hormones are released through the regulated exocytosis of SVs (synaptic vesicles) and LDCVs (large dense-core vesicles), a process that is controlled by calcium. Synaptotagmins are a family of type 1 membrane proteins that share a common domain structure. Most....... Also, we discuss potential roles of synaptotagmins in non-traditional endocrine systems....... synaptotagmins are located in brain and endocrine cells, and some of these synaptotagmins bind to phospholipids and calcium at levels that trigger regulated exocytosis of SVs and LDCVs. This led to the proposed synaptotagmin-calcium-sensor paradigm, that is, members of the synaptotagmin family function...... as calcium sensors for the regulated exocytosis of neurotransmitters, neuropeptides and hormones. Here, we provide an overview of the synaptotagmin family, and review the recent mouse genetic studies aimed at understanding the functions of synaptotagmins in neurotransmission and endocrine-hormone secretion...

  12. Calcium phosphates for biomedical applications

    Directory of Open Access Journals (Sweden)

    Maria Canillas

    2017-05-01

    Full Text Available The history of calcium phosphates in the medicine field starts in 1769 when the first evidence of its existence in the bone tissue is discovered. Since then, the interest for calcium phosphates has increased among the scientific community. Their study has been developed in parallel with new advances in materials sciences, medicine or tissue engineering areas. Bone tissue engineering is the field where calcium phosphates have had a great importance. While the first bioceramics are selected according to bioinert, biocompatibility and mechanical properties with the aim to replace bone tissue damaged, calcium phosphates open the way to the bone tissue regeneration challenge. Nowadays, they are present in the majority of commercial products directed to repair or regenerate damaged bone tissue. Finally, in the last few decades, they have been suggested and studied as drug delivering devices and as vehicles of DNA and RNA for the future generation therapies.

  13. Functions of vitamin D / Calcium

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Excitation-contraction coupling,. Cardiac functions. Hormonal secretion. Control of enzymatic reactions. Mitotic division. Maintenance of cell integrity. Ciliary motility. Notes: Calcium is a vital second messenger.

  14. Calcium signals in planetary embryos

    Science.gov (United States)

    Morbidelli, Alessandro

    2018-03-01

    The calcium-isotope composition of planetary bodies in the inner Solar System correlates with the masses of such objects. This finding could have implications for our understanding of how the Solar System formed.

  15. Calcium homeostasis in diabetes mellitus.

    Science.gov (United States)

    Ahn, Changhwan; Kang, Ji-Houn; Jeung, Eui-Bae

    2017-09-30

    Diabetes mellitus (DM) is becoming a lifestyle-related pandemic disease. Diabetic patients frequently develop electrolyte disorders, especially diabetic ketoacidosis or nonketotic hyperglycemic hyperosmolar syndrome. Such patients show characteristic potassium, magnesium, phosphate, and calcium depletion. In this review, we discuss a homeostatic mechanism that links calcium and DM. We also provide a synthesis of the evidence in favor or against this linking mechanism by presenting recent clinical indications, mainly from veterinary research. There are consistent results supporting the use of calcium and vitamin D supplementation to reduce the risk of DM. Clinical trials support a marginal reduction in circulating lipids, and some meta-analyses support an increase in insulin sensitivity, following vitamin D supplementation. This review provides an overview of the calcium and vitamin D disturbances occurring in DM and describes the underlying mechanisms. Such elucidation will help indicate potential pathophysiology-based precautionary and therapeutic approaches and contribute to lowering the incidence of DM.

  16. Calcium phosphates for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Canillas, M.; Pena, P.; Aza, A.H. de; Rodriguez, M.A.

    2017-07-01

    The history of calcium phosphates in the medicine field starts in 1769 when the first evidence of its existence in the bone tissue is discovered. Since then, the interest for calcium phosphates has increased among the scientific community. Their study has been developed in parallel with new advances in materials sciences, medicine or tissue engineering areas. Bone tissue engineering is the field where calcium phosphates have had a great importance. While the first bioceramics are selected according to bioinert, biocompatibility and mechanical properties with the aim to replace bone tissue damaged, calcium phosphates open the way to the bone tissue regeneration challenge. Nowadays, they are present in the majority of commercial products directed to repair or regenerate damaged bone tissue. Finally, in the last few decades, they have been suggested and studied as drug delivering devices and as vehicles of DNA and RNA for the future generation therapies. (Author)

  17. Calcium signaling in liver.

    Science.gov (United States)

    Gaspers, Lawrence D; Thomas, Andrew P

    2005-01-01

    In hepatocytes, hormones linked to the formation of the second messenger inositol 1,4,5-trisphosphate (InsP3) evoke transient increases or spikes in cytosolic free calcium ([Ca2+]i), that increase in frequency with the agonist concentration. These oscillatory Ca2+ signals are thought to transmit the information encoded in the extracellular stimulus to down-stream Ca2+-sensitive metabolic processes. We have utilized both confocal and wide field fluorescence microscopy techniques to study the InsP3-dependent signaling pathway at the cellular and subcellular levels in the intact perfused liver. Typically InsP3-dependent [Ca2+]i spikes manifest as Ca2+ waves that propagate throughout the entire cytoplasm and nucleus, and in the intact liver these [Ca2+]i increases are conveyed through gap junctions to encompass entire lobular units. The translobular movement of Ca2+ provides a means to coordinate the function of metabolic zones of the lobule and thus, liver function. In this article, we describe the characteristics of agonist-evoked [Ca2+]i signals in the liver and discuss possible mechanisms to explain the propagation of intercellular Ca2+ waves in the intact organ.

  18. Does calcium influx regulate melatonin production through the circadian pacemaker in chick pineal cells? Effects of nitrendipine, Bay K 8644, Co2+, Mn2+, and low external Ca2+.

    Science.gov (United States)

    Zatz, M; Mullen, D A

    1988-11-01

    We have recently described a system, using dispersed chick pineal cells in static culture, which displays a persistent, photosensitive, circadian rhythm of melatonin production and release. Here, we describe the effects of nitrendipine (NTR) (a dihydropyridine 'antagonist' of L-type calcium channels), Bay K 8644 (BK) (a dihydropyridine calcium channel 'agonist'), cobalt and manganese ions (both inorganic calcium channel blockers), and low external calcium concentrations, on the melatonin rhythm. NTR inhibited and BK stimulated melatonin output; they were potent and effective. Co2+, Mn2+, and low external Ca2+ markedly inhibited melatonin output. These results support a role for calcium influx through voltage-dependent calcium channels (L-type) in the regulation of melatonin production. Four or 8 h pulses of white light or darkness, in otherwise constant red light, cause, in addition to acute effects, phase-dependent phase shifts of the melatonin rhythm in subsequent cycles. Such phase shifts indicate an effect on (proximal to) the pacemaker generating the rhythm. Four or 8 h pulses of NTR, BK, Co2+, or low Ca2+, however, did not appreciably alter the phase of subsequent melatonin cycles. Neither did BK interfere with phase shifts induced by light pulses. Mn2+ pulses did induce phase-dependent phase shifts, but, unlike those evoked by light or dark pulses, these were all delays. Such effects of Mn2+ in other systems have been attributed to, and are characteristic of, 'metabolic inhibitors'. On balance, the results fail to support a prominent role for calcium influx in regulating the pacemaker underlying the circadian rhythm in chick pineal cells. Rather, calcium influx appears to regulate melatonin production primarily by acting on the melatonin-synthesizing apparatus, distal to the pacemaker.

  19. Effects of diphosphonate on kidney calcium content and duodenal absorption of 45calcium

    International Nuclear Information System (INIS)

    Goulding, A.; Cameron, V.

    1978-01-01

    In rats the relationships between EHDP-induced changes in serum calcium concentration, kidney calcium content and duodenal transport of 45 calcium were studied. Body weights and kidney weights were similar in all groups. EHDP administration was associated with an increase in serum calcium concentration and kidney calcium content, and a decrease in duodenal 45 calcium transport. In the EHDP-treated rats, there was a significant negative correlation between kidney calcium concentration and duodenal 45 calcium transport but no correlation between either kidney calcium content and serum calcium concentration (r = 0.116) or between serum calcium concentration and duodenal 45 calcium transport (r = 0.02). Further experiments will be needed to determine whether the demonstrated increase in kidney calcium content induced by EHDP administration was the cause of, or was secondary to, inhibition of 1, 25(OH) 2 D 3 synthesis. (orig./AJ) [de

  20. Research of calcium oxide hydration in calcium nitrate solutions

    Directory of Open Access Journals (Sweden)

    M.A. Oliynyk

    2016-09-01

    Full Text Available Mineral fertilizers are one of the important factors of agriculture intensification and increasing of food products quantity. The volume of fertilizers production and its domestic consumption in Ukraine indicate that nitrogen fertilizer using only comes nearer to the required number of science-based. One of the most widespread artificial fertilizers is the calcium nitrate. Aim: The aim is to study and theoretically substantiate the processes occurring in the preparation of suspensions of calcium hydroxide Са(ОН2 in solution of calcium nitrate Ca(NО32. Materials and Methods: The technical calcium oxide (quicklime DSTU BV.2.7-90-99, solutions of calcium nitrate of 15, 20, 25, 30, 35 and 40% Ca(NО32 concentrations were used in the work. The content of lime in the preparation of a suspension in the solution changed (in terms of calcium oxide CaO from 150 g/dm3 to the maximum possible. Each of these solutions saturated at 40°С in lime to maximum concentration. Suitable for use in these experiments and in the technology of calcium nitrate obtaining are considered the solutions (suspensions that within 12 hours did not lose their mobility (transportability. Results: The experimental results show that increasing of the concentration of calcium nitrate in solution within the range 15...40%, the amount of lime that you can put into the solution without loss of transportability decreases. Further increasing of lime quantity in solutions concentrations causes to its solidifying, loss of mobility (transportability. Calculations showed that in the presence of calcium nitrate the solubility of Са(ОН2 is reduced nearly by order that can lead to the formation of calcium oxide CaO the solid phase Са(ОН2 on the surface, which also can form hydrogen bonds with the components of the solution. As the probability of formation of hydrogen bonds in solutions is high, there is a possibility of formation of clusters.

  1. Enzymatic pH Control for Biomimetic Deposition of Calcium Phosphate Coatings

    NARCIS (Netherlands)

    Nijhuis, A.W.; Reza Nejadnik, M.; Nudelman, F.; Walboomers, X.F.; te Riet, J.; Habibovic, Pamela; Tahmasebi Birgani, Zeinab; Yubao, L.; Bomans, P.H.H.; Jansen, J.A.; Sommerdijk, N.A.J.M.; Leeuwenburgh, S.C.G.

    2014-01-01

    The current study has focused on enzymatic decomposition of urea into carbon dioxide and ammonia as a means to increase the pH during biomimetic deposition of Calcium Phospate (CaP) onto implant surfaces. The kinetics of the enzymatically induced pH increase were studied by monitoring pH, calcium

  2. Enzymatic pH control for biomimetic depostion of calcium phosphate coatings

    NARCIS (Netherlands)

    Nijhuis, A.W.G.; Nejadnik, M.R.; Nudelman, F.; Walboomers, X.F.; Riet, te J.; Habibovic, P.; Birgani, Z.T.; Li, Y.B.; Bomans, P.H.H.; Jansen, J.A.; Sommerdijk, N.A.J.M.; Leeuwenburgh, S.C.G.

    2014-01-01

    The current study examines the enzymatic decomposition of urea into carbon dioxide and ammonia as a means to increase the pH during biomimetic deposition of calcium phospate (CaP) onto implant surfaces. The kinetics of the enzymatically induced pH increase were studied by monitoring pH, calcium

  3. Enzymatic pH control for biomimetic deposition of calcium phosphate coatings

    NARCIS (Netherlands)

    Nijhuis, A.W.G.; Nejadnik, M.R.; Nudelman, F.; Walboomers, X.F.; Riet, J. te; Habibovic, P.; Tahmasebi Birgani, Z.; Li, Y.; Bomans, P.H.; Jansen, J.A.; Sommerdijk, N.A.; Leeuwenburgh, S.C.G.

    2014-01-01

    The current study examines the enzymatic decomposition of urea into carbon dioxide and ammonia as a means to increase the pH during biomimetic deposition of calcium phosphate (CaP) onto implant surfaces. The kinetics of the enzymatically induced pH increase were studied by monitoring pH, calcium

  4. Calcium Orthophosphate Cements and Concretes

    Directory of Open Access Journals (Sweden)

    Sergey V. Dorozhkin

    2009-03-01

    Full Text Available In early 1980s, researchers discovered self-setting calcium orthophosphate cements, which are a bioactive and biodegradable grafting material in the form of a powder and a liquid. Both phases form after mixing a viscous paste that after being implanted, sets and hardens within the body as either a non-stoichiometric calcium deficient hydroxyapatite (CDHA or brushite, sometimes blended with unreacted particles and other phases. As both CDHA and brushite are remarkably biocompartible and bioresorbable (therefore, in vivo they can be replaced with newly forming bone, calcium orthophosphate cements represent a good correction technique for non-weight-bearing bone fractures or defects and appear to be very promising materials for bone grafting applications. Besides, these cements possess an excellent osteoconductivity, molding capabilities and easy manipulation. Furthermore, reinforced cement formulations are available, which in a certain sense might be described as calcium orthophosphate concretes. The concepts established by calcium orthophosphate cement pioneers in the early 1980s were used as a platform to initiate a new generation of bone substitute materials for commercialization. Since then, advances have been made in the composition, performance and manufacturing; several beneficial formulations have already been introduced as a result. Many other compositions are in experimental stages. In this review, an insight into calcium orthophosphate cements and concretes, as excellent biomaterials suitable for both dental and bone grafting application, has been provided.

  5. ATP- and gap junction-dependent intercellular calcium signaling in osteoblastic cells

    DEFF Research Database (Denmark)

    Jorgensen, N R; Geist, S T; Civitelli, R

    1997-01-01

    mechanically induced calcium waves in two rat osteosarcoma cell lines that differ in the gap junction proteins they express, in their ability to pass microinjected dye from cell to cell, and in their expression of P2Y2 (P2U) purinergic receptors. ROS 17/2.8 cells, which express the gap junction protein......Many cells coordinate their activities by transmitting rises in intracellular calcium from cell to cell. In nonexcitable cells, there are currently two models for intercellular calcium wave propagation, both of which involve release of inositol trisphosphate (IP3)- sensitive intracellular calcium...... stores. In one model, IP3 traverses gap junctions and initiates the release of intracellular calcium stores in neighboring cells. Alternatively, calcium waves may be mediated not by gap junctional communication, but rather by autocrine activity of secreted ATP on P2 purinergic receptors. We studied...

  6. Effect of substrate nature on the electrochemical deposition of calcium-deficient hydroxyapatites

    Science.gov (United States)

    Gualdrón-Reyes, A. F.; Domínguez-Vélez, V.; Morales-Morales, J. A.; Cabanzo, R.; Meléndez, A. M.

    2017-01-01

    Calcium phosphates were obtained by reducing nitrate ions to produce hydroxide ions on TiO2/stainless steel and TiO2/titanium electrodes. TiO2 coatings on metallic substrates were prepared by sol-gel dip-coating method. The morphology of deposits was observed by FESEM. Chemical nature of calcium phosphate deposits was identified by Raman micro-spectroscopy and FESEM/EDS microanalysis. Electrochemical behavior of nitrate and nitrite reduction on stainless steel and titanium electrodes was studied by linear sweep voltammetry. In addition, voltammetric study of the calcium phosphate electrodeposition on both electrodes was performed. From these measurements was selected the potential to form a calcium phosphate. A catalytic current associated to nitrate reduction reaction was obtained for stainless steel electrode, leading to significant deposition of calcium phosphate. Ca/P ratio for both substrates was less than 1.67. The formation of calcium deficient hydroxyapatite was confirmed by Raman spectroscopy.

  7. Effect of substrate nature on the electrochemical deposition of calcium-deficient hydroxyapatites

    International Nuclear Information System (INIS)

    Gualdrón-Reyes, A F; Cabanzo, R; Meléndez, A M; Domínguez-Vélez, V; Morales-Morales, J A

    2017-01-01

    Calcium phosphates were obtained by reducing nitrate ions to produce hydroxide ions on TiO 2 /stainless steel and TiO 2 /titanium electrodes. TiO 2 coatings on metallic substrates were prepared by sol-gel dip-coating method. The morphology of deposits was observed by FESEM. Chemical nature of calcium phosphate deposits was identified by Raman micro-spectroscopy and FESEM/EDS microanalysis. Electrochemical behavior of nitrate and nitrite reduction on stainless steel and titanium electrodes was studied by linear sweep voltammetry. In addition, voltammetric study of the calcium phosphate electrodeposition on both electrodes was performed. From these measurements was selected the potential to form a calcium phosphate. A catalytic current associated to nitrate reduction reaction was obtained for stainless steel electrode, leading to significant deposition of calcium phosphate. Ca/P ratio for both substrates was less than 1.67. The formation of calcium deficient hydroxyapatite was confirmed by Raman spectroscopy. (paper)

  8. 21 CFR 184.1207 - Calcium lactate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium lactate. 184.1207 Section 184.1207 Food and... Substances Affirmed as GRAS § 184.1207 Calcium lactate. (a) Calcium lactate (C6H10CaO6.xH2O, where x is any... calcium carbonate or calcium hydroxide. (b) The ingredient meets the specifications of the Food Chemicals...

  9. Control of local intracellular calcium concentration with dynamic-clamp controlled 2-photon uncaging.

    Directory of Open Access Journals (Sweden)

    Erwin Idoux

    Full Text Available The variations of the intracellular concentration of calcium ion ([Ca(2+](i are at the heart of intracellular signaling, and their imaging is therefore of enormous interest. However, passive [Ca(2+](i imaging provides no control over these variations, meaning that a full exploration of the functional consequences of [Ca(2+](i changes is difficult to attain. The tools designed so far to modify [Ca(2+](i, even qualitatively, suffer drawbacks that undermine their widespread use. Here, we describe an electro-optical technique to quantitatively set [Ca(2+](i, in real time and with sub-cellular resolution, using two-photon Ca(2+ uncaging and dynamic-clamp. We experimentally demonstrate, on neurons from acute olfactory bulb slices of Long Evans rats, various capabilities of this technique previously difficult to achieve, such as the independent control of the membrane potential and [Ca(2+](i variations, the functional knocking-in of user-defined virtual voltage-dependent Ca(2+ channels, and the standardization of [Ca(2+](i patterns across different cells. Our goal is to lay the groundwork for this technique and establish it as a new and versatile tool for the study of cell signaling.

  10. Inhibition of GluR Current in Microvilli of Sensory Neurons via Na+-Microdomain Coupling Among GluR, HCN Channel, and Na+/K+ Pump

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kawasaki

    2018-04-01

    Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.

  11. Why Calcium? How Calcium Became the Best Communicator*

    Science.gov (United States)

    Carafoli, Ernesto; Krebs, Joachim

    2016-01-01

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations, e.g. magnesium. Its free concentration within cells can thus be maintained at the very low levels demanded by the signaling function. A large cadre of proteins has evolved to bind or transport calcium. They all contribute to buffer it within cells, but a number of them also decode its message for the benefit of the target. The most important of these “calcium sensors” are the EF-hand proteins. Calcium is an ambivalent messenger. Although essential to the correct functioning of cell processes, if not carefully controlled spatially and temporally within cells, it generates variously severe cell dysfunctions, and even cell death. PMID:27462077

  12. Why Calcium? How Calcium Became the Best Communicator.

    Science.gov (United States)

    Carafoli, Ernesto; Krebs, Joachim

    2016-09-30

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations, e.g. magnesium. Its free concentration within cells can thus be maintained at the very low levels demanded by the signaling function. A large cadre of proteins has evolved to bind or transport calcium. They all contribute to buffer it within cells, but a number of them also decode its message for the benefit of the target. The most important of these "calcium sensors" are the EF-hand proteins. Calcium is an ambivalent messenger. Although essential to the correct functioning of cell processes, if not carefully controlled spatially and temporally within cells, it generates variously severe cell dysfunctions, and even cell death. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Testosterone increases urinary calcium excretion and inhibits expression of renal calcium transport proteins.

    NARCIS (Netherlands)

    Hsu, Y.J.; Dimke, H.; Schoeber, J.P.H.; Hsu, S.C.; Lin, S.H.; Chu, P.; Hoenderop, J.G.J.; Bindels, R.J.M.

