WorldWideScience

Sample records for voltage-dependent calcium currents

  1. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  2. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  3. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  4. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  5. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  6. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Science.gov (United States)

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  7. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  8. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  9. Modulation of voltage-gated channel currents by harmaline and harmane.

    Science.gov (United States)

    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

    2005-01-01

    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

  10. Simultaneous mapping of membrane voltage and calcium in zebrafish heart in vivo reveals chamber-specific developmental transitions in ionic currents

    Directory of Open Access Journals (Sweden)

    Jennifer H Hou

    2014-09-01

    Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.

  11. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  12. 5-HT modulation of hyperpolarization-activated inward current and calcium- dependent outward current in a crustacean motor neuron

    DEFF Research Database (Denmark)

    Kiehn, O.; Harris-Warrick, R. M.

    1992-01-01

    1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...

  13. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  14. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  15. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  16. Inhibition of large conductance calcium-dependent potassium ...

    African Journals Online (AJOL)

    conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

  17. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

    Science.gov (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

    2017-05-01

    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  18. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  19. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  20. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  1. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  2. Progesterone treatment inhibits and dihydrotestosterone (DHT) treatment potentiates voltage-gated calcium currents in gonadotropin-releasing hormone (GnRH) neurons.

    Science.gov (United States)

    Sun, Jianli; Moenter, Suzanne M

    2010-11-01

    GnRH neurons are central regulators of fertility, and their activity is modulated by steroid feedback. In normal females, GnRH secretion is regulated by estradiol and progesterone (P). Excess androgens present in hyperandrogenemic fertility disorders may disrupt communication of negative feedback signals from P and/or independently stimulate GnRH release. Voltage-gated calcium channels (VGCCs) are important in regulating excitability and hormone release. Estradiol alters VGCCs in a time-of-day-dependent manner. To further elucidate ovarian steroid modulation of GnRH neuron VGCCs, we studied the effects of dihydrotestosterone (DHT) and P. Adult mice were ovariectomized (OVX) or OVX and treated with implants containing DHT (OVXD), estradiol (OVXE), estradiol and DHT (OVXED), estradiol and P (OVXEP), or estradiol, DHT, and P (OVXEDP). Macroscopic calcium current (I(Ca)) was recorded in the morning or afternoon 8-12 d after surgery using whole-cell voltage-clamp. I(Ca) was increased in afternoon vs. morning in GnRH neurons from OVXE mice but this increase was abolished in cells from OVXEP mice. I(Ca) in cells from OVXD mice was increased regardless of time of day; there was no additional effect in OVXED mice. P reduced N-type and DHT potentiated N- and R-type VGCCs; P blocked the DHT potentiation of N-type-mediated current. These data suggest P and DHT have opposing actions on VGCCs in GnRH neurons, but in the presence of both steroids, P dominates. VGCCs are targets of ovarian steroid feedback modulation of GnRH neuron activity and, more specifically, a potential mechanism whereby androgens could activate GnRH neuronal function.

  3. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  4. High-voltage-activated calcium current subtypes in mouse DRG neurons adapt in a subpopulation-specific manner after nerve injury.

    Science.gov (United States)

    Murali, Swetha S; Napier, Ian A; Mohammadi, Sarasa A; Alewood, Paul F; Lewis, Richard J; Christie, MacDonald J

    2015-03-01

    Changes in ion channel function and expression are characteristic of neuropathic pain. Voltage-gated calcium channels (VGCCs) are integral for neurotransmission and membrane excitability, but relatively little is known about changes in their expression after nerve injury. In this study, we investigate whether peripheral nerve ligation is followed by changes in the density and proportion of high-voltage-activated (HVA) VGCC current subtypes in dorsal root ganglion (DRG) neurons, the contribution of presynaptic N-type calcium channels in evoked excitatory postsynaptic currents (EPSCs) recorded from dorsal horn neurons in the spinal cord, and the changes in expression of mRNA encoding VGCC subunits in DRG neurons. Using C57BL/6 mice [8- to 11-wk-old males (n = 91)] for partial sciatic nerve ligation or sham surgery, we performed whole cell patch-clamp recordings on isolated DRG neurons and dorsal horn neurons and measured the expression of all VGCC subunits with RT-PCR in DRG neurons. After nerve injury, the density of P/Q-type current was reduced overall in DRG neurons. There was an increase in the percentage of N-type and a decrease in that of P/Q-type current in medium- to large-diameter neurons. No changes were found in the contribution of presynaptic N-type calcium channels in evoked EPSCs recorded from dorsal horn neurons. The α2δ-1 subunit was upregulated by 1.7-fold and γ-3, γ-2, and β-4 subunits were all downregulated 1.7-fold in injured neurons compared with sham-operated neurons. This comprehensive characterization of HVA VGCC subtypes in mouse DRG neurons after nerve injury revealed changes in N- and P/Q-type current proportions only in medium- to large-diameter neurons. Copyright © 2015 the American Physiological Society.

  5. Calcium currents in a fast-twitch skeletal muscle of the rat.

    Science.gov (United States)

    Donaldson, P L; Beam, K G

    1983-10-01

    Slow ionic currents were measured in the rat omohyoid muscle with the three-microelectrode voltage-clamp technique. Sodium and delayed rectifier potassium currents were blocked pharmacologically. Under these conditions, depolarizing test pulses elicited an early outward current, followed by a transient slow inward current, followed in turn by a late outward current. The early outward current appeared to be a residual delayed rectifier current. The slow inward current was identified as a calcium current on the basis that (a) its magnitude depended on extracellular calcium concentration, (b) it was blocked by the addition of the divalent cations cadmium or nickel, and reduced in magnitude by the addition of manganese or cobalt, and (c) barium was able to replace calcium as an inward current carrier. The threshold potential for inward calcium current was around -20 mV in 10mM extracellular calcium and about -35 mV in 2 mM calcium. Currents were net inward over part of their time course for potentials up to at least +30 mV. At temperatures of 20-26 degrees C, the peak inward current (at approximately 0 mV) was 139 +/- 14 microA/cm2 (mean +/- SD), increasing to 226 +/- 28 microA/cm2 at temperatures of 27-37 degrees C. The late outward current exhibited considerable fiber-to-fiber variability. In some fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it appeared to be the sum of both leak and a slowly activated outward current. The rate of activation of inward calcium current was strongly temperature dependent. For example, in a representative fiber, the time-to-peak inward current for a +10-mV test pulse decreased from approximately 250 ms at 20 degrees C to 100 ms at 30 degrees C. At 37 degrees C, the time-to-peak current was typically approximately 25 ms. The earliest phase of activation was difficult to quantify because the ionic current was partially

  6. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  7. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  8. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  9. New Role of P/Q-type Voltage-gated Calcium Channels

    DEFF Research Database (Denmark)

    Hansen, Pernille B L

    2015-01-01

    Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various calcium channel subtypes, and the functional contribution from P/Q-type channels as compared with L-type should be considered. Confirming the presence of P/Q-type voltage...

  10. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  12. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

    Science.gov (United States)

    Minor, Daniel L; Findeisen, Felix

    2010-01-01

    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  13. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  14. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  15. Effects of inositol trisphosphate on calcium mobilization in high-voltage and saponin-permeabilized platelets

    International Nuclear Information System (INIS)

    Gear, A.R.L.; Hallam, T.J.

    1986-01-01

    Interest in phosphatidylinositol metabolism has been greatly stimulated by the findings that diglyceride and inositol phosphates may serve as second messengers in modulating cellular function. Formation of 1,4,5-inositol trisphosphate (IP 3 ), in particular, has been linked to mobilization of intracellular calcium in a number of cell types. The authors have examined the ability of IP 3 to mobilize calcium in human platelets permeabilized by either saponin or high-voltage discharge. Saponin at 15 μg/ml effectively permeabilized platelets to exogenous inositol 1,4,5-trisphosphate which released bound [ 45 Ca] within 1 min and with a Ka of 7.4 +/- 4.1 μM. A small (25%) azide-sensitive pool was also responsive to inositol trisphosphate. The calcium pools were completely discharged by A-23187 and the ATP-dependent uptake was prevented by dinitrophenol. In contrast to the result with saponin, platelets accessed by high-voltage discharge were insensitive to challenge by inositol 1,4,5-trisphosphate. The data suggest that while inositol 1,4,5-trisphosphate can rapidly mobilize platelet calcium, the ability to demonstrate this depends on the method of permeabilization

  16. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  17. A cyclic GMP-dependent calcium-activated chloride current in smooth-muscle cells from rat mesenteric resistance arteries

    DEFF Research Database (Denmark)

    Matchkov, Vladimir; Aalkjær, Christian; Nilsson, Holger

    2004-01-01

    We have previously demonstrated the presence of a cyclic GMP (cGMP)-dependent calcium-activated inward current in vascular smooth-muscle cells, and suggested this to be of importance in synchronizing smooth-muscle contraction. Here we demonstrate the characteristics of this current. Using......M) in the pipette solution. The current was found to be a calcium-activated chloride current with an absolute requirement for cyclic GMP (EC50 6.4 microM). The current could be activated by the constitutively active subunit of PKG. Current activation was blocked by the protein kinase G antagonist Rp-8-Br-PET-cGMP...... differed from those of the calcium-activated chloride current in pulmonary myocytes, which was cGMP-independent, exhibited a high sensitivity to inhibition by niflumic acid, was unaffected by zinc ions, and showed outward current rectification as has previously been reported for this current. Under...

  18. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  19. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  20. Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

    Directory of Open Access Journals (Sweden)

    J. Koton

    2011-04-01

    Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

  1. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  2. Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide

    International Nuclear Information System (INIS)

    Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf

    2007-01-01

    The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel

  3. The Glycolytic Metabolite, Fructose-1,6-bisphosphate, Blocks Epileptiform Bursts by Attenuating Voltage-Activated Calcium Currents in Hippocampal Slices

    Directory of Open Access Journals (Sweden)

    Li-Rong Shao

    2018-06-01

    Full Text Available Manipulation of metabolic pathways (e.g., ketogenic diet (KD, glycolytic inhibition alters neural excitability and represents a novel strategy for treatment of drug-refractory seizures. We have previously shown that inhibition of glycolysis suppresses epileptiform activity in hippocampal slices. In the present study, we aimed to examine the role of a “branching” metabolic pathway stemming off glycolysis (i.e., the pentose-phosphate pathway, PPP in regulating seizure activity, by using a potent PPP stimulator and glycolytic intermediate, fructose-1,6-bisphosphate (F1,6BP. Employing electrophysiological approaches, we investigated the action of F1,6BP on epileptiform population bursts, intrinsic neuronal firing, glutamatergic and GABAergic synaptic transmission and voltage-activated calcium currents (ICa in the CA3 area of hippocampal slices. Bath application of F1,6BP (2.5–5 mM blocked epileptiform population bursts induced in Mg2+-free medium containing 4-aminopyridine, in ~2/3 of the slices. The blockade occurred relatively rapidly (~4 min, suggesting an extracellular mechanism. However, F1,6BP did not block spontaneous intrinsic firing of the CA3 neurons (when synaptic transmission was eliminated with DNQX, AP-5 and SR95531, nor did it significantly reduce AMPA or NMDA receptor-mediated excitatory postsynaptic currents (EPSCAMPA and EPSCNMDA. In contrast, F1,6BP caused moderate reduction (~50% in GABAA receptor-mediated current, suggesting it affects excitatory and inhibitory synapses differently. Finally and unexpectedly, F1,6BP consistently attenuated ICa by ~40% without altering channel activation or inactivation kinetics, which may explain its anticonvulsant action, at least in this in vitro seizure model. Consistent with these results, epileptiform population bursts in CA3 were readily blocked by the nonspecific Ca2+ channel blocker, CdCl2 (20 μM, suggesting that these bursts are calcium dependent. Altogether, these data

  4. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  5. Simulation of forward dark current voltage characteristics of tandem solar cells

    International Nuclear Information System (INIS)

    Rubinelli, F.A.

    2012-01-01

    The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

  6. Expression of voltage-activated calcium channels in the early zebrafish embryo.

    Science.gov (United States)

    Sanhueza, Dayán; Montoya, Andro; Sierralta, Jimena; Kukuljan, Manuel

    2009-05-01

    Increases in cytosolic calcium concentrations regulate many cellular processes, including aspects of early development. Calcium release from intracellular stores and calcium entry through non-voltage-gated channels account for signalling in non-excitable cells, whereas voltage-gated calcium channels (CaV) are important in excitable cells. We report the expression of multiple transcripts of CaV, identified by its homology to other species, in the early embryo of the zebrafish, Danio rerio, at stages prior to the differentiation of excitable cells. CaV mRNAs and proteins were detected as early as the 2-cell stages, which indicate that they arise from both maternal and zygotic transcription. Exposure of embryos to pharmacological blockers of CaV does not perturb early development significantly, although late effects are appreciable. These results suggest that CaV may have a role in calcium homeostasis and control of cellular process during early embryonic development.

  7. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  8. Voltage current characteristics of type III superconductors

    International Nuclear Information System (INIS)

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  9. Voltage current characteristics of type III superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  10. Thermal instability and current-voltage scaling in superconducting fault current limiters

    Energy Technology Data Exchange (ETDEWEB)

    Zeimetz, B [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Tadinada, K [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Eves, D E [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Coombs, T A [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Evetts, J E [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Campbell, A M [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom)

    2004-04-01

    We have developed a computer model for the simulation of resistive superconducting fault current limiters in three dimensions. The program calculates the electromagnetic and thermal response of a superconductor to a time-dependent overload voltage, with different possible cooling conditions for the surfaces, and locally variable superconducting and thermal properties. We find that the cryogen boil-off parameters critically influence the stability of a limiter. The recovery time after a fault increases strongly with thickness. Above a critical thickness, the temperature is unstable even for a small applied AC voltage. The maximum voltage and maximum current during a short fault are correlated by a simple exponential law.

  11. Reversible calcium alloying enables a practical room-temperature rechargeable calcium-ion battery with a high discharge voltage

    Science.gov (United States)

    Wang, Meng; Jiang, Chunlei; Zhang, Songquan; Song, Xiaohe; Tang, Yongbing; Cheng, Hui-Ming

    2018-06-01

    Calcium-ion batteries (CIBs) are attractive candidates for energy storage because Ca2+ has low polarization and a reduction potential (-2.87 V versus standard hydrogen electrode, SHE) close to that of Li+ (-3.04 V versus SHE), promising a wide voltage window for a full battery. However, their development is limited by difficulties such as the lack of proper cathode/anode materials for reversible Ca2+ intercalation/de-intercalation, low working voltages (performance. Here, we report a CIB that can work stably at room temperature in a new cell configuration using graphite as the cathode and tin foils as the anode as well as the current collector. This CIB operates on a highly reversible electrochemical reaction that combines hexafluorophosphate intercalation/de-intercalation at the cathode and a Ca-involved alloying/de-alloying reaction at the anode. An optimized CIB exhibits a working voltage of up to 4.45 V with capacity retention of 95% after 350 cycles.

  12. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  13. Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam

    Science.gov (United States)

    Andreev, Andrey

    2005-10-01

    The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.

  14. Potassium conductances mediate bidirectional state-dependent modulation of action potential evoked dendritic calcium signals in dentate gyrus granule cells

    Directory of Open Access Journals (Sweden)

    János Brunner

    2014-03-01

    Full Text Available Backpropagating action potentials (bAPs and local calcium signals that they trigger are fundamental for dendritic functions. Here we addressed the question what extent the changes of local dendritic membrane properties can contribute to the shaping of the coupling between dendritic action potentials and the local calcium responses. Using a combination of in vitro electrophysiological and confocal imaging techniques we found that activation of dendritic GIRK channels via mGlu2 or GABAB receptors enhanced the bAP¬-triggered calcium signals in the dendrites of dentate gyrus granule cells (GCs. The enhancement of calcium signals was significant only in those dendritic regions, where these receptors are predominantly expressed. Similarly to GIRK channel activation, somatic hyperpolarization by DC current injection (from -64 mV to -77 mV, significantly increased bAP-associated calcium signals in the proximal dendrites. The hyperpolarization was associated with a decrease in the input resistance due to the rectification of the membrane potential of GCs. The effect of hyperpolarization on the calcium signals was maintained when T-type calcium currents were blocked but it decreased when GIRK channels were inhibited. Simultaneous dual somato-dendritic recordings from GCs showed that somatic hyperpolarization accelerated the repolarization phase of dendritic bAP in the proximal region whereas the rising phase and peak amplitude was not affected. We hypothesize that the larger driving force for calcium ions during the faster repolarization can contribute to the increasing in calcium signals. Employment of previously recorded dendritic bAP waveforms from hyperpolarized membrane potential as voltage command evoked larger calcium currents in nucleated patches compared to bAP waveform from the same recording at depolarized membrane potential. Furthermore, addition of native, high-voltage activated, inactivating potassium conductance by somatic dynamic clamp

  15. Conotoxins as Tools to Understand the Physiological Function of Voltage-Gated Calcium (CaV Channels

    Directory of Open Access Journals (Sweden)

    David Ramírez

    2017-10-01

    Full Text Available Voltage-gated calcium (CaV channels are widely expressed and are essential for the completion of multiple physiological processes. Close regulation of their activity by specific inhibitors and agonists become fundamental to understand their role in cellular homeostasis as well as in human tissues and organs. CaV channels are divided into two groups depending on the membrane potential required to activate them: High-voltage activated (HVA, CaV1.1–1.4; CaV2.1–2.3 and Low-voltage activated (LVA, CaV3.1–3.3. HVA channels are highly expressed in brain (neurons, heart, and adrenal medulla (chromaffin cells, among others, and are also classified into subtypes which can be distinguished using pharmacological approaches. Cone snails are marine gastropods that capture their prey by injecting venom, “conopeptides”, which cause paralysis in a few seconds. A subset of conopeptides called conotoxins are relatively small polypeptides, rich in disulfide bonds, that target ion channels, transporters and receptors localized at the neuromuscular system of the animal target. In this review, we describe the structure and properties of conotoxins that selectively block HVA calcium channels. We compare their potency on several HVA channel subtypes, emphasizing neuronal calcium channels. Lastly, we analyze recent advances in the therapeutic use of conotoxins for medical treatments.

  16. Glycosylation of voltage-gated calcium channels in health and disease

    Czech Academy of Sciences Publication Activity Database

    Lazniewska, Joanna; Weiss, Norbert

    2017-01-01

    Roč. 1859, č. 5 (2017), s. 662-668 ISSN 0005-2736 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channels * voltage-gated calcium channels * N-glycosylation * ancillary subunit * trafficking * stability Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.498, year: 2016

  17. Effect of selected factors on the current flow and voltage loss at ...

    African Journals Online (AJOL)

    In this paper, laboratory scale study was conducted to investigate the current flow and voltage loss at the electrodes in the electrochemical treatment of a tropical laterite. Three different tests using calcium chloride (CC) as anolyte and sodium chloride (SC) as catholyte (NC); SC as anolyte and Phosphoric acid (PA) as ...

  18. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  19. Voltage current characteristics of type III superconductors

    Science.gov (United States)

    Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

  20. Functional Importance of L- and P/Q-Type Voltage-Gated Calcium Channels in Human Renal Vasculature

    DEFF Research Database (Denmark)

    Hansen, Pernille B; Poulsen, Christian B; Walter, Steen

    2011-01-01

    Calcium channel blockers are widely used for treatment of hypertension, because they decrease peripheral vascular resistance through inhibition of voltage-gated calcium channels. Animal studies of renal vasculature have shown expression of several types of calcium channels that are involved......-type subtype (Ca(v) 3.1 and Ca(v) 3.2) voltage-gated calcium channels (Ca(v)s), and quantitative PCR showed highest expression of L-type channels in renal arteries and variable expression between patients of subtypes of calcium channels in intrarenal vessels. Immunohistochemical labeling of kidney sections...

  1. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation.

    Science.gov (United States)

    Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L

    1993-03-01

    The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

  2. Construction and use of a zebrafish heart voltage and calcium optical mapping system, with integrated electrocardiogram and programmable electrical stimulation

    Science.gov (United States)

    Lin, Eric; Craig, Calvin; Lamothe, Marcel; Sarunic, Marinko V.; Beg, Mirza Faisal

    2015-01-01

    Zebrafish are increasingly being used as a model of vertebrate cardiology due to mammalian-like cardiac properties in many respects. The size and fecundity of zebrafish make them suitable for large-scale genetic and pharmacological screening. In larger mammalian hearts, optical mapping is often used to investigate the interplay between voltage and calcium dynamics and to investigate their respective roles in arrhythmogenesis. This report outlines the construction of an optical mapping system for use with zebrafish hearts, using the voltage-sensitive dye RH 237 and the calcium indicator dye Rhod-2 using two industrial-level CCD cameras. With the use of economical cameras and a common 532-nm diode laser for excitation, the rate dependence of voltage and calcium dynamics within the atrial and ventricular compartments can be simultaneously determined. At 140 beats/min, the atrial action potential duration was 36 ms and the transient duration was 53 ms. With the use of a programmable electrical stimulator, a shallow rate dependence of 3 and 4 ms per 100 beats/min was observed, respectively. In the ventricle the action potential duration was 109 ms and the transient duration was 124 ms, with a steeper rate dependence of 12 and 16 ms per 100 beats/min. Synchronous electrocardiograms and optical mapping recordings were recorded, in which the P-wave aligns with the atrial voltage peak and R-wave aligns with the ventricular peak. A simple optical pathway and imaging chamber are detailed along with schematics for the in-house construction of the electrocardiogram amplifier and electrical stimulator. Laboratory procedures necessary for zebrafish heart isolation, cannulation, and loading are also presented. PMID:25740339

  3. Current-voltage-temperature characteristics of DNA origami

    Energy Technology Data Exchange (ETDEWEB)

    Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)

    2009-04-29

    The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

  4. Current-voltage-temperature characteristics of DNA origami

    International Nuclear Information System (INIS)

    Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander

    2009-01-01

    The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

  5. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  6. Cardiac voltage gated calcium channels and their regulation by β-adrenergic signaling.

    Science.gov (United States)

    Kumari, Neema; Gaur, Himanshu; Bhargava, Anamika

    2018-02-01

    Voltage-gated calcium channels (VGCCs) are the predominant source of calcium influx in the heart leading to calcium-induced calcium release and ultimately excitation-contraction coupling. In the heart, VGCCs are modulated by the β-adrenergic signaling. Signaling through β-adrenergic receptors (βARs) and modulation of VGCCs by β-adrenergic signaling in the heart are critical signaling and changes to these have been significantly implicated in heart failure. However, data related to calcium channel dysfunction in heart failure is divergent and contradictory ranging from reduced function to no change in the calcium current. Many recent studies have highlighted the importance of functional and spatial microdomains in the heart and that may be the key to answer several puzzling questions. In this review, we have briefly discussed the types of VGCCs found in heart tissues, their structure, and significance in the normal and pathological condition of the heart. More importantly, we have reviewed the modulation of VGCCs by βARs in normal and pathological conditions incorporating functional and structural aspects. There are different types of βARs, each having their own significance in the functioning of the heart. Finally, we emphasize the importance of location of proteins as it relates to their function and modulation by co-signaling molecules. Its implication on the studies of heart failure is speculated. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

    Science.gov (United States)

    Teverovsky, Alexander A.

    2016-01-01

    Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

  8. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  9. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  10. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  11. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  12. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  13. Phencyclidine block of calcium current in isolated guinea-pig hippocampal neurones.