    2010-01-01

    Although gender differences in the renal handling of calcium have been reported, the overall contribution of androgens to these differences remains uncertain. We determined here whether testosterone affects active renal calcium reabsorption by regulating calcium transport proteins. Male mice had

  14. Calcium: the molecular basis of calcium action in biology and medicine

    National Research Council Canada - National Science Library

    Pochet, Roland; Donato, Rosario

    2000-01-01

    ... of Calcium Calcium Signalling in Excitable Cells Ca2+ Release in Muscle Cells by N. Macrez and J. Mironneau Calcium Signalling in Neurons Exemplified by Rat Sympathetic Ganglion Cells by S.J. M...

  15. Coronary artery calcium in breast cancer survivors after radiation therapy

    NARCIS (Netherlands)

    Takx, Richard A P; Vliegenthart, Rozemarijn; Schoepf, U Joseph; Pilz, Lothar R; Schoenberg, Stefan O; Morris, Pamela B; Henzler, Thomas; Apfaltrer, Paul

    The purpose of the current study is to investigate whether breast cancer survivors after radiation therapy have a higher burden of coronary artery calcium as a potential surrogate of radiation-induced accelerated coronary artery disease. 333 patients were included. 54 patients underwent chest CT ae

  16. The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

    2016-07-11

    Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

  17. Stochastic Simulation of Cardiac Ventricular Myocyte Calcium Dynamics and Waves

    OpenAIRE

    Tuan, Hoang-Trong Minh; Williams, George S. B.; Chikando, Aristide C.; Sobie, Eric A.; Lederer, W. Jonathan; Jafri, M. Saleet

    2011-01-01

    A three dimensional model of calcium dynamics in the rat ventricular myocyte was developed to study the mechanism of calcium homeostasis and pathological calcium dynamics during calcium overload. The model contains 20,000 calcium release units (CRUs) each containing 49 ryanodine receptors. The model simulates calcium sparks with a realistic spontaneous calcium spark rate. It suggests that in addition to the calcium spark-based leak, there is an invisible calcium leak caused by the stochastic ...

  18. Lead in calcium supplements (abstract)

    International Nuclear Information System (INIS)

    Rehman, S.; Khalid, N.

    2011-01-01

    Lead present in calcium supplements is of grave concern as some lead levels have been measured up to the extent of regulatory limit set by the United States. Calcium supplements inevitably get contaminated with lead as both are naturally occurring elements. Therefore, it is imperative to indicate its level in these supplements in order to create awareness among consumers. In this study, a sophisticated analytical technique, atomic absorption spectrometry was used to analyze Pb contents in 27 commonly consumed Ca supplements manufactured by different national and multinational companies. The daily intake of lead through these supplements was calculated. Only 10% of the calcium supplements analyzed met the criteria of acceptable Pb levels (1.5 mu g/daily dose) in supplements/consumer products set by the United States. It was also found that Pb intake was highest in chelated calcium supplements 28.5 mu g/daily dose, whereas lowest 0.47 mu g/daily dose through calcium supplements with vitamin D formulation. In order to validate our results from the study conducted, IAEA-certified reference material (animal bone, H-5) was analyzed for its Pb levels. The levels of Pb determined were quite in good agreement with the certified values. (author)

  19. Isomorfic Substitutions of Calcium by Strontium in Calcium Hydroxyapatite

    Energy Technology Data Exchange (ETDEWEB)

    Christensen, Hilbert

    1962-12-15

    By means of homogeneous precipitation it has been possible to synthesize crystalline solid solutions of calcium strontium hydroxyapatite from aqueous solutions. The lattice constants for the solid solutions were measured in the range Ca{sub 9}Sr(PO{sub 4}){sub 6}(OH){sub 2} - CaSr{sub 9}(PO{sub 4}){sub 6}(OH){sub 2}. The investigations show that the discrimination of strontium against calcium is considerably smaller than reported elsewhere (1). Strontium is preferentially built into the c-axis direction of the apatite lattice.

  20. Discovery of the calcium, indium, tin, and platinum isotopes

    International Nuclear Information System (INIS)

    Amos, S.; Gross, J.L.; Thoennessen, M.

    2011-01-01

    Currently, twenty-four calcium, thirty-eight indium, thirty-eight tin, and thirty-nine platinum isotopes have been observed and the discovery of these isotopes is discussed here. For each isotope a brief synopsis of the first refereed publication, including the production and identification method, is presented. - Highlights: Documentation of the discovery of all calcium, indium, tin and platinum isotopes. → Summary of author, journal, year, place and country of discovery for each isotope. → Brief description of discovery history of each isotope.

  1. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  2. Calcium stable isotope geochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Gausonne, Nikolaus [Muenster Univ. (Germany). Inst. fuer Mineralogie; Schmitt, Anne-Desiree [Strasbourg Univ. (France). LHyGeS/EOST; Heuser, Alexander [Bonn Univ. (Germany). Steinmann-Inst. fuer Geologie, Mineralogie und Palaeontologie; Wombacher, Frank [Koeln Univ. (Germany). Inst. fuer Geologie und Mineralogie; Dietzel, Martin [Technische Univ. Graz (Austria). Inst. fuer Angewandte Geowissenschaften; Tipper, Edward [Cambridge Univ. (United Kingdom). Dept. of Earth Sciences; Schiller, Martin [Copenhagen Univ. (Denmark). Natural History Museum of Denmark

    2016-08-01

    This book provides an overview of the fundamentals and reference values for Ca stable isotope research, as well as current analytical methodologies including detailed instructions for sample preparation and isotope analysis. As such, it introduces readers to the different fields of application, including low-temperature mineral precipitation and biomineralisation, Earth surface processes and global cycling, high-temperature processes and cosmochemistry, and lastly human studies and biomedical applications. The current state of the art in these major areas is discussed, and open questions and possible future directions are identified. In terms of its depth and coverage, the current work extends and complements the previous reviews of Ca stable isotope geochemistry, addressing the needs of graduate students and advanced researchers who want to familiarize themselves with Ca stable isotope research.

  3. Calcium stable isotope geochemistry

    International Nuclear Information System (INIS)

    Gausonne, Nikolaus; Schmitt, Anne-Desiree; Heuser, Alexander; Wombacher, Frank; Dietzel, Martin; Tipper, Edward; Schiller, Martin

    2016-01-01

    This book provides an overview of the fundamentals and reference values for Ca stable isotope research, as well as current analytical methodologies including detailed instructions for sample preparation and isotope analysis. As such, it introduces readers to the different fields of application, including low-temperature mineral precipitation and biomineralisation, Earth surface processes and global cycling, high-temperature processes and cosmochemistry, and lastly human studies and biomedical applications. The current state of the art in these major areas is discussed, and open questions and possible future directions are identified. In terms of its depth and coverage, the current work extends and complements the previous reviews of Ca stable isotope geochemistry, addressing the needs of graduate students and advanced researchers who want to familiarize themselves with Ca stable isotope research.

  4. Electrophysical properties of calcium vanadates

    International Nuclear Information System (INIS)

    Krasnenko, T.I.; Fotiev, A.A.

    1983-01-01

    Electrophysical properties of calcium vanadates are studied for the case of alteration of external parameters of the medium (PO 2 , T). It is lshown that structural transformations bring about changes in the nature of electrophysical properties of Ca 2 V 2 O 7 , Ca 3 (VO 4 ) 2 , this being the reason for charge redistribution in anion groupings. It is obvious, that the general conductivity of calcium methavanadate is mainly caused by ion transport. Ca(VO 3 ) 2 possesses amphoteric character of semiconducting properties: the type of conductivity changes from ''p'' to ''n'' with temperature increase. Polytherms of conductivity and sums of ion numbers of Ca 2 V 2 O 7 transition are given. It is established that calcium pyrovanadate has a mixed electron-ion conductivity

  5. Preparation of calcium phosphate paste

    International Nuclear Information System (INIS)

    Mohd Reusmaazran Yusof; Norzita Yaacob; Idris Besar; Che Seman Mahmood; Rusnah Mustafa

    2010-01-01

    Calcium phosphate paste were prepared by mixing between calcium sodium potassium phosphate, Ca 2 NaK (PO 4 ) 2 (CSPP) and monocalcium phosphate monohydrate, Ca(H 2 PO 4 ) 2 .H 2 O (MCPM). CSPP were obtained by reaction between calcium hydrogen phosphate (CaHPO 4 ), potassium carbonate (K 2 CO 3 ) and sodium carbonate (Na 2 CO 3 ) in solid state sintering process followed by quenching in air at 1000 degree Celsius. The paste was aging in simulated body fluid (SBF) for 0.5, 1, 3, 6, 12, 24, 48 hrs, 3, 7 and 14 days. The morphological investigation indicated the formation of apatite crystal were first growth after 24 hours. The obvious growth of apatite crystal was shown at 3 days. The obvious growth of apatite crystal was shown in 7 and 14 days indicated the prediction of paste would have rapid reaction with bone after implantation. (author)

  6. Model of Inclusion Evolution During Calcium Treatment in the Ladle Furnace

    Science.gov (United States)

    Tabatabaei, Yousef; Coley, Kenneth S.; Irons, Gordon A.; Sun, Stanley

    2018-04-01

    Calcium treatment of steel is typically employed to modify alumina inclusions to liquid calcium aluminates. However, injected calcium also reacts with the dissolved sulfur to form calcium sulfide. The current work aims to develop a kinetic model for the evolution of oxide and sulfide inclusions in Al-killed alloyed steel during Ca treatment in the ladle refining process. The model considers dissolution of the calcium from the calcium bubbles into the steel and reduction of calcium oxide in the slag to dissolved calcium. A steel-inclusion kinetic model is used for mass transfer to the inclusion interface and diffusion within the calcium aluminate phases formed on the inclusion. The inclusion-steel kinetic model is then coupled with a previously developed steel-slag kinetic model. The coupled inclusion-steel-slag kinetic model is applied to the chemical composition changes in molten steel, slag, and evolution of inclusions in the ladle. The result of calculations is found to agree well with an industrial heat for species in the steel as well as inclusions during Ca treatment.

  7. Calcium determination in bone by proton activation analysis. Progress report

    International Nuclear Information System (INIS)

    Wilson, R.; Adelstein, S.

    1974-01-01

    The incidence of post-menopausal osteoporosis in almost epidemic proportions makes the early diagnosis and development of effective therapy a matter of considerable concern. Current status of the project is reviewed and new applications of calcium determination by in vivo proton activation analysis are discussed. The proton activation method promises to give precise and reproducible measurements of calcium content for a single vertebra or several vertebrae in vivo. By controlling the number and energy of protons incident on a vertebra and by accurately detecting the number of 2.17 MeV gamma rays emitted, one may determine the 40Ca content. The proton technique offers advantages by directly measuring calcium in a very well-defined region. On-going studies by the construction of a lead shield for in vivo counting and for the analysis of the results are also given

  8. Uptake of radiactive calcium by groundnut (Arachis hypogaea L. ) and efficiency of utilisation of applied calcium

    Energy Technology Data Exchange (ETDEWEB)

    Loganathan, S; Krishnamoorthy, K K [Tamil Nadu Agricultural Univ., Coimbatore (India). Dept. of Soil Science and Agricultural Chemistry

    1977-04-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium.

  9. Uptake of radiactive calcium by groundnut (Arachis hypogaea L.) and efficiency of utilisation of applied calcium

    International Nuclear Information System (INIS)

    Loganathan, S.; Krishnamoorthy, K.K.

    1977-01-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium

  10. The effect of habitat geology on calcium intake and calcium status of wild rodents.

    Science.gov (United States)

    Shore, R F; Balment, R J; Yalden, D W

    1991-12-01

    Calcium is essential for normal physiological function, reproduction and growth in mammals but its distribution in the natural environment is heterogeneous. Spatial variation in calcium soil content is especially marked in the Peak District, United Kingdom, where both calcium-rich limestone and calcium-poor gritstone rock types occur. Wood mice Apodemus sylvaticus (L) and bank voles Clethrionomys glareolus (Schreber 1780) from limestone areas had significantly higher calcium concentrations in stomach contents and in faeces compared with their counterparts from gritstone areas. Calcium status was assessed from serum calcium concentration, femur weight, ash content of the body, calcium concentration in the femur and body ash. There was no significant difference in serum calcium concentration, femur calcium concentration and body ash calcium concentration between animals from the limestone and the gritstone. However, on the limestone, bank voles, but not wood mice, had significantly heavier femora and a greater proportion of ash in the body compared with their gritstone counterparts.

  11. Calcium Orthophosphates as Bioceramics: State of the Art

    Directory of Open Access Journals (Sweden)

    Sergey V. Dorozhkin

    2010-11-01

    Full Text Available In the late 1960s, much interest was raised in regard to biomedical applications of various ceramic materials. A little bit later, such materials were named bioceramics. This review is limited to bioceramics prepared from calcium orthophosphates only, which belong to the categories of bioactive and bioresorbable compounds. There have been a number of important advances in this field during the past 30–40 years. Namely, by structural and compositional control, it became possible to choose whether calcium orthophosphate bioceramics were biologically stable once incorporated within the skeletal structure or whether they were resorbed over time. At the turn of the millennium, a new concept of calcium orthophosphate bioceramics—which is able to promote regeneration of bones—was developed. Presently, calcium orthophosphate bioceramics are available in the form of particulates, blocks, cements, coatings, customized designs for specific applications and as injectable composites in a polymer carrier. Current biomedical applications include artificial replacements for hips, knees, teeth, tendons and ligaments, as well as repair for periodontal disease, maxillofacial reconstruction, augmentation and stabilization of the jawbone, spinal fusion and bone fillers after tumor surgery. Exploratory studies demonstrate potential applications of calcium orthophosphate bioceramics as scaffolds, drug delivery systems, as well as carriers of growth factors, bioactive peptides and/or various types of cells for tissue engineering purposes.

  12. Investigation of calcium phosphate coatings for biomedical applications

    International Nuclear Information System (INIS)

    Yusof Abdullah; Idris Besar; Muhammad Jamal Md Isa; Mohamad Abd Razak; Hyzan Mohd Yusof

    1999-01-01

    Calcium phosphate is the main constituent of our bone and tooth minerals. The use of this bioactive material for coating implant such as artificial joint prosthesis, therefore, can promote biological fixation and enhance biocompatibility. Our initial work has been focused on the evaluation of experimental conditions of coating preparation and the effects of post-deposition calcium phosphate coatings on stainless steel substrates. The coating layers were produced by the precipitation technique and coatings were carried out in sol-gel by the dipping method. For comparison purposes a wet method was used to obtain a fine calcium phosphate ceramic powder for fabrication of microcrystal suspension used as a coating material. Scanning electron microscopy (SEM), energy dispersive microanalysis (EDS), energy dispersive x-ray fluorescence (EDXRF) and x-ray diffraction (XRD) were used to characterise the morphology, chemical composition and structure of the coatings. The results showed that the dip coating of stainless steel substrates using viscous solutions lead to the formation of porous calcium phosphate layers. These results suggested that fabrication of bioactive calcium phosphate coatings using this route offers significant advantages over the currently used methods due to considerably lower temperature process involved and may produce better result for substrates with complex shapes

  13. Calcium-based biomaterials for diagnosis, treatment, and theranostics.

    Science.gov (United States)

    Qi, Chao; Lin, Jing; Fu, Lian-Hua; Huang, Peng

    2018-01-22

    Calcium-based (CaXs) biomaterials including calcium phosphates, calcium carbonates, calcium silicate and calcium fluoride have been widely utilized in the biomedical field owing to their excellent biocompatibility and biodegradability. In recent years, CaXs biomaterials have been strategically integrated with imaging contrast agents and therapeutic agents for various molecular imaging modalities including fluorescence imaging, magnetic resonance imaging, ultrasound imaging or multimodal imaging, as well as for various therapeutic approaches including chemotherapy, gene therapy, hyperthermia therapy, photodynamic therapy, radiation therapy, or combination therapy, even imaging-guided therapy. Compared with other inorganic biomaterials such as silica-, carbon-, and gold-based biomaterials, CaXs biomaterials can dissolve into nontoxic ions and participate in the normal metabolism of organisms. Thus, they offer safer clinical solutions for disease theranostics. This review focuses on the state-of-the-art progress in CaXs biomaterials, which covers from their categories, characteristics and preparation methods to their bioapplications including diagnosis, treatment, and theranostics. Moreover, the current trends and key problems as well as the future prospects and challenges of CaXs biomaterials are also discussed at the end.

  14. Calcium and Bone Metabolism Indices.

    Science.gov (United States)

    Song, Lu

    2017-01-01

    Calcium and inorganic phosphate are of critical importance for many body functions, thus the regulations of their plasma concentrations are tightly controlled by the concerted actions of reabsorption/excretion in the kidney, absorption in the intestines, and exchange from bone, the major reservoir for calcium and phosphate in the body. Parathyroid hormone (PTH) and 1,25-dihydroxyvitamin D (1,25(OH) 2 D) control calcium homeostasis, whereas PTH, 1,25(OH) 2 D, and bone-derived fibroblast growth factor 23 (FGF 23) control phosphate homeostasis. Hypoparathyroidism can cause hypocalcemia and hyperphosphatemia, whereas deficient vitamin D actions can cause osteomalacia in adults and rickets in children. Hyperparathyroidism, alternatively, can cause hypercalcemia and hypophosphatemia. Laboratory tests of calcium, phosphate, PTH, and 25-hydroxyvitamin D are very useful in the diagnosis of abnormalities associated with calcium and/or phosphate metabolisms. Bone is constantly remodeled throughout life in response to mechanical stress and a need for calcium in extracellular fluids. Metabolic bone diseases such as osteoporosis, osteomalacia in adults or rickets in children, and renal osteodystrophy develop when bone resorption exceeds bone formation. Bone turnover markers (BTM) such as serum N-terminal propeptide of type I procollagen (P1NP) and C-terminal collagen cross-link (CTX) may be useful in predicting future fracture risk or monitoring the response to anti-resorptive therapy. There is a need to standardize sample collection protocols because certain BTMs exhibit large circadian variations and tend to be influenced by food intakes. In the United States, a project to standardize BTM sample collection protocols and to establish the reference intervals for serum P1NP and serum CTX is ongoing. We anticipate the outcome of this project to shine lights on the standardization of BTM assays, sample collection protocols, reference intervals in relation to age, sex, and ethnic

  15. Magnetically responsive calcium carbonate microcrystals.

    Science.gov (United States)

    Fakhrullin, Rawil F; Bikmullin, Aidar G; Nurgaliev, Danis K

    2009-09-01

    Here we report the fabrication of magnetically responsive calcium carbonate microcrystals produced by coprecipitation of calcium carbonate in the presence of citrate-stabilized iron oxide nanoparticles. We demonstrate that the calcite microcrystals obtained possess superparamagnetic properties due to incorporated magnetite nanoparticles and can be manipulated by an external magnetic field. The microcrystals doped with magnetic nanoparticles were utilized as templates for the fabrication of hollow polyelectrolyte microcapsules, which retain the magnetic properties of the sacrificial cores and might be spatially manipulated using a permanent magnet, thus providing the magnetic-field-facilitated delivery and separation of materials templated on magnetically responsive calcite microcrystals.

  16. Calcium channel blockers ameliorate iron overload-associated hepatic fibrosis by altering iron transport and stellate cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ying [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Department of Pathology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Chinese Medicine Research on Cardio-Cerebrovascular Disease, Shijiazhuang 050200, Hebei (China); Zhao, Xin [Department of Hepatobiliary Surgery, The Third Hospital of Hebei Medical University, Shijiazhuang 050051, Hebei (China); Chang, Yanzhong [Laboratory of Molecular Iron Metabolism, College of Life Science, Hebei Normal University, Shijiazhuang 050024, Hebei (China); Zhang, Yuanyuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Xi [Department of Pharmacy, The Forth Hospital of Hebei Medical University, Shijiazhuang 050011, Hebei (China); Zhang, Xuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Liu, Zhenyi; Guo, Hui [Department of Medicinal Chemistry, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Wang, Na [Department of Physiology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Gao, Yonggang [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Zhang, Jianping, E-mail: zhangjianping14@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Li, E-mail: chuli0614@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Integrative Medicine on Liver-Kidney Patterns, Shijiazhuang 050200, Hebei (China)

    2016-06-15

    Liver fibrosis is the principal cause of morbidity and mortality in patients with iron overload. Calcium channel blockers (CCBs) can antagonize divalent cation entry into renal and myocardial cells and inhibit fibrogenic gene expression. We investigated the potential of CCBs to resolve iron overload-associated hepatic fibrosis. Kunming mice were assigned to nine groups (n = 8 per group): control, iron overload, deferoxamine, high and low dose verapamil, high and low dose nimodipine, and high and low dose diltiazem. Iron deposition and hepatic fibrosis were measured in mouse livers. Expression levels of molecules associated with transmembrane iron transport were determined by molecular biology approaches. In vitro HSC-T6 cells were randomized into nine groups (the same groups as the mice). Changes in proliferation, apoptosis, and metalloproteinase expression in cells were detected to assess the anti-fibrotic effects of CCBs during iron overload conditions. We found that CCBs reduced hepatic iron content, intracellular iron deposition, the number of hepatic fibrotic areas, collagen expression levels, and hydroxyproline content. CCBs rescued abnormal expression of α1C protein in L-type voltage-dependent calcium channel (LVDCC) and down-regulated divalent metal transporter-1 (DMT-1) expression in mouse livers. In iron-overloaded HSC-T6 cells, CCBs reduced iron deposition, inhibited proliferation, induced apoptosis, and elevated expression of matrix metalloproteinase-13 (MMP-13) and tissue inhibitor of metalloproteinase-1 (TIMP-1). CCBs are potential therapeutic agents that can be used to address hepatic fibrosis during iron overload. They resolve hepatic fibrosis probably correlated with regulating transmembrane iron transport and inhibiting HSC growth. - Highlights: • Calcium channel blockers (CCBs) reduced hepatic iron content. • CCBs decreased hepatic fibrotic areas and collagen expression levels. • CCBs resolve fibrosis by regulating iron transport and

  17. Calcium electroporation in three cell lines; a comparison of bleomycin and calcium, calcium compounds, and pulsing conditions

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; Gissel, Hanne; Hojman, Pernille

    2013-01-01

    offers several advantages over standard treatment options: calcium is inexpensive and may readily be applied without special precautions, as is the case with cytostatic drugs. Therefore, details on the use of calcium electroporation are essential for carrying out clinical trials comparing calcium...

  18. Calcium fertilization increases the concentration of calcium in sapwood and calcium oxalate in foliage of red spruce

    Science.gov (United States)

    Kevin T. Smith; Walter C. Shortle; Jon H. Connolly; Rakesh Minocha; Jody Jellison

    2009-01-01

    Calcium cycling plays a key role in the health and productivity of red spruce forests in the northeastern US. A portion of the flowpath of calcium within forests includes translocation as Ca2+ in sapwood and accumulation as crystals of calcium oxalate in foliage. Concentrations of Ca in these tree tissues have been used as markers of...

  19. Generation of a Homozygous Transgenic Rat Strain Stably Expressing a Calcium Sensor Protein for Direct Examination of Calcium Signaling.

    Science.gov (United States)

    Szebényi, Kornélia; Füredi, András; Kolacsek, Orsolya; Pergel, Enikő; Bősze, Zsuzsanna; Bender, Balázs; Vajdovich, Péter; Tóvári, József; Homolya, László; Szakács, Gergely; Héja, László; Enyedi, Ágnes; Sarkadi, Balázs; Apáti, Ágota; Orbán, Tamás I

    2015-08-03

    In drug discovery, prediction of selectivity and toxicity require the evaluation of cellular calcium homeostasis. The rat is a preferred laboratory animal for pharmacology and toxicology studies, while currently no calcium indicator protein expressing rat model is available. We established a transgenic rat strain stably expressing the GCaMP2 fluorescent calcium sensor by a transposon-based methodology. Zygotes were co-injected with mRNA of transposase and a CAG-GCaMP2 expressing construct, and animals with one transgene copy were pre-selected by measuring fluorescence in blood cells. A homozygous rat strain was generated with high sensor protein expression in the heart, kidney, liver, and blood cells. No pathological alterations were found in these animals, and fluorescence measurements in cardiac tissue slices and primary cultures demonstrated the applicability of this system for studying calcium signaling. We show here that the GCaMP2 expressing rat cardiomyocytes allow the prediction of cardiotoxic drug side-effects, and provide evidence for the role of Na(+)/Ca(2+) exchanger and its beneficial pharmacological modulation in cardiac reperfusion. Our data indicate that drug-induced alterations and pathological processes can be followed by using this rat model, suggesting that transgenic rats expressing a calcium-sensitive protein provide a valuable system for pharmacological and toxicological studies.

  20. Vitamin D, Calcium, and Bone Health

    Science.gov (United States)

    ... Bone Health Featured Resource Find an Endocrinologist Search Vitamin D, Calcium, and Bone Health Download PDFs English ... also helps keep your bones strong. Why are vitamin D and calcium important to bone health? Vitamin ...

  1. Complex formation ions calcium with macromolecules pectin

    International Nuclear Information System (INIS)

    Khalikova, M.D.; Avloev, Kh.Kh.; Muhiddinov, Z.K.

    2005-01-01

    In clause the mechanism of sorption of ions of calcium by macromolecules of pectin is opened. Is shown, that the linkage of ions of calcium descends on acid bunches of pectin, and process carries cooperative character

  2. Atomic layer deposition of calcium oxide and calcium hafnium oxide films using calcium cyclopentadienyl precursor

    International Nuclear Information System (INIS)

    Kukli, Kaupo; Ritala, Mikko; Sajavaara, Timo; Haenninen, Timo; Leskelae, Markku

    2006-01-01

    Calcium oxide and calcium hafnium oxide thin films were grown by atomic layer deposition on borosilicate glass and silicon substrates in the temperature range of 205-300 o C. The calcium oxide films were grown from novel calcium cyclopentadienyl precursor and water. Calcium oxide films possessed refractive index 1.75-1.80. Calcium oxide films grown without Al 2 O 3 capping layer occurred hygroscopic and converted to Ca(OH) 2 after exposure to air. As-deposited CaO films were (200)-oriented. CaO covered with Al 2 O 3 capping layers contained relatively low amounts of hydrogen and re-oriented into (111) direction upon annealing at 900 o C. In order to examine the application of CaO in high-permittivity dielectric layers, mixtures of Ca and Hf oxides were grown by alternate CaO and HfO 2 growth cycles at 230 and 300 o C. HfCl 4 was used as a hafnium precursor. When grown at 230 o C, the films were amorphous with equal amounts of Ca and Hf constituents (15 at.%). These films crystallized upon annealing at 750 o C, showing X-ray diffraction peaks characteristic of hafnium-rich phases such as Ca 2 Hf 7 O 16 or Ca 6 Hf 19 O 44 . At 300 o C, the relative Ca content remained below 8 at.%. The crystallized phase well matched with rhombohedral Ca 2 Hf 7 O 16 . The dielectric films grown on Si(100) substrates possessed effective permittivity values in the range of 12.8-14.2

  3. Kinetics of calcium sulfoaluminate formation from tricalcium aluminate, calcium sulfate and calcium oxide

    International Nuclear Information System (INIS)

    Li, Xuerun; Zhang, Yu; Shen, Xiaodong; Wang, Qianqian; Pan, Zhigang

    2014-01-01

    The formation kinetics of tricalcium aluminate (C 3 A) and calcium sulfate yielding calcium sulfoaluminate (C 4 A 3 $) and the decomposition kinetics of calcium sulfoaluminate were investigated by sintering a mixture of synthetic C 3 A and gypsum. The quantitative analysis of the phase composition was performed by X-ray powder diffraction analysis using the Rietveld method. The results showed that the formation reaction 3Ca 3 Al 2 O 6 + CaSO 4 → Ca 4 Al 6 O 12 (SO 4 ) + 6CaO was the primary reaction 4 Al 6 O 12 (SO 4 ) + 10CaO → 6Ca 3 Al 2 O 6 + 2SO 2 ↑ + O 2 ↑ primarily occurred beyond 1350 °C with an activation energy of 792 ± 64 kJ/mol. The optimal formation region for C 4 A 3 $ was from 1150 °C to 1350 °C and from 6 h to 1 h, which could provide useful information on the formation of C 4 A 3 $ containing clinkers. The Jander diffusion model was feasible for the formation and decomposition of calcium sulfoaluminate. Ca 2+ and SO 4 2− were the diffusive species in both the formation and decomposition reactions. -- Highlights: •Formation and decomposition of calcium sulphoaluminate were studied. •Decomposition of calcium sulphoaluminate combined CaO and yielded C 3 A. •Activation energy for formation was 231 ± 42 kJ/mol. •Activation energy for decomposition was 792 ± 64 kJ/mol. •Both the formation and decomposition were controlled by diffusion

  4. 21 CFR 184.1210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium oxide. 184.1210 Section 184.1210 Food and... Substances Affirmed as GRAS § 184.1210 Calcium oxide. (a) Calcium oxide (CaO, CAS Reg. No. 1305-78-8) is also known as lime, quick lime, burnt lime, or calx. It is produced from calcium carbonate, limestone, or...

  5. Oxalic acid decreases calcium absorption in rats

    International Nuclear Information System (INIS)

    Weaver, C.M.; Martin, B.R.; Ebner, J.S.; Krueger, C.A.

    1987-01-01

    Calcium absorption from salts and foods intrinsically labeled with 45 Ca was determined in the rat model. Calcium bioavailability was nearly 10 times greater for low oxalate kale, CaCO 3 and CaCl 2 than from CaC 2 O 4 (calcium oxalate) and spinach (high in oxalates). Extrinsic and intrinsic labeling techniques gave a similar assessment of calcium bioavailability from kale but not from spinach

  6. Calcium and Nuclear Signaling in Prostate Cancer

    OpenAIRE

    Ivan V. Maly; Wilma A. Hofmann

    2018-01-01

    Recently, there have been a number of developments in the fields of calcium and nuclear signaling that point to new avenues for a more effective diagnosis and treatment of prostate cancer. An example is the discovery of new classes of molecules involved in calcium-regulated nuclear import and nuclear calcium signaling, from the G protein-coupled receptor (GPCR) and myosin families. This review surveys the new state of the calcium and nuclear signaling fields with the aim of identifying the un...

  7. 21 CFR 184.1195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium citrate. 184.1195 Section 184.1195 Food and... Substances Affirmed as GRAS § 184.1195 Calcium citrate. (a) Calcium citrate (Ca3(C6H5O7)2·4H2O, CAS Reg. No. 813-0994-095) is the calcium salt of citric acid. It is prepared by neutralizing citric acid with...

  8. 21 CFR 184.1185 - Calcium acetate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium acetate. 184.1185 Section 184.1185 Food and... Substances Affirmed as GRAS § 184.1185 Calcium acetate. (a) Calcium acetate (Ca (C2H3O2)2, CAS Reg. No. 62-54-4), also known as acetate of lime or vinegar salts, is the calcium salt of acetic acid. It may be...

  9. 21 CFR 184.1229 - Calcium stearate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium stearate. 184.1229 Section 184.1229 Food... Specific Substances Affirmed as GRAS § 184.1229 Calcium stearate. (a) Calcium stearate (Ca(C17H35COO)2, CAS Reg. No. 1529-23-0) is the calcium salt of stearic acid derived from edible sources. It is prepared as...

  10. 21 CFR 184.1193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium chloride. 184.1193 Section 184.1193 Food... Specific Substances Affirmed as GRAS § 184.1193 Calcium chloride. (a) Calcium chloride (CaCl2·2H2O, CAS Reg. No. 10035-04-8) or anhydrous calcium chloride (CaCl2, CAS Reg. No. 10043-52-4) may be commercially...

  11. The Electronic Structure of Calcium

    DEFF Research Database (Denmark)

    Jan, J.-P.; Skriver, Hans Lomholt

    1981-01-01

    The electronic structure of calcium under pressure is re-examined by means of self-consistent energy band calculations based on the local density approximation and using the linear muffin-tin orbitals (LMTO) method with corrections to the atomic sphere approximation included. At zero pressure...

  12. The impact of calcium assay change on a local adjusted calcium equation.

    Science.gov (United States)

    Davies, Sarah L; Hill, Charlotte; Bailey, Lisa M; Davison, Andrew S; Milan, Anna M

    2016-03-01

    Deriving and validating local adjusted calcium equations is important for ensuring appropriate calcium status classification. We investigated the impact on our local adjusted calcium equation of a change in calcium method by the manufacturer from cresolphthalein complexone to NM-BAPTA. Calcium and albumin results from general practice requests were extracted from the Laboratory Information Management system for a three-month period. Results for which there was evidence of disturbance in calcium homeostasis were excluded leaving 13,482 sets of results for analysis. The adjusted calcium equation was derived following least squares regression analysis of total calcium on albumin and normalized to the mean calcium concentration of the data-set. The revised equation (NM-BAPTA calcium method) was compared with the previous equation (cresolphthalein complexone calcium method). The switch in calcium assay resulted in a small change in the adjusted calcium equation but was not considered to be clinically significant. The calcium reference interval differed from that proposed by Pathology Harmony in the UK. Local adjusted calcium equations should be re-assessed following changes in the calcium method. A locally derived reference interval may differ from the consensus harmonized reference interval. © The Author(s) 2015.

  13. Absorbability of calcium from calcium-bound phosphoryl oligosaccharides in comparison with that from various calcium compounds in the rat ligated jejunum loop.

    Science.gov (United States)

    To-o, Kenji; Kamasaka, Hiroshi; Nishimura, Takahisa; Kuriki, Takashi; Saeki, Shigeru; Nakabou, Yukihiro

    2003-08-01

    Calcium-bound phosphoryl oligosaccharides (POs-Ca) were prepared from potato starch. Their solubility and in situ absorbability as a calcium source were investigated by comparing with the soluble calcium compounds, calcium chloride and calcium lactate, or insoluble calcium compounds, calcium carbonate and dibasic calcium phosphate. The solubility of POs-Ca was as high as that of calcium chloride and about 3-fold higher than that of calcium lactate. An in situ experiment showed that the intestinal calcium absorption rate of POs-Ca was almost comparable with that of the soluble calcium compounds, and was significantly higher (pcalcium groups. Moreover, the total absorption rate of a 1:1 mixture of the calcium from POs-Ca and a whey mineral complex (WMC) was significantly higher (psoluble calcium source with relatively high absorption in the intestinal tract.

  14. 21 CFR 582.1210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium oxide. 582.1210 Section 582.1210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS....1210 Calcium oxide. (a) Product. Calcium oxide. (b) Conditions of use. This substance is generally...

  15. 21 CFR 582.5210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium oxide. 582.5210 Section 582.5210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS... 1 § 582.5210 Calcium oxide. (a) Product. Calcium oxide. (b) Conditions of use. This substance is...

  16. Lactulose stimulates calcium absorption in postmenopausal women

    NARCIS (Netherlands)

    Heuvel, E.G.H.M. van den; Muijs, T.; Dokkum, W. van; Schaafsma, G.

    1999-01-01

    Animal studies have indicated that calcium absorption is increased by lactulose, a synthetic disaccharide. Therefore, the influence of lactulose on calcium absorption was measured in postmenopausal women who may benefit from the possible enhancing effect of lactulose on calcium absorption. Twelve

  17. 21 CFR 182.3225 - Calcium sorbate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium sorbate. 182.3225 Section 182.3225 Food and... CONSUMPTION (CONTINUED) SUBSTANCES GENERALLY RECOGNIZED AS SAFE Chemical Preservatives § 182.3225 Calcium sorbate. (a) Product. Calcium sorbate. (b) Conditions of use. This substance is generally recognized as...

  18. 21 CFR 582.5230 - Calcium sulfate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium sulfate. 582.5230 Section 582.5230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5230 Calcium sulfate. (a) Product. Calcium sulfate. (b) Conditions of use. This substance...

  19. 21 CFR 582.6185 - Calcium acetate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium acetate. 582.6185 Section 582.6185 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium acetate. (a) Product. Calcium acetate. (b) Conditions of use. This substance is generally...

  20. 21 CFR 582.5195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.5195 Section 582.5195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5195 Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance...

  1. 21 CFR 582.3225 - Calcium sorbate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium sorbate. 582.3225 Section 582.3225 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL....3225 Calcium sorbate. (a) Product. Calcium sorbate. (b) Conditions of use. This substance is generally...

  2. 21 CFR 582.6195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.6195 Section 582.6195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance is generally...

  3. 21 CFR 582.6219 - Calcium phytate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium phytate. 582.6219 Section 582.6219 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium phytate. (a) Product. Calcium phytate. (b) Conditions of use. This substance is generally...

  4. 21 CFR 582.1207 - Calcium lactate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium lactate. 582.1207 Section 582.1207 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1207 Calcium lactate. (a) Product. Calcium lactate. (b) Conditions of use. This substance is...

  5. 21 CFR 182.2227 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium silicate. 182.2227 Section 182.2227 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Calcium silicate. (a) Product. Calcium silicate. (b) Tolerance. 2 percent and 5 percent. (c) Limitations...

  6. 21 CFR 582.1195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.1195 Section 582.1195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1195 Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance is...

  7. 21 CFR 582.7187 - Calcium alginate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium alginate. 582.7187 Section 582.7187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium alginate. (a) Product. Calcium alginate. (b) Conditions of use. This substance is generally...

  8. 21 CFR 582.2227 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium silicate. 582.2227 Section 582.2227 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium silicate. (a) Product. Calcium silicate. (b) Tolerance. 2 percent and 5 percent. (c) Limitations...

  9. Mechanism of store-operated calcium entry

    Indian Academy of Sciences (India)

    Activation of receptors coupled to the phospholipase C/IP3 signalling pathway results in a rapid release of calcium from its intracellular stores, eventually leading to depletion of these stores. Calcium store depletion triggers an influx of extracellular calcium across the plasma membrane, a mechanism known as the ...

  10. 21 CFR 201.70 - Calcium labeling.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Calcium labeling. 201.70 Section 201.70 Food and... LABELING Labeling Requirements for Over-the-Counter Drugs § 201.70 Calcium labeling. (a) The labeling of over-the-counter (OTC) drug products intended for oral ingestion shall contain the calcium content per...

  11. Preparation and properties of calcium zirconate

    International Nuclear Information System (INIS)

    Dudek, M.; Bucko, M.; Rog, G.

    2001-01-01

    Dense samples of calcium zirconate were prepared. Electrical conductivity of the samples were measured in the temperature range 873 - 1273 K by both the d.c. four probe and the impedance spectroscopy methods. Calcium zirconate with small excess of calcium oxide appeared to be oxygen ion conductor. It was applied as an electrolyte in solid-state galvanic cells. (author)

  12. Calcium dynamics in vascular smooth muscle

    OpenAIRE

    Amberg, Gregory C.; Navedo, Manuel F.

    2013-01-01

    Smooth muscle cells are ultimately responsible for determining vascular luminal diameter and blood flow. Dynamic changes in intracellular calcium are a critical mechanism regulating vascular smooth muscle contractility. Processes influencing intracellular calcium are therefore important regulators of vascular function with physiological and pathophysiological consequences. In this review we discuss the major dynamic calcium signals identified and characterized in vascular smooth muscle cells....

  13. 21 CFR 582.6193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium chloride. 582.6193 Section 582.6193 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium chloride. (a) Product. Calcium chloride. (b) Conditions of use. This substance is generally...

  14. 21 CFR 582.1193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium chloride. 582.1193 Section 582.1193 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1193 Calcium chloride. (a) Product. Calcium chloride. (b) Conditions of use. This substance...

  15. 7 CFR 58.434 - Calcium chloride.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Calcium chloride. 58.434 Section 58.434 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... Material § 58.434 Calcium chloride. Calcium chloride, when used, shall meet the requirements of the Food...

  16. Mammary-Specific Ablation of the Calcium-Sensing Receptor During Lactation Alters Maternal Calcium Metabolism, Milk Calcium Transport, and Neonatal Calcium Accrual

    Science.gov (United States)

    Mamillapalli, Ramanaiah; VanHouten, Joshua; Dann, Pamela; Bikle, Daniel; Chang, Wenhan; Brown, Edward

    2013-01-01

    To meet the demands for milk calcium, the lactating mother adjusts systemic calcium and bone metabolism by increasing dietary calcium intake, increasing bone resorption, and reducing renal calcium excretion. As part of this adaptation, the lactating mammary gland secretes PTHrP into the maternal circulation to increase bone turnover and mobilize skeletal calcium stores. Previous data have suggested that, during lactation, the breast relies on the calcium-sensing receptor (CaSR) to coordinate PTHrP secretion and milk calcium transport with calcium availability. To test this idea genetically, we bred BLG-Cre mice with CaSR-floxed mice to ablate the CaSR specifically from mammary epithelial cells only at the onset of lactation (CaSR-cKO mice). Loss of the CaSR in the lactating mammary gland did not disrupt alveolar differentiation or milk production. However, it did increase the secretion of PTHrP into milk and decreased the transport of calcium from the circulation into milk. CaSR-cKO mice did not show accelerated bone resorption, but they did have a decrease in bone formation. Loss of the mammary gland CaSR resulted in hypercalcemia, decreased PTH secretion, and increased renal calcium excretion in lactating mothers. Finally, loss of the mammary gland CaSR resulted in decreased calcium accrual by suckling neonates, likely due to the combination of increased milk PTHrP and decreased milk calcium. These results demonstrate that the mammary gland CaSR coordinates maternal bone and calcium metabolism, calcium transport into milk, and neonatal calcium accrual during lactation. PMID:23782944

  17. Effect of anions or foods on absolute bioavailability of calcium from calcium salts in mice by pharmacokinetics

    OpenAIRE

    Zenei Taira, Zenei; Ueda,Yukari

    2013-01-01

    Yukari Ueda, Zenei TairaFaculty of Pharmaceutical Sciences, Tokushima Bunri University, Tokushima, JapanAbstract: We studied the absolute bioavailability of calcium from calcium L-lactate in mice using pharmacokinetics, and reviewed the absolute bioavailability of calcium from three other calcium salts in mice previously studied: calcium chloride, calcium acetate, and calcium ascorbate. The results showed that calcium metabolism is linear between intravenous administration of 15 mg/kg and 30 ...