    Science.gov (United States)

    Ffrench-Mullen, J M; Rogawski, M A

    1992-10-01

    1. Phencyclidine (PCP) block of Ca2+ channel current in enzymatically dissociated neurones from the CA1 region of the adult guinea-pig hippocampus was studied using whole-cell voltage clamp techniques. Ca2+ channel current was recorded with 3 mM-Ba2+ as the charge carrier. Na+ currents were blocked with tetrodotoxin and K+ currents were eliminated by using tetraethylammonium and N-methyl-D-glucamine as the predominant extracellular and intracellular cations, respectively. 2. Peak Ca2+ channel current evoked by depolarization from -80 to -10 mV was reduced in a use-dependent fashion by PCP. The apparent forward and reverse rate constants for block at the depolarized voltage were 10(6) s-1 M-1 and 11-14 s-1, respectively. These values were at least 60 times faster than the corresponding rates at the resting voltage. The steady-state block produced by PCP increased in a concentration-dependent fashion with an IC50 of 7 microM. Other dissociative anaesthetic drugs were substantially weaker inhibitors of the current (tiletamine > dizocilpine (MK-801) > ketamine). 3. The Ca2+ channel current recorded under identical conditions in rat dorsal root ganglion neurones was less sensitive to blockade by PCP (IC50, 90 microM). 4. PCP block of the hippocampal Ca2+ channel current occurred in a voltage-dependent fashion with the fractional block decreasing at positive membrane potentials. Analysis indicated that the PCP blocking site senses 56% of the transmembrane electric field. 5. Analysis of tail currents recorded at -80 mV demonstrated that PCP does not affect the voltage-dependent or time-dependent activation or deactivation of the Ca2+ channel current. 6. The rate and extent of inactivation of the Ca2+ channel current was maximal at -10 mV and diminished at more positive potentials. Experiments with Ba(2+)-free external solution demonstrated that inactivation of the Ca2+ channels is largely voltage-dependent and is not affected by Ba2+ influx. 7. PCP markedly increased the

  14. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium

    Directory of Open Access Journals (Sweden)

    Adela Banciu

    2018-05-01

    Full Text Available Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1, estrogen receptors (ESR1, ESR2, GPR30, and nuclear receptor coactivator 3 (NCOA3. Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM antagonized the effect of BAY K8644 (2.5 or 5 µM in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant

  15. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium.

    Science.gov (United States)

    Banciu, Adela; Banciu, Daniel Dumitru; Mustaciosu, Cosmin Catalin; Radu, Mihai; Cretoiu, Dragos; Xiao, Junjie; Cretoiu, Sanda Maria; Suciu, Nicolae; Radu, Beatrice Mihaela

    2018-05-09

    Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs) contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1), estrogen receptors (ESR1, ESR2, GPR30), and nuclear receptor coactivator 3 (NCOA3). Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM) downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM) antagonized the effect of BAY K8644 (2.5 or 5 µM) in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant human uterine

  16. Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

    Science.gov (United States)

    Petit, C.; Zander, D.

    2007-10-01

    It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

  17. 6-OHDA induced calcium influx through N-type calcium channel alters membrane properties via PKA pathway in substantia nigra pars compacta dopaminergic neurons.

    Science.gov (United States)

    Qu, Liang; Wang, Yuan; Zhang, Hai-Tao; Li, Nan; Wang, Qiang; Yang, Qian; Gao, Guo-Dong; Wang, Xue-Lian

    2014-07-11

    Voltage gated calcium channels (VGCC) are sensitive to oxidative stress, and their activation or inactivation can impact cell death. Although these channels have been extensively studied in expression systems, their role in the brain, particularly in the substantia nigra pars compacta (SNc), remain controversial. In this study, we assessed 6-hydroxydopamine (6-OHDA) induced transformation of firing pattern and functional changes of calcium channels in SNc dopaminergic neurons. Application of 6-OHDA (0.5-2mM) evoked a dose-dependent, desensitizing inward current and intracellular free calcium concentration ([Ca(2+)]i) rise. In voltage clamp, ω-conotoxin-sensitive Ca(2+) current modulation mediated by 6-OHDA reflected an altered sensitivity. Furthermore, we found that 6-OHDA modulated Ca(2+) currents through PKA pathway. These results provided evidence for the potential role of VGCCs and PKA involved in oxidative stress in degeneration of SNc neurons in Parkinson's disease (PD). Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Low voltage-activated calcium channels gate transmitter release at the dorsal root ganglion sandwich synapse.

    Science.gov (United States)

    Rozanski, Gabriela M; Nath, Arup R; Adams, Michael E; Stanley, Elise F

    2013-11-15

    A subpopulation of dorsal root ganglion (DRG) neurons are intimately attached in pairs and separated solely by thin satellite glial cell membrane septa. Stimulation of one neuron leads to transglial activation of its pair by a bi-, purinergic/glutamatergic synaptic pathway, a transmission mechanism that we term sandwich synapse (SS) transmission. Release of ATP from the stimulated neuron can be attributed to a classical mechanism involving Ca(2+) entry via voltage-gated calcium channels (CaV) but via an unknown channel type. Specific blockers and toxins ruled out CaV1, 2.1 and 2.2. Transmission was, however, blocked by a moderate depolarization (-50 mV) or low-concentration Ni(2+) (0.1 mM). Transmission persisted using a voltage pulse to -40 mV from a holding potential of -80 mV, confirming the involvement of a low voltage-activated channel type and limiting the candidate channel type to either CaV3.2 or a subpopulation of inactivation- and Ni(2+)-sensitive CaV2.3 channels. Resistance of the neuron calcium current and SS transmission to SNX482 argue against the latter. Hence, we conclude that inter-somatic transmission at the DRG SS is gated by CaV3.2 type calcium channels. The use of CaV3 family channels to gate transmission has important implications for the biological function of the DRG SS as information transfer would be predicted to occur not only in response to action potentials but also to sub-threshold membrane voltage oscillations. Thus, the SS synapse may serve as a homeostatic signalling mechanism between select neurons in the DRG and could play a role in abnormal sensation such as neuropathic pain.

  19. Activation of L-type calcium channels is required for gap junction-mediated intercellular calcium signaling in osteoblastic cells

    DEFF Research Database (Denmark)

    Jørgensen, Niklas Rye; Teilmann, Stefan Cuoni; Henriksen, Zanne

    2003-01-01

    The propagation of mechanically induced intercellular calcium waves (ICW) among osteoblastic cells occurs both by activation of P2Y (purinergic) receptors by extracellular nucleotides, resulting in "fast" ICW, and by gap junctional communication in cells that express connexin43 (Cx43), resulting...... in "slow" ICW. Human osteoblastic cells transmit intercellular calcium signals by both of these mechanisms. In the current studies we have examined the mechanism of slow gap junction-dependent ICW in osteoblastic cells. In ROS rat osteoblastic cells, gap junction-dependent ICW were inhibited by removal...... of extracellular calcium, plasma membrane depolarization by high extracellular potassium, and the L-type voltage-operated calcium channel inhibitor, nifedipine. In contrast, all these treatments enhanced the spread of P2 receptor-mediated ICW in UMR rat osteoblastic cells. Using UMR cells transfected to express Cx...

  20. T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles

    DEFF Research Database (Denmark)

    Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L

    2011-01-01

    Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...

  1. Divergent biophysical properties, gating mechanisms, and possible functions of the two skeletal muscle Ca(V)1.1 calcium channel splice variants.

    Science.gov (United States)

    Tuluc, Petronel; Flucher, Bernhard E

    2011-12-01

    Voltage-gated calcium channels are multi-subunit protein complexes that specifically allow calcium ions to enter the cell in response to membrane depolarization. But, for many years it seemed that the skeletal muscle calcium channel Ca(V)1.1 is the exception. The classical splice variant Ca(V)1.1a activates slowly, has a very small current amplitude and poor voltage sensitivity. In fact adult muscle fibers work perfectly well even in the absence of calcium influx. Recently a new splice variant of the skeletal muscle calcium channel Ca(V)1.1e has been characterized. The lack of the 19 amino acid exon 29 in this splice variant results in a rapidly activating calcium channel with high current amplitude and good voltage sensitivity. Ca(V)1.1e is the dominant channel in embryonic muscle, where the expression of this high calcium-conducting Ca(V)1.1 isoform readily explains developmental processes depending on L-type calcium currents. Moreover, the availability of these two structurally similar but functionally distinct channel variants facilitates the analysis of the molecular mechanisms underlying the unique current properties of the classical Ca(V)1.1a channel.

  2. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  3. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  4. Non-contact current and voltage sensor

    Science.gov (United States)

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  5. Intracellular calcium modulation of voltage-gated sodium channels in ventricular myocytes

    NARCIS (Netherlands)

    Casini, Simona; Verkerk, Arie O.; van Borren, Marcel M. G. J.; van Ginneken, Antoni C. G.; Veldkamp, Marieke W.; de Bakker, Jacques M. T.; Tan, Hanno L.

    2009-01-01

    AIMS: Cardiac voltage-gated sodium channels control action potential (AP) upstroke and cell excitability. Intracellular calcium (Ca(i)(2+)) regulates AP properties by modulating various ion channels. Whether Ca(i)(2+) modulates sodium channels in ventricular myocytes, is unresolved. We studied

  6. Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

    Directory of Open Access Journals (Sweden)

    Seyyed Yousef Mousazadeh Mousavi

    2017-10-01

    Full Text Available In recent years, the harmonics and unbalance problems endanger the voltage and current quality of power systems, due to increasing usage of nonlinear and unbalanced loads. Use of Distributed Generation (DG-interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method is proposed to compensate voltage and current unbalance and harmonics using the distributed generation (DG-interfacing inverters. This method is applicable to both grid-connected and islanded Microgrids (MGs. In the proposed method, not only the proper control of active and reactive powers can be achieved, but also there is flexibility in compensating the voltage or current quality problems at DG terminals or Points of Common Coupling (PCCs. This control strategy consists of active and reactive power controllers and a voltage/current quality-improvement block. The controller is designed in a stationary (αβ frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. Depending on the compensation modes, the harmonics and unbalance compensation of DG output current, MG-injected current to the grid, as well as PCC and DG voltages, can be achieved in grid-connected operation of MG while in the islanded operation, and the PCC and DG voltages compensation can be obtained through the proposed control scheme.

  7. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  8. Classification of methods for measuring current-voltage characteristics of semiconductor devices

    Directory of Open Access Journals (Sweden)

    Iermolenko Ia. O.

    2014-06-01

    Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.

  9. Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Sheyda R Frolova

    Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

  10. Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.

    Science.gov (United States)

    Freites, J Alfredo; Tobias, Douglas J

    2015-06-01

    Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.

  11. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    OpenAIRE

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  12. Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

    DEFF Research Database (Denmark)

    Mousazadeh, Seyyed Yousef; Jalilian, Alireza; Savaghebi, Mehdi

    2017-01-01

    In recent years, the harmonics and unbalance problem endanger the voltage and current quality of power systems due to increasing usage of nonlinear and unbalance loads. Using DG interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method...... is proposed to compensate voltage and current unbalance and harmonics using the Distributed Generation (DG) interfacing inverters. This method is applicable to both grid-connected and islanded microgrids. In the proposed method, not only the proper control of active and reactive powers can be achieved......) frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. The results show that depending on the compensation mode, the harmonics and unbalance compensation of DGs’ output current, MG’s injected current to the grid as well...

  13. Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement

    International Nuclear Information System (INIS)

    Boudjella, Aissa

    2011-01-01

    The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.

  14. Ca(2+) currents and voltage responses in Type I and Type II hair cells of the chick embryo semicircular canal.

    Science.gov (United States)

    Masetto, Sergio; Zampini, Valeria; Zucca, Giampiero; Valli, Paolo

    2005-11-01

    Type I and Type II hair cells, and Type II hair cells located in different zones of the semicircular canal crista, express different patterns of voltage-dependent K channels, each one specifically shaping the hair cell receptor potential. We report here that, close to hatching, chicken embryo semicircular canal Type I and Type II hair cells express a similar voltage-dependent L-type calcium current (I(Ca)), whose main features are: activation above -60 mV, fast activation kinetics, and scarce inactivation. I(Ca) should be already active at rest in Zone 1 Type II hair cells, whose resting membrane potential was on average slightly less negative than -60 mV. Conversely, I(Ca) would not be active at rest in Type II hair cells from Zone 2 and 3, nor in Type I hair cells, since their resting membrane potential was significantly more negative than -60 mV. However, even small depolarising currents would activate I(Ca) steadily in Zone 2 and 3 Type II hair cells, but not in Type I hair cells because of the robust repolarising action of their specific array of K(+) currents. The implications of the present findings in the afferent discharge are discussed.

  15. Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

    DEFF Research Database (Denmark)

    Fuchs, W; Larsen, Erik Hviid; Lindemann, B

    1977-01-01

    1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

  16. Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

    Science.gov (United States)

    Naranjo, David; Wen, Hua; Brehm, Paul

    2015-01-01

    The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

  17. Branching in current-voltage characteristics of intrinsic Josephson junctions

    International Nuclear Information System (INIS)

    Shukrinov, Yu M; Mahfouzi, F

    2007-01-01

    We study branching in the current-voltage characteristics of the intrinsic Josephson junctions of high-temperature superconductors in the framework of the capacitively coupled Josephson junction model with diffusion current. A system of dynamical equations for the gauge-invariant phase differences between superconducting layers for a stack of ten intrinsic junctions has been numerically solved. We have obtained a total branch structure in the current-voltage characteristics. We demonstrate the existence of a 'breakpoint region' on the current-voltage characteristics and explain it as a result of resonance between Josephson and plasma oscillations. The effect of the boundary conditions is investigated. The existence of two outermost branches and correspondingly two breakpoint regions for the periodic boundary conditions is shown. One branch, which is observed only at periodic boundary conditions, corresponds to the propagating of the plasma mode. The second one corresponds to the situation when the charge oscillations on the superconducting layers are absent, excluding the breakpoint. A time dependence of the charge oscillations at breakpoints is presented

  18. Structure-function of proteins interacting with the alpha1 pore-forming subunit of high voltage-activated calcium channel

    Directory of Open Access Journals (Sweden)

    Alan eNeely

    2014-06-01

    Full Text Available Openings of high-voltage-activated calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, high-voltage-activated calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1 associated with four additional polypeptide chains β, α2, δ and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of high-voltage-activated calcium channels.

  19. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  20. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  1. Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by proteoliposomes and cultured rat sertoli cells: Evidence for involvement of voltage-activated and voltage-independent calcium channels

    International Nuclear Information System (INIS)

    Grasso, P.; Reichert, L.E. Jr.

    1989-01-01

    We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-[3-thiotriphosphate]) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels

  2. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  3. Apo states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain.

    Science.gov (United States)

    Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L

    2013-09-09

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Influence of coupling parameter on current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors

    International Nuclear Information System (INIS)

    Shukrinov, Yu.M.; Mahfouzi, F.

    2006-01-01

    We study the current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors by numerical calculations and in framework of capacitively coupled Josephson junctions model we obtain the total number of branches. The influence of the coupling parameter α on the current-voltage characteristics at fixed parameter β (β 2 1/β c , where β c is McCumber parameter) and the influence of α on β-dependence of the current-voltage characteristics are investigated. We obtain the α-dependence of the branch's slopes and branch's endpoints. The presented results show new features of the coupling effect on the scheme of hysteresis jumps in current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors

  5. Current-voltage characteristics of porous-silicon structures

    International Nuclear Information System (INIS)

    Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

    1996-01-01

    I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

  6. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  7. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  8. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  9. Differences between signal currents for both polarities of applied voltages on cavity ionization chambers

    International Nuclear Information System (INIS)

    Takata, N.

    2000-01-01

    It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the

  10. Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

    International Nuclear Information System (INIS)

    Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

    2014-01-01

    Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

  11. Calcium current homeostasis and synaptic deficits in hippocampal neurons from Kelch-like 1 knockout mice

    Directory of Open Access Journals (Sweden)

    Paula Patricia Perissinotti

    2015-01-01

    Full Text Available Kelch-like 1 (KLHL1 is a neuronal actin-binding protein that modulates voltage-gated CaV2.1 (P/Q-type and CaV3.2 (α1H T-type calcium channels; KLHL1 knockdown experiments (KD cause down-regulation of both channel types and altered synaptic properties in cultured rat hippocampal neurons (Perissinotti et al., 2014. Here, we studied the effect of ablation of KLHL1 on calcium channel function and synaptic properties in cultured hippocampal neurons from KLHL1 knockout (KO mice. Western blot data showed the P/Q-type channel α1A subunit was less abundant in KO hippocampus compared to wildtype (WT; and PQ-type calcium currents were smaller in KO neurons than WT during early days in vitro, although this decrease was compensated for at late stages by increases in L-type calcium current. In contrast, T-type currents did not change in culture. However, biophysical properties and western blot analysis revealed a differential contribution of T-type channel isoforms in the KO, with CaV3.2 α1H subunit being down-regulated and CaV3.1 α1G up-regulated. Synapsin I levels were reduced in the KO hippocampus; cultured neurons displayed a concomitant reduction in synapsin I puncta and decreased miniature excitatory postsynaptic current (mEPSC frequency. In summary, genetic ablation of the calcium channel modulator resulted in compensatory mechanisms to maintain calcium current homeostasis in hippocampal KO neurons; however, synaptic alterations resulted in a reduction of excitatory synapse number, causing an imbalance of the excitatory-inhibitory synaptic input ratio favoring inhibition.

  12. Low Voltage Current Mode Switched-Current-Mirror Mixer

    Directory of Open Access Journals (Sweden)

    Chunhua Wang

    2009-09-01

    Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.

  13. Current-voltage characteristics of bulk heterojunction organic solar cells: connection between light and dark curves

    Energy Technology Data Exchange (ETDEWEB)

    Boix, Pablo P.; Guerrero, Antonio; Garcia-Belmonte, Germa; Bisquert, Juan [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain); Marchesi, Luis F. [Laboratorio Interdisciplinar de, Eletroquimica e Ceramica (LIEC), Universidade Federal de Sao Carlos (Brazil); Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain)

    2011-11-15

    A connection is established between recombination and series resistances extracted from impedance spectroscopy and current-voltage curves of polythiophene:fullerene organic solar cells. Recombination is shown to depend exclusively on the (Fermi level) voltage, which allows construction of the current-voltage characteristics in any required conditions based on a restricted set of measurements. The analysis highlights carrier recombination current as the determining mechanism of organic solar cell performance. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Current-voltage characteristic of a Josephson junction with randomly distributed Abrikosov vortices

    International Nuclear Information System (INIS)

    Fistul, M.V.; Giuliani, G.F.

    1997-01-01

    We have developed a theory of the current-voltage characteristic of a Josephson junction in the presence of randomly distributed, pinned misaligned Abrikosov vortices oriented perpendicularly to the junction plane. Under these conditions the Josephson phase difference var-phi acquires an interesting stochastic dependence on the position in the plane of the junction. In this situation it is possible to define an average critical current which is determined by the spatial correlations of this function. Due to the inhomogeneity, we find that for finite voltage bias the electromagnetic waves propagating in the junction display a broad spectrum of wavelengths. This is at variance with the situation encountered in homogeneous junctions. The amplitude of these modes is found to decrease as the bias is increased. We predict that the presence of these excitations is directly related to a remarkable feature in the current-voltage characteristic. The dependence of the position and the magnitude of this feature on the vortex concentration has been determined. copyright 1997 The American Physical Society

  15. Dynamic range of low-voltage cascode current mirrors

    DEFF Research Database (Denmark)

    Bruun, Erik; Shah, Peter Jivan

    1995-01-01

    Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...

  16. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  17. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  18. High-temperature performance of MoS{sub 2} thin-film transistors: Direct current and pulse current-voltage characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, C.; Samnakay, R.; Balandin, A. A., E-mail: balandin@ee.ucr.edu [Nano-Device Laboratory (NDL), Department of Electrical Engineering, Bourns College of Engineering, University of California—Riverside, Riverside, California 92521 (United States); Phonon Optimized Engineered Materials (POEM) Center, Materials Science and Engineering Program, University of California—Riverside, Riverside, California 92521 (United States); Rumyantsev, S. L. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Ioffe Physical-Technical Institute, St. Petersburg 194021 (Russian Federation); Shur, M. S. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

    2015-02-14

    We report on fabrication of MoS{sub 2} thin-film transistors (TFTs) and experimental investigations of their high-temperature current-voltage characteristics. The measurements show that MoS{sub 2} devices remain functional to temperatures of at least as high as 500 K. The temperature increase results in decreased threshold voltage and mobility. The comparison of the direct current (DC) and pulse measurements shows that the direct current sub-linear and super-linear output characteristics of MoS{sub 2} thin-films devices result from the Joule heating and the interplay of the threshold voltage and mobility temperature dependences. At temperatures above 450 K, a kink in the drain current occurs at zero gate voltage irrespective of the threshold voltage value. This intriguing phenomenon, referred to as a “memory step,” was attributed to the slow relaxation processes in thin films similar to those in graphene and electron glasses. The fabricated MoS{sub 2} thin-film transistors demonstrated stable operation after two months of aging. The obtained results suggest new applications for MoS{sub 2} thin-film transistors in extreme-temperature electronics and sensors.

  19. Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro

    DEFF Research Database (Denmark)

    Rekling, J C; Feldman, J L

    1997-01-01

    Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro. J. Neurophysiol. 78: 2483-2492, 1997. The nucleus ambiguus contains vagal and glossopharyngeal motoneurons and preganglionic neurons involved in respiration, swallowing, vocalization......-stimulus orthodromic activation, using an electrode placed in the dorsomedial slice near the nucleus tractus solitarius, evoked single excitatory postsynaptic potentials (EPSPs) or short trains of EPSPs (500 ms to 1 s). However, tetanic stimulation (5 pulses, 10 Hz) induced voltage-dependent afterdepolarizations...

  20. Associating ground magnetometer observations with current or voltage generators

    DEFF Research Database (Denmark)

    Hartinger, M. D.; Xu, Z.; Clauer, C. R.

    2017-01-01

    A circuit analogy for magnetosphere-ionosphere current systems has two extremes for driversof ionospheric currents: ionospheric elec tric fields/voltages constant while current/conductivity vary—the“voltage generator”—and current constant while electric field/conductivity vary—the “current generator.......”Statistical studies of ground magnetometer observations associated with dayside Transient High LatitudeCurrent Systems (THLCS) driven by similar mechanisms find contradictory results using this paradigm:some studies associate THLCS with voltage generators, others with current generators. We argue that mostof...... these two assumptions substantially alter expectations for magnetic perturbations associatedwith either a current or a voltage generator. Our results demonstrate that before interpreting groundmagnetometer observations of THLCS in the context of current/voltage generators, the location...

  1. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  2. Calcium-dependent but calmodulin-independent protein kinase from soybean

    International Nuclear Information System (INIS)

    Harmon, A.C.; Putnam-Evans, C.; Cormier, M.J.