  18. Reduction of orthophosphates loss in agricultural soil by nano calcium sulfate.

    Science.gov (United States)

    Chen, Dong; Szostak, Paul; Wei, Zongsu; Xiao, Ruiyang

    2016-01-01

    Nutrient loss from soil, especially phosphorous (P) from farmlands to natural water bodies via surface runoff or infiltration, have caused significant eutrophication problems. This is because dissolved orthophosphates are usually the limiting nutrient for algal blooms. Currently, available techniques to control eutrophication are surprisingly scarce. Calcium sulfate or gypsum is a common soil amendment and has a strong complexation to orthophosphates. The results showed that calcium sulfate reduced the amount of water extractable P (WEP) through soil incubation tests, suggesting less P loss from farmlands. A greater decrease in WEP occurred with a greater dosage of calcium sulfate. Compared to conventional coarse calcium sulfate, nano calcium sulfate further reduced WEP by providing a much greater specific surface area, higher solubility, better contact with the fertilizer and the soil particles, and superior dispersibility. The enhancement of the nano calcium sulfate for WEP reduction is more apparent for a pellet- than a powdered- fertilizer. At the dosage of Ca/P weight ratio of 2.8, the WEP decreased by 31±5% with the nano calcium sulfate compared to 20±5% decrease with the coarse calcium sulfate when the pellet fertilizer was used. Computation of the chemical equilibrium speciation shows that calcium hydroxyapatite has the lowest solubility. However, other mineral phases such as hydroxydicalcium phosphate, dicalcium phosphate dihydrate, octacalcium phosphate, and tricalcium phosphate might form preceding to calcium hydroxyapatite. Since calcium sulfate is the major product of the flue gas desulfurization (FGD) process, this study demonstrates a potential beneficial reuse and reduction of the solid FGD waste. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Radioisotope 45Ca labeling four calcium chemical compounds and tracing calcium bioavailability

    International Nuclear Information System (INIS)

    Zheng Hui; Zhen Rong; Niu Huisheng; Li Huaifen

    2004-01-01

    Objective: To build up a new method of the radioisotope 45 Ca labeling four calcium chemical compounds, observe and tracing bioavailability change of calcium labeled with radioisotope 45 Ca. Methods: The calcium gluconate (Ca-Glu), calcium citrate (Ca-Cit), calcium carbonate (Ca-Car) and calcium L-threonate (Ca-Thr)were labeled by radioisotope 45 Ca. Four calcium chemical compounds of 45 Ca labeling were used of calcium content 200 mg/kg in the rats and measure the absorption content and bioavailability of calcium in tissue of heart, lever spleen, stomach, kidney, brain, intestine, whole blood, urine, faeces. Results: 1) Radioisotope 45 Ca labeling calcium chemical compound has high radio intensity, more steady standard curve and recover rate. 2) The absorption of organic calcium chemical compounds is higher than the inorganic calcium chemical compound in the study of calcium bioavailability. Conclusion: The method of tracing with radioisotope 45 Ca labeling calcium chemical compounds has the characteristic of the sensitive, objective, accurate and steady in the study of calcium bioavailability

  20. Calcium regulation and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Deepthi Rapaka

    2014-09-01

    Full Text Available Activation of the neuron induces transient fluctuations in [Ca2+]i. This transient rise in [Ca2+]i is dependent on calcium entry via calcium channels and release of calcium from intracellular stores, finally resulting in increase in calcium levels, which activates calcium regulatory proteins to restore the resting calcium levels by binding to the calcium-binding proteins, sequestration into the endoplasmic reticulum and the mitochondria, and finally extrusion of calcium spike potential from the cell by adenosine triphosphate-driven Ca2+ pumps and the Na+/Ca2+ exchanger. Improper regulation of calcium signaling, sequentially, likely contributes to synaptic dysfunction and excitotoxic and/or apoptotic death of the vulnerable neuronal populations. The cognitive decline associated with normal aging is not only due to neuronal loss, but is fairly the result of synaptic connectivity. Many evidences support that Ca2+ dyshomeostasis is implicated in normal brain aging. Thus the chief factor associated with Alzheimer’s disease was found to be increase in the levels of free intracellular calcium, demonstrating that the excessive levels might lead to cell death, which provides a key target for the calcium channel blockers might be used as the neuroprotective agents in Alzheimer’s disease.

  1. Targeting Cellular Calcium Homeostasis to Prevent Cytokine-Mediated Beta Cell Death.

    Science.gov (United States)

    Clark, Amy L; Kanekura, Kohsuke; Lavagnino, Zeno; Spears, Larry D; Abreu, Damien; Mahadevan, Jana; Yagi, Takuya; Semenkovich, Clay F; Piston, David W; Urano, Fumihiko

    2017-07-17

    Pro-inflammatory cytokines are important mediators of islet inflammation, leading to beta cell death in type 1 diabetes. Although alterations in both endoplasmic reticulum (ER) and cytosolic free calcium levels are known to play a role in cytokine-mediated beta cell death, there are currently no treatments targeting cellular calcium homeostasis to combat type 1 diabetes. Here we show that modulation of cellular calcium homeostasis can mitigate cytokine- and ER stress-mediated beta cell death. The calcium modulating compounds, dantrolene and sitagliptin, both prevent cytokine and ER stress-induced activation of the pro-apoptotic calcium-dependent enzyme, calpain, and partly suppress beta cell death in INS1E cells and human primary islets. These agents are also able to restore cytokine-mediated suppression of functional ER calcium release. In addition, sitagliptin preserves function of the ER calcium pump, sarco-endoplasmic reticulum Ca 2+ -ATPase (SERCA), and decreases levels of the pro-apoptotic protein thioredoxin-interacting protein (TXNIP). Supporting the role of TXNIP in cytokine-mediated cell death, knock down of TXNIP in INS1-E cells prevents cytokine-mediated beta cell death. Our findings demonstrate that modulation of dynamic cellular calcium homeostasis and TXNIP suppression present viable pharmacologic targets to prevent cytokine-mediated beta cell loss in diabetes.

  2. Presynaptic calcium signalling in cerebellar mossy fibres

    DEFF Research Database (Denmark)

    Thomsen, Louiza Bohn; Jörntell, Henrik; Midtgaard, Jens

    2010-01-01

    Whole-cell recordings were obtained from mossy fibre terminals in adult turtles in order to characterize the basic membrane properties. Calcium imaging of presynaptic calcium signals was carried out in order to analyse calcium dynamics and presynaptic GABA B inhibition. A tetrodotoxin (TTX......)-sensitive fast Na(+) spike faithfully followed repetitive depolarizing pulses with little change in spike duration or amplitude, while a strong outward rectification dominated responses to long-lasting depolarizations. High-threshold calcium spikes were uncovered following addition of potassium channel blockers....... Calcium imaging using Calcium-Green dextran revealed a stimulus-evoked all-or-none TTX-sensitive calcium signal in simple and complex rosettes. All compartments of a complex rosette were activated during electrical activation of the mossy fibre, while individual simple and complex rosettes along an axon...

  3. Seasonal Variations in Mercury's Dayside Calcium Exosphere

    Science.gov (United States)

    Burger, Matthew H.; Killen, Rosemary M.; McClintock, William E.; Merkel, Aimee W.; Vervack, Ronald J., Jr.; Cassidy, Timothy A.; Sarantos, Menelaos

    2014-01-01

    The Mercury Atmospheric and Surface Composition Spectrometer on the MESSENGER spacecraft has observed calcium emission in Mercury's exosphere on a near-daily basis since March 2011. During MESSENGER's primary and first extended missions (March 2011 - March 2013) the dayside calcium exosphere was measured over eight Mercury years. We have simulated these data with a Monte Carlo model of exospheric source processes to show that (a) there is a persistent source of energetic calcium located in the dawn equatorial region, (b) there is a seasonal dependence in the calcium source rate, and (c) there are no obvious year-to-year variations in the near-surface dayside calcium exosphere. Although the precise mechanism responsible for ejecting the calcium has not yet been determined, the most likely process is the dissociation of Ca-bearing molecules produced in micrometeoroid impact plumes to form energetic, escaping calcium atoms.

  4. Intracellular sphingosine releases calcium from lysosomes.

    Science.gov (United States)

    Höglinger, Doris; Haberkant, Per; Aguilera-Romero, Auxiliadora; Riezman, Howard; Porter, Forbes D; Platt, Frances M; Galione, Antony; Schultz, Carsten

    2015-11-27

    To elucidate new functions of sphingosine (Sph), we demonstrate that the spontaneous elevation of intracellular Sph levels via caged Sph leads to a significant and transient calcium release from acidic stores that is independent of sphingosine 1-phosphate, extracellular and ER calcium levels. This photo-induced Sph-driven calcium release requires the two-pore channel 1 (TPC1) residing on endosomes and lysosomes. Further, uncaging of Sph leads to the translocation of the autophagy-relevant transcription factor EB (TFEB) to the nucleus specifically after lysosomal calcium release. We confirm that Sph accumulates in late endosomes and lysosomes of cells derived from Niemann-Pick disease type C (NPC) patients and demonstrate a greatly reduced calcium release upon Sph uncaging. We conclude that sphingosine is a positive regulator of calcium release from acidic stores and that understanding the interplay between Sph homeostasis, calcium signaling and autophagy will be crucial in developing new therapies for lipid storage disorders such as NPC.

  5. Effect of purines on calcium-independent acetylcholine release at the mouse neuromuscular junction.

    Science.gov (United States)

    Veggetti, M; Muchnik, S; Losavio, A

    2008-07-17

    At the mouse neuromuscular junction, activation of adenosine A(1) and P2Y receptors inhibits acetylcholine release by an effect on voltage dependent calcium channels related to spontaneous and evoked secretion. However, an effect of purines upon the neurotransmitter-releasing machinery downstream of Ca(2+) influx cannot be ruled out. An excellent tool to study neurotransmitter exocytosis in a Ca(2+)-independent step is the hypertonic response. Intracellular recordings were performed on diaphragm fibers of CF1 mice to determine the action of the specific adenosine A(1) receptor agonist 2-chloro-N(6)-cyclopentyl-adenosine (CCPA) and the P2Y(12-13) agonist 2-methylthio-adenosine 5'-diphosphate (2-MeSADP) on the hypertonic response. Both purines significantly decreased such response (peak and area under the curve), and their effect was prevented by specific antagonists of A(1) and P2Y(12-13) receptors, 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) and N-[2-(methylthioethyl)]-2-[3,3,3-trifluoropropyl]thio-5'-adenylic acid, monoanhydride with dichloromethylenebiphosphonic acid, tetrasodium salt (AR-C69931MX), respectively. Moreover, incubation of preparations only with the antagonists induced a higher response compared with controls, suggesting that endogenous ATP/ADP and adenosine are able to modulate the hypertonic response by activating their specific receptors. To search for the intracellular pathways involved in this effect, we studied the action of CCPA and 2-MeSADP in hypertonicity in the presence of inhibitors of several pathways. We found that the effect of CPPA was prevented by the calmodulin antagonist N-(6-aminohexil)-5-chloro-1-naphthalenesulfonamide hydrochloride (W-7) while that of 2-MeSADP was occluded by the protein kinase C antagonist chelerythrine and W-7. On the other hand, the inhibitors of protein kinase A (N-(2[pbromocinnamylamino]-ethyl)-5-isoquinolinesulfonamide, H-89) and phosphoinositide-3 kinase (PI3K) (2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran

  6. Exopolysaccharides regulate calcium flow in cariogenic biofilms

    Science.gov (United States)

    Varenganayil, Muth M.; Decho, Alan W.

    2017-01-01

    Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS) provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya’s agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC) by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR) spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC). Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries. PMID:29023506

  7. Exopolysaccharides regulate calcium flow in cariogenic biofilms.

    Directory of Open Access Journals (Sweden)

    Monika Astasov-Frauenhoffer

    Full Text Available Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya's agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC. Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries.

  8. Trafficking of neuronal calcium channels

    Czech Academy of Sciences Publication Activity Database

    Weiss, Norbert; Zamponi, G. W.

    2017-01-01

    Roč. 1, č. 1 (2017), č. článku NS20160003. ISSN 2059-6553 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channel * neuron * trafficing Subject RIV: ED - Physiology OBOR OECD: Physiology (including cytology) http://www.neuronalsignaling.org/content/1/1/NS20160003

  9. Constraining Calcium Production in Novae

    Science.gov (United States)

    Tiwari, Pranjal; C. Fry, C. Wrede Team; A. Chen, J. Liang Collaboration; S. Bishop, T. Faestermann, D. Seiler Collaboration; R. Hertenberger, H. Wirth Collaboration

    2017-09-01

    Calcium is an element that can be produced by thermonuclear reactions in the hottest classical novae. There are discrepancies between the abundance of Calcium observed in novae and expectations based on astrophysical models. Unbound states 1 MeV above the proton threshold affect the production of Calcium in nova models because they act as resonances in the 38 K(p , γ) 39 Ca reaction present. This work describes an experiment to measure the energies of the excited states of 39 Ca . We will bombard a thin target of 40 Ca with a beam of 22 MeV deuterons, resulting in tritons and 39Ca. We will use a Q3D magnetic spectrograph from the MLL in Garching, Germany to momenta analyze the tritons to observe the excitation energies of the resulting 39 Ca states. Simulations have been run to determine the optimal spectrograph settings. We decided to use a chemically stable target composed of CaF2 , doing so resulted in an extra contaminant, Fluorine, which is dealt with by measuring the background from a LiF target. These simulations have led to settings and targets that will result in the observation of the 39 Ca states of interest with minimal interference from contaminants. Preliminary results from this experiment will be presented. National Sciences and Engineering Research Council of Canada and U.S. National Science Foundation.

  10. Rapid screening assay for calcium bioavailability studies

    International Nuclear Information System (INIS)

    Luhrsen, K.R.; Hudepohl, G.R.; Smith, K.T.

    1986-01-01

    Calcium bioavailability has been studied by numerous techniques. The authors report here the use of the gamma emitting isotope of calcium ( 47 Ca) in a whole body retention assay system. In this system, calcium sources are administered by oral gavage and subsequent counts are determined and corrected for isotopic decay. Unlike iron and zinc retention curves, which exhibit a 2-3 day equilibration period, calcium reaches equilibration after 24 hours. Autoradiographic analysis of the femurs indicate that the newly absorbed calcium is rapidly distributed to the skeletal system. Moreover, the isotope is distributed along the entire bone. Comparisons of calcium bioavailability were made using intrinsic/extrinsic labeled milk from two species i.e. rat and goat as well as CaCO 3 . In addition, extrinsic labeled cow milk was examined. In the rat, the extrinsic labeled calcium from milk was better absorbed than the intrinsic calcium. This was not the case in goat milk or the calcium carbonate which exhibited no significant differences. Chromatographic analysis of the labeled milk indicates a difference in distribution of the 47 Ca. From these data, the authors recommend the use of this assay system in calcium bioavailability studies. The labeling studies and comparisons indicate caution should be used, however, in labeling techniques and species milk comparison

  11. The Role of Calcium in Osteoporosis

    Science.gov (United States)

    Arnaud, C. D.; Sanchez, S. D.

    1991-01-01

    Calcium requirements may vary throughout the lifespan. During the growth years and up to age 25 to 30, it is important to maximize dietary intake of calcium to maintain positive calcium balance and achieve peak bone mass, thereby possibly decreasing the risk of fracture when bone is subsequently lost. Calcium intake need not be greater than 800 mg/day during the relatively short period of time between the end of bone building and the onset of bone loss (30 to 40 years). Starting at age 40 to 50, both men and women lose bone slowly, but women lose bone more rapidly around the menopause and for about 10 years after. Intestinal calcium absorption and the ability to adapt to low calcium diets are impaired in many postmenopausal women and elderly persons owing to a suspected functional or absolute decrease in the ability of the kidney to produce 1,25(OH)2D2. The bones then become more and more a source of calcium to maintain critical extracellular fluid calcium levels. Excessive dietary intake of protein and fiber may induce significant negative calcium balance and thus increase dietary calcium requirements. Generally, the strongest risk factors for osteoporosis are uncontrollable (e.g., sex, age, and race) or less controllable (e.g., disease and medications). However, several factors such as diet, physical activity, cigarette smoking, and alcohol use are lifestyle related and can be modified to help reduce the risk of osteoporosis.

  12. Vitamin E isomer δ-tocopherol enhances the efficiency of neural stem cell differentiation via L-type calcium channel.

    Science.gov (United States)

    Deng, Sihao; Hou, Guoqiang; Xue, Zhiqin; Zhang, Longmei; Zhou, Yuye; Liu, Chao; Liu, Yanqing; Li, Zhiyuan

    2015-01-12

    The effects of the vitamin E isomer δ-tocopherol on neural stem cell (NSC) differentiation have not been investigated until now. Here we investigated the effects of δ-tocopherol on NSC neural differentiation, maturation and its possible mechanisms. Neonatal rat NSCs were grown in suspended neurosphere cultures, and were identified by their expression of nestin protein and their capacity for self-renewal. Treatment with a low concentration of δ-tocopherol induced a significant increase in the percentage of β-III-tubulin-positive cells. δ-Tocopherol also stimulated morphological maturation of neurons in culture. We further observed that δ-tocopherol stimulation increased the expression of voltage-dependent Ca(2+) channels. Moreover, a L-type specific Ca(2+) channel blocker verapamil reduced the percentage of differentiated neurons after δ-tocopherol treatment, and blocked the effects of δ-tocopherol on NSC differentiation into neurons. Together, our study demonstrates that δ-tocopherol may act through elevation of L-type calcium channel activity to increase neuronal differentiation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. The Risks and Benefits of Calcium Supplementation

    Directory of Open Access Journals (Sweden)

    Chan Soo Shin

    2015-03-01

    Full Text Available The association between calcium supplementation and adverse cardiovascular events has recently become a topic of debate due to the publication of two epidemiological studies and one meta-analysis of randomized controlled clinical trials. The reports indicate that there is a significant increase in adverse cardiovascular events following supplementation with calcium; however, a number of experts have raised several issues with these reports such as inconsistencies in attempts to reproduce the findings in other populations and questions concerning the validity of the data due to low compliance, biases in case ascertainment, and/or a lack of adjustment. Additionally, the Auckland Calcium Study, the Women's Health Initiative, and many other studies included in the meta-analysis obtained data from calcium-replete subjects and it is not clear whether the same risk profile would be observed in populations with low calcium intakes. Dietary calcium intake varies widely throughout the world and it is especially low in East Asia, although the risk of cardiovascular events is less prominent in this region. Therefore, clarification is necessary regarding the occurrence of adverse cardiovascular events following calcium supplementation and whether this relationship can be generalized to populations with low calcium intakes. Additionally, the skeletal benefits from calcium supplementation are greater in subjects with low calcium intakes and, therefore, the risk-benefit ratio of calcium supplementation is likely to differ based on the dietary calcium intake and risks of osteoporosis and cardiovascular diseases of various populations. Further studies investigating the risk-benefit profiles of calcium supplementation in various populations are required to develop population-specific guidelines for individuals of different genders, ages, ethnicities, and risk profiles around the world.

  14. Calcium K-line network in coronal holes

    Energy Technology Data Exchange (ETDEWEB)

    Marsh, K A [Hale Observatories, Pasadena, Calif. (USA)

    1977-05-01

    Microphotometry of calcium K-line photographs in the regions of polar coronal holes shows that the chromospheric network exterior to a hole has a slightly broader intensity distribution than that inside the hole itself, a fact which can be attributed to a greater number of bright network elements outside the hole. These bright elements presumably represent the enhanced network resulting from the dispersal of magnetic flux from old active regions, a hypothesis which is consistent with current ideas of coronal hole formation.