    1987-01-01

    A calcium-dependent protein kinase activity from suspension-cultured soybean cells (Glycine max L. Wayne) was shown to be dependent on calcium but not calmodulin. The concentrations of free calcium required for half-maximal histone H1 phosphorylation and autophosphorylation were similar (≥ 2 micromolar). The protein kinase activity was stimulated 100-fold by ≥ 10 micromolar-free calcium. When exogenous soybean or bovine brain calmodulin was added in high concentration (1 micromolar) to the purified kinase, calcium-dependent and -independent activities were weakly stimulated (≤ 2-fold). Bovine serum albumin had a similar effect on both activities. The kinase was separated from a small amount of contaminating calmodulin by sodium dodecyl sulfate polyacrylamide gel electrophoresis. After renaturation the protein kinase autophosphorylated and phosphorylated histone H1 in a calcium-dependent manner. Following electroblotting onto nitrocellulose, the kinase bound 45 Ca 2+ in the presence of KCl and MgCl 2 , which indicated that the kinase itself is a high-affinity calcium-binding protein. Also, the mobility of one of two kinase bands in SDS gels was dependent on the presence of calcium. Autophosphorylation of the calmodulin-free kinase was inhibited by the calmodulin-binding compound N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide (W-7), showing that the inhibition of activity by W-7 is independent of calmodulin. These results show that soybean calcium-dependent protein kinase represents a new class of protein kinase which requires calcium but not calmodulin for activity

  3. Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

    Directory of Open Access Journals (Sweden)

    Josef Burian

    2012-12-01

    Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

  4. High-voltage, high-current, solid-state closing switch

    Science.gov (United States)

    Focia, Ronald Jeffrey

    2017-08-22

    A high-voltage, high-current, solid-state closing switch uses a field-effect transistor (e.g., a MOSFET) to trigger a high-voltage stack of thyristors. The switch can have a high hold-off voltage, high current carrying capacity, and high time-rate-of-change of current, di/dt. The fast closing switch can be used in pulsed power applications.

  5. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  6. Voltage-Gated Calcium Channel Antagonists and Traumatic Brain Injury

    Directory of Open Access Journals (Sweden)

    Bruce Lyeth

    2013-06-01

    Full Text Available Traumatic brain injury (TBI is a leading cause of death and disability in the United States. Despite more than 30 years of research, no pharmacological agents have been identified that improve neurological function following TBI. However, several lines of research described in this review provide support for further development of voltage gated calcium channel (VGCC antagonists as potential therapeutic agents. Following TBI, neurons and astrocytes experience a rapid and sometimes enduring increase in intracellular calcium ([Ca2+]i. These fluxes in [Ca2+]i drive not only apoptotic and necrotic cell death, but also can lead to long-term cell dysfunction in surviving cells. In a limited number of in vitro experiments, both L-type and N-type VGCC antagonists successfully reduced calcium loads as well as neuronal and astrocytic cell death following mechanical injury. In rodent models of TBI, administration of VGCC antagonists reduced cell death and improved cognitive function. It is clear that there is a critical need to find effective therapeutics and rational drug delivery strategies for the management and treatment of TBI, and we believe that further investigation of VGCC antagonists should be pursued before ruling out the possibility of successful translation to the clinic.

  7. Shaping charge excitations in chiral edge states with a time-dependent gate voltage

    Science.gov (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

    2018-02-01

    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  8. Electrical stimulation induces calcium-dependent release of NGF from cultured Schwann cells.

    Science.gov (United States)

    Huang, Jinghui; Ye, Zhengxu; Hu, Xueyu; Lu, Lei; Luo, Zhuojing

    2010-04-01

    Production of nerve growth factor (NGF) from Schwann cells (SCs) progressively declines in the distal stump, if axonal regeneration is staggered across the suture site after peripheral nerve injuries. This may be an important factor limiting the outcome of nerve injury repair. Thus far, extensive efforts are devoted to modulating NGF production in cultured SCs, but little has been achieved. In the present in vitro study, electrical stimulation (ES) was attempted to stimulate cultured SCs to release NGF. Our data showed that ES was capable of enhancing NGF release from cultured SCs. An electrical field (1 Hz, 5 V/cm) caused a 4.1-fold increase in NGF release from cultured SCs. The ES-induced NGF release is calcium dependent. Depletion of extracellular or/and intracellular calcium partially/ completely abolished the ES-induced NGF release. Further pharmacological interventions showed that ES induces calcium influx through T-type voltage-gated calcium channels and mobilizes calcium from 1, 4, 5-trisphosphate-sensitive stores and caffeine/ryanodine-sensitive stores, both of which contributed to the enhanced NGF release induced by ES. In addition, a calcium-triggered exocytosis mechanism was involved in the ES-induced NGF release from cultured SCs. These findings show the feasibility of using ES in stimulating SCs to release NGF, which holds great potential in promoting nerve regeneration by enhancing survival and outgrowth of damaged nerves, and is of great significance in nerve injury repair and neuronal tissue engineering.

  9. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu

    2010-01-01

    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  10. A kinetic model of dopamine- and calcium-dependent striatal synaptic plasticity.

    Directory of Open Access Journals (Sweden)

    Takashi Nakano

    2010-02-01

    Full Text Available Corticostriatal synapse plasticity of medium spiny neurons is regulated by glutamate input from the cortex and dopamine input from the substantia nigra. While cortical stimulation alone results in long-term depression (LTD, the combination with dopamine switches LTD to long-term potentiation (LTP, which is known as dopamine-dependent plasticity. LTP is also induced by cortical stimulation in magnesium-free solution, which leads to massive calcium influx through NMDA-type receptors and is regarded as calcium-dependent plasticity. Signaling cascades in the corticostriatal spines are currently under investigation. However, because of the existence of multiple excitatory and inhibitory pathways with loops, the mechanisms regulating the two types of plasticity remain poorly understood. A signaling pathway model of spines that express D1-type dopamine receptors was constructed to analyze the dynamic mechanisms of dopamine- and calcium-dependent plasticity. The model incorporated all major signaling molecules, including dopamine- and cyclic AMP-regulated phosphoprotein with a molecular weight of 32 kDa (DARPP32, as well as AMPA receptor trafficking in the post-synaptic membrane. Simulations with dopamine and calcium inputs reproduced dopamine- and calcium-dependent plasticity. Further in silico experiments revealed that the positive feedback loop consisted of protein kinase A (PKA, protein phosphatase 2A (PP2A, and the phosphorylation site at threonine 75 of DARPP-32 (Thr75 served as the major switch for inducing LTD and LTP. Calcium input modulated this loop through the PP2B (phosphatase 2B-CK1 (casein kinase 1-Cdk5 (cyclin-dependent kinase 5-Thr75 pathway and PP2A, whereas calcium and dopamine input activated the loop via PKA activation by cyclic AMP (cAMP. The positive feedback loop displayed robust bi-stable responses following changes in the reaction parameters. Increased basal dopamine levels disrupted this dopamine-dependent plasticity. The

  11. Clinical features of neuromuscular disorders in patients with N-type voltage-gated calcium channel antibodies

    Directory of Open Access Journals (Sweden)

    Andreas Totzeck

    2016-09-01

    Full Text Available Neuromuscular junction disorders affect the pre- or postsynaptic nerve to muscle transmission due to autoimmune antibodies. Members of the group like myasthenia gravis and Lambert-Eaton syndrome have pathophysiologically distinct characteristics. However, in practice, distinction may be difficult. We present a series of three patients with a myasthenic syndrome, dropped-head syndrome, bulbar and respiratory muscle weakness and positive testing for anti-N-type voltage-gated calcium channel antibodies. In two cases anti-acetylcholin receptor antibodies were elevated, anti-P/Q-type voltage-gated calcium channel antibodies were negative. All patients initially responded to pyridostigmine with a non-response in the course of the disease. While one patient recovered well after treatment with intravenous immunoglobulins, 3,4-diaminopyridine, steroids and later on immunosuppression with mycophenolate mofetil, a second died after restriction of treatment due to unfavorable cancer diagnosis, the third patient declined treatment. Although new antibodies causing neuromuscular disorders were discovered, clinical distinction has not yet been made. Our patients showed features of pre- and postsynaptic myasthenic syndrome as well as severe dropped-head syndrome and bulbar and axial muscle weakness, but only anti-N-type voltage-gated calcium channel antibodies were positive. When administered, one patient benefited from 3,4-diaminopyridine. We suggest that this overlap-syndrome should be considered especially in patients with assumed seronegative myasthenia gravis and lack of improvement under standard therapy.

  12. The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model

    Directory of Open Access Journals (Sweden)

    Marius Birlea

    2012-08-01

    Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.

  13. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca

    2012-09-01

    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  14. Current voltage characteristics of composite superconductors with high contact resistance

    International Nuclear Information System (INIS)

    Akhmetov, A.A.; Baev, V.P.

    1984-01-01

    An experimental study has been made of current-voltage characteristics of composite superconductors with contact resistance between superconducting filaments and normal metal with high electrical conductivity. It is shown that stable resistive states exist in such conductors over a wide range of currents. The presence of resistive states is interpreted in terms of the resistive domain concept. The minimum and maximum currents of resistive states are found to be dependent on the electrical resistance of normal metal and magnetic field. (author)

  15. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

    2016-01-01

    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  16. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes.

    Science.gov (United States)

    Samigullin, Dmitry; Fatikhov, Nijaz; Khaziev, Eduard; Skorinkin, Andrey; Nikolsky, Eugeny; Bukharaeva, Ellya

    2014-01-01

    At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers-which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal-has hitherto been technically impossible. With the aim of quantifying both Ca(2+) currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 pA and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 μM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  17. GABA(A) Increases Calcium in Subventricular Zone Astrocyte-Like Cells Through L- and T-Type Voltage-Gated Calcium Channels

    DEFF Research Database (Denmark)

    Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V

    2010-01-01

    In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...

  18. Effect of localized states on the current-voltage characteristics of metal-semiconductor contacts with thin interfacial layer

    Science.gov (United States)

    Chattopadhyay, P.

    1994-10-01

    The role of discrete localized states on the current-voltage characteristics of metal-semiconductor contact is examined. It is seen that, because of these localized states, the logarithmic current vs voltage characteristics become nonlinear. Such nonlinearity is found sensitive to the temperature, and the energy and density of the localized states. The predicted temperature dependence of barrier height and the current-voltage characteristics are in agreement with the experimental results of Aboelfotoh [ Phys. Rev. B39, 5070 (1989)].

  19. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    Energy Technology Data Exchange (ETDEWEB)

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

    2010-09-21

    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  20. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes

    Directory of Open Access Journals (Sweden)

    Dmitry eSamigullin

    2015-01-01

    Full Text Available At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers—which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal—has hitherto been technically impossible. With the aim of quantifying both Ca2+ currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 рА and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 µM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  1. Hysteresis loops of spin-dependent electronic current in a paramagnetic resonant tunnelling diode

    International Nuclear Information System (INIS)

    Wójcik, P; Spisak, B J; Wołoszyn, M; Adamowski, J

    2012-01-01

    Nonlinear properties of the spin-dependent electronic transport through a semiconductor resonant tunnelling diode with a paramagnetic quantum well are considered. The spin-dependent Wigner–Poisson model of the electronic transport and the two-current Mott’s formula for the independent spin channels are applied to determine the current–voltage curves of the nanodevice. Two types of the electronic current hysteresis loops are found in the current–voltage characteristics for both the spin components of the electronic current. The physical interpretation of these two types of the electronic current hysteresis loops is given based on the analysis of the spin-dependent electron densities and the potential energy profiles. The differences between the current–voltage characteristics for both the spin components of the electronic current allow us to explore the changes of the spin polarization of the current for different electric fields and determine the influence of the electronic current hysteresis on the spin polarization of the current flowing through the paramagnetic resonant tunnelling diode. (paper)

  2. Calcium release-dependent inactivation precedes formation of the tubular system in developing rat cardiac myocytes.

    Science.gov (United States)

    Macková, Katarina; Zahradníková, Alexandra; Hoťka, Matej; Hoffmannová, Barbora; Zahradník, Ivan; Zahradníková, Alexandra

    2017-12-01

    Developing cardiac myocytes undergo substantial structural and functional changes transforming the mechanism of excitation-contraction coupling from the embryonic form, based on calcium influx through sarcolemmal DHPR calcium channels, to the adult form, relying on local calcium release through RYR calcium channels of sarcoplasmic reticulum stimulated by calcium influx. We characterized day-by-day the postnatal development of the structure of sarcolemma, using techniques of confocal fluorescence microscopy, and the development of the calcium current, measured by the whole-cell patch-clamp in isolated rat ventricular myocytes. We characterized the appearance and expansion of the t-tubule system and compared it with the appearance and progress of the calcium current inactivation induced by the release of calcium ions from sarcoplasmic reticulum as structural and functional measures of direct DHPR-RYR interaction. The release-dependent inactivation of calcium current preceded the development of the t-tubular system by several days, indicating formation of the first DHPR-RYR couplons at the surface sarcolemma and their later spreading close to contractile myofibrils with the growing t-tubules. Large variability of both of the measured parameters among individual myocytes indicates uneven maturation of myocytes within the growing myocardium.

  3. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  4. Thermal domains in inhomogeneous current-carrying superconductors. Current-voltage characteriscs and dynamics of domain formation after current jumps

    International Nuclear Information System (INIS)

    Bezuglyj, A.I.; Shklovskij, V.A.

    1984-01-01

    The static and dynamic behavior of thermal domains in inhomogeneous superconducting films, where the inhomogeneity behaves like a portion of the film with a reduced critical current, have been studied theoretically within the framework of the phenomenological approach, using the heat balance equation and the dependence of the superconductor critical current on temperature. Depending on the size of the inhomogeneity (local or extended) and on the relative values of parameters of the homogeneous and inhomogeneous regions, different types of current-voltage characteristics are obtained. The nonstationary problem of thermal domain formation near the inhomogeneity after a current jump has been solved, and the domain boundary (kink) dynamics at a distance from the inhomogeneity has been analyzed. A combination of the results allows one to describe the whole process of normal phase formation and its spread throughout the superconducting film

  5. Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks

    Science.gov (United States)

    Pace, D. C.; Austin, M. E.; Bardoczi, L.; Collins, C. S.; Crowley, B.; Davis, E.; Du, X.; Ferron, J.; Grierson, B. A.; Heidbrink, W. W.; Holcomb, C. T.; McKee, G. R.; Pawley, C.; Petty, C. C.; Podestà, M.; Rauch, J.; Scoville, J. T.; Spong, D. A.; Thome, K. E.; Van Zeeland, M. A.; Varela, J.; Victor, B.

    2018-05-01

    An engineering upgrade to the neutral beam system at the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)] enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic ( E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2 MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities and results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.

  6. Mechanism of Estradiol-Induced Block of Voltage-Gated K+ Currents in Rat Medial Preoptic Neurons

    Science.gov (United States)

    Druzin, Michael; Malinina, Evgenya; Grimsholm, Ola; Johansson, Staffan

    2011-01-01

    The present study was conducted to characterize possible rapid effects of 17-β-estradiol on voltage-gated K+ channels in preoptic neurons and, in particular, to identify the mechanisms by which 17-β-estradiol affects the K+ channels. Whole-cell currents from dissociated rat preoptic neurons were studied by perforated-patch recording. 17-β-estradiol rapidly (within seconds) and reversibly reduced the K+ currents, showing an EC50 value of 9.7 µM. The effect was slightly voltage dependent, but independent of external Ca2+, and not sensitive to an estrogen-receptor blocker. Although 17-α-estradiol also significantly reduced the K+ currents, membrane-impermeant forms of estradiol did not reduce the K+ currents and other estrogens, testosterone and cholesterol were considerably less effective. The reduction induced by estradiol was overlapping with that of the KV-2-channel blocker r-stromatoxin-1. The time course of K+ current in 17-β-estradiol, with a time-dependent inhibition and a slight dependence on external K+, suggested an open-channel block mechanism. The properties of block were predicted from a computational model where 17-β-estradiol binds to open K+ channels. It was concluded that 17-β-estradiol rapidly reduces voltage-gated K+ currents in a way consistent with an open-channel block mechanism. This suggests a new mechanism for steroid action on ion channels. PMID:21625454

  7. Calcium Signaling in Taste Cells

    Science.gov (United States)

    Medler, Kathryn F.

    2014-01-01

    The sense of taste is a common ability shared by all organisms and is used to detect nutrients as well as potentially harmful compounds. Thus taste is critical to survival. Despite its importance, surprisingly little is known about the mechanisms generating and regulating responses to taste stimuli. All taste responses depend on calcium signals to generate appropriate responses which are relayed to the brain. Some taste cells have conventional synapses and rely on calcium influx through voltage-gated calcium channels. Other taste cells lack these synapses and depend on calcium release to formulate an output signal through a hemichannel. Beyond establishing these characteristics, few studies have focused on understanding how these calcium signals are formed. We identified multiple calcium clearance mechanisms that regulate calcium levels in taste cells as well as a calcium influx that contributes to maintaining appropriate calcium homeostasis in these cells. Multiple factors regulate the evoked taste signals with varying roles in different cell populations. Clearly, calcium signaling is a dynamic process in taste cells and is more complex than has previously been appreciated. PMID:25450977

  8. Calcium Co-regulates Oxidative Metabolism and ATP Synthase-dependent Respiration in Pancreatic Beta Cells

    Science.gov (United States)

    De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas

    2014-01-01

    Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722

  9. Calcium-dependence of Donnan potentials in glycerinated rabbit psoas muscle in rigor, at and beyond filament overlap; a role for titin in the contractile process

    DEFF Research Database (Denmark)

    Coomber, S J; Bartels, E M; Elliott, G F

    2011-01-01

    contracts and breaks the microelectrode. Therefore the rigor state was studied. There is no reason to suppose a priori that a similar voltage switch does not occur during contraction, however. Calcium dependence is still apparent in muscles stretched beyond overlap (sarcomere length>3.8 μm) and is also seen...... in the gap filaments between the A- and I-band ends; further stretching abolishes the dependence. These experiments strongly suggest that calcium dependence is controlled initially by the titin component, and that this control is lost when titin filaments break. We suppose that that effect is mediated...

  10. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  11. Protein kinase C interaction with calcium: a phospholipid-dependent process.

    LENUS (Irish Health Repository)

    Bazzi, M D

    1990-08-21

    The calcium-binding properties of calcium- and phospholipid-dependent protein kinase C (PKC) were investigated by equilibrium dialysis in the presence and the absence of phospholipids. Calcium binding to PKC displayed striking and unexpected behavior; the free proteins bound virtually no calcium at intracellular calcium concentrations and bound limited calcium (about 1 mol\\/mol of PKC) at 200 microM calcium. However, in the presence of membranes containing acidic phospholipids, PKC bound at least eight calcium ions per protein. The presence of 1 microM phorbol dibutyrate (PDBu) in the dialysis buffer had little effect on these calcium-binding properties. Analysis of PKC-calcium binding by gel filtration under equilibrium conditions gave similar results; only membrane-associated PKC bound significant amounts of calcium. Consequently, PKC is a member of what may be a large group of proteins that bind calcium in a phospholipid-dependent manner. The calcium concentrations needed to induce PKC-membrane binding were similar to those needed for calcium binding (about 40 microM calcium at the midpoint). However, the calcium concentration required for PKC-membrane binding was strongly influenced by the phosphatidylserine composition of the membranes. Membranes with higher percentages of phosphatidylserine required lower concentrations of calcium. These properties suggested that the calcium sites may be generated at the interface between PKC and the membrane. Calcium may function as a bridge between PKC and phospholipids. These studies also suggested that calcium-dependent PKC-membrane binding and PKC function could be regulated by a number of factors in addition to calcium levels and diacylglycerol content of the membrane.

  12. Mitigation of Voltage and Current Harmonics in Grid-Connected Microgrids

    DEFF Research Database (Denmark)

    Savaghebi, Mehdi; Guerrero, Josep M.; Jalilian, Alireza

    2012-01-01

    In this paper, a control approach is proposed for selective compensation of main voltage and current harmonics in grid-connected microgrids. Two modes of compensation are considered, i.e. voltage and current compensation modes. In the case that sensitive loads are connected to the point of common...... coupling (PCC), voltage compensation mode is activated in order to provide a high voltage quality at PCC. Otherwise, grid current harmonics are mitigated (current compensation mode) in order to avoid excessive harmonic supply by the grid. In both modes, harmonic compensation is achieved through proper...... control of distributed generators (DGs) interface converters. The compensation effort of each harmonic is shared considering the corresponding current harmonic supplied by the DGs. The control system of each DG comprises harmonic compensator, power controllers, voltage and current controllers and virtual...

  13. Method of controlling illumination device based on current-voltage model

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an illumination device comprising a number of LEDs, means for receiving an input signal, means for generating an activation signal for at least one of the LEDs based on the input signal. The illumination device comprises further means for obtaining the voltage...... and the colorimetric properties of said light emitted by LED. The present invention relates also to a method of controlling and a meted of calibrating such illumination device....... across and current through the LED and the means for generating the activation signal is adapted to generate the activating signal based on the voltage, the current and a current- voltage model related to LED. The current-voltage model defines a relationship between the current, the voltage...

  14. Apo-states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain

    Science.gov (United States)

    Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.

    2013-01-01

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053

  15. Enhanced expression of a calcium-dependent protein kinase

    Indian Academy of Sciences (India)

    Among the downstream targets of calcium in plants, calcium-dependent protein kinases (CDPKs) form an interesting class of kinases which are activated by calcium binding. They have been implicated in a diverse array of responses to hormonal and environmental stimuli. In order to dissect the role of CDPKs in the moss ...

  16. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  17. Calcium Electroporation

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; Gibot, Laure; Madi, Moinecha

    2015-01-01

    BACKGROUND: Calcium electroporation describes the use of high voltage electric pulses to introduce supraphysiological calcium concentrations into cells. This promising method is currently in clinical trial as an anti-cancer treatment. One very important issue is the relation between tumor cell kill...... efficacy-and normal cell sensitivity. METHODS: Using a 3D spheroid cell culture model we have tested the effect of calcium electroporation and electrochemotherapy using bleomycin on three different human cancer cell lines: a colorectal adenocarcinoma (HT29), a bladder transitional cell carcinoma (SW780......), and a breast adenocarcinoma (MDA-MB231), as well as on primary normal human dermal fibroblasts (HDF-n). RESULTS: The results showed a clear reduction in spheroid size in all three cancer cell spheroids three days after treatment with respectively calcium electroporation (p

  18. Functional and pharmacological consequences of the distribution of voltage-gated calcium channels in the renal blood vessels

    DEFF Research Database (Denmark)

    Hansen, P B L

    2013-01-01

    Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L......-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular...... vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore...

  19. Intracellular calcium levels can regulate Importin-dependent nuclear import

    International Nuclear Information System (INIS)

    Kaur, Gurpreet; Ly-Huynh, Jennifer D.; Jans, David A.

    2014-01-01

    Highlights: • High intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import. • The effect of Ca 2+ on nuclear import does not relate to changes in the nuclear pore. • High intracellular calcium can result in mislocalisation of Impβ1, Ran and RCC1. - Abstract: We previously showed that increased intracellular calcium can modulate Importin (Imp)β1-dependent nuclear import of SRY-related chromatin remodeling proteins. Here we extend this work to show for the first time that high intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import generally. The basis of this relates to the mislocalisation of the transport factors Impβ1 and Ran, which show significantly higher nuclear localization in contrast to various other factors, and RCC1, which shows altered subnuclear localisation. The results here establish for the first time that intracellular calcium modulates conventional nuclear import through direct effects on the nuclear transport machinery

  20. Intracellular calcium levels can regulate Importin-dependent nuclear import

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Gurpreet; Ly-Huynh, Jennifer D.; Jans, David A., E-mail: David.Jans@monash.edu

    2014-07-18

    Highlights: • High intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import. • The effect of Ca{sup 2+} on nuclear import does not relate to changes in the nuclear pore. • High intracellular calcium can result in mislocalisation of Impβ1, Ran and RCC1. - Abstract: We previously showed that increased intracellular calcium can modulate Importin (Imp)β1-dependent nuclear import of SRY-related chromatin remodeling proteins. Here we extend this work to show for the first time that high intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import generally. The basis of this relates to the mislocalisation of the transport factors Impβ1 and Ran, which show significantly higher nuclear localization in contrast to various other factors, and RCC1, which shows altered subnuclear localisation. The results here establish for the first time that intracellular calcium modulates conventional nuclear import through direct effects on the nuclear transport machinery.