  15. FGF-23 dysregulates calcium homeostasis and electrophysiological properties in HL-1 atrial cells.

    Science.gov (United States)

    Kao, Yu-Hsun; Chen, Yao-Chang; Lin, Yung-Kuo; Shiu, Rong-Jie; Chao, Tze-Fan; Chen, Shih-Ann; Chen, Yi-Jen

    2014-08-01

    Fibroblast growth factor (FGF)-23 is a key regulator of phosphate homeostasis. Higher FGF-23 levels are correlated with poor outcomes in cardiovascular diseases. FGF-23 can produce cardiac hypertrophy and increase intracellular calcium, which can change cardiac electrical activity. However, it is not clear whether FGF-23 possesses arrhythmogenic potential through calcium dysregulation. Therefore, the purposes of this study were to evaluate the electrophysiological effects of FGF-23 and identify the underlying mechanisms. Patch clamp, confocal microscope with Fluo-4 fluorescence, and Western blot analyses were used to evaluate the electrophysiological characteristics, calcium homeostasis and calcium regulatory proteins in HL-1 atrial myocytes with and without FGF-23 (10 and 25 ng/mL) incubation for 24 h. FGF-23 (25 ng/mL) increased L-type calcium currents, calcium transient and sarcoplasmic reticulum Ca(2+) contents in HL-1 cells. FGF-23 (25 ng/mL)-treated cells (n = 14) had greater incidences (57%, 17% and 15%, P calcium/calmodulin-dependent protein kinase IIδ and phospholamban (PLB) at threonine 17 but had similar phosphorylation extents of PLB at serine 16, total PLB and sarcoplasmic reticulum Ca(2+) -ATPase protein. Moreover, the FGF receptor inhibitor (PD173074, 10 nM), calmodulin inhibitor (W7, 5 μM) and phospholipase C inhibitor (U73122, 1 μM) attenuated the effects of FGF-23 on calcium/calmodulin-dependent protein kinase II phosphorylation. FGF-23 increases HL-1 cells arrhythmogenesis with calcium dysregulation through modulating calcium-handling proteins. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

  16. 6-OHDA induced calcium influx through N-type calcium channel alters membrane properties via PKA pathway in substantia nigra pars compacta dopaminergic neurons.

    Science.gov (United States)

    Qu, Liang; Wang, Yuan; Zhang, Hai-Tao; Li, Nan; Wang, Qiang; Yang, Qian; Gao, Guo-Dong; Wang, Xue-Lian

    2014-07-11

    Voltage gated calcium channels (VGCC) are sensitive to oxidative stress, and their activation or inactivation can impact cell death. Although these channels have been extensively studied in expression systems, their role in the brain, particularly in the substantia nigra pars compacta (SNc), remain controversial. In this study, we assessed 6-hydroxydopamine (6-OHDA) induced transformation of firing pattern and functional changes of calcium channels in SNc dopaminergic neurons. Application of 6-OHDA (0.5-2mM) evoked a dose-dependent, desensitizing inward current and intracellular free calcium concentration ([Ca(2+)]i) rise. In voltage clamp, ω-conotoxin-sensitive Ca(2+) current modulation mediated by 6-OHDA reflected an altered sensitivity. Furthermore, we found that 6-OHDA modulated Ca(2+) currents through PKA pathway. These results provided evidence for the potential role of VGCCs and PKA involved in oxidative stress in degeneration of SNc neurons in Parkinson's disease (PD). Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Calcium signals can freely cross the nuclear envelope in hippocampal neurons: somatic calcium increases generate nuclear calcium transients

    Directory of Open Access Journals (Sweden)

    Bading Hilmar

    2007-07-01

    Full Text Available Abstract Background In hippocampal neurons, nuclear calcium signaling is important for learning- and neuronal survival-associated gene expression. However, it is unknown whether calcium signals generated by neuronal activity at the cell membrane and propagated to the soma can unrestrictedly cross the nuclear envelope to invade the nucleus. The nuclear envelope, which allows ion transit via the nuclear pore complex, may represent a barrier for calcium and has been suggested to insulate the nucleus from activity-induced cytoplasmic calcium transients in some cell types. Results Using laser-assisted uncaging of caged calcium compounds in defined sub-cellular domains, we show here that the nuclear compartment border does not represent a barrier for calcium signals in hippocampal neurons. Although passive diffusion of molecules between the cytosol and the nucleoplasm may be modulated through changes in conformational state of the nuclear pore complex, we found no evidence for a gating mechanism for calcium movement across the nuclear border. Conclusion Thus, the nuclear envelope does not spatially restrict calcium transients to the somatic cytosol but allows calcium signals to freely enter the cell nucleus to trigger genomic events.

  18. Calcium-dependent smooth muscle excitatory effect elicited by the venom of the hydrocoral Millepora complanata.

    Science.gov (United States)

    Rojas, Alejandra; Torres, Mónica; Rojas, J Isela; Feregrino, Angélica; Heimer-de la Cotera, Edgar P

    2002-06-01

    In the present paper, we describe the results obtained from a preliminary pharmacological and biochemical study of the fire coral Millepora complanata, a regular component of coral reefs in the Mexican Caribbean. The protein-containing crude extract obtained from M. complanata (tested from 0.001 to 1000 microg protein/ml) caused a concentration-dependent stimulation of spontaneous contractions of the guinea pig ileum. The extract (EC(50)=11.55+/-2.36 microg/ml) was approximately 12-fold less potent than ionomycin (EC(50)=0.876+/-0.25 microg/ml) and its maximum induced contraction (1mg protein/ml) was equivalent to 68% of the response to 60mM KCl. FPLC size exclusion chromatography of the M. complanta extract afforded 12 primary fractions, of which only FV (containing proteins with molecular weights ranging from 17 to 44 kDa) and FVIII (consisting of peptides with molecular weights lesser than 1.8k Da) elicited an excitatory effect when tested at the EC(50) of the original extract. After incubation in Ca(2+)-free medium, the ileal response to FV and FVIII was significantly reduced. Blockage of L-type Ca(2+) channels with nifedipine (1 microM) inhibited FV and FVIII-evoked contractions. Cd(2+) (10 microM), an unspecific blocker of voltage-activated calcium channels, also antagonized FV and FVIII-induced effects, whereas the Na(+) channel blocker tetrodotoxin (10nM) did not significantly affect FV and FVIII responses. These results suggest that the contractions induced by the bioactive fractions obtained from the crude extract of M. complanata are caused mainly by a direct action on smooth muscle cells, via an increase in Ca(2+) permeability that occurs, at least partly, through L-type voltage-dependent Ca(2+) channels found in the cell membrane of smooth muscle. Copright 2002 Elsevier Science Ltd.

  19. Brain calcium - Role in temperature regulation.

    Science.gov (United States)

    Hanegan, J. L.; Williams, B. A.

    1973-01-01

    Perfusion of the preoptic-anterior hypothalamus with excess calcium ion in ground squirrels produces a drop in core temperature. The magnitude of the drop is directly dependent on ambient temperature. Respiration, heart rate, and oxygen consumption are also reduced during perfusion of calcium ion. It is concluded that the depression of body temperature during calcium ion perfusion is due to generalized depression of the neurons of the preoptic-anterior hypothalamus.

  20. Familial hypocalciuric hypercalcemia and calcium sensing receptor

    DEFF Research Database (Denmark)

    Mrgan, Monija; Nielsen, Sanne; Brixen, Kim

    2014-01-01

    Familial hypocalciuric hypercalcemia (FHH) is a lifelong, benign autosomal dominant disease characterized by hypercalcemia, normal to increased parathyroid hormone level, and a relatively low renal calcium excretion. Inactivation of the calcium-sensing receptor in heterozygous patients results...... in FHH, while in homozygous patients as well as in compound heterozygous or dominant negative heterozygous patients, it may result in neonatal severe hyperparathyroidism (NSHPT). Parathyroid surgery is not indicated in FHH and does not lower plasma calcium unless total parathyroidectomy is performed...

  1. The total synthesis of calcium atorvastatin.

    Science.gov (United States)

    Dias, Luiz C; Vieira, Adriano S; Barreiro, Eliezer J

    2016-02-21

    A practical and convergent asymmetric route to calcium atorvastatin (1) is reported. The synthesis of calcium atorvastatin (1) was performed using the remote 1,5-anti asymmetric induction in the boron-mediated aldol reaction of β-alkoxy methylketone (4) with pyrrolic aldehyde (3) as a key step. Calcium atorvastatin was obtained from aldehyde (3) after 6 steps, with a 41% overall yield.

  2. 21 CFR 184.1206 - Calcium iodate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium iodate. 184.1206 Section 184.1206 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1206 Calcium iodate. (a) Calcium iodate [Ca(IO3)2·H2O, CAS Reg. No. 7789-80...

  3. Electrogenic glutamate uptake is a major current carrier in the membrane of axolotl retinal glial cells

    Science.gov (United States)

    Brew, Helen; Attwell, David

    1987-06-01

    Glutamate is taken up avidly by glial cells in the central nervous system1. Glutamate uptake may terminate the transmitter action of glutamate released from neurons1, and keep extracellular glutamate at concentrations below those which are neurotoxic. We report here that glutamate evokes a large inward current in retinal glial cells which have their membrane potential and intracellular ion concentrations controlled by the whole-cell patch-clamp technique2. This current seems to be due to an electrogenic glutamate uptake carrier, which transports at least two sodium ions with every glutamate anion carried into the cell. Glutamate uptake is strongly voltage-dependent, decreasing at depolarized potentials: when fully activated, it contributes almost half of the conductance in the part of the glial cell membrane facing the retinal neurons. The spatial localization, glutamate affinity and magnitude of the uptake are appropriate for terminating the synaptic action of glutamate released from photoreceptors and bipolar cells. These data challenge present explanations of how the b-wave of the electroretinogram is generated, and suggest a mechanism for non-vesicular voltage-dependent release of glutamate from neurons.

  4. Caffeine-Induced Suppression of GABAergic Inhibition and Calcium-Independent Metaplasticity

    Directory of Open Access Journals (Sweden)

    Masako Isokawa

    2016-01-01

    Full Text Available GABAergic inhibition plays a critical role in the regulation of neuron excitability; thus, it is subject to modulations by many factors. Recent evidence suggests the elevation of intracellular calcium ([Ca2+]i and calcium-dependent signaling molecules underlie the modulations. Caffeine induces a release of calcium from intracellular stores. We tested whether caffeine modulated GABAergic transmission by increasing [Ca2+]i. A brief local puff-application of caffeine to hippocampal CA1 pyramidal cells transiently suppressed GABAergic inhibitory postsynaptic currents (IPSCs by 73.2 ± 6.98%. Time course of suppression and the subsequent recovery of IPSCs resembled DSI (depolarization-induced suppression of inhibition, mediated by endogenous cannabinoids that require a [Ca2+]i rise. However, unlike DSI, caffeine-induced suppression of IPSCs (CSI persisted in the absence of a [Ca2+]i rise. Intracellular applications of BAPTA and ryanodine (which blocks caffeine-induced calcium release from intracellular stores failed to prevent the generation of CSI. Surprisingly, ruthenium red, an inhibitor of multiple calcium permeable/release channels including those of stores, induced metaplasticity by amplifying the magnitude of CSI independently of calcium. This metaplasticity was accompanied with the generation of a large inward current. Although ionic basis of this inward current is undetermined, the present result demonstrates that caffeine has a robust Ca2+-independent inhibitory action on GABAergic inhibition and causes metaplasticity by opening plasma membrane channels.

  5. [Recommendations on vitamin D and calcium supplements for adults in Spain].

    Science.gov (United States)

    Rigueira García, Ana Isabel

    2012-10-01

    Calcium supplements and vitamin D are involved in current debates of health, as cardiovascular safety of calcium, and correction of vitamin levels. The aim is to review the possibilities of making better use of supplements marketed in Spain, depending on their availability, information and related epidemiology. Analysis of comercial offer and available information about pharmacological aspects of Spanish medicinal supplements in data-sheets (39), guides and reports current institutional and professional, with additional search of this information and epidemiological data related Spanish in Cochrane Database of Systematic Reviews ®, PubMed ® (tool "Clinical Queries"), Dialnet database and hand search of Spanish journals directly related. There is no uniformity in terms of indication, expression of content, dosages, precautions and safety in data sheets or technical reports. The literature search found more recent publications volume for vitamin D than calcium, No evidence was found to establish appropriate dosing regimens indisputable or universal, or cholecalciferol bioavailability tests with aqueous vehiculización. In Spain nutritional situation is found generally suitable for the calcium but a status mostly unsuitable for vitamin D with several references for insufficiency and vitamin deficiency in adults. Corrective treatments primarily affect calcium supplements. There is an ample supply of calcium and vitamin D in Spain, whose drug design should rethink because don't respond to the needs identified or correction possibilities currently recommended. It should also improve and update their information, with particular interest in health status related to hypovitaminosis D.

  6. Calcium hydroxide isotope effect in calcium isotope enrichment by ion exchange

    International Nuclear Information System (INIS)

    Jepson, B.E.; Shockey, G.C.

    1984-01-01

    The enrichment of calcium isotopes has been observed in ion-exchange chromatography with an aqueous phase of calcium hydroxide and a solid phase of sulfonic acid resin. The band front was exceedingly sharp as a result of the acid-base reaction occuring at the front of the band. Single-stage separation coefficients were found to be epsilon( 44 Ca/ 40 Ca) = 11 x 10 -4 and epsilon( 48 Ca/ 40 Ca) = 18 x 10 -4 . The maximum column separation factors achieved were 1.05 for calcium-44 and 1.09 for calcium-48 with the heavy isotopes enriching in the fluid phase. The calcium isotope effect between fully hydrated aqueous calcium ions and undissociated aqueous calcium hydroxide was estimated. For the calcium-44/40 isotope pair the separation coefficient was 13 x 10 -4 . 20 references, 2 figures

  7. Calcium isotope fractionation between soft and mineralized tissues as a monitor of calcium use in vertebrates

    Science.gov (United States)

    Skulan, Joseph; DePaolo, Donald J.

    1999-01-01

    Calcium from bone and shell is isotopically lighter than calcium of soft tissue from the same organism and isotopically lighter than source (dietary) calcium. When measured as the 44Ca/40Ca isotopic ratio, the total range of variation observed is 5.5‰, and as much as 4‰ variation is found in a single organism. The observed intraorganismal calcium isotopic variations and the isotopic differences between tissues and diet indicate that isotopic fractionation occurs mainly as a result of mineralization. Soft tissue calcium becomes heavier or lighter than source calcium during periods when there is net gain or loss of mineral mass, respectively. These results suggest that variations of natural calcium isotope ratios in tissues may be useful for assessing the calcium and mineral balance of organisms without introducing isotopic tracers. PMID:10570137

  8. Calcium and magnesium silicate hydrates

    International Nuclear Information System (INIS)

    Lothenbach, B.; L'Hopital, E.; Nied, D.; Achiedo, G.; Dauzeres, A.

    2015-01-01

    Deep geological disposals are planed to discard long-lived intermediate-level and high-level radioactive wastes. Clay-based geological barriers are expected to limit the ingress of groundwater and to reduce the mobility of radioelements. In the interaction zone between the cement and the clay based material alteration can occur. Magnesium silicate hydrates (M-S-H) have been observed due to the reaction of magnesium sulfate containing groundwater with cements or in the interaction zone between low-pH type cement and clays. M-S-H samples synthesized in the laboratory showed that M-S-H has a variable composition within 0.7 ≤ Mg/Si ≤ 1.5. TEM/EDS analyses show an homogeneous gel with no defined structure. IR and 29 Si NMR data reveal a higher polymerization degree of the silica network in M-S-H compared to calcium silicate hydrates (C-S-H). The presence of mainly Q 3 silicate tetrahedrons in M-S-H indicates a sheet like or a triple-chain silica structure while C-S-H is characterised by single chain-structure. The clear difference in the silica structure and the larger ionic radius of Ca 2+ (1.1 Angstrom) compared to Mg 2+ (0.8 Angstrom) make the formation of an extended solid solution between M-S-H and C-S-H gel improbable. In fact, the analyses of synthetic samples containing both magnesium and calcium in various ratios indicate the formation of separate M-S-H and C-S-H gels with no or very little uptake of magnesium in CS-H or calcium in M-S-H

  9. Calcium carboorthovanadate - a new compound with the apa

    International Nuclear Information System (INIS)

    Slobodin, B.V.; Dmitrieva, O.I.; Fotiev, A.A.

    1977-01-01

    Data on calcium carboorthovanadate, Ca 10 (VO 4 ) 6 CO 3 , a new compound with an appatite structure based on calcium orthovanadate, are reported. The synthesis has been conducted in a stoichiometric mixture of finely ground calcium carbonate and calcium orthovanadate. It is found that calcium carboorthovanadate belongs to the hexagonal syngony and has an apatite structure. An analysis of the infrared spectra of initial compounds and calcium carboorthovanadate confirmed the presence of carbonate (CO 3 ) 2- and orthovanadate (VO 4 ) 3 groupings in the latter. On heating in air, beginning with 450 deg C calcium carboorthovanadate decomposes at a slow rate into calcium oxide, calcium orthovanadate, and carbon dioxide

  10. Regulation of cardiomyocyte autophagy by calcium.

    Science.gov (United States)

    Shaikh, Soni; Troncoso, Rodrigo; Criollo, Alfredo; Bravo-Sagua, Roberto; García, Lorena; Morselli, Eugenia; Cifuentes, Mariana; Quest, Andrew F G; Hill, Joseph A; Lavandero, Sergio

    2016-04-15

    Calcium signaling plays a crucial role in a multitude of events within the cardiomyocyte, including cell cycle control, growth, apoptosis, and autophagy. With respect to calcium-dependent regulation of autophagy, ion channels and exchangers, receptors, and intracellular mediators play fundamental roles. In this review, we discuss calcium-dependent regulation of cardiomyocyte autophagy, a lysosomal mechanism that is often cytoprotective, serving to defend against disease-related stress and nutrient insufficiency. We also highlight the importance of the subcellular distribution of calcium and related proteins, interorganelle communication, and other key signaling events that govern cardiomyocyte autophagy. Copyright © 2016 the American Physiological Society.

  11. How calcium makes endocytic receptors attractive

    DEFF Research Database (Denmark)

    Andersen, Christian B F; Moestrup, Søren K

    2014-01-01

    of the receptor. Endosomal acidification and calcium efflux lead to the essential ligand-receptor affinity switch and separation. Recent data, including crystal structures of receptor-ligand complexes, now reveal how calcium, in different types of domain scaffolds, functions in a common way as a removable...... 'lynchpin' that stabilizes favorable positioning of ligand-attractive receptor residues. In addition to explaining how calcium depletion can cause ligand-receptor dissociation, the new data add further insight into how acidification contributes to dissociation through structural changes that affect...... the receptor calcium sites....

  12. Diuretics and disorders of calcium homeostasis.

    Science.gov (United States)

    Grieff, Marvin; Bushinsky, David A

    2011-11-01

    Diuretics commonly are administered in disorders of sodium balance. Loop diuretics inhibit the Na-K-2Cl transporter and also increase calcium excretion. They are often used in the treatment of hypercalcemia. Thiazide diuretics block the thiazide-sensitive NaCl transporter in the distal convoluted tubule, and can decrease calcium excretion. They are often used in the treatment of nephrolithiasis. Carbonic anhydrase inhibitors decrease bicarbonate absorption and the resultant metabolic acidosis can increase calcium excretion. Their use can promote nephrocalcinosis and nephrolithiasis. This review will address the use of diuretics on disorders of calcium homeostasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Role of polyhydroxybutyrate in mitochondrial calcium uptake

    Science.gov (United States)

    Smithen, Matthew; Elustondo, Pia A.; Winkfein, Robert; Zakharian, Eleonora; Abramov, Andrey Y.; Pavlov, Evgeny

    2013-01-01

    Polyhydroxybutyrate (PHB) is a biological polymer which belongs to the class of polyesters and is ubiquitously present in all living organisms. Mammalian mitochondrial membranes contain PHB consisting of up to 120 hydroxybutyrate residues. Roles played by PHB in mammalian mitochondria remain obscure. It was previously demonstrated that PHB of the size similar to one found in mitochondria mediates calcium transport in lipid bilayer membranes. We hypothesized that the presence of PHB in mitochondrial membrane might play a significant role in mitochondrial calcium transport. To test this, we investigated how the induction of PHB hydrolysis affects mitochondrial calcium transport. Mitochondrial PHB was altered enzymatically by targeted expression of bacterial PHB hydrolyzing enzyme (PhaZ7) in mitochondria of mammalian cultured cells. The expression of PhaZ7 induced changes in mitochondrial metabolism resulting in decreased mitochondrial membrane potential in HepG2 but not in U87 and HeLa cells. Furthermore, it significantly inhibited mitochondrial calcium uptake in intact HepG2, U87 and HeLa cells stimulated by the ATP or by the application of increased concentrations of calcium to the digitonin permeabilized cells. Calcium uptake in PhaZ7 expressing cells was restored by mimicking calcium uniporter properties with natural electrogenic calcium ionophore - ferutinin. We propose that PHB is a previously unrecognized important component of the mitochondrial calcium uptake system. PMID:23702223

  14. Trace mineral interactions during elevated calcium consumption

    International Nuclear Information System (INIS)

    Smith, K.T.; Luhrsen, K.R.

    1986-01-01

    Elevated calcium consumption is reported to affect trace mineral bioavailability. The authors examined this phenomenon in both single dose radio-label test meals and an eight week feeding trial in rats. In the single dose studies, human milk, cows milk, and various calcium sources were examined in relation to radio-iron and radio-zinc retention. 59 Fe retention was greater from human milk than cows milk. However, when the calcium content of human milk was adjusted (with CaHPO 4 or CaCO 3 ) to equal the level in cows milk, iron retention was depressed. Similarly, when calcium sources (CaCO 3 , CaHPO 4 , hydroxy-apatite, bone meal) were examined at different calcium:metal molar ratios, the degree of inhibition on metal retention varied. In general, phosphate salts were more inhibiting than carbonates. In the feeding trial, calcium was fed in diets at normal (0.5%) or elevated (1.5%) levels. Serum, liver, kidney, and bone trace mineral profiles were obtained. In general, most trace elements showed decreased levels in the tissues. Zinc and iron were most striking, followed by magnesium with minor changes in copper. A high calcium:high mineral supplemented group was also fed. Mixed mineral supplementation prevented all calcium interactions. These data indicate the importance of calcium mineral interactions in bioavailability considerations in both milk sources and in mineral supplementation

  15. [Calcium hypothesis of Alzheimer disease].

    Science.gov (United States)

    Riazantseva, M A; Mozhaeva, G N; Kaznacheeva, E V

    2012-01-01

    Alzheimer's disease is the most common neurodegenerative disorder characterized by progressive memory and cognitive abilities loss. The etiology of Alzheimer's disease is poorly understood. In this regard, there is no effective treatment for the disease. Various hypotheses to explain the nature of the pathology of Alzheimer's disease led to the development of appropriate therapeutics. Despite of decades of research and clinical trials available therapeutics, at best, can only slow down the progression of the disease, but cannot cure it. This review dedicated to the one of modern hypotheses of Alzheimer's disease pathogenesis implied the impairment of calcium homeostasis as a key event for the development of neurodegenerative processes.

  16. Calcium

    Science.gov (United States)

    ... of new bone. People with lactose intolerance cannot digest this natural sugar found in milk and experience ... Disclaimer | FOIA | Información en español Download free Acrobat Reader Term Selected: Select the term below that you' ...

  17. Vanishing current hysteresis under competing nuclear spin pumping processes in a quadruplet spin-blockaded double quantum dot

    Energy Technology Data Exchange (ETDEWEB)

    Amaha, S., E-mail: s-amaha@riken.jp [Quantum Spin Information Project, Japan Science and Technology Agency, ICORP, 3-1, Morinosato Wakamiya, Atsugi-shi, Kanagawa 243-0198 (Japan); Quantum Functional System Research Group, RIKEN Center for Emergent Matter Science, RIKEN, 3-1 Wako-shi, Saitama 351-0198 (Japan); Hatano, T. [Quantum Spin Information Project, Japan Science and Technology Agency, ICORP, 3-1, Morinosato Wakamiya, Atsugi-shi, Kanagawa 243-0198 (Japan); Department of Physics, Tohoku University, Sendai-shi, Miyagi 980-8578 (Japan); Tarucha, S. [Quantum Spin Information Project, Japan Science and Technology Agency, ICORP, 3-1, Morinosato Wakamiya, Atsugi-shi, Kanagawa 243-0198 (Japan); Quantum Functional System Research Group, RIKEN Center for Emergent Matter Science, RIKEN, 3-1 Wako-shi, Saitama 351-0198 (Japan); Department of Applied Physics, School of Engineering, University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Gupta, J. A.; Austing, D. G. [National Research Council of Canada, M50, Montreal Road, Ottawa, Ontario K1A 0R6 (Canada)

    2015-04-27

    We investigate nuclear spin pumping with five-electron quadruplet spin states in a spin-blockaded weakly coupled vertical double quantum dot device. Two types of hysteretic steps in the leakage current are observed on sweeping the magnetic field and are associated with bidirectional polarization of nuclear spin. Properties of the steps are understood in terms of bias-voltage-dependent conditions for the mixing of quadruplet and doublet spin states by the hyperfine interaction. The hysteretic steps vanish when up- and down-nuclear spin pumping processes are in close competition.

  18. Impaired body calcium metabolism with low bone density and compensatory colonic calcium absorption in cecectomized rats

    NARCIS (Netherlands)

    Jongwattanapisan, P.; Suntornsaratoon, P.; Wongdee, K.; Dorkkam, N.; Krishnamra, N.; Charoenphandhu, N.

    2012-01-01

    An earlier study reported that cecal calcium absorption contributes less than 10% of total calcium absorbed by the intestine, although the cecum has the highest calcium transport rate compared with other intestinal segments. Thus, the physiological significance of the cecum pertaining to body

  19. Effect of lowering dietary calcium intake on fractional whole body calcium retention

    International Nuclear Information System (INIS)

    Dawson-Hughes, B.; Stern, D.T.; Shipp, C.C.; Rasmussen, H.M.

    1988-01-01

    Although fractional calcium absorption is known to vary inversely with calcium intake, the extent and timing of individual hormonal and calcium absorption responses to altered calcium intake have not been defined. We measured fractional whole body retention of orally ingested 47 Ca, an index of calcium absorption, in nine normal women after they had eaten a 2000-mg calcium diet for 8 weeks and a 300-mg calcium diet for 1, 2, 4, and 8 weeks. After the diet change, serum intact PTH (32.2% increase; P = 0.005), serum 1,25-dihydroxyvitamin D [1,25-(OH)2D; 43.8% increase; P = 0.003], and fractional whole body calcium retention (42.8% increase; P = 0.004) increased within 1 week. Although the PTH and calcium retention responses remained fairly constant throughout the low calcium intake period, serum 1,25-(OH)2D concentrations declined toward baseline after week 1. Thus, the late increase in calcium retention may have resulted from calcium absorption that was independent of 1,25-(OH)2D stimulation

  20. Short communication: Urinary oxalate and calcium excretion by dogs and cats diagnosed with calcium oxalate urolithiasis

    NARCIS (Netherlands)

    Dijcker, J.C.; Kummeling, A.; Hagen-Plantinga, E.A.; Hendriks, W.H.

    2012-01-01

    Introduction Urine concentrations of oxalate and calcium play an important role in calcium oxalate (CaOx) urolith formation in dogs and cats, with high excretions of both substances increasing the chance of CaOx urolithiasis. In 17 CaOx-forming dogs, urine calcium:creatinine ratio (Ca:Cr) was found

  1. Calcium Co-regulates Oxidative Metabolism and ATP Synthase-dependent Respiration in Pancreatic Beta Cells

    Science.gov (United States)

    De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas

    2014-01-01

    Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722

  2. Studies on magnetic properties of chemically synthesized crystalline calcium ferrite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Debnath, A., E-mail: debnathanimesh@gmail.com [Department of Civil Engineering, National Institute of Technology Agartala, Jirania, West Tripura, 799046 India (India); Bera, A.; Saha, B. [Department of Physics, National Institute of Technology Agartala, Jirania, West Tripura 799046 (India); Chattopadhyay, K. K. [Department of Physics, Jadavpur University, Kolkata 700 032 (India)

    2016-05-23

    Spinel-type ferrites have taken a very important role for modern electronic industry. Most of these ferrites exhibit low-loss dielectric properties, high resistivity, low eddy current and also high temperature ferromagnetism. Calcium ferrite is one such important metal oxide which is environmentally safe, chemically stable, low cost and greatly abundant. This outstanding material of calcium ferrite is synthesized by a simple chemical precipitation method using NaOH as the precipitating agent. Ferric chloride anhydrous (FeCl{sub 3}) and Calcium chloride dihydrate (CaCl{sub 2}.2H{sub 2}O) were used as iron and calcium sources respectively. The samples were heated at 200°C for 8h to obtain homogeneous powder of Calcium ferrite. The powders were characterized by using X-ray diffraction (XRD), field emission scanning electron microscope (FESEM), Transmission electrical microscopy (TEM), and Fourier transform infrared spectroscopic (FTIR) measurements. The polycrystalline nature of the sample was confirmed by X-ray diffraction study. The magnetic properties of the sample were investigated by vibrating sample magnetometer (VSM) measurements. Magnetization curve of the prepared sample depicts that as synthesized calcium ferrite nanoparticles have saturation magnetic moment of 1.74 emu/g and the coercivity of 35.08 Oe with superparamagnetic behavior. The synthesized calcium ferrite nanoparticles with such magnetic properties will be a candidate material for different applications in electronics and exploring its functionality in the field of recently developing semiconductor device physics and spintronics.

  3. Studies on magnetic properties of chemically synthesized crystalline calcium ferrite nanoparticles

    International Nuclear Information System (INIS)

    Debnath, A.; Bera, A.; Saha, B.; Chattopadhyay, K. K.

    2016-01-01

    Spinel-type ferrites have taken a very important role for modern electronic industry. Most of these ferrites exhibit low-loss dielectric properties, high resistivity, low eddy current and also high temperature ferromagnetism. Calcium ferrite is one such important metal oxide which is environmentally safe, chemically stable, low cost and greatly abundant. This outstanding material of calcium ferrite is synthesized by a simple chemical precipitation method using NaOH as the precipitating agent. Ferric chloride anhydrous (FeCl_3) and Calcium chloride dihydrate (CaCl_2.2H_2O) were used as iron and calcium sources respectively. The samples were heated at 200°C for 8h to obtain homogeneous powder of Calcium ferrite. The powders were characterized by using X-ray diffraction (XRD), field emission scanning electron microscope (FESEM), Transmission electrical microscopy (TEM), and Fourier transform infrared spectroscopic (FTIR) measurements. The polycrystalline nature of the sample was confirmed by X-ray diffraction study. The magnetic properties of the sample were investigated by vibrating sample magnetometer (VSM) measurements. Magnetization curve of the prepared sample depicts that as synthesized calcium ferrite nanoparticles have saturation magnetic moment of 1.74 emu/g and the coercivity of 35.08 Oe with superparamagnetic behavior. The synthesized calcium ferrite nanoparticles with such magnetic properties will be a candidate material for different applications in electronics and exploring its functionality in the field of recently developing semiconductor device physics and spintronics.

  4. [Association between dietary calcium/dairy intakes and overweight/obesity].

    Science.gov (United States)

    Chen, Yanrong; Liu, Yan; Xue, Hongmei; Bao, Yuxin; Luo, Jiao; Tian, Guo; Cheng, Guo

    2016-05-01

    To investigate the intakes of dietary calcium/dairy and the current prevalence of overweight and obesity among children and adolescents aged 7-15 in Longquanyi District, Chengdu, and to explore the association of dietary calcium and dairy intake with overweight/obesity. 1738 children and adolescents were recruited in the cross-sectional study using cluster random sampling method. Information on dietary calcium and dairy intakes was collected using 24-hour dietary recall and food frequency questionnaire (FFQ). Height, weight and waist circumference were measured to calculate body mass index (BMI)/waist-to-height ratio (WHtR) and body mass index standard deviation (BMI SDS). Overweight/obesity was defined based on the criteria of Working Group on Obesity in China (WGOC). Participants were grouped into 3 categories indicating lower, moderate and higher intakes of dietary calcium and dairy, respectively. The association of dietary calcium and dairy consumption with (BMI SDS) /WHtR and the prevalence of overweight/obesity was analyzed after being stratified by gender and age. The prevalence of overweight/obesity in boys and girls were 11.92%/7.04% and 8.04%/6.30%, respectively. The intake of dietary calcium and dairy in girls were much higher than that in boys (P obesity in boys, however the associations were inconsistent among different age groups. Associations between consumption of calcium, dairy and overweight/obesity were not found among girls.

  5. Dextromethorphan inhibition of voltage-gated proton currents in BV2 microglial cells.

    Science.gov (United States)

    Song, Jin-Ho; Yeh, Jay Z

    2012-05-10

    Dextromethorphan, an antitussive drug, has a neuroprotective property as evidenced by its inhibition of microglial production of pro-inflammatory cytokines and reactive oxygen species. The microglial activation requires NADPH oxidase activity, which is sustained by voltage-gated proton channels in microglia as they dissipate an intracellular acid buildup. In the present study, we examined the effect of dextromethorphan on proton currents in microglial BV2 cells. Dextromethorphan reversibly inhibited proton currents with an IC(50) value of 51.7 μM at an intracellular/extracellular pH gradient of 5.5/7.3. Dextromethorphan did not change the reversal potential or the voltage dependence of the gating. Dextrorphan and 3-hydroxymorphinan, major metabolites of dextromethorphan, and dextromethorphan methiodide were ineffective in inhibiting proton currents. The results indicate that dextromethorphan inhibition of proton currents would suppress NADPH oxidase activity and, eventually, microglial activation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. An overview of techniques for the measurement of calcium distribution, calcium fluxes, and cytosolic free calcium in mammalian cells

    International Nuclear Information System (INIS)

    Borle, A.B.

    1990-01-01

    An array of techniques can be used to study cell calcium metabolism that comprises several calcium compartments and many types of transport systems such as ion channels, ATP-dependent pumps, and antiporters. The measurement of total call calcium brings little information of value since 60 to 80% of total cell calcium is actually bound to the extracellular glycocalyx. Cell fractionation and differential centrifugation have been used to study intracellular Ca 2+ compartmentalization, but the methods suffer from the possibility of Ca 2+ loss or redistribution among cell fractions. Steady-state kinetic analyses of 45 Ca uptake or desaturation curves have been used to study the distribution of Ca 2+ among various kinetic pools in living cells and their rate of Ca 2+ exchange, but the analyses are constrained by many limitations. Nonsteady-state tracer studies can provide information about rapid changes in calcium influx or efflux in and out of the cell. Zero-time kinetics of 45 Ca uptake can detect instantaneous changes in calcium influx, while 45 Ca fractional efflux ratio, can detect rapid stimulations or inhibitions of calcium efflux out of cells. The best strategy to study cell calcium metabolism is to use several different methods that focus on a specific problem from widely different angles

  7. Pharmacological modulation of mitochondrial calcium homeostasis.

    Science.gov (United States)

    Arduino, Daniela M; Perocchi, Fabiana

    2018-01-10

    Mitochondria are pivotal organelles in calcium (Ca 2+ ) handling and signalling, constituting intracellular checkpoints for numerous processes that are vital for cell life. Alterations in mitochondrial Ca 2+ homeostasis have been linked to a variety of pathological conditions and are critical in the aetiology of several human diseases. Efforts have been taken to harness mitochondrial Ca 2+ transport mechanisms for therapeutic intervention, but pharmacological compounds that direct and selectively modulate mitochondrial Ca 2+ homeostasis are currently lacking. New avenues have, however, emerged with the breakthrough discoveries on the genetic identification of the main players involved in mitochondrial Ca 2+ influx and efflux pathways and with recent hints towards a deep understanding of the function of these molecular systems. Here, we review the current advances in the understanding of the mechanisms and regulation of mitochondrial Ca 2+ homeostasis and its contribution to physiology and human disease. We also introduce and comment on the recent progress towards a systems-level pharmacological targeting of mitochondrial Ca 2+ homeostasis. © 2018 The Authors. The Journal of Physiology © 2018 The Physiological Society.

  8. Research applications of calcium-47

    International Nuclear Information System (INIS)

    1962-01-01

    The possibility of using the isotope calcium-47 for calcium metabolism investigation was discussed. It seemed particularly suited for this purpose since it has a half-life of only 4.7 days; it is, moreover, a strong gamma-emitter which permits easy detection of very small quantities from outside the body. It was, however, produced on an experimental basis only and at a price of US $1400 per mC which was beyond the financial possibilities of almost any medical research institution or hospital. In view of IAEA's mandate to promote isotope research in the fields of radiobiology and medicine the participants asked the Agency to carry out a programme of encouraging research that might lead to cheaper methods of producing this isotope and of assisting in its practical applications in diagnosis and clinical research. The Agency took up this suggestion and the way it has pursued the project might be considered characteristic of its methods of dealing with such problems on an international scale

  9. Research applications of calcium-47

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1962-04-15

    The possibility of using the isotope calcium-47 for calcium metabolism investigation was discussed. It seemed particularly suited for this purpose since it has a half-life of only 4.7 days; it is, moreover, a strong gamma-emitter which permits easy detection of very small quantities from outside the body. It was, however, produced on an experimental basis only and at a price of US $1400 per mC which was beyond the financial possibilities of almost any medical research institution or hospital. In view of IAEA's mandate to promote isotope research in the fields of radiobiology and medicine the participants asked the Agency to carry out a programme of encouraging research that might lead to cheaper methods of producing this isotope and of assisting in its practical applications in diagnosis and clinical research. The Agency took up this suggestion and the way it has pursued the project might be considered characteristic of its methods of dealing with such problems on an international scale

  10. Crosstalk between KCNK3-Mediated Ion Current and Adrenergic Signaling Regulates Adipose Thermogenesis and Obesity.

    Science.gov (United States)

    Chen, Yi; Zeng, Xing; Huang, Xuan; Serag, Sara; Woolf, Clifford J; Spiegelman, Bruce M

    2017-11-02

    Adrenergic stimulation promotes lipid mobilization and oxidation in brown and beige adipocytes, where the harnessed energy is dissipated as heat in a process known as adaptive thermogenesis. The signaling cascades and energy-dissipating pathways that facilitate thermogenesis have been extensively described, yet little is known about the counterbalancing negative regulatory mechanisms. Here, we identify a two-pore-domain potassium channel, KCNK3, as a built-in rheostat negatively regulating thermogenesis. Kcnk3 is transcriptionally wired into the thermogenic program by PRDM16, a master regulator of thermogenesis. KCNK3 antagonizes norepinephrine-induced membrane depolarization by promoting potassium efflux in brown adipocytes. This limits calcium influx through voltage-dependent calcium channels and dampens adrenergic signaling, thereby attenuating lipolysis and thermogenic respiration. Adipose-specific Kcnk3 knockout mice display increased energy expenditure and are resistant to hypothermia and obesity. These findings uncover a critical K + -Ca 2+ -adrenergic signaling axis that acts to dampen thermogenesis, maintain tissue homeostasis, and reveal an electrophysiological regulatory mechanism of adipocyte function. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Codissolution of calcium hydrogenphosphate and sodium hydrogencitrate in water. Spontaneous supersaturation of calcium citrate increasing calcium bioavailability

    DEFF Research Database (Denmark)

    Hedegaard, Martina Vavrusova; Danielsen, Bente Pia; Garcia, André Castilho

    2018-01-01

    The sparingly soluble calcium hydrogenphosphate dihydrate, co-dissolving in water during dissolution of freely soluble sodium hydrogencitrate sesquihydrate as caused by proton transfer from hydrogencitrate to hydrogenphosphate, was found to form homogenous solutions supersaturated by a factor up...... to 8 in calcium citrate tetrahydrate. A critical hydrogencitrate concentration for formation of homogeneous solutions was found to depend linearly on dissolved calcium hydrogenphosphate: [HCitr2-] = 14[CaHPO4] - 0.05 at 25 °C. The lag phase for precipitation of calcium citrate tetrahydrate......, as identified from FT-IR spectra, from these spontaneously formed supersaturated solutions was several hours, and the time to reach solubility equilibrium was several days. Initial calcium ion activity was found to be almost independent of the degree of supersaturation as determined electrochemically...

  12. Block of the delayed rectifier current (IK) by the 5-HT3 antagonists ondansetron and granisetron in feline ventricular myocytes.