  1. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  2. Dextromethorphan inhibition of voltage-gated proton currents in BV2 microglial cells.

    Science.gov (United States)

    Song, Jin-Ho; Yeh, Jay Z

    2012-05-10

    Dextromethorphan, an antitussive drug, has a neuroprotective property as evidenced by its inhibition of microglial production of pro-inflammatory cytokines and reactive oxygen species. The microglial activation requires NADPH oxidase activity, which is sustained by voltage-gated proton channels in microglia as they dissipate an intracellular acid buildup. In the present study, we examined the effect of dextromethorphan on proton currents in microglial BV2 cells. Dextromethorphan reversibly inhibited proton currents with an IC(50) value of 51.7 μM at an intracellular/extracellular pH gradient of 5.5/7.3. Dextromethorphan did not change the reversal potential or the voltage dependence of the gating. Dextrorphan and 3-hydroxymorphinan, major metabolites of dextromethorphan, and dextromethorphan methiodide were ineffective in inhibiting proton currents. The results indicate that dextromethorphan inhibition of proton currents would suppress NADPH oxidase activity and, eventually, microglial activation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  3. DC-Voltage Fluctuation Elimination Through a DC-Capacitor Current Control for DFIG Converters Under Unbalanced Grid Voltage Conditions

    DEFF Research Database (Denmark)

    Liu, Changjin; Xu, Dehong; Zhu, Nan

    2013-01-01

    Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...

  4. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  5. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  6. Study of current-voltage characteristics in PbTe(Ga) alloys at low temperatures

    International Nuclear Information System (INIS)

    Akimov, B.A.; Albul, A.V.; Bogdanov, E.V.

    1992-01-01

    Results of determining current-voltage characteristics in PbTe(Ga) monocrystals of n- and p-types of conductivity in strong electric fields E ≤ 2 x 10 3 V/Cm at 4.2-77 K are presented. It was established that at helium and nitrogen temperatures, the current-voltage characteristics of PbTe(Ga) alloys, high-ohmic state of which was realized in helium, differed qualitatively from ones, typical for unalloyed PbTe. The superlinear dependence, observed in the fields, beginning from E ≥ 1 V/cm, is explained in the framework of concepts of strong electric field effect on conductivity of impurity states

  7. Optical sensors for the measurement of electric current and voltage

    Energy Technology Data Exchange (ETDEWEB)

    Rutgers, W R; Hulshof, H J.M.; Laurensse, I J; van der Wey, A H

    1987-01-01

    Optical sensors for the measurement of electrical current and voltage were developed for application in electric power systems. The current sensor, based on the Faraday effect in a monomode glass fiber, and the voltage sensor, based on the transverse Pockels effect in a crystal, are demonstrated in wide-band (10 MHz) interference-free measurements of pulsed currents and impulse voltages.

  8. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...

  9. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  10. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  11. Harmonic current interaction at a low voltage customer's installations

    NARCIS (Netherlands)

    Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.

    2009-01-01

    The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low

  12. Structure-function of proteins interacting with the α1 pore-forming subunit of high-voltage-activated calcium channels

    Science.gov (United States)

    Neely, Alan; Hidalgo, Patricia

    2014-01-01

    Openings of high-voltage-activated (HVA) calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, HVA calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1) associated with four additional polypeptide chains β, α2, δ, and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of HVA calcium channels. PMID:24917826

  13. Bidirectional current-voltage converters based on magnetostrictive/piezoelectric composites

    NARCIS (Netherlands)

    Jia, Y.; Or, S.W.; Chan, H.L.W.; Jiao, J.; Luo, H.; Van der Zwaag, S.

    2009-01-01

    We report a power supply-free, bidirectional electric current-voltage converter based on a coil-wound laminated composite of magnetostrictive alloy and piezoelectric crystal. An electric current applied to the coil induces a magnetic field, resulting in an electric voltage from the composite due to

  14. Lack of direct evidence for a functional role of voltage-operated calcium channels in juxtaglomerular cells

    DEFF Research Database (Denmark)

    Kurtz, A; Skott, O; Chegini, S

    1990-01-01

    in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...

  15. Current-voltage model of LED light sources

    DEFF Research Database (Denmark)

    Beczkowski, Szymon; Munk-Nielsen, Stig

    2012-01-01

    Amplitude modulation is rarely used for dimming light-emitting diodes in polychromatic luminaires due to big color shifts caused by varying magnitude of LED driving current and nonlinear relationship between intensity of a diode and driving current. Current-voltage empirical model of light...

  16. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  17. ELECTROMECHANICAL TRANSIENT PROCESSES DURING SUPPLY VOLTAGE CHANGING IN THE SYSTEM OF POLYMER INSULATION COVERING OF THE CURRENT-CARRYING CORE OF ULTRA HIGH VOLTAGE CABLES

    Directory of Open Access Journals (Sweden)

    V. M. Zolotaryov

    2018-04-01

    Full Text Available Aim. The article is devoted to the analysis of the electromechanical transient processes in a system of three frequency-controlled electric drives based on asynchronous motors that control current-carrying core motion, as well as to the study of the effect of such processes on the modes applying three-layer polymer insulation to the current-carrying core. Technique. The study was conducted based on the concepts of electromechanics, electromagnetic field theory, mathematical physics, mathematical modeling. Results. A mathematical model has been developed to analyze transients in an electromechanical system consisting of three frequency-controlled electric drives providing current-carrying core motion of ultra-high voltage cables in an inclined extrusion line. The coordination of the electromechanical parameters of the system drives has been carried out and the permissible changes in the supply voltage at the limiting mass while moving current-carrying core of ultra-high voltage cables with applied polymer insulation have been estimated. Scientific novelty. For the first time it is determined that with the limiting mass of the current-carrying core, the electromechanical system allows to stabilize the current-carrying core speed with the required accuracy at short-term decreases in the supply voltage by no more than 27 % of its amplitude value. It is also shown that this system is resistant to short-term increases in voltage by 32 % for 0.2 s. Practical significance. Using the developed model, it is possible to calculate the change in the configuration and speed of the slack current-carrying core when applying polymer insulation, depending on the specific mass of the current-carrying core per unit length, its tension at the bottom, the torque of the traction motor and the supply voltage to achieve stable operation of the system and accurate working of the set parameters.

  18. Low noise constant current source for bias dependent noise measurements

    International Nuclear Information System (INIS)

    Talukdar, D.; Bose, Suvendu; Bardhan, K. K.; Chakraborty, R. K.

    2011-01-01

    A low noise constant current source used for measuring the 1/f noise in disordered systems in ohmic as well as nonohmic regime is described. The source can supply low noise constant current starting from as low as 1 μA to a few tens of milliampere with a high voltage compliance limit of around 20 V. The constant current source has several stages, which can work in a standalone manner or together to supply the desired value of load current. The noise contributed by the current source is very low in the entire current range. The fabrication of a low noise voltage preamplifier modified for bias dependent noise measurements and based on the existing design available in the MAT04 data sheet is also described.

  19. Special features of the current-voltage characteristics of short superconducting bridges

    International Nuclear Information System (INIS)

    Zhilinskii, S.; Latyshev, Y.; Nad', F.

    1981-01-01

    A study was made of variable-thickness superconducting bridges made of tin and indium. The current-voltage characteristics were determined for these bridges as a function of their length and width. The characteristics exhibited a linear region as well as an inflection. The temperature of the appearance of such an inflection depended on the length of the bridge but was independent of the bridge material

  20. Voltage-regulating constant-current sources in a linear induction accelerator

    International Nuclear Information System (INIS)

    Zhao Juan; Cao Kefeng; Deng Jianjun; Zhu Lijun; Yang Jia; Ye Chao; Huang Bin; Cao Ningxiang; Dong Jinxuan; Zhang Jichang; Yu Zhiguo; Chen Min

    2002-01-01

    Constant-current Sources are one of key units in a linear induction accelerator. The requirements for the sources are to supply stable direct current of high power for the induction coil, be easy to computer-control and highly stable and reliable. Applying the technique of linear current source regulating in series, the primary voltage of the power transformer is regulated through an MJYS-JL-350A type three-phase alterative voltage-regulating module. The output current variation is 300-500 A when the load variation is 0.06-0.1 Ω and the voltage drop of the regulator tube is controlled within 8 V±2V when the variation of mains voltage is in ±10%. Both the current ripple and stability meet the technical requirements. The constant-current sources are controlled through an industrial controller. For each of the constant-current sources has a smallest system comprised of 8051 which is communication-controlled through a RS-485 interface, the sources can be controlled remotely

  1. Analysis of the current-voltage characteristics lineshapes of resonant tunneling diodes

    International Nuclear Information System (INIS)

    Rivera, P.H.; Schulz, P.A.

    1996-01-01

    It is discussed the influence of a two dimensional electron gas at the emitter-barrier interface on the current-voltage characteristics of a Ga As-Al Ga As double-barrier quantum well resonant tunneling diode. This effect is characterized by the modification of the space charge distribution along the structure. Within the framework of a self-consistent calculation we analyse the current-voltage characteristics of the tunneling diodes. This analysis permits us to infer different tunneling ways, related to the formation of confined states in the emitter region, and their signatures in the current-voltage characteristics. We show that varying the spacer layer, together with barrier heights, changes drastically the current density-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics reported in the literature. The general trend of experimental lineshapes can be reproduced and interpreted with our model. The possibility of tunneling paths is predicted for a range that has not yet been explored experimentally. (author). 12 refs., 4 figs

  2. ATP-dependent calcium transport across basal plasma membranes of human placental trophoblast

    International Nuclear Information System (INIS)

    Fisher, G.J.; Kelley, L.K.; Smith, C.H.

    1987-01-01

    As a first step in understanding the cellular basis of maternal-fetal calcium transfer, the authors examined the characteristics of calcium uptake by a highly purified preparation of the syncytiotrophoblast basal (fetal facing) plasma membrane. In the presence of nanomolar concentrations of free calcium, basal membranes demonstrated substantial ATP-dependent calcium uptake. This uptake required magnesium, was not significantly affected by Na + or K + (50 mM), or sodium azide (10 mM). Intravesicular calcium was rapidly and completely released by the calcium ionophore rapidly and completely released by the calcium ionophore A23187. Calcium transport was significantly stimulated by the calcium-dependent regulatory protein calmodulin. Placental membrane fractions enriched in endoplasmic reticulum (ER) and mitochondria also demonstrated ATP-dependent calcium uptake. In contrast to basal membrane, mitochondrial calcium uptake was completely inhibited by azide. The rate of calcium uptake was completely inhibited by azide. The rate of calcium uptake by the ER was only 20% of that of basal membranes. They conclude that the placental basal plasma membrane possesses a high-affinity calcium transport system similar to that found in plasma membranes of a variety of cell types. This transporter is situated to permit it to function in vivo in maternal-fetal calcium transfer

  3. Calcium ion binding properties of Medicago truncatula calcium/calmodulin-dependent protein kinase.

    Science.gov (United States)

    Swainsbury, David J K; Zhou, Liang; Oldroyd, Giles E D; Bornemann, Stephen

    2012-09-04

    A calcium/calmodulin-dependent protein kinase (CCaMK) is essential in the interpretation of calcium oscillations in plant root cells for the establishment of symbiotic relationships with rhizobia and mycorrhizal fungi. Some of its properties have been studied in detail, but its calcium ion binding properties and subsequent conformational change have not. A biophysical approach was taken with constructs comprising either the visinin-like domain of Medicago truncatula CCaMK, which contains EF-hand motifs, or this domain together with the autoinhibitory domain. The visinin-like domain binds three calcium ions, leading to a conformational change involving the exposure of hydrophobic surfaces and a change in tertiary but not net secondary or quaternary structure. The affinity for calcium ions of visinin-like domain EF-hands 1 and 2 (K(d) = 200 ± 50 nM) was appropriate for the interpretation of calcium oscillations (~125-850 nM), while that of EF-hand 3 (K(d) ≤ 20 nM) implied occupancy at basal calcium ion levels. Calcium dissociation rate constants were determined for the visinin-like domain of CCaMK, M. truncatula calmodulin 1, and the complex between these two proteins (the slowest of which was 0.123 ± 0.002 s(-1)), suggesting the corresponding calcium association rate constants were at or near the diffusion-limited rate. In addition, the dissociation of calmodulin from the protein complex was shown to be on the same time scale as the dissociation of calcium ions. These observations suggest that the formation and dissociation of the complex between calmodulin and CCaMK would substantially mirror calcium oscillations, which typically have a 90 s periodicity.

  4. Voltage-current characteristics of multiterminal HVDC-VSC for offshore wind farms

    Energy Technology Data Exchange (ETDEWEB)

    Gomis-Bellmunt, Oriol [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Universitat Politecnica de Catalunya UPC, Av. Diagonal, 647, Pl. 2., 08028 Barcelona (Spain); IREC Catalonia Institute for Energy Research, Barcelona (Spain); Liang, Jun; Ekanayake, Janaka; Jenkins, Nicholas [School of Engineering, Cardiff University, Queen' s Buildings, The Parade, Cardiff CF24 3AA, Wales (United Kingdom)

    2011-02-15

    Voltage-current characteristics and equilibrium points for the DC voltages of multiterminal HVDC systems using voltage source converters are discussed. The wind farm rectifiers and grid connected inverters are analyzed through their operating modes, governing equations and graphical characteristics. Using the converter equations and the HVDC grid conductance matrix the equilibrium voltages and currents are found. Case studies are presented considering wind power generation, loss of a converter and voltage sags in the AC grid. (author)

  5. Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

    Directory of Open Access Journals (Sweden)

    N Hatefi Kargan

    2013-09-01

    Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

  6. Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

    Science.gov (United States)

    Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

    2017-06-01

    The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

  7. Enhanced current and voltage regulators for stand-alone applications

    DEFF Research Database (Denmark)

    Federico, de Bosio; Pastorelli, Michele; Antonio DeSouza Ribeiro, Luiz

    2016-01-01

    State feedback decoupling permits to achieve a better dynamic response for Voltage Source in stand-alone applications. The design of current and voltage regulators is performed in the discrete-time domain since it provides better accuracy and allows direct pole placement. As the attainable...... bandwidth of the current loop is mainly limited by computational and PWM delays, a lead compensator structure is proposed to overcome this limitation. The design of the voltage regulator is based on the Nyquist criterion, verifying to guarantee a high sensitivity peak. Discrete-time domain implementation...

  8. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  9. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. A New Asymmetrical Current-fed Converter with Voltage Lifting

    Directory of Open Access Journals (Sweden)

    DELSHAD, M.

    2011-05-01

    Full Text Available This paper presents a new zero voltage switching current-fed DC-DC converter with high voltage gain. In this converter all switches (main and auxiliary turn on under zero voltage switching and turn off under almost zero voltage switching due to snubber capacitor. Furthermore, the voltage spike across the main switch due to leakage inductance of forward transformer is absorbed. The flyback transformer which is connected to the output in series causes to high voltage gain and less voltage stress on the power devices. Considering high efficiency and voltage gain of this converter, it is suitable for green generated systems such as fuel cells or photovoltaic systems. The presented experimental results verify the integrity of the proposed converter.

  11. Direct Interaction of CaVβ with Actin Up-regulates L-type Calcium Currents in HL-1 Cardiomyocytes*

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E.; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-01-01

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. PMID:25533460

  12. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  13. Unusual Voltage-Gated Sodium Currents as Targets for Pain.

    Science.gov (United States)

    Barbosa, C; Cummins, T R

    2016-01-01

    Pain is a serious health problem that impacts the lives of many individuals. Hyperexcitability of peripheral sensory neurons contributes to both acute and chronic pain syndromes. Because voltage-gated sodium currents are crucial to the transmission of electrical signals in peripheral sensory neurons, the channels that underlie these currents are attractive targets for pain therapeutics. Sodium currents and channels in peripheral sensory neurons are complex. Multiple-channel isoforms contribute to the macroscopic currents in nociceptive sensory neurons. These different isoforms exhibit substantial variations in their kinetics and pharmacology. Furthermore, sodium current complexity is enhanced by an array of interacting proteins that can substantially modify the properties of voltage-gated sodium channels. Resurgent sodium currents, atypical currents that can enhance recovery from inactivation and neuronal firing, are increasingly being recognized as playing potentially important roles in sensory neuron hyperexcitability and pain sensations. Here we discuss unusual sodium channels and currents that have been identified in nociceptive sensory neurons, describe what is known about the molecular determinants of the complex sodium currents in these neurons. Finally, we provide an overview of therapeutic strategies to target voltage-gated sodium currents in nociceptive neurons. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. A Hybrid, Current-Source/Voltage-Source Power Inverter Circuit

    DEFF Research Database (Denmark)

    Trzynadlowski, Andrzej M.; Patriciu, Niculina; Blaabjerg, Frede

    2001-01-01

    A combination of a large current-source inverter and a small voltage-source inverter circuits is analyzed. The resultant hybrid inverter inherits certain operating advantages from both the constituent converters. In comparison with the popular voltage-source inverter, these advantages include...... reduced switching losses, improved quality of output current waveforms, and faster dynamic response to current control commands. Description of operating principles and characteristics of the hybrid inverter is illustrated with results of experimental investigation of a laboratory model....

  15. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  16. Attenuated response of L-type calcium current to nitric oxide in atrial fibrillation.

    Science.gov (United States)

    Rozmaritsa, Nadiia; Christ, Torsten; Van Wagoner, David R; Haase, Hannelore; Stasch, Johannes-Peter; Matschke, Klaus; Ravens, Ursula

    2014-03-01

    Nitric oxide (NO) synthesized by cardiomyocytes plays an important role in the regulation of cardiac function. Here, we studied the impact of NO signalling on calcium influx in human right atrial myocytes and its relation to atrial fibrillation (AF). Right atrial appendages (RAAs) were obtained from patients in sinus rhythm (SR) and AF. The biotin-switch technique was used to evaluate endogenous S-nitrosylation of the α1C subunit of L-type calcium channels. Comparing SR to AF, S-nitrosylation of Ca(2+) channels was similar. Direct effects of the NO donor S-nitroso-N-acetyl-penicillamine (SNAP) on L-type calcium current (ICa,L) were studied in cardiomyocytes with standard voltage-clamp techniques. In SR, ICa,L increased with SNAP (100 µM) by 48%, n/N = 117/56, P < 0.001. The SNAP effect on ICa,L involved activation of soluble guanylate cyclase and protein kinase A. Specific inhibition of phosphodiesterase (PDE)3 with cilostamide (1 µM) enhanced ICa,L to a similar extent as SNAP. However, when cAMP was elevated by PDE3 inhibition or β-adrenoceptor stimulation, SNAP reduced ICa,L, pointing to cGMP-cAMP cross-regulation. In AF, the stimulatory effect of SNAP on ICa,L was attenuated, while its inhibitory effect on isoprenaline- or cilostamide-stimulated current was preserved. cGMP elevation with SNAP was comparable between the SR and AF group. Moreover, the expression of PDE3 and soluble guanylate cyclase was not reduced in AF. NO exerts dual effects on ICa,L in SR with an increase of basal and inhibition of cAMP-stimulated current, and in AF NO inhibits only stimulated ICa,L. We conclude that in AF, cGMP regulation of PDE2 is preserved, but regulation of PDE3 is lost.

  17. Mitigation of Grid Current Distortion for LCL-Filtered Voltage Source Inverter with Inverter Current Feedback Control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2018-01-01

    LCL filters feature low inductance; thus, the injected grid current from an LCL-filtered Voltage Source Inverter (VSI) can be easily distorted by grid voltage harmonics. This problem is especially tough for the control system with Inverter-side Current Feedback (ICF), since the grid current...... harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...

  18. Analytical drift-current threshold voltage model of long-channel double-gate MOSFETs

    International Nuclear Information System (INIS)

    Shih, Chun-Hsing; Wang, Jhong-Sheng

    2009-01-01

    This paper presents a new, physical threshold voltage model to solve the ambiguity in determining the threshold voltage of double-gate (DG) MOSFETs. To avoid the difficulties of the conventional 2ψ B model in nearly undoped DG MOSFETs, this study proposes to define the on–off switching based on the actual roles of the drift and diffusion components in the total drain current. The drift current strongly enhances beyond the threshold voltage, while the diffusion current plays a major role in the subthreshold. The threshold voltage is defined as the drift component that exceeds the diffusion counterpart. From the solutions of Poisson's equation, the drift and diffusion currents of DG MOSFETs are separately formulated to derive the analytical expressions of the threshold voltage and associated threshold current. This model provides a comprehensive description of the switching behavior of DG MOSFET devices, and offers a physical onset threshold current to determine the threshold voltage in practical extraction

  19. Dynamic voltage-current characteristics for a water jet plasma arc

    International Nuclear Information System (INIS)

    Yang Jiaxiang; Lan Sheng; Xu Zuoming

    2008-01-01

    A virtual instrument technology is used to measure arc current, arc voltage, dynamic V-I characteristics, and nonlinear conductance for a cone-shaped water jet plasma arc under ac voltage. Experimental results show that ac arc discharge mainly happens in water vapor evaporated from water when heated. However, due to water's cooling effect and its conductance, arc conductance, reignition voltage, extinguish voltage, and current zero time are very different from those for ac arc discharge in gas work fluid. These can be valuable to further studies on mechanism and characteristics of plasma ac discharge in water, and even in gas work fluid

  20. CaV3.1 isoform of T-type calcium channels supports excitability of rat and mouse ventral tegmental area neurons.

    Science.gov (United States)

    Tracy, Matthew E; Tesic, Vesna; Stamenic, Tamara Timic; Joksimovic, Srdjan M; Busquet, Nicolas; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M

    2018-03-23

    Recent data have implicated voltage-gated calcium channels in the regulation of the excitability of neurons within the mesolimbic reward system. While the attention of most research has centered on high voltage L-type calcium channel activity, the presence and role of the low voltage-gated T-type calcium channel (T-channels) has not been well explored. Hence, we investigated T-channel properties in the neurons of the ventral tegmental area (VTA) utilizing wild-type (WT) rats and mice, Ca V 3.1 knock-out (KO) mice, and TH-eGFP knock-in (KI) rats in acute horizontal brain slices of adolescent animals. In voltage-clamp experiments, we first assessed T-channel activity in WT rats with characteristic properties of voltage-dependent activation and inactivation, as well as characteristic crisscrossing patterns of macroscopic current kinetics. T-current kinetics were similar in WT mice and WT rats but T-currents were abolished in Ca V 3.1 KO mice. In ensuing current-clamp experiments, we observed the presence of hyperpolarization-induced rebound burst firing in a subset of neurons in WT rats, as well as dopaminergic and non-dopaminergic neurons in TH-eGFP KI rats. Following the application of a pan-selective T-channel blocker TTA-P2, rebound bursting was significantly inhibited in all tested cells. In a behavioral assessment, the acute locomotor increase induced by a MK-801 (Dizocilpine) injection in WT mice was abolished in Ca V 3.1 KO mice, suggesting a tangible role for 3.1 T-type channels in drug response. We conclude that pharmacological targeting of Ca V 3.1 isoform of T-channels may be a novel approach for the treatment of disorders of mesolimbic reward system. Copyright © 2018. Published by Elsevier Ltd.