    Science.gov (United States)

    de Lorenzi, F G; Bridal, T R; Spinelli, W

    1994-01-01

    1. We investigated the effects of two 5-HT3 antagonists, ondansetron and granisetron, on the action potential duration (APD) and the delayed rectifier current (IK) of feline isolated ventricular myocytes. Whole-cell current and action potential recordings were performed at 37 degrees C with the patch clamp technique. 2. Ondansetron and granisetron blocked IK with a KD of 1.7 +/- 1.0 and 4.3 +/- 1.7 microM, respectively. At a higher concentration (30 microM), both drugs blocked the inward rectifier (IKl). 3. The block of IK was dependent on channel activation. Both drugs slowed the decay of IK tail currents and produced a crossover with the pre-drug current trace. These results are consistent with block and unblock from the open state of the channel. 4. Granisetron showed an intrinsic voltage-dependence as the block increased with depolarization. The equivalent voltage-dependency of block (delta) was 0.10 +/- 0.04, suggesting that granisetron blocks from the intracellular side at a binding site located 10% across the transmembrane electrical field. 5. Ondansetron (1 microM) and granisetron (3 microM) prolonged APD by about 30% at 0.5 Hz. The prolongation of APD by ondansetron was abolished at faster frequencies (3 Hz) showing reverse rate dependence. 6. In conclusion, the 5-HT3 antagonists, ondansetron and granisetron, are open state blockers of the ventricular delayed rectifier and show a clear class III action. PMID:7834204

  13. Presenilin-mediated modulation of capacitative calcium entry.

    Science.gov (United States)

    Yoo, A S; Cheng, I; Chung, S; Grenfell, T Z; Lee, H; Pack-Chung, E; Handler, M; Shen, J; Xia, W; Tesco, G; Saunders, A J; Ding, K; Frosch, M P; Tanzi, R E; Kim, T W

    2000-09-01

    We studied a novel function of the presenilins (PS1 and PS2) in governing capacitative calcium entry (CCE), a refilling mechanism for depleted intracellular calcium stores. Abrogation of functional PS1, by either knocking out PS1 or expressing inactive PS1, markedly potentiated CCE, suggesting a role for PS1 in the modulation of CCE. In contrast, familial Alzheimer's disease (FAD)-linked mutant PS1 or PS2 significantly attenuated CCE and store depletion-activated currents. While inhibition of CCE selectively increased the amyloidogenic amyloid beta peptide (Abeta42), increased accumulation of the peptide had no effect on CCE. Thus, reduced CCE is most likely an early cellular event leading to increased Abeta42 generation associated with FAD mutant presenilins. Our data indicate that the CCE pathway is a novel therapeutic target for Alzheimer's disease.

  14. ALG-2, a multifunctional calcium binding protein?

    DEFF Research Database (Denmark)

    Tarabykina, Svetlana; Mollerup, Jens; Winding Gojkovic, P.

    2004-01-01

    ALG-2 was originally discovered as a pro-apoptotic protein in a genetic screen. Due to its ability to bind calcium with high affinity it was postulated to provide a link between the known effect of calcium in programmed cell death and the molecular death execution machinery. This review article...

  15. CALCIUM AND THE PREVENTION OF COLON CANCER

    NARCIS (Netherlands)

    WELBERG, JWM; KLEIBEUKER, JH; VANDERMEER, R; MULDER, NH; DEVRIES, EGE

    1991-01-01

    Diet is a major determinant of colon cancer risk. Calcium may protect against colon cancer, presumably by binding cytotoxic bile acids and fatty acids. Numerous studies support this proposition. In subjects at risk for colon cancer oral calcium supplementation has been shown to reduce rectal

  16. Comparison of Serum Calcium and Magnesium Between ...

    African Journals Online (AJOL)

    Background: Evidence suggests the involvement of calcium and magnesium metabolism in the pathophysiology of preeclampsia. However, findings from studies are heterogenous and inconsistent. Aim: The study aimed to compare the total serum calcium and magnesium levels in preeclamptic women with that of ...

  17. Fast kinetics of calcium dissociation from calsequestrin

    Directory of Open Access Journals (Sweden)

    MARIANELA BELTRÁN

    2006-01-01

    Full Text Available We measured the kinetics of calcium dissociation from calsequestrin in solution or forming part of isolated junctional sarcoplasmic reticulum membranes by mixing calsequestrin equilibrated with calcium with calcium-free solutions in a stopped-flow system. In parallel, we measured the kinetics of the intrinsic fluorescence changes that take place following calcium dissociation from calsequestrin. We found that at 25ºC calcium dissociation was 10-fold faster for calsequestrin attached to junctional membranes (k = 109 s-1 than in solution. These results imply that calcium dissociation from calsequestrin in vivo is not rate limiting during excitation-contraction coupling. In addition, we found that the intrinsic fluorescence decrease for calsequestrin in solution or forming part of junctional membranes was significantly slower than the rates of calcium dissociation. The kinetics of intrinsic fluorescence changes had two components for calsequestrin associated to junctional membranes and only one for calsequestrin in solution; the faster component was 8-fold faster (k = 54.1 s-1 than the slower component (k = 6.9 s-1, which had the same k value as for calsequestrin in solution. These combined results suggest that the presence of calsequestrin at high concentrations in a restricted space, such as when bound to the junctional membrane, accelerates calcium dissociation and the resulting structural changes, presumably as a result of cooperative molecular interactions.

  18. Calcium, snails, and birds: a case study

    Directory of Open Access Journals (Sweden)

    R. Mänd

    2000-10-01

    Full Text Available Recent studies have shown that wild birds breeding in acidified areas have difficulties with obtaining sufficient calcium for their eggshells, and that the cause of it is the shortage of land snails. Many birds have to search for Ca-rich snail shells on a daily basis during egg production. Molluscs depend on litter calcium, which has decreased due to acidification of the environment. Calcium limitation may be a widespread phenomenon also in non-acidified, naturally Ca-poor areas. The problem is that while in the latter areas the time for development of specific adaptations may have been sufficient, then in acidified areas, on the contrary, calcium shortage is a recent phenomenon. Therefore, since the extent of calcium limitation in non-acidified areas is hard to derive from observational data, experimental approach is needed. We provide experimental evidence that specific calcium deficit does affect reproductive traits also in the birds breeding in naturally base-poor habitats. Our study was conducted in a heterogeneous woodland area in Estonia containing deciduous forest patches as well as base-poor pine forest with low snail abundance. Ca supplementation, using snail shell and chicken eggshell fragments, was carried out for pied flycatchers and great tits. Extra calcium affected positively several reproductive traits like egg volume and eggshell thickness, start of breeding, and fledglings’ parameters. The negative relationship between calcium availability and lay-date suggests that birds adjust their breeding tactics to conditions of Ca deficiency, for example, by postponing laying.

  19. In vivo calcium metabolism by IRMS

    Science.gov (United States)

    Public policy initiatives related to enhancing the health of populations, increasingly seek to identify meaningful biological outcomes on which to determine age-related nutritional requirements. For calcium, the primary outcome of interest is the availability of calcium in the diet for bone formatio...

  20. 21 CFR 172.715 - Calcium lignosulfonate.

    Science.gov (United States)

    2010-04-01

    ... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Other Specific Usage Additives § 172.715 Calcium lignosulfonate. Calcium lignosulfonate may be...

  1. Sensory analysis of calcium-biofortified lettuce

    Science.gov (United States)

    Vegetables represent an attractive means of providing increased calcium nutrition to the public. In this study, it was demonstrated that lettuce expressing the deregulated Arabidopsis H(+)/Ca(2+) transporter sCAX1 (cation exchanger 1) contained 25-32% more calcium than controls. These biofortified l...

  2. 21 CFR 184.1187 - Calcium alginate.

    Science.gov (United States)

    2010-04-01

    ... ingredient is used in food only within the following specific limitations: Category of food Maximum level of... other food categories 0.3 Do. (d) Prior sanctions for calcium alginate different from the uses... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium alginate. 184.1187 Section 184.1187 Food...

  3. Calcium supplementation in osteoporosis: useful or harmful?

    Science.gov (United States)

    Chiodini, Iacopo; Bolland, Mark J

    2018-04-01

    Osteoporosis and fragility fractures are important social and economic problems worldwide and are due to both the loss of bone mineral density and sarcopenia. Indeed, fragility fractures are associated with increased disability, morbidity and mortality. It is known that a normal calcium balance together with a normal vitamin D status is important for maintaining well-balanced bone metabolism, and for many years, calcium and vitamin D have been considered crucial in the prevention and treatment of osteoporosis. However, recently, the usefulness of calcium supplementation (alone or with concomitant vitamin D) has been questioned, since some studies reported only weak efficacy of these supplementations in reducing fragility fracture risk. On the other hand, besides the gastrointestinal side effects of calcium supplements and the risk of kidney stones related to use of co-administered calcium and vitamin D supplements, other recent data suggested potential adverse cardiovascular effects from calcium supplementation. This debate article is focused on the evidence regarding both the possible usefulness for bone health and the potential harmful effects of calcium and/or calcium with vitamin D supplementation. © 2018 European Society of Endocrinology.

  4. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  5. Oligofructose stimulates calcium absorption in adolescents

    NARCIS (Netherlands)

    Heuvel, E.G.H.M. van den; Muys, T.; Dokkum, W. van; Schaafsma, G.

    1999-01-01

    Background: In rats, nondigestible oligosaccharides stimulate calcium absorption. Recently, this effect was also found in human subjects. Objective: The objective of the study was to investigate whether consumption of 15 g oligofructose/d stimulates calcium absorption in male adolescents. Design:

  6. Rates of calcium carbonate removal from soils.

    NARCIS (Netherlands)

    Breemen, van N.; Protz, R.

    1988-01-01

    Mean annual rates of calcium carbonate removal from soils in a subarctic climate estimated from data on two chronosequences of calcareous storm ridges, appeared to be relatively constant through time. Concentrations of dissolved calcium carbonate in the soil solution in the study sites calculated

  7. Phosphorus Balance in Adolescent Girls and the Effect of Supplemental Dietary Calcium.

    Science.gov (United States)

    Vorland, Colby J; Martin, Berdine R; Weaver, Connie M; Peacock, Munro; Gallant, Kathleen M Hill

    2018-03-01

    There are limited data on phosphorus balance and the effect of dietary calcium supplements on phosphorus balance in adolescents. The purpose of this study was to determine phosphorus balance and the effect of increasing dietary calcium intake with a supplement on net phosphorus absorption and balance in healthy adolescent girls. This study utilized stored urine, fecal, and diet samples from a previously conducted study that focused on calcium balance. Eleven healthy girls ages 11 to 14 years participated in a randomized crossover study, which consisted of two 3-week periods of a controlled diet with low (817 ± 19.5 mg/d) or high (1418 ± 11.1 mg/d) calcium, separated by a 1-week washout period. Phosphorus intake was controlled at the same level during both placebo and calcium supplementation (1435 ± 23.5 and 1453 ± 28.0 mg/d, respectively, p = 0.611). Mean phosphorus balance was positive by about 200 mg/d and was unaffected by the calcium supplement ( p = 0.826). Urinary phosphorus excretion was lower with the calcium supplement (535 ± 42 versus 649 ± 41 mg/d, p = 0.013), but fecal phosphorus and net phosphorus absorption were not significantly different between placebo and calcium supplement (553 ± 60 versus 678 ± 63 versus mg/d, p = 0.143; 876 ± 62 versus 774 ± 64 mg/d, p = 0.231, respectively). Dietary phosphorus underestimates using a nutrient database compared with the content measured chemically from meal composites by ~40%. These results show that phosphorus balance is positive in girls during adolescent growth and that a calcium dietary supplement to near the current recommended level does not affect phosphorus balance when phosphorus intake is at 1400 mg/d, a typical US intake level. © 2017 American Society for Bone and Mineral Research.

  8. Calcium intake is not associated with increased coronary artery calcification: the Framingham Study.

    Science.gov (United States)

    Samelson, Elizabeth J; Booth, Sarah L; Fox, Caroline S; Tucker, Katherine L; Wang, Thomas J; Hoffmann, Udo; Cupples, L Adrienne; O'Donnell, Christopher J; Kiel, Douglas P

    2012-12-01

    Adequate calcium intake is known to protect the skeleton. However, studies that have reported adverse effects of calcium supplementation on vascular events have raised widespread concern. We assessed the association between calcium intake (from diet and supplements) and coronary artery calcification, which is a measure of atherosclerosis that predicts risk of ischemic heart disease independent of other risk factors. This was an observational, prospective cohort study. Participants included 690 women and 588 men in the Framingham Offspring Study (mean age: 60 y; range: 36-83 y) who attended clinic visits and completed food-frequency questionnaires in 1998-2001 and underwent computed tomography scans 4 y later in 2002-2005. The mean age-adjusted coronary artery-calcification Agatston score decreased with increasing total calcium intake, and the trend was not significant after adjustment for age, BMI, smoking, alcohol consumption, vitamin D-supplement use, energy intake, and, for women, menopause status and estrogen use. Multivariable-adjusted mean Agatston scores were 2.36, 2.52, 2.16, and 2.39 (P-trend = 0.74) with an increasing quartile of total calcium intake in women and 4.32, 4.39, 4.19, and 4.37 (P-trend = 0.94) in men, respectively. Results were similar for dietary calcium and calcium supplement use. Our study does not support the hypothesis that high calcium intake increases coronary artery calcification, which is an important measure of atherosclerosis burden. The evidence is not sufficient to modify current recommendations for calcium intake to protect skeletal health with respect to vascular calcification risk.

  9. Development of novel titanium nitride-based decorative coatings by calcium addition

    Energy Technology Data Exchange (ETDEWEB)

    Hodroj, A. [Institut Jean Lamour, CNRS UMR 7198, Departement CP2S, Ecole des Mines, Parc de Saurupt, CS 14234, 54042 Nancy cedex (France); Pierson, J.F., E-mail: jean-francois.pierson@ijl.nancy-universite.fr [Institut Jean Lamour, CNRS UMR 7198, Departement CP2S, Ecole des Mines, Parc de Saurupt, CS 14234, 54042 Nancy cedex (France)

    2011-08-01

    Calcium was added into titanium nitride coatings deposited using a hybrid magnetron sputtering-arc evaporation process. The calcium content in the films was adjusted by the variation of the pulsed DC current applied to the Ca sputtering target. X-ray diffraction analyses suggested that the increase of the calcium content induced the partial substitution of titanium atoms by calcium ones in the TiN lattice and a refinement of the grain size. Optical reflectance investigations showed that the absorption band of TiN was shifted towards higher wavelengths and that (Ti,Ca)N coatings may be suitable for decorative applications. Finally, the decrease of the film reflectivity was interpreted as a consequence of a free electron concentration decrease as confirmed from electrical resistivity measurements.

  10. Development of novel titanium nitride-based decorative coatings by calcium addition

    International Nuclear Information System (INIS)

    Hodroj, A.; Pierson, J.F.

    2011-01-01

    Calcium was added into titanium nitride coatings deposited using a hybrid magnetron sputtering-arc evaporation process. The calcium content in the films was adjusted by the variation of the pulsed DC current applied to the Ca sputtering target. X-ray diffraction analyses suggested that the increase of the calcium content induced the partial substitution of titanium atoms by calcium ones in the TiN lattice and a refinement of the grain size. Optical reflectance investigations showed that the absorption band of TiN was shifted towards higher wavelengths and that (Ti,Ca)N coatings may be suitable for decorative applications. Finally, the decrease of the film reflectivity was interpreted as a consequence of a free electron concentration decrease as confirmed from electrical resistivity measurements.

  11. The impact of the presence on global markets of calcium carbide originating from China on other industry role players: the case of sa calcium carbide (PTY LTD

    Directory of Open Access Journals (Sweden)

    Royce Sitshonile Mazo

    2017-12-01

    Full Text Available This research assesses how the presence of calcium carbide originating from China has impacted on the operations of other role players in the industry. SA Calcium Carbide (Pty Ltd. located in Newcastle, South Africa, was used as a case study. The study spanned all markets where the company has a footprint meaning domestically, regionally and internationally. The aim of the study was to discern the extent to which companies like SA Calcium Carbide have been affected by the presence of products from China on the global market with special focus being put on the competitiveness in terms of pricing of products. The study used a survey strategy, and was exploratory in nature. The choice of the survey strategy was motivated by the need to collect both quantitative and qualitative data in order to meet the research objectives. The data was gathered, with an 80 percent response rate, using a questionnaire method from more than 70 current SA Calcium Carbide customers both from the domestic and the export side of the business. In order to consider the different perspectives of the whole scenario, 10 companies involved in either manufacturing or trading of Chinese manufactured calcium carbide were interviewed, some face to face and some telephonically. The study revealed that current customers, who are predominantly from the African continent, buy product from SA Calcium Carbide primarily because of its high quality. It also evident from the results that the export volumes of SA Calcium Carbide were on a gradual downward trend due to loss of market share to Chinese companies

  12. RNA-Seq analysis identifies potential modulators of gravity response in Ceratopteris spores: Evidence for modulation by calcium pumps and apyrase activity

    Data.gov (United States)

    National Aeronautics and Space Administration — Gravity regulates the magnitude and direction of a trans-cell calcium current in germinating spores of Ceratopteris richardii. Blocking this current with nifedipine...

  13. The calcium and vitamin D controversy

    DEFF Research Database (Denmark)

    Abrahamsen, Bo

    2017-01-01

    Areas of the world where vitamin D levels are low for months of the year and intakes of calcium are high have a high prevalence of osteoporosis and cardiovascular disease. This suggests a public health message of avoiding calcium supplements and increasing vitamin D intake. No message could be more...... welcome as vitamin D can be given as a bolus while calcium must be taken daily and may be poorly tolerated. This approach is based on no evidence from intervention studies. Randomized controlled trials (RCTs) suggest that vitamin D given with calcium elicits a small reduction in fracture risk and deaths....... This has not been demonstrated for D given alone. The cardiovascular safety of calcium and vitamin D (CaD) supplements is difficult to ascertain due to weaknesses in RCT designs and adjudication that cannot be remedied by subanalysis. Moreover, no major new RCTs are in process to provide better evidence...

  14. Voltage sensitivity of M2 muscarinic receptors underlies the delayed rectifier-like activation of ACh-gated K(+) current by choline in feline atrial myocytes.

    Science.gov (United States)

    Navarro-Polanco, Ricardo A; Aréchiga-Figueroa, Iván A; Salazar-Fajardo, Pedro D; Benavides-Haro, Dora E; Rodríguez-Elías, Julio C; Sachse, Frank B; Tristani-Firouzi, Martin; Sánchez-Chapula, José A; Moreno-Galindo, Eloy G

    2013-09-01

    Choline (Ch) is a precursor and metabolite of the neurotransmitter acetylcholine (ACh). In canine and guinea pig atrial myocytes, Ch was shown to activate an outward K(+) current in a delayed rectifier fashion. This current has been suggested to modulate cardiac electrical activity and to play a role in atrial fibrillation pathophysiology. However, the exact nature and identity of this current has not been convincingly established. We recently described the unique ligand- and voltage-dependent properties of muscarinic activation of ACh-activated K(+) current (IKACh) and showed that, in contrast to ACh, pilocarpine induces a current with delayed rectifier-like properties with membrane depolarization. Here, we tested the hypothesis that Ch activates IKACh in feline atrial myocytes in a voltage-dependent manner similar to pilocarpine. Single-channel recordings, biophysical profiles, specific pharmacological inhibition and computational data indicate that the current activated by Ch is IKACh. Moreover, we show that membrane depolarization increases the potency and efficacy of IKACh activation by Ch and thus gives the appearance of a delayed rectifier activating K(+) current at depolarized potentials. Our findings support the emerging concept that IKACh modulation is both voltage- and ligand-specific and reinforce the importance of these properties in understanding cardiac physiology.

  15. Oral calcium carbonate affects calcium but not phosphorus balance in stage 3–4 chronic kidney disease

    Science.gov (United States)

    Hill, Kathleen M.; Martin, Berdine R.; Wastney, Meryl; McCabe, George P.; Moe, Sharon M.; Weaver, Connie M.; Peacock, Munro

    2014-01-01

    Chronic kidney disease (CKD) patients are given calcium carbonate to bind dietary phosphorus and reduce phosphorus retention, and to prevent negative calcium balance. Data are limited on calcium and phosphorus balance in CKD to support this. The aim of this study was to determine calcium and phosphorus balance and calcium kinetics with and without calcium carbonate in CKD patients. Eight stage 3/4 CKD patients, eGFR 36 mL/min, participated in two 3-week balances in a randomized placebo-controlled cross-over study of calcium carbonate (1500 mg/d calcium). Calcium and phosphorus balance were determined on a controlled diet. Oral and intravenous 45calcium with blood sampling and urine and fecal collections were used for calcium kinetics. Fasting blood and urine were collected at baseline and end of each week of each balance period for biochemical analyses. Results showed that patients were in neutral calcium and phosphorus balance while on placebo. Calcium carbonate produced positive calcium balance, did not affect phosphorus balance, and produced only a modest reduction in urine phosphorus excretion compared with placebo. Calcium kinetics demonstrated positive net bone balance but less than overall calcium balance suggesting tissue deposition. Fasting biochemistries of calcium and phosphate homeostasis were unaffected by calcium carbonate. If they can be extrapolated to effects of chronic therapy, these data caution against the use of calcium carbonate as a phosphate binder. PMID:23254903

  16. Does bipolar pacemaker current activate blood platelets?

    DEFF Research Database (Denmark)

    Gjesdal, Grunde; Hansen, Annebirthe Bo; Brandes, Axel

    2009-01-01

    OBJECTIVE: The aim of this study was to investigate whether bipolar pacemaker current lead can activate blood platelets. The null hypothesis was that 1 minute of electrical stimulation of platelets would not influence their subsequent reactivity to adenosine diphosphate (ADP). BACKGROUND: Both...... platelets and muscle cells contain actin and myosin filaments, and both cells are activated following calcium influx. Muscle cells open their calcium channels and contract when exposed to an electric current. Current through a bipolar pacemaker lead will expose a small volume of blood, including platelets......, to the depolarizing current. Platelet activation may ensue, resulting in aggregation, release reaction, and contraction. In contrast, a unipolar pacemaker system will not depolarize blood, but transmit current directly into the myocardium, and the current afterward passes through other tissues before returning...