  1. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  2. Structural basis for the differential effects of CaBP1 and calmodulin on CaV1.2 calcium-dependent inactivation

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L.

    2010-01-01

    Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (CaVs) with unusual properties. CaBP1 inhibits CaV1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit CaV1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF-hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the CaV1.2 IQ domain at a site that overlaps with the Ca2+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates CaVs. PMID:21134641

  3. Structural basis for the differential effects of CaBP1 and calmodulin on Ca(V)1.2 calcium-dependent inactivation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2010-12-08

    Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (Ca(V)s) with unusual properties. CaBP1 inhibits Ca(V)1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit Ca(V)1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the Ca(V)1.2 IQ domain at a site that overlaps with the Ca²+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates Ca(V)s. Copyright © 2010 Elsevier Ltd. All rights reserved.

  4. Electronic Current Transducer (ECT) for high voltage dc lines

    Science.gov (United States)

    Houston, J. M.; Peters, P. H., Jr.; Summerayes, H. R., Jr.; Carlson, G. J.; Itani, A. M.

    1980-02-01

    The development of a bipolar electronic current transducer (ECT) for measuring the current in a high voltage dc (HVDC) power line at line potential is discussed. The design and construction of a free standing ECT for use on a 400 kV line having a nominal line current of 2000 A is described. Line current is measured by a 0.0001 ohm shunt whose voltage output is sampled by a 14 bit digital data link. The high voltage interface between line and ground is traversed by optical fibers which carry digital light signals as far as 300 m to a control room where the digital signal is converted back to an analog representation of the shunt voltage. Two redundant electronic and optical data links are used in the prototype. Power to operate digital and optical electronics and temperature controlling heaters at the line is supplied by a resistively and capacitively graded 10 stage cascade of ferrite core transformers located inside the hollow, SF6 filled, porcelain support insulator. The cascade is driven by a silicon controlled rectifier inverter which supplies about 100 W of power at 30 kHz.

  5. Fault Ride-through Capability Enhancement of Voltage Source Converter-High Voltage Direct Current Systems with Bridge Type Fault Current Limiters

    Directory of Open Access Journals (Sweden)

    Md Shafiul Alam

    2017-11-01

    Full Text Available This paper proposes the use of bridge type fault current limiters (BFCLs as a potential solution to reduce the impact of fault disturbance on voltage source converter-based high voltage DC (VSC-HVDC systems. Since VSC-HVDC systems are vulnerable to faults, it is essential to enhance the fault ride-through (FRT capability with auxiliary control devices like BFCLs. BFCL controllers have been developed to limit the fault current during the inception of system disturbances. Real and reactive power controllers for the VSC-HVDC have been developed based on current control mode. DC link voltage control has been achieved by a feedback mechanism such that net power exchange with DC link capacitor is zero. A grid-connected VSC-HVDC system and a wind farm integrated VSC-HVDC system along with the proposed BFCL and associated controllers have been implemented in a real time digital simulator (RTDS. Symmetrical three phase as well as different types of unsymmetrical faults have been applied in the systems in order to show the effectiveness of the proposed BFCL solution. DC link voltage fluctuation, machine speed and active power oscillation have been greatly suppressed with the proposed BFCL. Another significant feature of this work is that the performance of the proposed BFCL in VSC-HVDC systems is compared to that of series dynamic braking resistor (SDBR. Comparative results show that the proposed BFCL is superior over SDBR in limiting fault current as well as improving system fault ride through (FRT capability.

  6. Fast calcium transients translate the distribution and conduction of neural activity in different regions of a single sensory neuron.

    Science.gov (United States)

    Purali, Nuhan

    2017-09-01

    In the present study, cytosolic calcium concentration changes were recorded in response to various forms of excitations, using the fluorescent calcium indicator dye OG-BAPTA1 together with the current or voltage clamp methods in stretch receptor neurons of crayfish. A single action potential evoked a rise in the resting calcium level in the axon and axonal hillock, whereas an impulse train or a large saturating current injection would be required to evoke an equivalent response in the dendrite region. Under voltage clamp conditions, amplitude differences between axon and dendrite responses vanished completely. The fast activation time and the modulation of the response by extracellular calcium concentration changes indicated that the evoked calcium transients might be mediated by calcium entry into the cytosol through a voltage-gated calcium channel. The decay of the responses was slow and sensitive to extracellular sodium and calcium concentrations as well as exposure to 1-10 mM NiCl 2 and 10-500 µM lanthanum. Thus, a sodium calcium exchanger and a calcium ATPase might be responsible for calcium extrusion from the cytosol. Present results indicate that the calcium indicator OG-BAPTA1 might be an efficient but indirect way of monitoring regional membrane potential differences in a single neuron.

  7. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef

    2009-01-01

    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  8. Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

    Energy Technology Data Exchange (ETDEWEB)

    Chuan, Lee Te, E-mail: gd130079@siswa.uthm.edu.my; Rathi, Muhammad Fareez Mohamad, E-mail: cd110238@siswa.uthm.edu.my; Abidin, Muhamad Yusuf Zainal, E-mail: cd110221@siswa.uthm.edu.my; Abdullah, Hasan Zuhudi, E-mail: hasan@uthm.edu.my; Idris, Maizlinda Izwana, E-mail: izwana@uthm.edu.my [Faculty of Mechanical and Manufacturing Engineering, Universiti Tun Hussein Onn Malaysia, 86400 Parit Raja, Batu Pahat, Johor (Malaysia)

    2015-07-22

    Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm{sup −2}) at room temperature. Surface oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.

  9. Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film

    Science.gov (United States)

    Das, Amit Kumar; Meikap, Ajit Kumar

    2017-12-01

    In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.

  10. Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film

    Science.gov (United States)

    Das, Amit Kumar; Meikap, Ajit Kumar

    2018-06-01

    In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.

  11. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  12. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  13. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  14. Active Dendrites and Differential Distribution of Calcium Channels Enable Functional Compartmentalization of Golgi Cells.

    Science.gov (United States)

    Rudolph, Stephanie; Hull, Court; Regehr, Wade G

    2015-11-25

    Interneurons are essential to controlling excitability, timing, and synaptic integration in neuronal networks. Golgi cells (GoCs) serve these roles at the input layer of the cerebellar cortex by releasing GABA to inhibit granule cells (grcs). GoCs are excited by mossy fibers (MFs) and grcs and provide feedforward and feedback inhibition to grcs. Here we investigate two important aspects of GoC physiology: the properties of GoC dendrites and the role of calcium signaling in regulating GoC spontaneous activity. Although GoC dendrites are extensive, previous studies concluded they are devoid of voltage-gated ion channels. Hence, the current view holds that somatic voltage signals decay passively within GoC dendrites, and grc synapses onto distal dendrites are not amplified and are therefore ineffective at firing GoCs because of strong passive attenuation. Using whole-cell recording and calcium imaging in rat slices, we find that dendritic voltage-gated sodium channels allow somatic action potentials to activate voltage-gated calcium channels (VGCCs) along the entire dendritic length, with R-type and T-type VGCCs preferentially located distally. We show that R- and T-type VGCCs located in the dendrites can boost distal synaptic inputs and promote burst firing. Active dendrites are thus critical to the regulation of GoC activity, and consequently, to the processing of input to the cerebellar cortex. In contrast, we find that N-type channels are preferentially located near the soma, and control the frequency and pattern of spontaneous firing through their close association with calcium-activated potassium (KCa) channels. Thus, VGCC types are differentially distributed and serve specialized functions within GoCs. Interneurons are essential to neural processing because they modulate excitability, timing, and synaptic integration within circuits. At the input layer of the cerebellar cortex, a single type of interneuron, the Golgi cell (GoC), carries these functions. The

  15. Two coupled Josephson junctions: dc voltage controlled by biharmonic current

    International Nuclear Information System (INIS)

    Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J

    2012-01-01

    We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)

  16. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  17. Direct interaction of CaVβ with actin up-regulates L-type calcium currents in HL-1 cardiomyocytes.

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-02-20

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Investigation of leakage current and breakdown voltage in irradiated double-sided 3D silicon sensors

    International Nuclear Information System (INIS)

    Betta, G.-F. Dalla; Mendicino, R.; Povoli, M.; Sultan, D.M.S.; Ayllon, N.; Hoeferkamp, M.; McDuff, H.; Seidel, S.; Boscardin, M.; Zorzi, N.; Mattiazzo, S.

    2016-01-01

    We report on an experimental study aimed at gaining deeper insight into the leakage current and breakdown voltage of irradiated double-sided 3D silicon sensors from FBK, so as to improve both the design and the fabrication technology for use at future hadron colliders such as the High Luminosity LHC. Several 3D diode samples of different technologies and layout are considered, as well as several irradiations with different particle types. While the leakage current follows the expected linear trend with radiation fluence, the breakdown voltage is found to depend on both the bulk damage and the surface damage, and its values can vary significantly with sensor geometry and process details.

  19. Low-cost wireless voltage & current grid monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Hines, Jacqueline [SenSanna Inc., Arnold, MD (United States)

    2016-12-31

    This report describes the development and demonstration of a novel low-cost wireless power distribution line monitoring system. This system measures voltage, current, and relative phase on power lines of up to 35 kV-class. The line units operate without any batteries, and without harvesting energy from the power line. Thus, data on grid condition is provided even in outage conditions, when line current is zero. This enhances worker safety by detecting the presence of voltage and current that may appear from stray sources on nominally isolated lines. Availability of low-cost power line monitoring systems will enable widespread monitoring of the distribution grid. Real-time data on local grid operating conditions will enable grid operators to optimize grid operation, implement grid automation, and understand the impact of solar and other distributed sources on grid stability. The latter will enable utilities to implement eneygy storage and control systems to enable greater penetration of solar into the grid.

  20. Balanced Current Control Strategy for Current Source Rectifier Stage of Indirect Matrix Converter under Unbalanced Grid Voltage Conditions

    Directory of Open Access Journals (Sweden)

    Yeongsu Bak

    2016-12-01

    Full Text Available This paper proposes a balanced current control strategy for the current source rectifier (CSR stage of an indirect matrix converter (IMC under unbalanced grid voltage conditions. If the three-phase grid connected to the voltage source inverter (VSI of the IMC has unbalanced voltage conditions, it affects the currents of the CSR stage and VSI stage, and the currents are distorted. Above all, the distorted currents of the CSR stage cause instability in the overall system, which can affect the life span of the system. Therefore, in this paper, a control strategy for balanced currents in the CSR stage is proposed. To achieve balanced currents in the CSR stage, the VSI stage should receive DC power without ripple components from the CSR stage. This is implemented by controlling the currents in the VSI stage. Therefore, the proposed control strategy decouples the positive and negative phase-sequence components existing in the unbalanced voltages and currents of the VSI stage. Using the proposed control strategy under unbalanced grid voltage conditions, the stability and life span of the overall system can be improved. The effectiveness of the proposed control strategy is verified by simulation and experimental results.

  1. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  2. Reconstruction of Cell Surface Densities of Ion Pumps, Exchangers, and Channels from mRNA Expression, Conductance Kinetics, Whole-Cell Calcium, and Current-Clamp Voltage Recordings, with an Application to Human Uterine Smooth Muscle Cells.

    Directory of Open Access Journals (Sweden)

    Jolene Atia

    2016-04-01

    Full Text Available Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the 'conductance repertoire' being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations.

  3. Current-Voltage Characteristics of Quasi-One-Dimensional Superconductors

    DEFF Research Database (Denmark)

    Vodolazov, D.Y.; Peeters, F.M.; Piraux, L.

    2003-01-01

    The current-voltage (I-V) characteristics of quasi-one-dimensional superconductors were discussed. The I-V characteristics exhibited an unusual S behavior. The dynamics of superconducting condensate and the existence of two different critical currents resulted in such an unusual behavior....

  4. First direct electron microscopic visualization of a tight spatial coupling between GABAA-receptors and voltage-sensitive calcium channels

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Belhage, B; Schousboe, A

    1992-01-01

    Using cerebellar granule neurons in culture it was demonstrated that exposure of the cells to the GABAA receptor agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) leads to an increase in the number of voltage-gated calcium channels as revealed by quantitative preembedding indirect imm...

  5. Observation of dark pulses in 10 nm thick YBCO nanostrips presenting hysteretic current voltage characteristics

    Science.gov (United States)

    Ejrnaes, M.; Parlato, L.; Arpaia, R.; Bauch, T.; Lombardi, F.; Cristiano, R.; Tafuri, F.; Pepe, G. P.

    2017-12-01

    We have fabricated several 10 nm thick and 65 nm wide YBa2Cu3O7-δ (YBCO) nanostrips. The nanostrips with the highest critical current densities are characterized by hysteretic current voltage characteristics (IVCs) with a direct bistable switch from the zero-voltage to the finite voltage state. The presence of hysteretic IVCs allowed the observation of dark pulses due to fluctuations phenomena. The key role of the bistable behavior is its ability to transform a small disturbance (e.g. an intrinsic fluctuation) into a measurable transient signal, i.e. a dark pulse. On the contrary, in devices characterized by lower critical current density values, the IVCs are non-hysteretic and dark pulses have not been observed. To investigate the physical origin of the dark pulses, we have measured the bias current dependence of the dark pulse rate: the observed exponential increase with the bias current is compatible with mechanisms based on thermal activation of magnetic vortices in the nanostrip. We believe that the successful amplification of small fluctuation events into measurable signals in nanostrips of ultrathin YBCO is a milestone for further investigation of YBCO nanostrips for superconducting nanostrip single photon detectors and other quantum detectors for operation at higher temperatures.

  6. Current source converter based D-STATCOM for voltage sag mitigation

    Directory of Open Access Journals (Sweden)

    Singh Moirangthem Deben

    2015-01-01

    Full Text Available This paper presents a novel method of realizing one of the custom power controllers, the distribution static synchronous compensator (D-STATCOM using current source converter (CSC topology. Almost all the custom power controllers such as dynamic voltage restorer (DVR, unified power quality conditioner (UPQC including D-STATCOM are generally designed and implemented by using voltage source converters (VSC and not much research publications with CSC based approach has been reported over the last one decade. Since the D-STATCOM is a current injection device, its performance can be improved when realized by a current-source converter which can generate a controllable current directly at its output terminals and offers many advantageous features. In this paper, an attempt has been made to study the performance of a CSC based D-STATCOM suitable for use in the power distribution system in order to mitigate voltage sag and improve power quality. The proposed model uses a three leg CSC whose switching strategy is based on sinusoidal pulse width modulation (SPWM. The model has been simulated in the Matlab/Simulink environment. The results of the simulation runs under steady state and dynamic load perturbation provide excellent voltage and current waveforms that support the justification of the proposed model.

  7. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  8. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  9. High Voltage Coil Current Sensor for DC-DC Converters Employing DDCC

    Directory of Open Access Journals (Sweden)

    M. Drinovsky

    2015-12-01

    Full Text Available Current sensor is an integral part of every switching converter. It is used for over-current protection, regulation and in case of multiphase converters for balancing. A new high voltage current sensor for coil-based current sensing in DC-DC converters is presented. The sensor employs DDCC with high voltage input stage and gain trimming. The circuit has been simulated and implemented in 0.35 um BCD technology as part of a multiphase DC-DC converter where its function has been verified. The circuit is able to sustain common mode voltage on the input up to 40 V, it occupies 0.387*0.345 mm2 and consumes 3.2 mW typically.

  10. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  11. Exploring dark current voltage characteristics of micromorph silicon tandem cells with computer simulations

    NARCIS (Netherlands)

    Sturiale, A.; Li, H. B. T.; Rath, J.K.; Schropp, R.E.I.; Rubinelli, F.A.

    2009-01-01

    The transport mechanisms controlling the forward dark current-voltage characteristic of the silicon micromorph tandem solar cell were investigated with numerical modeling techniques. The dark current-voltage characteristics of the micromorph tandem structure at forward voltages show three regions:

  12. Influence of surface losses and the self-pumping effect on current-voltage characteristics of a long Josephson junction

    DEFF Research Database (Denmark)

    Pankratov, A.L.; Sobolev, A.S.; Koshelets, V.P.

    2007-01-01

    We have numerically investigated the dynamics of a long linear Josephson tunnel junction with overlap geometry. Biased by a direct current (dc) and an applied dc magnetic field, the junction has important applications as tunable high frequency oscillator [flux-flow oscillator (FFO......) placed at both ends of the FFO. In our model, the damping parameter depends both on the spatial coordinate and on the amplitude of the ac voltage. In order to find the dc current-voltage curves, the damping parameter has to be calculated self-consistently by successive approximations and time integration...

  13. A micro-power LDO with piecewise voltage foldback current limit protection

    International Nuclear Information System (INIS)

    Wei Hailong; Liu Youbao; Guo Zhongjie; Liao Xue

    2012-01-01

    To achieve a constant current limit, low power consumption and high driving capability, a micro-power LDO with a piecewise voltage-foldback current-limit circuit is presented. The current-limit threshold is dynamically adjusted to achieve a maximum driving capability and lower quiescent current of only 300 nA. To increase the loop stability of the proposed LDO, a high impedance transconductance buffer under a micro quiescent current is designed for splitting the pole that exists at the gate of the pass transistor to the dominant pole, and a zero is designed for the purpose of the second pole phase compensation. The proposed LDO is fabricated in a BiCMOS process. The measurement results show that the short-circuit current of the LDO is 190 mA, the constant limit current under a high drop-out voltage is 440 mA, and the maximum load current under a low drop-out voltage is up to 800 mA. In addition, the quiescent current of the LDO is only 7 μA, the load regulation is about 0.56% on full scale, the line regulation is about 0.012%/V, the PSRR at 120 Hz is 58 dB and the drop-out voltage is only 70 mV when the load current is 250 mA. (semiconductor integrated circuits)

  14. Surge currents and voltages at the low voltage power mains during lightning strike to a GSM tower

    Energy Technology Data Exchange (ETDEWEB)

    Markowska, Renata [Bialystok Technical University (Poland)], E-mail: remark@pb.edu.pl

    2007-07-01

    The paper presents the results of numerical calculations of lightning surge currents and voltages in the low voltage power mains system connected to a free standing GSM base station. Direct lightning strike to GSM tower was studied. The analysis concerned the current that flows to the transformer station through AC power mains, the potential difference between the grounding systems of the GSM and the transformer stations and the voltage differences between phase and PE conductors of the power mains underground cable at both the GSM and the transformer sides. The calculations were performed using a numerical program based on the electromagnetic field theory and the method of moments. (author)

  15. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  16. Current regulators for I/SUP 2/L circuits to be operated from low-voltage power supplies

    DEFF Research Database (Denmark)

    Bruun, Erik; Hansen, Ole

    1980-01-01

    A new bandgap current reference is described which can be used to control the injector current of I/SUP 2/L circuits for supply voltages down to about 1 V. For small currents the total injector current is obtained as a mirror of the reference current. For large injector currents the current control......, but well controlled temperature coefficient is desired. It is shown how a temperature stable ring oscillator with I/SUP 2/L gates can be constructed by tailoring the temperature dependence of the supply current appropriately....

  17. Current-voltage curves of gold quantum point contacts revisited

    DEFF Research Database (Denmark)

    Hansen, K.; Nielsen, S K.; Brandbyge, Mads

    2000-01-01

    We present measurements of current-voltage (I-V) curves on gold quantum point contacts (QPCs) with a conductance up to 4 G(0) (G(0) = 2e(2)/h is the conductance quantum) and voltages up to 2 V. The QPCs are formed between the gold tip of a scanning tunneling microscope and a Au(110) surface under...

  18. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  19. L-Type Calcium Channels Modulation by Estradiol.

    Science.gov (United States)

    Vega-Vela, Nelson E; Osorio, Daniel; Avila-Rodriguez, Marco; Gonzalez, Janneth; García-Segura, Luis Miguel; Echeverria, Valentina; Barreto, George E

    2017-09-01

    Voltage-gated calcium channels are key regulators of brain function, and their dysfunction has been associated with multiple conditions and neurodegenerative diseases because they couple membrane depolarization to the influx of calcium-and other processes such as gene expression-in excitable cells. L-type calcium channels, one of the three major classes and probably the best characterized of the voltage-gated calcium channels, act as an essential calcium binding proteins with a significant biological relevance. It is well known that estradiol can activate rapidly brain signaling pathways and modulatory/regulatory proteins through non-genomic (or non-transcriptional) mechanisms, which lead to an increase of intracellular calcium that activate multiple kinases and signaling cascades, in the same way as L-type calcium channels responses. In this context, estrogens-L-type calcium channels signaling raises intracellular calcium levels and activates the same signaling cascades in the brain probably through estrogen receptor-independent modulatory mechanisms. In this review, we discuss the available literature on this area, which seems to suggest that estradiol exerts dual effects/modulation on these channels in a concentration-dependent manner (as a potentiator of these channels in pM concentrations and as an inhibitor in nM concentrations). Indeed, estradiol may orchestrate multiple neurotrophic responses, which open a new avenue for the development of novel estrogen-based therapies to alleviate different neuropathologies. We also highlight that it is essential to determine through computational and/or experimental approaches the interaction between estradiol and L-type calcium channels to assist these developments, which is an interesting area of research that deserves a closer look in future biomedical research.

  20. Nonlinear current-voltage behavior in PZT thin films

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)

    2017-05-15

    In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)

  1. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  2. Current and Voltage Mode Multiphase Sinusoidal Oscillators Using CBTAs

    Directory of Open Access Journals (Sweden)

    M. Sagbas

    2013-04-01

    Full Text Available Current-mode (CM and voltage-mode (VM multiphase sinusoidal oscillator (MSO structures using current backward transconductance amplifier (CBTA are proposed. The proposed oscillators can generate n current or voltage signals (n being even or odd equally spaced in phase. n+1 CBTAs, n grounded capacitors and a grounded resistor are used for nth-state oscillator. The oscillation frequency can be independently controlled through transconductance (gm of the CBTAs which are adjustable via their bias currents. The effects caused by the non-ideality of the CBTA on the oscillation frequency and condition have been analyzed. The performance of the proposed circuits is demonstrated on third-stage and fifth-stage MSOs by using PSPICE simulations based on the 0.25 µm TSMC level-7 CMOS technology parameters.

  3. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  4. Bradykinin induced a positive chronotropic effect via stimulation of T- and L-type calcium currents in heart cells.

    Science.gov (United States)

    El-Bizri, Nesrine; Bkaily, Ghassan; Wang, Shimin; Jacques, Danielle; Regoli, Domenico; D'Orléans-Juste, Pedro; Sukarieh, Rami

    2003-03-01

    Using Fluo-3 calcium dye confocal microscopy and spontaneously contracting embryonic chick heart cells, bradykinin (10(-10) M) was found to induce positive chronotropic effects by increasing the frequency of the transient increase of cytosolic and nuclear free Ca2+. Pretreatment of the cells with either B1 or B2 receptor antagonists (R126 and R817, respectively) completely prevented bradykinin (BK) induced positive chronotropic effects on spontaneously contracting single heart cells. Using the whole-cell voltage clamp technique and ionic substitution to separate the different ionic current species, our results showed that BK (10(-6) M) had no effect on fast Na+ inward current and delayed outward potassium current. However, both L- and T-type Ca2+ currents were found to be increased by BK in a dose-dependent manner (10(-10)-10(-7) M). The effects of BK on T- and L-type Ca2+ currents were partially blocked by the B1 receptor antagonist [Leu8]des-Arg9-BK (R592) (10(-7) M) and completely reversed by the B2 receptor antagonist D-Arg[Hyp3,D-Phe7,Leu8]BK (R-588) (10(-7) M) or pretreatment with pertussis toxin (PTX). These results demonstrate that BK induced a positive chronotropic effect via stimulation of T- and L-type Ca2+ currents in heart cells mainly via stimulation of B2 receptor coupled to PTX-sensitive G-proteins. The increase of both types of Ca2+ current by BK in heart cells may explain the positive inotropic and chronotropic effects of this hormone.

  5. Rapid pH and PO2 changes in the tissue recording chamber during stoppage of a gas-equilibrated perfusate: effects on calcium currents in ventral horn neurons.

    Science.gov (United States)

    Carlin, K P; Brownstone, R M

    2006-09-01

    In vitro studies often use bicarbonate-buffered saline solutions to mimic the normal extracellular environment of tissues. These solutions are typically equilibrated with gaseous O2 and CO2, the latter interacting with bicarbonate ions to maintain a physiological pH. In vitro tissue chambers, like those used for electrophysiology, are usually continually perfused with the gassed buffer, but stopping the perfusion to add expensive chemicals or acquire imaging data is a common practice. The present study demonstrates that this procedure leads to rapid (PO2 of the detained solution in the tissue chamber. During the first 200 s, pH increased by 0.4 units and resulted in a 25% PO2 reduction of the detained solution. The rates of these changes were dependent on the volume of solution in the chamber. In experiments using acute transverse slices from the lumbar spinal cord of neonatal (postnatal day 0-10) mice, perfusion stoppage of the same duration was accompanied by a 34.7% enhancement of the peak voltage-gated calcium current recorded from ventral horn neurons. In these cells both low voltage-activated and high voltage-activated currents were affected. These currents were unaffected by decreasing PO2 when a CO2-independent buffer was used, suggesting that changes in pH were responsible for the observed effects. It is concluded that the procedure of stopping a bicarbonate/CO2-buffered perfusate results in rapid changes in pH and PO2 of the solution detained in the tissue chamber, and that these changes have the potential to covertly influence experimental results.

  6. Development of an intelligent high-voltage direct-current power supply for nuclear detectors

    International Nuclear Information System (INIS)

    Zhao Xiuliang

    1997-01-01

    The operation and performances of a new type direct-current high-voltage power supply are described. The power supply with intelligent feature is controlled by a single-chip microcomputer (8031), and various kinds of output voltage can be preset. The output-voltage is monitored and regulated by the single-chip microcomputer and displayed by LED. The output voltage is stable when the load current is within the allowable limits

  7. Thyristor current-pulse generator for betatron electromagnet with independent low-voltage supply

    International Nuclear Information System (INIS)

    Baginskii, B.A.; Makarevich, V.N.; Shtein, M.M.

    1989-01-01

    A thyristor generator is described that produces unipolar current pulses in the winding of a betatron electromagnet. The voltage on the electro-magnet is increased and the shape of the current pulses is improved by use of an intermediate inductive storage device. The current pulses have a duration of 11 msec, an amplitude of 190 A, and a repetition frequency of 50 Hz. The maximum magnetic-field energy is 450 J, the voltage on the electromagnet winding is 1.5 kV, and the supply voltage is 27 V

  8. A dulal-functional medium voltage level DVR to limit downstream fault currents

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Li, Yun Wei; Vilathgamuwa, D. Mahinda

    2007-01-01

    on the other parallel feeders connected to PCC. Furthermore, if not controlled properly, the DVR might also contribute to this PCC voltage sag in the process of compensating the missing voltage, thus further worsening the fault situation. To limit the flow of large line currents, and therefore restore the PCC...... situations. Controlling the DVR as a virtual inductor would also ensure zero real power absorption during the DVR compensation and thus minimize the stress in the dc link. Finally, the proposed fault current limiting algorithm has been tested in Matlab/Simulink simulation and experimentally on a medium......The dynamic voltage restorer (DVR) is a modern custom power device used in power distribution networks to protect consumers from sudden sags (and swells) in grid voltage. Implemented at medium voltage level, the DVR can be used to protect a group of medium voltage or low voltage consumers. However...

  9. Current integrator using the voltage to frequency converter

    International Nuclear Information System (INIS)

    Ukai, K.; Gomi, K.

    1975-01-01

    A current integrator using the Voltage to Frequency Converter has been constructed to measure the beam intensity of the 1.3 GeV Electron Synchrotron at the INS. This integrator ranges the current 10 -7 to 10 -11 amperes and has been calibrated by the extracted electron beam and constant current sources. The accuracy of this integrator agrees with the previous integrator within 1%. (auth.)

  10. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    Science.gov (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  11. Cathode fall model and current-voltage characteristics of field emission driven direct current microplasmas

    Energy Technology Data Exchange (ETDEWEB)

    Venkattraman, Ayyaswamy [Department of Applied Mechanics, Indian Institute of Technology Madras, Chennai 600036 (India)

    2013-11-15

    The post-breakdown characteristics of field emission driven microplasma are studied theoretically and numerically. A cathode fall model assuming a linearly varying electric field is used to obtain equations governing the operation of steady state field emission driven microplasmas. The results obtained from the model by solving these equations are compared with particle-in-cell with Monte Carlo collisions simulation results for parameters including the plasma potential, cathode fall thickness, ion number density in the cathode fall, and current density vs voltage curves. The model shows good overall agreement with the simulations but results in slightly overpredicted values for the plasma potential and the cathode fall thickness attributed to the assumed electric field profile. The current density vs voltage curves obtained show an arc region characterized by negative slope as well as an abnormal glow discharge characterized by a positive slope in gaps as small as 10 μm operating at atmospheric pressure. The model also retrieves the traditional macroscale current vs voltage theory in the absence of field emission.

  12. Cathode fall model and current-voltage characteristics of field emission driven direct current microplasmas

    International Nuclear Information System (INIS)

    Venkattraman, Ayyaswamy

    2013-01-01

    The post-breakdown characteristics of field emission driven microplasma are studied theoretically and numerically. A cathode fall model assuming a linearly varying electric field is used to obtain equations governing the operation of steady state field emission driven microplasmas. The results obtained from the model by solving these equations are compared with particle-in-cell with Monte Carlo collisions simulation results for parameters including the plasma potential, cathode fall thickness, ion number density in the cathode fall, and current density vs voltage curves. The model shows good overall agreement with the simulations but results in slightly overpredicted values for the plasma potential and the cathode fall thickness attributed to the assumed electric field profile. The current density vs voltage curves obtained show an arc region characterized by negative slope as well as an abnormal glow discharge characterized by a positive slope in gaps as small as 10 μm operating at atmospheric pressure. The model also retrieves the traditional macroscale current vs voltage theory in the absence of field emission

  13. PV source based high voltage gain current fed converter

    Science.gov (United States)

    Saha, Soumya; Poddar, Sahityika; Chimonyo, Kudzai B.; Arunkumar, G.; Elangovan, D.

    2017-11-01

    This work involves designing and simulation of a PV source based high voltage gain, current fed converter. It deals with an isolated DC-DC converter which utilizes boost converter topology. The proposed converter is capable of high voltage gain and above all have very high efficiency levels as proved by the simulation results. The project intends to produce an output of 800 V dc from a 48 V dc input. The simulation results obtained from PSIM application interface were used to analyze the performance of the proposed converter. Transformer used in the circuit steps up the voltage as well as to provide electrical isolation between the low voltage and high voltage side. Since the converter involves high switching frequency of 100 kHz, ultrafast recovery diodes are employed in the circuitry. The major application of the project is for future modeling of solar powered electric hybrid cars.

  14. Monitoring Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes with Genetically Encoded Calcium and Voltage Fluorescent Reporters

    Directory of Open Access Journals (Sweden)

    Rami Shinnawi

    2015-10-01

    Full Text Available The advent of the human-induced pluripotent stem cell (hiPSC technology has transformed biomedical research, providing new tools for human disease modeling, drug development, and regenerative medicine. To fulfill its unique potential in the cardiovascular field, efficient methods should be developed for high-resolution, large-scale, long-term, and serial functional cellular phenotyping of hiPSC-derived cardiomyocytes (hiPSC-CMs. To achieve this goal, we combined the hiPSC technology with genetically encoded voltage (ArcLight and calcium (GCaMP5G fluorescent indicators. Expression of ArcLight and GCaMP5G in hiPSC-CMs permitted to reliably follow changes in transmembrane potential and intracellular calcium levels, respectively. This allowed monitoring short- and long-term changes in action-potential and calcium-handling properties and the development of arrhythmias in response to several pharmaceutical agents and in hiPSC-CMs derived from patients with different inherited arrhythmogenic syndromes. Combining genetically encoded fluorescent reporters with hiPSC-CMs may bring a unique value to the study of inherited disorders, developmental biology, and drug development and testing.

  15. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  16. Calcium-dependent binding of Escherichia coli alpha-hemolysin to erythrocytes

    International Nuclear Information System (INIS)

    Boehm, D.F.

    1989-01-01

    Alpha hemolysin (AH), a protein secreted by certain strains of Escherichia coli, causes lysis of erythrocytes (RBCs) and is cytotoxic for other cells. The primary structure of AH contains an eight amino acid sequence tandemly repeated 13 times near the C-terminus. These repeated sequences are essential for hemolytic activity. AH also requires an unknown modification by an accessory protein, Hly C, for hemolytic activity. The role of calcium in the interaction of Ah with RBCs was investigated using recombinant strains which produced active and inactive forms of the toxin. Hemolytic activity was calcium-dependent. Osmotic protection experiments and immunoblots of SDS-PAGE separated proteins from washed, toxin-treated RBCs showed that the binding of active AH to RBCs was calcium-dependent. Binding of active AH to RBCs increased the calcium permeability of RBC membranes and resulted in changes in membrane protein profiles. The changes in membrane proteins did not cause the lysis of the cells. These results were consistent with a mechanism of lysis involving the formation of cation-selective pores in the membranes of target cells. 45 Ca-autoradiography of the recombinant hemolysins separated by SDS-PAGE and transferred to nitrocellulose showed that active AH bound calcium. The domain involved in binding calcium was identified as the tandemly repeated sequences since a deletion hemolysin missing 11 of the 13 repeated sequences did not bind calcium. This deletion hemolysin was non-hemolytic and did not bind to RBC membranes. Hemolysin lacking the Hly C modification was also non-hemolytic and did not bind to RBC membranes. This unmodified AH contained the repeated sequences and bound calcium as efficiently as active AH

  17. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  18. Functional and pharmacological consequences of the distribution of voltage-gated calcium channels in the renal blood vessels.

    Science.gov (United States)

    Hansen, P B L

    2013-04-01

    Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore, by different mechanisms, T-type channels may contribute to both constriction and dilation of the arterioles. Finally, P-/Q-type channels are involved in the regulation of human intrarenal arterial contractility. The calcium blockers used in the clinic affect not only L-type but also P-/Q- and T-type channels. Therefore, the distinct effect obtained by inhibiting a given subtype or set of channels under experimental settings should be considered when choosing a calcium blocker for treatment. T-type channels seem to be crucial for regulating the GFR and the filtration fraction. Use of blockers is expected to lead to preferential efferent vasodilation, reduction of glomerular pressure and proteinuria. Therefore, renovascular T-type channels might provide novel therapeutic targets, and may have superior renoprotective effects compared to conventional calcium blockers. Acta Physiologica © 2013 Scandinavian Physiological Society.

  19. Features of current-voltage characteristic of nonequilibrium trench MOS barrier Schottky diode

    Science.gov (United States)

    Mamedov, R. K.; Aslanova, A. R.

    2018-06-01

    The trench MOS barrier Schottky diodes (TMBS diode) under the influence of the voltage drop of the additional electric field (AEF) appearing in the near-contact region of the semiconductor are in a nonequilibrium state and their closed external circuit flows currents in the absence of an external voltage. When an external voltage is applied to the TMBS diode, the current transmission is described by the thermionic emission theory with a specific feature. Both forward and reverse I-V characteristics of the TMBS diode consist of two parts. In the initial first part of the forward I-V characteristic there are no forward currents, but reverse saturation currents flow, in its subsequent second part the currents increase exponentially with the voltage. In the initial first part of the reverse I-V characteristic, the currents increase in an abrupt way and in the subsequent second part the saturation currents flow under the action of the image force. The mathematical expressions for forward and reverse I-V characteristic of the TMBS diode and also narrow or nanostructure Schottky diode are proposed, which are in good agreement with the results of experimental and calculated I-V characteristics.

  20. Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons.

    Science.gov (United States)

    Lazcano-Pérez, Fernando; Castro, Héctor; Arenas, Isabel; García, David E; González-Muñoz, Ricardo; Arreguín-Espinosa, Roberto

    2016-05-05

    The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7), voltage-gated calcium channel (CaV2.2), the A-type transient outward (IA) and delayed rectifier (IDR) currents of KV channels of the superior cervical ganglion (SCG) neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

  1. Aqueous leaf extract of Averrhoa carambola L. (Oxalidaceae reduces both the inotropic effect of BAY K 8644 on the guinea pig atrium and the calcium current on GH3cells

    Directory of Open Access Journals (Sweden)

    Carla M. L. Vasconcelos

    Full Text Available It was previously showed that aqueous leaf extract (AqEx of Averrhoa carambola depresses the guinea pig atrial inotropism. Therefore, experiments were carried out on guinea pig left atrium and on pituitary GH3 cells in order to evaluate the effect of AqEx on the cellular calcium influx. The atrium was mounted in an organ chamber (5 mL, Tyrode, 27 ± 0.1 ºC, 95 % O2, 5 % CO2, stretched to 10 mN, and paced at 2 Hz (0.5 ms, 400 V and GH3 cells were submitted to a whole cell voltage clamp configuration. In the atrium, the AqEx (1500 µg/mL shifted to the right the concentration-effect curve of the positive inotropic effect produced by (± BAY K 8644, an L-type calcium channel agonist. The AqEx increased EC50 (concentration required to promote 50% of the maximum effect of the inotropic effect of BAY K 8644 from 7.8 ± 0.38 to 115.1 ± 0.44 nM (N = 3; p < 0.05. In GH3 cells assayed with 500 µg/mL of AqEx, the L-type calcium inward current declined 30 % (from 282 to 190 pA. Nevertheless, the extract did not change the voltage correspondent to the peak current. These data suggest that, at least in part, the negative inotropic effect of AqEx on the guinea pig atrium is due to a reduction of the L-type calcium current.

  2. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  3. Electrophoretic mobility shift in native gels indicates calcium-dependent structural changes of neuronal calcium sensor proteins.

    Science.gov (United States)

    Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat

    2016-02-01

    In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Calcium binding properties of calcium dependent protein kinase 1 (CaCDPK1) from Cicer arietinum.

    Science.gov (United States)

    Dixit, Ajay Kumar; Jayabaskaran, Chelliah

    2015-05-01

    Calcium plays a crucial role as a secondary messenger in all aspects of plant growth, development and survival. Calcium dependent protein kinases (CDPKs) are the major calcium decoders, which couple the changes in calcium level to an appropriate physiological response. The mechanism by which calcium regulates CDPK protein is not well understood. In this study, we investigated the interactions of Ca(2+) ions with the CDPK1 isoform of Cicer arietinum (CaCDPK1) using a combination of biophysical tools. CaCDPK1 has four different EF hands as predicted by protein sequence analysis. The fluorescence emission spectrum of CaCDPK1 showed quenching with a 5 nm red shift upon addition of calcium, indicating conformational changes in the tertiary structure. The plot of changes in intensity against calcium concentrations showed a biphasic curve with binding constants of 1.29 μM and 120 μM indicating two kinds of binding sites. Isothermal calorimetric (ITC) titration with CaCl2 also showed a biphasic curve with two binding constants of 0.027 μM and 1.7 μM. Circular dichroism (CD) spectra showed two prominent peaks at 208 and 222 nm indicating that CaCDPK1 is a α-helical rich protein. Calcium binding further increased the α-helical content of CaCDPK1 from 75 to 81%. Addition of calcium to CaCDPK1 also increased fluorescence of 8-anilinonaphthalene-1-sulfonic acid (ANS) indicating exposure of hydrophobic surfaces. Thus, on the whole this study provides evidence for calcium induced conformational changes, exposure of hydrophobic surfaces and heterogeneity of EF hands in CaCDPK1. Copyright © 2015 Elsevier GmbH. All rights reserved.

  5. Current-Voltage Characteristics of the Metal / Organic Semiconductor / Metal Structures: Top and Bottom Contact Configuration Case

    Directory of Open Access Journals (Sweden)

    Šarūnas MEŠKINIS

    2013-03-01

    Full Text Available In present study five synthesized organic semiconductor compounds have been used for fabrication of the planar metal / organic semiconductor / metal structures. Both top electrode and bottom electrode configurations were used. Current-voltage (I-V characteristics of the samples were investigated. Effect of the hysteresis of the I-V characteristics was observed for all the investigated samples. However, strength of the hysteresis was dependent on the organic semiconductor used. Study of I-V characteristics of the top contact Al/AT-RB-1/Al structures revealed, that in (0 – 500 V voltages range average current of the samples measured in air is only slightly higher than current measured in nitrogen ambient. Deposition of the ultra-thin diamond like carbon interlayer resulted in both decrease of the hysteresis of I-V characteristics of top contact Al/AT-RB-1/Al samples. However, decreased current and decreased slope of the I-V characteristics of the samples with diamond like carbon interlayer was observed as well. I-V characteristic hysteresis effect was less pronounced in the case of the bottom contact metal/organic semiconductor/metal samples. I-V characteristics of the bottom contact samples were dependent on electrode metal used.DOI: http://dx.doi.org/10.5755/j01.ms.19.1.3816

  6. Realization of Nth-Order Voltage Transfer Function using Current Conveyors CCII

    Directory of Open Access Journals (Sweden)

    K. Vrba

    1997-06-01

    Full Text Available A universal method for the realization of arbitrary voltage transfer function in canonic form is presented. A voltage-controlled current-source using a plus-type second-generation current conveyor is here applied as the basic building element. Filters designed according to this method have a high input impedance and low sensitivity to variations of circuit parameters. All passive elements are grounded.

  7. Spine Calcium Transients Induced by Synaptically-Evoked Action Potentials Can Predict Synapse Location and Establish Synaptic Democracy

    Science.gov (United States)

    Meredith, Rhiannon M.; van Ooyen, Arjen

    2012-01-01

    CA1 pyramidal neurons receive hundreds of synaptic inputs at different distances from the soma. Distance-dependent synaptic scaling enables distal and proximal synapses to influence the somatic membrane equally, a phenomenon called “synaptic democracy”. How this is established is unclear. The backpropagating action potential (BAP) is hypothesised to provide distance-dependent information to synapses, allowing synaptic strengths to scale accordingly. Experimental measurements show that a BAP evoked by current injection at the soma causes calcium currents in the apical shaft whose amplitudes decay with distance from the soma. However, in vivo action potentials are not induced by somatic current injection but by synaptic inputs along the dendrites, which creates a different excitable state of the dendrites. Due to technical limitations, it is not possible to study experimentally whether distance information can also be provided by synaptically-evoked BAPs. Therefore we adapted a realistic morphological and electrophysiological model to measure BAP-induced voltage and calcium signals in spines after Schaffer collateral synapse stimulation. We show that peak calcium concentration is highly correlated with soma-synapse distance under a number of physiologically-realistic suprathreshold stimulation regimes and for a range of dendritic morphologies. Peak calcium levels also predicted the attenuation of the EPSP across the dendritic tree. Furthermore, we show that peak calcium can be used to set up a synaptic democracy in a homeostatic manner, whereby synapses regulate their synaptic strength on the basis of the difference between peak calcium and a uniform target value. We conclude that information derived from synaptically-generated BAPs can indicate synapse location and can subsequently be utilised to implement a synaptic democracy. PMID:22719238

  8. Voltage Balancing Method on Expert System for 51-Level MMC in High Voltage Direct Current Transmission

    Directory of Open Access Journals (Sweden)

    Yong Chen

    2016-01-01

    Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.

  9. Dose-dependent ATP depletion and cancer cell death following calcium electroporation, relative effect of calcium concentration and electric field strength

    DEFF Research Database (Denmark)

    Hansen, Emilie Louise; Sozer, Esin Bengisu; Romeo, Stefania

    2015-01-01

    death and could be a novel cancer treatment. This study aims at understanding the relationship between applied electric field, calcium concentration, ATP depletion and efficacy. METHODS: In three human cell lines--H69 (small-cell lung cancer), SW780 (bladder cancer), and U937 (leukaemia), viability...... was observed with fluorescence confocal microscopy of quinacrine-labelled U937 cells. RESULTS: Both H69 and SW780 cells showed dose-dependent (calcium concentration and electric field) decrease in intracellular ATP (p...-dependently reduced cell survival and intracellular ATP. Increasing extracellular calcium allows the use of a lower electric field. GENERAL SIGNIFICANCE: This study supports the use of calcium electroporation for treatment of cancer and possibly lowering the applied electric field in future trials....

  10. High-voltage direct-current circuit breakers

    International Nuclear Information System (INIS)

    Yoshioka, Y.; Hirasawa, K.

    1991-01-01

    This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system

  11. Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell

    Directory of Open Access Journals (Sweden)

    Walker Don

    2017-01-01

    Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.

  12. H∞ Robust Current Control for DFIG Based Wind Turbine subject to Grid Voltage Distortions

    DEFF Research Database (Denmark)

    Wang, Yun; Wu, Qiuwei; Gong, Wenming

    2016-01-01

    This paper proposes an H∞ robust current controller for doubly fed induction generator (DFIG) based wind turbines (WTs) subject to grid voltage distortions. The controller is to mitigate the impact of the grid voltage distortions on rotor currents with DFIG parameter perturbation. The grid voltage...... distortions considered include asymmetric voltage dips and grid background harmonics. An uncertain DFIG model is developed with uncertain factors originating from distorted stator voltage, and changed generator parameters due to the flux saturation effect, the skin effect, etc. Weighting functions...... are designed to efficiently track the unbalanced current components and the 5th and 7th background harmonics. The robust stability (RS) and robust performance (RP) of the proposed controller are verified by the structured singular value µ. The performance of the H∞ robust current controller was demonstrated...

  13. Non-contact current and voltage sensor having detachable housing incorporating multiple ferrite cylinder portions

    Science.gov (United States)

    Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael A.

    2016-04-26

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing formed from two portions that mechanically close around the wire and that contain the current and voltage sensors. The current sensor is a ferrite cylinder formed from at least three portions that form the cylinder when the sensor is closed around the wire with a hall effect sensor disposed in a gap between two of the ferrite portions along the circumference to measure current. A capacitive plate or wire is disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  14. Dependence of critical current on sample length analyzed by the variation of local critical current bent of BSCCO superconducting composite tape

    International Nuclear Information System (INIS)

    Matsubayashi, H.; Mukai, Y.; Shin, J.K.; Ochiai, S.; Okuda, H.; Osamura, K.; Otto, A.; Malozemoff, A.