  17. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  18. Calcium-sensitive immunoaffinity chromatography

    DEFF Research Database (Denmark)

    Henriksen, Maiken L; Lindhardt Madsen, Kirstine; Skjoedt, Karsten

    2014-01-01

    Immunoaffinity chromatography is a powerful fractionation technique that has become indispensable for protein purification and characterization. However, it is difficult to retrieve bound proteins without using harsh or denaturing elution conditions, and the purification of scarce antigens...... to homogeneity may be impossible due to contamination with abundant antigens. In this study, we purified the scarce, complement-associated plasma protein complex, collectin LK (CL-LK, complex of collectin liver 1 and kidney 1), by immunoaffinity chromatography using a calcium-sensitive anti-collectin-kidney-1 m...... chromatography was superior to the traditional immunoaffinity chromatographies and resulted in a nine-fold improvement of the purification factor. The technique is applicable for the purification of proteins in complex mixtures by single-step fractionation without the denaturation of eluted antigens...

  19. Oxalate: Effect on calcium absorbability

    International Nuclear Information System (INIS)

    Heaney, R.P.; Weaver, C.M.

    1989-01-01

    Absorption of calcium from intrinsically labeled Ca oxalate was measured in 18 normal women and compared with absorption of Ca from milk in these same subjects, both when the test substances were ingested in separate meals and when ingested together. Fractional Ca absorption from oxalate averaged 0.100 +/- 0.043 when ingested alone and 0.140 +/- 0.063 when ingested together with milk. Absorption was, as expected, substantially lower than absorption from milk (0.358 +/- 0.113). Nevertheless Ca oxalate absorbability in these women was higher than we had previously found for spinach Ca. When milk and Ca oxalate were ingested together, there was no interference of oxalate in milk Ca absorption and no evidence of tracer exchange between the two labeled Ca species

  20. Diagnosis and assessment of skeletal related disease using calcium 41

    Science.gov (United States)

    Hillegonds, Darren J [Oakland, CA; Vogel, John S [San Jose, CA; Fitzgerald, Robert L [Encinitas, CA; Deftos, Leonard J [Del Mar, CA; Herold, David [Del Mar, CA; Burton, Douglas W [San Diego, CA

    2012-05-15

    A method of determining calcium metabolism in a patient comprises the steps of administering radioactive calcium isotope .sup.41Ca to the patient, allowing a period of time to elapse sufficient for dissemination and reaction of the radioactive calcium isotope .sup.41Ca by the patient, obtaining a sample of the radioactive calcium isotope .sup.41Ca from the patient, isolating the calcium content of the sample in a form suitable for precise measurement of isotopic calcium concentrations, and measuring the calcium content to determine parameters of calcium metabolism in the patient.

  1. Calcium Blood Test: MedlinePlus Lab Test Information

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Calcium, Serum; Calcium and Phosphates, Urine; ...

  2. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  3. The Hepatitis B Virus X Protein Elevates Cytosolic Calcium Signals by Modulating Mitochondrial Calcium Uptake

    Science.gov (United States)

    Yang, Bei

    2012-01-01

    Chronic hepatitis B virus (HBV) infections are associated with the development of hepatocellular carcinoma (HCC). The HBV X protein (HBx) is thought to play an important role in the development of HBV-associated HCC. One fundamental HBx function is elevation of cytosolic calcium signals; this HBx activity has been linked to HBx stimulation of cell proliferation and transcription pathways, as well as HBV replication. Exactly how HBx elevates cytosolic calcium signals is not clear. The studies described here show that HBx stimulates calcium entry into cells, resulting in an increased plateau level of inositol 1,4,5-triphosphate (IP3)-linked calcium signals. This increased calcium plateau can be inhibited by blocking mitochondrial calcium uptake and store-operated calcium entry (SOCE). Blocking SOCE also reduced HBV replication. Finally, these studies also demonstrate that there is increased mitochondrial calcium uptake in HBx-expressing cells. Cumulatively, these studies suggest that HBx can increase mitochondrial calcium uptake and promote increased SOCE to sustain higher cytosolic calcium and stimulate HBV replication. PMID:22031934

  4. Chapter 15. Measurement of the main calcium metabolism processes

    International Nuclear Information System (INIS)

    Milhaud, G.

    1975-01-01

    A method of measuring the chief calcium metabolism processes in man is described and is based on the following techniques and theory: intraveinous injection of 45 Ca; determination of the specific radioactivity of serum calcium, total radioactivity of urine and stools, ingested and excreted calcium; mathematical analysis of the specific radioactivity decay curve for serum calcium. The following data were obtained in this way: intestinal absorption fraction of calcium in the chemical state in which it is found in foods; quantity of calcium excreted by the intestin, as distinct from the non-absorbed fraction; physiological turnover rates in the skeleton by osteolysis and osteoblastosis; mass of rapidly exchangeable calcium in the organism, i.e. the calcium pool; rates of exchange with serum calcium of calcium from the different pool components, mass of bone calcium subjected to recrystallisation. Some applications of the method in man and the verification of the theory in rats are reported [fr

  5. Calcium phosphates: what is the evidence?

    Science.gov (United States)

    Larsson, Sune

    2010-03-01

    A number of different calcium phosphate compounds such as calcium phosphate cements and solid beta-tricalcium phosphate products have been introduced during the last decade. The chemical composition mimics the mineral phase of bone and as a result of this likeness, the materials seem to be remodeled as for normal bone through a cell-mediated process that involves osteoclastic activity. This is a major difference when compared with, for instance, calcium sulphate compounds that after implantation dissolve irrespective of the new bone formation rate. Calcium phosphates are highly biocompatible and in addition, they act as synthetic osteoconductive scaffolds after implantation in bone. When placed adjacent to bone, osteoid is formed directly on the surface of the calcium phosphate with no soft tissue interposed. Remodeling is slow and incomplete, but by adding more and larger pores, like in ultraporous beta-tricalcium phosphate, complete or nearly complete resorption can be achieved. The indications explored so far include filling of metaphyseal fracture voids or bone cysts, a volume expander in conjunction with inductive products, and as a carrier for various growth factors and antibiotics. Calcium phosphate compounds such as calcium phosphate cement and beta-tricalcium phosphate will most certainly be part of the future armamentarium when dealing with fracture treatment. It is reasonable to believe that we have so far only seen the beginning when it comes to clinical applications.

  6. Transgenic plants with increased calcium stores

    Science.gov (United States)

    Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

    2004-01-01

    The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

  7. Effect of calcium intake on urinary oxalate excretion in calcium stone-forming patients

    Directory of Open Access Journals (Sweden)

    Nishiura J.L.

    2002-01-01

    Full Text Available Dietary calcium lowers the risk of nephrolithiasis due to a decreased absorption of dietary oxalate that is bound by intestinal calcium. The aim of the present study was to evaluate oxaluria in normocalciuric and hypercalciuric lithiasic patients under different calcium intake. Fifty patients (26 females and 24 males, 41 ± 10 years old, whose 4-day dietary records revealed a regular low calcium intake (<=500 mg/day, received an oral calcium load (1 g/day for 7 days. A 24-h urine was obtained before and after load and according to the calciuria under both diets, patients were considered as normocalciuric (NC, N = 15, diet-dependent hypercalciuric (DDHC, N = 9 or diet-independent hypercalciuric (DIHC, N = 26. On regular diet, mean oxaluria was 30 ± 14 mg/24 h for all patients. The 7-day calcium load induced a significant decrease in mean oxaluria compared to the regular diet in NC and DIHC (20 ± 12 vs 26 ± 7 and 27 ± 18 vs 32 ± 15 mg/24 h, respectively, P<0.05 but not in DDHC patients (22 ± 10 vs 23 ± 5 mg/24 h. The lack of an oxalate decrease among DDHC patients after the calcium load might have been due to higher calcium absorption under higher calcium supply, with a consequent lower amount of calcium left in the intestine to bind with oxalate. These data suggest that a long-lasting regular calcium consumption <500 mg was not associated with high oxaluria and that a subpopulation of hypercalciuric patients who presented a higher intestinal calcium absorption (DDHC tended to hyperabsorb oxalate as well, so that oxaluria did not change under different calcium intake.

  8. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture*

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M.; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-01-01

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. PMID:26231212

  9. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture.

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-09-18

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Determining attitudinal and behavioral factors concerning milk and dairy intake and their association with calcium intake in college students.

    Science.gov (United States)

    Rose, Angela M; Williams, Rachel A; Rengers, Brooke; Kennel, Julie A; Gunther, Carolyn

    2018-04-01

    Average intake of calcium among college students is below the recommended intake, and knowledge surrounding the attitudinal and behavioral factors that influence milk and dairy intake, a primary food source of calcium, is limited. The purpose of this study was to evaluate college students' attitudes and behaviors concerning milk and dairy consumption and their association with calcium intake. Participants were 1,730 undergraduate students who completed an online survey (SurveyMonkey) as part of baseline data collection for a social marketing dairy campaign. The online survey assessed attitudes and behaviors concerning milk and dairy intake, and calcium intake. Questions about milk- and dairy-related attitudes and behaviors were grouped into 14 factors using factor analysis. Predictors of calcium intake were then evaluated. Median calcium intake across all participants was 928.6 mg/day, with males consuming higher calcium intakes than females ( P negative-parent rules concerning milk ( P = 0.031) and viewing milk in dining halls negatively ( P = 0.05). Calcium intakes among college students enrolled in the current study was below the recommended dietary allowance of 1,000 mg/day, reinforcing the need for dietary interventions in this target population, especially females. Practitioners and researchers should consider the factors found here to impact calcium intake, particularly associating milk with specific eating occasions (e.g., milk with breakfast) and having calcium-rich foods available in the dorm room or apartment, as intervention strategies in future efforts aimed at promoting milk and dairy foods and beverages for improved calcium intake in college students.

  11. Crystallization of calcium oxalate in minimally diluted urine

    Science.gov (United States)

    Bretherton, T.; Rodgers, A.

    1998-09-01

    Crystallization of calcium oxalate was studied in minimally diluted (92%) urine using a mixed suspension mixed product crystallizer in series with a Malvern particle sizer. The crystallization was initiated by constant flow of aqueous sodium oxalate and urine into the reaction vessel via two independent feed lines. Because the Malvern cell was in series with the reaction vessel, noninvasive measurement of particle sizes could be effected. In addition, aliquots of the mixed suspension were withdrawn and transferred to a Coulter counter for crystal counting and sizing. Steady-state particle size distributions were used to determine nucleation and growth kinetics while scanning electron microscopy was used to examine deposited crystals. Two sets of experiments were performed. In the first, the effect of the concentration of the exogenous sodium oxalate was investigated while in the second, the effect of temperature was studied. Calcium oxalate nucleation and growth rates were found to be dependent on supersaturation levels inside the crystallizer. However, while growth rate increased with increasing temperature, nucleation rates decreased. The favored phases were the trihydrate at 18°C, the dihydrate at 38° and the monohydrate at 58°C. The results of both experiments are in agreement with those obtained in other studies that have been conducted in synthetic and in maximally diluted urine and which have employed invasive crystal counting and sizing techniques. As such, the present study lends confidence to the models of urinary calcium oxalate crystallization processes which currently prevail in the literature.

  12. Calcium efflux systems in stress signalling and adaptation in plants

    Directory of Open Access Journals (Sweden)

    Jayakumar eBose

    2011-12-01

    Full Text Available Transient cytosolic calcium ([Ca2+]cyt elevation is an ubiquitous denominator of the signalling network when plants are exposed to literally every known abiotic and biotic stress. These stress-induced [Ca2+]cyt elevations vary in magnitude, frequency and shape, depending on the severity of the stress as well the type of stress experienced. This creates a unique stress-specific calcium signature that is then decoded by signal transduction networks. While most published papers have been focused predominantly on the role of Ca2+ influx mechanisms in shaping [Ca2+]cyt signatures, restoration of the basal [Ca2+]cyt levels is impossible without both cytosolic Ca2+ buffering and efficient Ca2+ efflux mechanisms removing excess Ca2+ from cytosol, to reload Ca2+ stores and to terminate Ca2+ signalling. This is the topic of the current review. The molecular identity of two major types of Ca2+ efflux systems, Ca2+-ATPase pumps and Ca2+/H+ exchangers, is described, and their regulatory modes are analysed in detail. The spatial and temporal organisation of calcium signalling networks is described, and the importance of existence of intracellular calcium microdomains is discussed. Experimental evidence for the role of Ca2+ efflux systems in plant responses to a range of abiotic and biotic factors is summarised. Contribution of Ca2+-ATPase pumps and Ca2+/H+ exchangers in shaping [Ca2+]cyt signatures is then modelled by using a four-component model (plasma- and endo- membrane-based Ca2+-permeable channels and efflux systems taking into account the cytosolic Ca2+ buffering. It is concluded that physiologically relevant variations in the activity of Ca2+-ATPase pumps and Ca2+/H+ exchangers are sufficient to fully describe all the reported experimental evidence and determine the shape of [Ca2+]cyt signatures in response to environmental stimuli, emphasising the crucial role these active efflux systems play in plant adaptive responses to environment.

  13. Cardiac voltage gated calcium channels and their regulation by β-adrenergic signaling.

    Science.gov (United States)

    Kumari, Neema; Gaur, Himanshu; Bhargava, Anamika

    2018-02-01

    Voltage-gated calcium channels (VGCCs) are the predominant source of calcium influx in the heart leading to calcium-induced calcium release and ultimately excitation-contraction coupling. In the heart, VGCCs are modulated by the β-adrenergic signaling. Signaling through β-adrenergic receptors (βARs) and modulation of VGCCs by β-adrenergic signaling in the heart are critical signaling and changes to these have been significantly implicated in heart failure. However, data related to calcium channel dysfunction in heart failure is divergent and contradictory ranging from reduced function to no change in the calcium current. Many recent studies have highlighted the importance of functional and spatial microdomains in the heart and that may be the key to answer several puzzling questions. In this review, we have briefly discussed the types of VGCCs found in heart tissues, their structure, and significance in the normal and pathological condition of the heart. More importantly, we have reviewed the modulation of VGCCs by βARs in normal and pathological conditions incorporating functional and structural aspects. There are different types of βARs, each having their own significance in the functioning of the heart. Finally, we emphasize the importance of location of proteins as it relates to their function and modulation by co-signaling molecules. Its implication on the studies of heart failure is speculated. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Evidence of dietary calcium and vitamin D inadequacies in a population of dental patients.

    Science.gov (United States)

    Pehowich, Daniel J; Pehowich, Enid D

    2016-12-01

    To determine the dietary calcium and vitamin D intake of a cohort of dental patients identified as being at risk of inadequacy based on a 24-hour food recall. A retrospective chart analysis was carried out on 5-day food record and nutrient analyses of 670 dental patients aged 18 to 82 years obtained over a 10-year period. All patients had scored poorly on a 24-hour food recall survey during their initial examination. The overall mean and median calcium and vitamin D intakes of the patients were significantly lower than the current estimated needs for the general population. Although calcium intake did not change over the 10-year period, vitamin D consumption decreased. The greatest dietary intake inadequacies for both calcium and vitamin D were seen in both male and female patients over age 50 years. A 24-Hour Food Recall Questionnaire may be an effective means for the oral health professional to screen patients for calcium and vitamin D and other nutrient inadequacies. Screening for potential dietary inadequacies of calcium and vitamin D may identify patients potentially at risk for poor bone health. Our results indicate that the dental health professional can obtain evidence necessary to change patient dietary behavior and thus contribute to successful treatment outcomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Safety assessment of the calcium-binding protein, apoaequorin, expressed by Escherichia coli.

    Science.gov (United States)

    Moran, Daniel L; Tetteh, Afua O; Goodman, Richard E; Underwood, Mark Y

    2014-07-01

    Calcium-binding proteins are ubiquitous modulators of cellular activity and function. Cells possess numerous calcium-binding proteins that regulate calcium concentration in the cytosol by buffering excess free calcium ion. Disturbances in intracellular calcium homeostasis are at the heart of many age-related conditions making these proteins targets for therapeutic intervention. A calcium-binding protein, apoaequorin, has shown potential utility in a broad spectrum of applications for human health and well-being. Large-scale recombinant production of the protein has been successful; enabling further research and development and commercialization efforts. Previous work reported a 90-day subchronic toxicity test that demonstrated this protein has no toxicity by oral exposure in Sprague-Dawley rodents. The current study assesses the allergenic potential of the purified protein using bioinformatic analysis and simulated gastric digestion. The results from the bioinformatics searches with the apoaequorin sequence show the protein is not a known allergen and not likely to cross-react with known allergens. Apoaequorin is easily digested by pepsin, a characteristic commonly exhibited by many non-allergenic dietary proteins. From these data, there is no added concern of safety due to unusual stability of the protein by ingestion. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Exaggerated levothyroxine malabsorption due to calcium carbonate supplementation in gastrointestinal disorders.

    Science.gov (United States)

    Csako, G; McGriff, N J; Rotman-Pikielny, P; Sarlis, N J; Pucino, F

    2001-12-01

    To describe a patient with primary hypothyroidism in whom ingestion of levothyroxine with calcium carbonate led to markedly elevated serum thyrotropin concentrations. A 61-year-old white woman with primary hypothyroidism, systemic lupus erythematosus, celiac disease, and history of Whipple resection for pancreatic cancer was euthyroid with levothyroxine 175-188 micrograms/d. After taking a high dose of calcium carbonate (1250 mg three times daily) with levothyroxine, she developed biochemical evidence of hypothyroidism (thyrotropin up to 41.4 mU/L) while remaining clinically euthyroid. Delaying calcium carbonate administration by four hours returned her serum thyrotropin to a borderline high concentration (5.7 mU/L) within a month. Serum concentrations of unbound and total thyroxine and triiodothyronine tended to decrease, but remained borderline low to normal while the patient concomitantly received levothyroxine and calcium carbonate. Concomitant administration of levothyroxine and calcium carbonate often results in levothyroxine malabsorption. While in most patients the clinical consequences of this interaction, even with prolonged exposure, are relatively small, overt hypothyrodism may develop in patients with preexisting malabsorption disorders. However, as the current case illustrates, the clinical manifestations of the initial levothyroxine deficit may not always be apparent and, of all usual laboratory thyroid function tests, only thyrotropin measurement will reliably uncover the exaggerated levothyroxine malabsorption. Decreased absorption of levothyroxine when given with calcium carbonate may be particularly pronounced in patients with preexisting malabsorption disorders. Once recognized, a change in drug administration schedule usually minimizes or eliminates this interaction.

  17. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    Energy Technology Data Exchange (ETDEWEB)

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

    2010-09-21

    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  18. Weak currents

    International Nuclear Information System (INIS)

    Leite Lopes, J.

    1976-01-01

    A survey of the fundamental ideas on weak currents such as CVC and PCAC and a presentation of the Cabibbo current and the neutral weak currents according to the Salam-Weinberg model and the Glashow-Iliopoulos-Miami model are given [fr

  19. Spin current

    CERN Document Server

    Valenzuela, Sergio O; Saitoh, Eiji; Kimura, Takashi

    2012-01-01

    In a new branch of physics and technology called spin-electronics or spintronics, the flow of electrical charge (usual current) as well as the flow of electron spin, the so-called 'spin current', are manipulated and controlled together. This book provides an introduction and guide to the new physics and application of spin current.

  20. Altered Elementary Calcium Release Events and Enhanced Calcium Release by Thymol in Rat Skeletal Muscle

    OpenAIRE

    Szentesi, Péter; Szappanos, Henrietta; Szegedi, Csaba; Gönczi, Monika; Jona, István; Cseri, Julianna; Kovács, László; Csernoch, László

    2004-01-01

    The effects of thymol on steps of excitation-contraction coupling were studied on fast-twitch muscles of rodents. Thymol was found to increase the depolarization-induced release of calcium from the sarcoplasmic reticulum, which could not be attributed to a decreased calcium-dependent inactivation of calcium release channels/ryanodine receptors or altered intramembrane charge movement, but rather to a more efficient coupling of depolarization to channel opening. Thymol increased ryanodine bind...