    2008-01-01

    Using the high critical current type BSCCO composite tape fabricated at American Superconductor Corporation, the relation of overall critical current to the distribution of local critical current and the dependence of overall critical current on sample length of the bent samples were studied experimentally and analytically. The measured overall critical current was described well from the distribution of local critical current and n-value of the constituting short elements, by regarding the overall sample to be composed of local series circuits and applying the voltage summation model. Also the dependence of overall critical current on sample length could be reproduced in computer satisfactorily by the proposed simulation method

  15. Purification and reconstitution of the calcium antagonist receptor of the voltage-sensitive calcium channel

    International Nuclear Information System (INIS)

    Curtis, B.M.

    1986-01-01

    Treatment with digitonin solubilized the calcium antagonist receptor as a stable complex with [ 3 H]nitrendipine from rat brain membranes. The solubilized complex retains allosteric coupling to binding sites for diltiazem, verapamil, and inorganic calcium antagonist sites. The calcium antagonist receptor from cardiac sarcolemma and the transverse-tubule membrane of skeletal muscle is also efficiently solubilized with digitonin and the receptor in all three tissues is a large glycoprotein with a sedimentation coefficient of 20 S. The T-tubule calcium antagonist receptor complex was extensively purified by a combination of chromatography on WGA-Sepharose, ion exchange chromatography, and sedimentation on sucrose gradients to yield preparations estimated to be 41% homogeneous by specific activity and 63% homogeneous by SDS gel electrophoresis. Analysis of SDS gels detect three polypeptides termed α(Mr 135,000), β(Mr 50,000), and γ(Mr 32,000) as noncovalently associated subunits of the calcium antagonist receptor. The α and γ subunits are glycosylated polypeptides, and the molecular weight of the core polypeptides are 108,000 and 24,000 respectively. The calcium antagonist receptor was reconstituted into a phospholipid bilayer by adding CHAPS and exogeneous lipid to the purified receptor followed by rapid detergent removal. This procedure resulted in the incorporation of 45% of the calcium antagonist receptor into closed phospholipid vesicles. Data suggests that the α, β, and γ subunits of the T-tubule calcium antagonist receptor are sufficient to form a functional calcium channel

  16. Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons

    Directory of Open Access Journals (Sweden)

    Fernando Lazcano-Pérez

    2016-05-01

    Full Text Available The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7, voltage-gated calcium channel (CaV2.2, the A-type transient outward (IA and delayed rectifier (IDR currents of KV channels of the superior cervical ganglion (SCG neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

  17. Current-voltage characteristics of individual conducting polymer nanotubes and nanowires

    Institute of Scientific and Technical Information of China (English)

    Long Yun-ze; Yin Zhi-Hua; Li Meng-Meng; Gu Chang-Zhi; Duvail Jean-Luc; Jin Ai-zi; Wan Mei-xiang

    2009-01-01

    We report the current-voltage (Ⅰ-Ⅴ) characteristics of individual polypyrrole nanotubes and poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires in a temperature range from 300 K to 2 K. Considering the complex structures of such quasi-one-dimensional systems with an array of ordered conductive regions separated by disordered barriers, we use the extended fluctuation-induced tunneling (FIT) and thermal excitation model (Kaiser expression) to fit the temperature and electric-field dependent Ⅰ-Ⅴ curves. It is found that the Ⅰ-Ⅴ data measured at higher temperatures or higher voltages can be well fitted by the Kaiser expression. However, the low-temperature data around the zero bias clearly deviate from those obtained from this model. The deviation (or zero-bias conductance suppression)could be possibly ascribed to the occurrence of the Coulomb-gap in the density of states near the Femi level and/or the enhancement of electron-electron interaction resulting from nanosize effects, which have been revealed in the previous studies on low-temperature electronic transport in conducting polymer films, pellets and nanostructures. In addition,similar Ⅰ-Ⅴ characteristics and deviation are also observed in an isolated K0.27MnO2 nanowire.

  18. On-line monitoring of base current and forward emitter current gain of the voltage regulator's serial pnp transistor in a radiation environment

    Directory of Open Access Journals (Sweden)

    Vukić Vladimir Đ.

    2012-01-01

    Full Text Available A method of on-line monitoring of the low-dropout voltage regulator's operation in a radiation environment is developed in this paper. The method had to enable detection of the circuit's degradation during exploitation, without terminating its operation in an ionizing radiation field. Moreover, it had to enable automatic measurement and data collection, as well as the detection of any considerable degradation, well before the monitored voltage regulator's malfunction. The principal parameters of the voltage regulator's operation that were monitored were the serial pnp transistor's base current and the forward emitter current gain. These parameters were procured indirectly, from the data on the voltage regulator's load and quiescent currents. Since the internal consumption current in moderately and heavily loaded devices was used, the quiescent current of a negligibly loaded voltage regulator of the same type served as a reference. Results acquired by on-line monitoring demonstrated marked agreement with the results acquired from examinations of the voltage regulator's maximum output current and minimum dropout voltage in a radiation environment. The results were particularly consistent in tests with heavily loaded devices. Results obtained for moderately loaded voltage regulators and the risks accompanying the application of the presented method, were also analyzed.

  19. The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

    2016-07-11

    Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

  20. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  1. Differential calcium sensitivity in NaV 1.5 mixed syndrome mutants.

    Science.gov (United States)

    Abdelsayed, Mena; Baruteau, Alban-Elouen; Gibbs, Karen; Sanatani, Shubhayan; Krahn, Andrew D; Probst, Vincent; Ruben, Peter C

    2017-09-15

    SCN5a mutations may express gain-of-function (Long QT Syndrome-3), loss-of-function (Brugada Syndrome 1) or both (mixed syndromes), depending on the mutation and environmental triggers. One such trigger may be an increase in cytosolic calcium, accompanying exercise. Many mixed syndromes mutants, including ∆KPQ, E1784K, 1795insD and Q1909R, are found in calcium-sensitive regions. Elevated cytosolic calcium attenuates gain-of-function properties in ∆KPQ, 1795insD and Q1909R, but not in E1784K. By contrast, elevated cytosolic calcium further exacerbates gain-of-function in E1784K by destabilizing slow inactivation. Action potential modelling, using a modified O'Hara Rudy model, suggests that elevated heart rate rescues action potential duration in ∆KPQ, 1795insD and Q1909R, but not in E1784K. Action potential simulations suggest that E1784K carriers have an increased intracellular sodium-to-calcium ratio under bradycardia and tachycardia conditions. Elevated cytosolic calcium, which is common during high heart rates, ameliorates or exacerbates the mixed syndrome phenotype depending on the genetic signature. Inherited arrhythmias may arise from mutations in the gene for SCN5a, which encodes the cardiac voltage-gated sodium channel, Na V 1.5. Mutants in Na V 1.5 result in Brugada Syndrome (BrS1), Long-QT Syndrome (LQT3) or mixed syndromes (an overlap of BrS1/LQT3). Exercise is a potential arrhythmogenic trigger in mixed syndromes. We aimed to determine the effects of elevated cytosolic calcium, which is common during exercise, in mixed syndrome Na V 1.5 mutants. We used whole-cell patch clamp to assess the biophysical properties of Na V 1.5 wild-type (WT), ∆KPQ, E1784K, 1795insD and Q1909R mutants in human embryonic kidney 293 cells transiently transfected with the Na V 1.5 α subunit (WT or mutants), β1 subunit and enhanced green fluorescent protein. Voltage-dependence and kinetics were measured at cytosolic calcium levels of approximately 0, 500 and 2500

  2. Rotor current transient analysis of DFIG-based wind turbines during symmetrical voltage faults

    International Nuclear Information System (INIS)

    Ling, Yu; Cai, Xu; Wang, Ningbo

    2013-01-01

    Highlights: • We theoretically analyze the rotor fault current of DFIG based on space vector. • The presented analysis is simple, easy to understand. • The analysis highlights the accuracy of the expression of the rotor fault currents. • The expression can be widely used to analyze the different levels of voltage symmetrical fault. • Simulation results show the accuracy of the expression of the rotor currents. - Abstract: The impact of grid voltage fault on doubly fed induction generators (DFIGs), especially rotor currents, has received much attention. So, in this paper, the rotor currents of based-DFIG wind turbines are considered in a generalized way, which can be widely used to analyze the cases under different levels of voltage symmetrical faults. A direct method based on space vector is proposed to obtain an accurate expression of rotor currents as a function of time for symmetrical voltage faults in the power system. The presented theoretical analysis is simple and easy to understand and especially highlights the accuracy of the expression. Finally, the comparable simulations evaluate this analysis and show that the expression of the rotor currents is sufficient to calculate the maximum fault current, DC and AC components, and especially helps to understand the causes of the problem and as a result, contributes to adapt reasonable approaches to enhance the fault ride through (FRT) capability of DFIG wind turbines during a voltage fault

  3. Current and voltage distribution in the diffuse vacuum arc

    NARCIS (Netherlands)

    Schellekens, H.; Schram, D.C.

    1985-01-01

    On the basis of extensive measurements, a model is developed for the diffuse plasma of the high-current vacuum arc. The model shows that the current constriction and the voltage distribution in the diffuse vacuum arc prior to anode-spot formation are caused by the pressure source to which the

  4. [Mg2+, ATP-dependent plasma membrane calcium pump of smooth muscle cells. I. Structural organization and properties].

    Science.gov (United States)

    Veklich, T O; Mazur, Iu Iu; Kosterin, S O

    2015-01-01

    Tight control of cytoplasm Ca2+ concentration is essential in cell functioning. Changing of Ca2+ concentration is thorough in smooth muscle cells, because it determines relaxation/constraint process. One of key proteins which control Ca2+ concentration in cytoplasm is Mg2+, ATP-dependent plasma membrane calcium pump. Thus, it is important to find compoumds which allowed one to change Mg2+, ATP-dependent plasma membrane calcium pump activity, as long as this topic is of current interest in biochemical research which regards energy and pharmacomechanical coupling mechanism of muscle excitation and contraction. In this article we generalized literatute and own data about properties of smooth muscle cell plasma membrane Ca(2+)-pump. Stuctural oganization, kinetical properties and molecular biology are considered.

  5. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.

    2013-01-01

    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  6. Calcium Homeostasis Modulator 1-Like Currents in Rat Fungiform Taste Cells Expressing Amiloride-Sensitive Sodium Currents.

    Science.gov (United States)

    Bigiani, Albertino

    2017-05-01

    Salt reception by taste cells is still the less understood transduction process occurring in taste buds, the peripheral sensory organs for the detection of food chemicals. Although there is evidence suggesting that the epithelial sodium channel (ENaC) works as sodium receptor, yet it is not clear how salt-detecting cells signal the relevant information to nerve endings. Taste cells responding to sweet, bitter, and umami substances release ATP as neurotransmitter through a nonvesicular mechanism. Three different channel proteins have been proposed as conduit for ATP secretion: pannexin channels, connexin hemichannels, and calcium homeostasis modulator 1 (CALHM1) channels. In heterologous expression systems, these channels mediate outwardly rectifying membrane currents with distinct biophysical and pharmacological properties. I therefore tested whether also salt-detecting taste cells were endowed with these currents. To this aim, I applied the patch-clamp techniques to single cells in isolated taste buds from rat fungiform papillae. Salt-detecting cells were functionally identified by exploiting the effect of amiloride, which induces a current response by shutting down ENaCs. I looked for the presence of outwardly rectifying currents by using appropriate voltage-clamp protocols and specific pharmacological tools. I found that indeed salt-detecting cells possessed these currents with properties consistent with the presence, at least in part, of CALHM1 channels. Unexpectedly, CALHM1-like currents in taste cells were potentiated by known blockers of pannexin, suggesting a possible inhibitory action of this protein on CALMH1. These findings indicate that communication between salt-detecting cells and nerve endings might involve ATP release by CALMH1 channels. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Current-voltage characterization of individual as-grown nanowires using a scanning tunneling microscope.

    Science.gov (United States)

    Timm, Rainer; Persson, Olof; Engberg, David L J; Fian, Alexander; Webb, James L; Wallentin, Jesper; Jönsson, Andreas; Borgström, Magnus T; Samuelson, Lars; Mikkelsen, Anders

    2013-11-13

    Utilizing semiconductor nanowires for (opto)electronics requires exact knowledge of their current-voltage properties. We report accurate on-top imaging and I-V characterization of individual as-grown nanowires, using a subnanometer resolution scanning tunneling microscope with no need for additional microscopy tools, thus allowing versatile application. We form Ohmic contacts to InP and InAs nanowires without any sample processing, followed by quantitative measurements of diameter dependent I-V properties with a very small spread in measured values compared to standard techniques.

  8. Electronic voltage and current transformers testing device.

    Science.gov (United States)

    Pan, Feng; Chen, Ruimin; Xiao, Yong; Sun, Weiming

    2012-01-01

    A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs) with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz). The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.

  9. Three-phase current transformer rectifier sets. High-voltage power supplies for difficult conditions in electrostatic precipitators

    Energy Technology Data Exchange (ETDEWEB)

    Stackelberg, Josef von [Rico-Werk Eiserlo und Emmrich GmbH, Toenisvorst (Germany)

    2013-04-01

    The precipitation rate of electrostatic precipitators (ESP) highly depends on the consistency of waste gas. Among other things, electrical conductivity plays an important role as well as the ability of particles to be electrically charged or ionised. Within certain limits, common ESPs are able to clean waste gas satisfactorily. If the dust attributes exceed these limits, more sophisticated technical solutions are required in the ESP to meet the demands for the gas cleaning equipment. In these cases, a three phase transformer rectifier system offers an alternative to the conventional single phase system, as it delivers a smooth direct current voltage over a wide voltage range. (orig.)

  10. Activation of TRPV1-dependent calcium oscillation exacerbates seawater inhalation-induced acute lung injury.

    Science.gov (United States)

    Li, Congcong; Bo, Liyan; Liu, Qingqing; Liu, Wei; Chen, Xiangjun; Xu, Dunquan; Jin, Faguang

    2016-03-01

    Calcium is an important second messenger and it is widely recognized that acute lung injury (ALI) is often caused by oscillations of cytosolic free Ca2+. Previous studies have indicated that the activation of transient receptor potential‑vanilloid (TRPV) channels and subsequent Ca2+ entry initiates an acute calcium‑dependent permeability increase during ALI. However, whether seawater exposure induces such an effect through the activation of TRPV channels remains unknown. In the current study, the effect of calcium, a component of seawater, on the inflammatory reactions that occur during seawater drowning‑induced ALI, was examined. The results demonstrated that a high concentration of calcium ions in seawater increased lung tissue myeloperoxidase activity and the secretion of inflammatory mediators, such as tumor necrosis factor‑α (TNF‑α) and interleukin (IL)‑1β and IL‑6. Further study demonstrated that the seawater challenge elevated cytosolic Ca2+ concentration, indicated by [Ca2+]c, by inducing calcium influx from the extracellular medium via TRPV1 channels. The elevated [Ca2+c] may have resulted in the increased release of TNF‑α and IL‑1β via increased phosphorylation of nuclear factor‑κB (NF‑κB). It was concluded that a high concentration of calcium in seawater exacerbated lung injury, and TRPV1 channels were notable mediators of the calcium increase initiated by the seawater challenge. Calcium influx through TRPV1 may have led to greater phosphorylation of NF‑κB and increased release of TNF‑α and IL‑1β.

  11. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Mitigation of grid-current distortion for LCL-filtered grid-connected voltage-source inverter with inverter-side current control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2017-01-01

    Due to the low inductance of an LCL-filter, the grid current generated by an LCL-filtered Voltage Source Inverter (VSI) is sensitive to low-order grid-voltage harmonics. This issue is especially tough for the control system with Inverter Current Feedback (ICF), because the grid-current harmonics...... can freely flow into the filter capacitor without control. To cope with this issue, this paper develops an approach for the ICF control system to suppress the grid-current harmonics without adding extra sensors. The proposed method applies harmonic controllers and feedforward scheme simultaneously...

  13. Calcium pathways such as cAMP modulate clothianidin action through activation of α-bungarotoxin-sensitive and -insensitive nicotinic acetylcholine receptors.

    Science.gov (United States)

    Calas-List, Delphine; List, Olivier; Quinchard, Sophie; Thany, Steeve H

    2013-07-01

    Clothianidin is a neonicotinoid insecticide developed in the early 2000s. We have recently demonstrated that it was a full agonist of α-bungarotoxin-sensitive and -insensitive nicotinic acetylcholine receptors expressed in the cockroach dorsal unpaired median neurons. Clothianidin was able to act as an agonist of imidacloprid-insensitive nAChR2 receptor and internal regulation of cAMP concentration modulated nAChR2 sensitivity to clothianidin. In the present study, we demonstrated that cAMP modulated the agonist action of clothianidin via α-bungarotoxin-sensitive and insensitive receptors. Clothianidin-induced current-voltage curves were dependent to clothianidin concentrations. At 10 μM clothianidin, increasing cAMP concentration induced a linear current-voltage curve. Clothianidin effects were blocked by 0.5 μM α-bungarotoxin suggesting that cAMP modulation occurred through α-bungarotoxin-sensitive receptors. At 1 mM clothianidin, cAMP effects were associated to α-bungarotoxin-insensitive receptors because clothianidin-induced currents were blocked by 5 μM mecamylamine and 20 μM d-tubocurarine. In addition, we found that application of 1mM clothianidin induced a strong increase of intracellular calcium concentration. These data reinforced the finding that calcium pathways including cAMP modulated clothianidin action on insect nicotinic acetylcholine receptors. We proposed that intracellular calcium pathways such as cAMP could be a target to modulate the mode of action of neonicotinoid insecticides. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-12-01

    Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

  15. Accelerated inactivation of the L-type calcium current due to a mutation in CACNB2b underlies Brugada syndrome

    DEFF Research Database (Denmark)

    Cordeiro, Jonathan M; Marieb, Mark; Pfeiffer, Ryan

    2009-01-01

    S in which loss of function is caused by accelerated inactivation of I(Ca). The proband, a 32 year old male, displayed a Type I ST segment elevation in two right precordial ECG leads following a procainamide challenge. EP study was positive with induction of polymorphic VT/VF. Interrogation of implanted ICD...... significantly faster in mutant channels between 0 and + 20 mV. Action potential voltage clamp experiments showed that total charge was reduced by almost half compared to WT. We report the first BrS mutation in CaCNB2b resulting in accelerated inactivation of L-type calcium channel current. Our results suggest...

  16. Sigma-1 receptor agonist increases axon outgrowth of hippocampal neurons via voltage-gated calcium ions channels.

    Science.gov (United States)

    Li, Dong; Zhang, Shu-Zhuo; Yao, Yu-Hong; Xiang, Yun; Ma, Xiao-Yun; Wei, Xiao-Li; Yan, Hai-Tao; Liu, Xiao-Yan

    2017-12-01

    Sigma-1 receptors (Sig-1Rs) are unique endoplasmic reticulum proteins that have been implicated in both neurodegenerative and ischemic diseases, such as Alzheimer's disease and stroke. Accumulating evidence has suggested that Sig-1R plays a role in neuroprotection and axon outgrowth. The underlying mechanisms of Sig-1R-mediated neuroprotection have been well elucidated. However, the mechanisms underlying the effects of Sig-1R on axon outgrowth are not fully understood. To clarify this issue, we utilized immunofluorescence to compare the axon lengths of cultured naïve hippocampal neurons before and after the application of the Sig-1R agonist, SA4503. Then, electrophysiology and immunofluorescence were used to examine voltage-gated calcium ion channel (VGCCs) currents in the cell membranes and growth cones. We found that Sig-1R activation dramatically enhanced the axonal length of the naïve hippocampal neurons. Application of the Sig-1R antagonist NE100 and gene knockdown techniques both demonstrated the effects of Sig-1R. The growth-promoting effect of SA4503 was accompanied by the inhibition of voltage-gated Ca 2+ influx and was recapitulated by incubating the neurons with the L-type, N-type, and P/Q-type VGCC blockers, nimodipine, MVIIA and ω-agatoxin IVA, respectively. This effect was unrelated to glial cells. The application of SA4503 transformed the growth cone morphologies from complicated to simple, which favored axon outgrowth. Sig-1R activation can enhance axon outgrowth and may have a substantial influence on neurogenesis and neurodegenerative diseases. © 2017 John Wiley & Sons Ltd.

  17. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  18. Maximum time-dependent space-charge limited diode currents

    Energy Technology Data Exchange (ETDEWEB)

    Griswold, M. E. [Tri Alpha Energy, Inc., Rancho Santa Margarita, California 92688 (United States); Fisch, N. J. [Princeton Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08543 (United States)

    2016-01-15

    Recent papers claim that a one dimensional (1D) diode with a time-varying voltage drop can transmit current densities that exceed the Child-Langmuir (CL) limit on average, apparently contradicting a previous conjecture that there is a hard limit on the average current density across any 1D diode, as t → ∞, that is equal to the CL limit. However, these claims rest on a different definition of the CL limit, namely, a comparison between the time-averaged diode current and the adiabatic average of the expression for the stationary CL limit. If the current were considered as a function of the maximum applied voltage, rather than the average applied voltage, then the original conjecture would not have been refuted.

  19. Non-contact current and voltage sensing method using a clamshell housing and a ferrite cylinder

    Science.gov (United States)

    Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael

    2016-04-26

    A method of measurement using a detachable current and voltage sensor provides an isolated and convenient technique for to measuring current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  20. Investigation of disorder and its effect on electrical transport in electrochemically doped polymer devices by current-voltage and impedance spectroscopy

    Science.gov (United States)

    Rahman Khan, Motiur; Anjaneyulu, P.; Koteswara Rao, K. S. R.; Menon, R.

    2017-03-01

    We report on the analysis of temperature-dependent current-voltage characteristics and impedance measurements of electrochemically doped poly(3-methylthiophene) devices at different doping levels. The extent of doping is carefully tailored such that only the bulk-limited transport mechanism prevails. A transition from exponentially distributed trap-limited transport to trap-free space-charge-limited current is observed in current-voltage conduction upon increasing the doping. The obtained trap densities (3.2  ×  1016 cm-3 and 8.6  ×  1015 cm-3) and trap energies (31.7 meV and 16.6 meV) for different devices signify the variation in disorder with doping, which is later supported by impedance measurements. Impedance-frequency data for various devices can not be explained using the parallel resistance-capacitance (RC) model in the equivalent circuit. However, this was established by incorporating a constant phase element Q (CPE) instead of the capacitance parameter. It should be emphasized that low doping devices in particular are best simulated with two CPE elements, while the data related to other devices are fitted well with a single CPE element. It is also observed from evaluated circuit parameters that the spatial inhomogeneity and disorder are the cause of variability in different samples, which has an excellent correlation with the temperature-dependent current-voltage characteristics.

  1. Neurotensin effects on N-type calcium currents among rat pallidal neurons: an electrophysiological and immunohistochemical study.

    Science.gov (United States)

    Martorana, Alessandro; Martella, Giuseppina; D'Angelo, Vincenza; Fusco, Francesca Romana; Spadoni, Francesca; Bernardi, Giorgio; Stefani, Alessandro

    2006-10-01

    The tridecapeptide neurotensin (NT) is involved in the modulation of dopamine (DA)-mediated functions in the nigrostriatal and mesocorticolimbic pathways. Its relevance in mammalian globus pallidus (GP) is questioned. A recent electrophysiological study on GP slices described NT-mediated robust membrane depolarization, depending upon the suppression of potassium conductance and/or the activation of cation current. Here, we have studied whether NT also affected high-voltage-activated calcium (Ca(2+)) currents, by means of whole-cell recordings on isolated GP neurons. In our hands, the full peptide and the segment NT8-13 reversibly inhibited N-like Ca(2+) current in about 60% of the recorded dissociated neurons, irrespective of their capacitance. The NT-mediated modulation showed no desensitization and was antagonized by the NT1 antagonists SR48692 and SR142948. These results imply an abundant expression of NTS(1) on GP cell somata. Then, we performed a light and immunofluorescence-confocal microscopy study of NTS(1) localization among GP neurons. We found that NTS(1) is localized in about 56% of GP neurons in both subpopulations of neurons, namely parvalbumin positive and negative. We conclude that NT, likely released from the striatal terminals in GP, acts through the postsynaptic NTS(1) preferentially localized in the lateral aspects of the GP. These data suggest a new implication (neither merely presynaptic nor simply "excitatory") for NT in the modulation of GP firing pattern. In addition, NT might have a role in affecting the interplay among the endogenous release of GABA/glutamate and DA. This hypothesis might have implications on both sensori-motor and associative functions of the GP and should be tested in DA-denervated disease models.

  2. Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

    Science.gov (United States)

    Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

    2014-11-01

    The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

  3. Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

    International Nuclear Information System (INIS)

    Pe, T.; McDonald, J.; Clem, J.R.

    1995-01-01

    The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

  4. EFFECTS OF PYRETHROIDS ON VOLTAGE-SENSITIVE CALCIUM CHANNELS: A CRITICAL EVALUATION OF STRENGTHS, WEAKNESSES, DATA NEEDS, AND RELATIONSHIP TO ASSESSMENT OF CUMULATIVE NEUROTOXICITY.

    Science.gov (United States)

    A recently published review (Soderlund et al., 2002, Toxicology 171, 3-59.) of the mechanisms of acute neurotoxicity of pyrethroid compounds postulated that voltage-sensitive calcium channels (VSCC) may be a target of some pyrethroid compounds and that effects on VSCC may contrib...

  5. ATP- and gap junction-dependent intercellular calcium signaling in osteoblastic cells

    DEFF Research Database (Denmark)

    Jorgensen, N R; Geist, S T; Civitelli, R

    1997-01-01

    mechanically induced calcium waves in two rat osteosarcoma cell lines that differ in the gap junction proteins they express, in their ability to pass microinjected dye from cell to cell, and in their expression of P2Y2 (P2U) purinergic receptors. ROS 17/2.8 cells, which express the gap junction protein......Many cells coordinate their activities by transmitting rises in intracellular calcium from cell to cell. In nonexcitable cells, there are currently two models for intercellular calcium wave propagation, both of which involve release of inositol trisphosphate (IP3)- sensitive intracellular calcium...... stores. In one model, IP3 traverses gap junctions and initiates the release of intracellular calcium stores in neighboring cells. Alternatively, calcium waves may be mediated not by gap junctional communication, but rather by autocrine activity of secreted ATP on P2 purinergic receptors. We studied...

  6. Characteristics of output voltage and current of integrated nanogenerators

    KAUST Repository

    Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin

    2009-01-01

    three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity

  7. Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors

    DEFF Research Database (Denmark)

    Mucha, Igor

    1999-01-01

    current memory cells were designed using a CMOS process with threshold voltages V-T0n = \\V-T0p\\ = 0.9 V for the n- and p-channel devices. Both hand calculations and PSPICE simulations showed that the designed example switched current memory cell allowed a maximum signal range better than +/-18 mu......A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages....... This paper presents the theoretical basis for the design of "floating-gate'' switched current memory cells by giving a detailed description and analysis of the most important impacts degrading the performance of the cells. To support the theoretical assumptions circuits based on "floating-gate'' switched...

  8. Comment on 'Temperature dependence of the current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions'

    Energy Technology Data Exchange (ETDEWEB)

    Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt

    2008-02-27

    Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)

  9. Antibodies to voltage-gated potassium and calcium channels in epilepsy.

    Science.gov (United States)

    Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela

    2006-10-01

    To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.

  10. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  11. Transient voltage response of a superconducting strip to a supercritical current pulse

    International Nuclear Information System (INIS)

    Attekum, P.M.Th.M. van; Wouters, M.C.H.M.; Wolter, J.; Horstman, R.E.

    1981-01-01

    A superconductor subject to a supercritical current pulse displays a delay time between the onset of the current pulse and the onset of the corresponding voltage response. From the onset of the voltage response it takes a second (transient) time to reach the stationary state. It is shown that the transient time can be explained with inhomogeneities in the strip which give rise to a distribution of delay times. The transient time is thus not related to a characteristic time in the superconductor. For small supercritical currents also heating effects show up. (author)

  12. Performance evaluation of wideband bio-impedance spectroscopy using constant voltage source and constant current source

    International Nuclear Information System (INIS)

    Mohamadou, Youssoufa; Oh, Tong In; Wi, Hun; Sohal, Harsh; Farooq, Adnan; Woo, Eung Je; McEwan, Alistair Lee

    2012-01-01

    Current sources are widely used in bio-impedance spectroscopy (BIS) measurement systems to maximize current injection for increased signal to noise while keeping within medical safety specifications. High-performance current sources based on the Howland current pump with optimized impedance converters are able to minimize stray capacitance of the cables and setup. This approach is limited at high frequencies primarily due to the deteriorated output impedance of the constant current source when situated in a real measurement system. For this reason, voltage sources have been suggested, but they require a current sensing resistor, and the SNR reduces at low impedance loads due to the lower current required to maintain constant voltage. In this paper, we compare the performance of a current source-based BIS and a voltage source-based BIS, which use common components. The current source BIS is based on a Howland current pump and generalized impedance converters to maintain a high output impedance of more than 1 MΩ at 2 MHz. The voltage source BIS is based on voltage division between an internal current sensing resistor (R s ) and an external sample. To maintain high SNR, R s is varied so that the source voltage is divided more or less equally. In order to calibrate the systems, we measured the transfer function of the BIS systems with several known resistor and capacitor loads. From this we may estimate the resistance and capacitance of biological tissues using the least-squares method to minimize error between the measured transimpedance excluding the system transfer function and that from an impedance model. When tested on realistic loads including discrete resistors and capacitors, and saline and agar phantoms, the voltage source-based BIS system had a wider bandwidth of 10 Hz to 2.2 MHz with less than 1% deviation from the expected spectra compared to more than 10% with the current source. The voltage source also showed an SNR of at least 60 dB up to 2.2 MHz

  13. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  14. Voltage sensitivity of M2 muscarinic receptors underlies the delayed rectifier-like activation of ACh-gated K(+) current by choline in feline atrial myocytes.

    Science.gov (United States)

    Navarro-Polanco, Ricardo A; Aréchiga-Figueroa, Iván A; Salazar-Fajardo, Pedro D; Benavides-Haro, Dora E; Rodríguez-Elías, Julio C; Sachse, Frank B; Tristani-Firouzi, Martin; Sánchez-Chapula, José A; Moreno-Galindo, Eloy G

    2013-09-01

    Choline (Ch) is a precursor and metabolite of the neurotransmitter acetylcholine (ACh). In canine and guinea pig atrial myocytes, Ch was shown to activate an outward K(+) current in a delayed rectifier fashion. This current has been suggested to modulate cardiac electrical activity and to play a role in atrial fibrillation pathophysiology. However, the exact nature and identity of this current has not been convincingly established. We recently described the unique ligand- and voltage-dependent properties of muscarinic activation of ACh-activated K(+) current (IKACh) and showed that, in contrast to ACh, pilocarpine induces a current with delayed rectifier-like properties with membrane depolarization. Here, we tested the hypothesis that Ch activates IKACh in feline atrial myocytes in a voltage-dependent manner similar to pilocarpine. Single-channel recordings, biophysical profiles, specific pharmacological inhibition and computational data indicate that the current activated by Ch is IKACh. Moreover, we show that membrane depolarization increases the potency and efficacy of IKACh activation by Ch and thus gives the appearance of a delayed rectifier activating K(+) current at depolarized potentials. Our findings support the emerging concept that IKACh modulation is both voltage- and ligand-specific and reinforce the importance of these properties in understanding cardiac physiology.

  15. Alcohol and the calcium-dependent potassium transport of human erythrocytes

    International Nuclear Information System (INIS)

    Harris, R.A.; Caldwell, K.K.

    1985-01-01

    In vitro exposure of human red blood cells to ethanol (100 and 400 mM) was found to increase the initial rate of calcium-dependent potassium efflux through the red cell membrane. This effect of ethanol was apparently not due to an elevation of the intracellular free calcium but rather to a direct action of the drug on the transport process as, (1) intracellular calcium concentrations were tightly buffered with EGTA, (2) ethanol did not alter the efflux of 45 Ca from the cells, and (3) dantrolene, which has been proposed to counteract the effect of ethanol on intracellular calcium levels in the erythrocyte, did not inhibit the stimulatory action of ethanol. The efflux of potassium from erythrocytes obtained from chronic alcoholics was not different from that of erythrocytes from non-alcoholic individuals. The relationship of these findings to neuronal potassium transport is discussed

  16. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  17. A Novel Programmable CMOS Fuzzifiers Using Voltage-to-Current Converter Circuit

    Directory of Open Access Journals (Sweden)

    K. P. Abdulla

    2012-01-01

    Full Text Available This paper presents a new voltage-input, current-output programmable membership function generator circuit (MFC using CMOS technology. It employs a voltage-to-current converter to provide the required current bias for the membership function circuit. The proposed MFC has several advantageous features. This MFC can be reconfigured to perform triangular, trapezoidal, S-shape, Z-Shape, and Gaussian membership forms. This membership function can be programmed in terms of its width, slope, and its center locations in its universe of discourses. The easily adjustable characteristics of the proposed circuit and its accuracy make it suitable for embedded system and industrial control applications. The proposed MFC is designed using the spice software, and simulation results are obtained.

  18. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  19. Voltage and Current Regulators Design of Power Converters in Islanded Microgrids based on State Feedback Decoupling

    DEFF Research Database (Denmark)

    Federico, de Bosio; de Sousa Ribeiro, Luiz Antonio; Freijedo Fernandez, Francisco Daniel

    2016-01-01

    In stand-alone microgrids based on voltage source inverters state feedback coupling between the capacitor voltage and inductor current degrades significantly the dynamics performance of voltage and current regulators. The decoupling of the controlled states is proposed, considering the limitations...

  20. Modelling of illuminated current–voltage characteristics to evaluate leakage currents in long wavelength infrared mercury cadmium telluride photovoltaic detectors

    International Nuclear Information System (INIS)

    Gopal, Vishnu; Qiu, WeiCheng; Hu, Weida

    2014-01-01

    The current–voltage characteristics of long wavelength mercury cadmium telluride infrared detectors have been studied using a recently suggested method for modelling of illuminated photovoltaic detectors. Diodes fabricated on in-house grown arsenic and vacancy doped epitaxial layers were evaluated for their leakage currents. The thermal diffusion, generation–recombination (g-r), and ohmic currents were found as principal components of diode current besides a component of photocurrent due to illumination. In addition, both types of diodes exhibited an excess current component whose growth with the applied bias voltage did not match the expected growth of trap-assisted-tunnelling current. Instead, it was found to be the best described by an exponential function of the type, I excess  = I r0  + K 1 exp (K 2 V), where I r0 , K 1 , and K 2 are fitting parameters and V is the applied bias voltage. A study of the temperature dependence of the diode current components and the excess current provided the useful clues about the source of origin of excess current. It was found that the excess current in diodes fabricated on arsenic doped epitaxial layers has its origin in the source of ohmic shunt currents. Whereas, the source of excess current in diodes fabricated on vacancy doped epitaxial layers appeared to be the avalanche multiplication of photocurrent. The difference in the behaviour of two types of diodes has been attributed to the difference in the quality of epitaxial layers

  1. Effect of current compliance and voltage sweep rate on the resistive switching of HfO2/ITO/Invar structure as measured by conductive atomic force microscopy

    International Nuclear Information System (INIS)

    Wu, You-Lin; Liao, Chun-Wei; Ling, Jing-Jenn

    2014-01-01

    The electrical characterization of HfO 2 /ITO/Invar resistive switching memory structure was studied using conductive atomic force microscopy (AFM) with a semiconductor parameter analyzer, Agilent 4156C. The metal alloy Invar was used as the metal substrate to ensure good ohmic contact with the substrate holder of the AFM. A conductive Pt/Ir AFM tip was placed in direct contact with the HfO 2 surface, such that it acted as the top electrode. Nanoscale current-voltage (I-V) characteristics of the HfO 2 /ITO/Invar structure were measured by applying a ramp voltage through the conductive AFM tip at various current compliances and ramp voltage sweep rates. It was found that the resistance of the low resistance state (RLRS) decreased with increasing current compliance value, but resistance of high resistance state (RHRS) barely changed. However, both the RHRS and RLRS decreased as the voltage sweep rate increased. The reasons for this dependency on current compliance and voltage sweep rate are discussed.

  2. A 1.8 V LDO voltage regulator with foldback current limit and thermal protection

    International Nuclear Information System (INIS)

    Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo

    2009-01-01

    This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 μm CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 μs and the quiescent current is 20 μA. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)

  3. Current voltage perspective of an organic electronic device

    Science.gov (United States)

    Mukherjee, Ayash K.; Kumari, Nikita

    2018-05-01

    Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.

  4. Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films

    International Nuclear Information System (INIS)

    Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David

    2007-01-01

    We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching

  5. Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

    Science.gov (United States)

    Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

    2010-11-01

    A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

  6. Current-voltage characteristics of carbon nanotubes with substitutional nitrogen

    DEFF Research Database (Denmark)

    Kaun, C.C.; Larade, B.; Mehrez, H.

    2002-01-01

    unit cell generates a metallic transport behavior. Nonlinear I-V characteristics set in at high bias and a negative differential resistance region is observed for the doped tubes. These behaviors can be well understood from the alignment/mis-alignment of the current carrying bands in the nanotube leads......We report ab initio analysis of current-voltage (I-V) characteristics of carbon nanotubes with nitrogen substitution doping. For zigzag semiconducting tubes, doping with a single N impurity increases current flow and, for small radii tubes, narrows the current gap. Doping a N impurity per nanotube...

  7. Anti-addiction drug ibogaine inhibits voltage-gated ionic currents: A study to assess the drug's cardiac ion channel profile

    International Nuclear Information System (INIS)

    Koenig, Xaver; Kovar, Michael; Rubi, Lena; Mike, Agnes K.; Lukacs, Peter; Gawali, Vaibhavkumar S.; Todt, Hannes; Hilber, Karlheinz; Sandtner, Walter

    2013-01-01

    The plant alkaloid ibogaine has promising anti-addictive properties. Albeit not licenced as a therapeutic drug, and despite hints that ibogaine may perturb the heart rhythm, this alkaloid is used to treat drug addicts. We have recently reported that ibogaine inhibits human ERG (hERG) potassium channels at concentrations similar to the drugs affinity for several of its known brain targets. Thereby the drug may disturb the heart's electrophysiology. Here, to assess the drug's cardiac ion channel profile in more detail, we studied the effects of ibogaine and its congener 18-Methoxycoronaridine (18-MC) on various cardiac voltage-gated ion channels. We confirmed that heterologously expressed hERG currents are reduced by ibogaine in low micromolar concentrations. Moreover, at higher concentrations, the drug also reduced human Na v 1.5 sodium and Ca v 1.2 calcium currents. Ion currents were as well reduced by 18-MC, yet with diminished potency. Unexpectedly, although blocking hERG channels, ibogaine did not prolong the action potential (AP) in guinea pig cardiomyocytes at low micromolar concentrations. Higher concentrations (≥ 10 μM) even shortened the AP. These findings can be explained by the drug's calcium channel inhibition, which counteracts the AP-prolonging effect generated by hERG blockade. Implementation of ibogaine's inhibitory effects on human ion channels in a computer model of a ventricular cardiomyocyte, on the other hand, suggested that ibogaine does prolong the AP in the human heart. We conclude that therapeutic concentrations of ibogaine have the propensity to prolong the QT interval of the electrocardiogram in humans. In some cases this may lead to cardiac arrhythmias. - Highlights: • We study effects of anti-addiction drug ibogaine on ionic currents in cardiomyocytes. • We assess the cardiac ion channel profile of ibogaine. • Ibogaine inhibits hERG potassium, sodium and calcium channels. • Ibogaine’s effects on ion channels are a potential

  8. Calcium Transient and Sodium-Calcium Exchange Current in Human versus Rabbit Sinoatrial Node Pacemaker Cells

    Directory of Open Access Journals (Sweden)

    Arie O. Verkerk

    2013-01-01

    Full Text Available There is an ongoing debate on the mechanism underlying the pacemaker activity of sinoatrial node (SAN cells, focusing on the relative importance of the “membrane clock” and the “Ca2+ clock” in the generation of the small net membrane current that depolarizes the cell towards the action potential threshold. Specifically, the debate centers around the question whether the membrane clock-driven hyperpolarization-activated current, If, which is also known as the “funny current” or “pacemaker current,” or the Ca2+ clock-driven sodium-calcium exchange current, INaCa, is the main contributor to diastolic depolarization. In our contribution to this journal’s “Special Issue on Cardiac Electrophysiology,” we present a numerical reconstruction of If and INaCa in isolated rabbit and human SAN pacemaker cells based on experimental data on action potentials, If, and intracellular calcium concentration ([Ca2+]i that we have acquired from these cells. The human SAN pacemaker cells have a smaller If, a weaker [Ca2+]i transient, and a smaller INaCa than the rabbit cells. However, when compared to the diastolic net membrane current, INaCa is of similar size in human and rabbit SAN pacemaker cells, whereas If is smaller in human than in rabbit cells.

  9. Omega-conotoxin- and nifedipine-insensitive voltage-operated calcium channels mediate K(+)-induced release of pro-thyrotropin-releasing hormone-connecting peptides Ps4 and Ps5 from perifused rat hypothalamic slices.

    Science.gov (United States)

    Valentijn, K; Tranchand Bunel, D; Vaudry, H

    1992-07-01

    The rat thyrotropin-releasing hormone (TRH) precursor (prepro-TRH) contains five copies of the TRH progenitor sequence linked together by intervening sequences. Recently, we have shown that the connecting peptides prepro-TRH-(160-169) (Ps4) and prepro-TRH-(178-199) (Ps5) are released from rat hypothalamic neurones in response to elevated potassium concentrations, in a calcium-dependent manner. In the present study, the role of voltage-operated calcium channels in potassium-induced release of Ps4 and Ps5 was investigated, using a perifusion system for rat hypothalamic slices. The release of Ps4 and Ps5 stimulated by potassium (70 mM) was blocked by the inorganic ions Co2+ (2.6 mM) and Ni2+ (5 mM). In contrast, the stimulatory effect of KCl was insensitive to Cd2+ (100 microM). The dihydropyridine antagonist nifedipine (10 microM) had no effect on K(+)-evoked release of Ps4 and Ps5. Furthermore, the response to KCl was not affected by nifedipine (10 microM) in combination with diltiazem (1 microM), a benzothiazepine which increases the affinity of dihydropyridine antagonists for their receptor. The dihydropyridine agonist BAY K 8644, at concentrations as high as 1 mM, did not stimulate the basal secretion of Ps4 and Ps5. In addition, BAY K 8644 had no potentiating effect on K(+)-induced release of Ps4 and Ps5. The marine cone snail toxin omega-conotoxin, a blocker of both L- and N-type calcium channels had no effect on the release of Ps4 and Ps5 stimulated by potassium. Similarly, the omega-conopeptide SNX-111, a selective blocker of N-type calcium channels, did not inhibit the stimulatory effect of potassium. The release of Ps4 and Ps5 evoked by high K+ was insensitive to the non-selective calcium channel blocker verapamil (20 microM). Amiloride (1 microM), a putative blocker of T-type calcium channels, did not affect KCl-induced secretion of the two connecting peptides. Taken together, these results indicate that two connecting peptides derived from the pro-TRH, Ps

  10. New Conotoxin SO-3 Targeting N-type Voltage-Sensitive Calcium Channels

    Directory of Open Access Journals (Sweden)

    Lei Wen

    2006-04-01

    Full Text Available Selective blockers of the N-type voltage-sensitive calcium (CaV channels are useful in the management of severe chronic pain. Here, the structure and function characteristics of a novel N-type CaV channel blocker, SO-3, are reviewed. SO-3 is a 25-amino acid conopeptide originally derived from the venom of Conus striatus, and contains the same 4-loop, 6-cysteine framework (C-C-CC-C-C as O-superfamily conotoxins. The synthetic SO-3 has high analgesic activity similar to ω-conotoxin MVIIA (MVIIA, a selective N-type CaV channel blocker approved in the USA and Europe for the alleviation of persistent pain states. In electrophysiological studies, SO-3 shows more selectivity towards the N-type CaV channels than MVIIA. The dissimilarity between SO-3 and MVIIA in the primary and tertiary structures is further discussed in an attempt to illustrate the difference in selectivity of SO-3 and MVIIA towards N-type CaV channels.

  11. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.

    1993-01-01

    We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

  12. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  13. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  14. Variable speed wind turbine generator system with current controlled voltage source inverter

    International Nuclear Information System (INIS)

    Muyeen, S.M.; Al-Durra, Ahmed; Tamura, J.

    2011-01-01

    highlights: → Current controlled voltage source inverter scheme for wind power application. → Low voltage ride through of wind farm. → Variable speed wind turbine driven permanent magnet synchronous generator-operation and control. -- Abstract: The present popular trend of wind power generation is to use variable speed wind turbine (VSWT) driving a doubly fed induction generator (DFIG), wound field synchronous generator (WFSG) or permanent magnet synchronous generator (PMSG). Among them, stability analyses of DFIG type of VSWT have already been reported in many literatures. However, transient stability and low voltage ride through (LVRT) characteristics analyses for synchronous generator type of VSWT is not sufficient enough. This paper focuses on detailed LVRT characteristic analysis of variable speed wind turbine driving a PMSG (VSWT-PMSG) with current controlled voltage source inverter (CC-VSI). Modeling and suitable control strategies for overall system are developed to augment the low voltage ride through capability of variable speed wind generator, considering recent wind farm grid code. Both symmetrical and unsymmetrical faults are analyzed as network disturbances in this paper. The permanent fault due to unsuccessful reclosing of circuit breakers is taken into consideration, which is a salient feature of this study. Moreover, the dynamic characteristic is analyzed using real wind speed data measured in Hokkaido Island, Japan. The proposed control scheme is simulated by using the standard power system simulation package PSCAD/EMTDC and results are verified by comparing that of voltage controlled voltage source inverter scheme available in power system literature.

  15. Variable speed wind turbine generator system with current controlled voltage source inverter

    Energy Technology Data Exchange (ETDEWEB)

    Muyeen, S.M., E-mail: muyeen0809@yahoo.co [Dept. of Electrical Engineering, Petroleum Institute, P.O. Box 2533, Abu Dhabi (United Arab Emirates); Al-Durra, Ahmed [Dept. of Electrical Engineering, The Petroleum Institute, P.O. Box 2533, Abu Dhabi (United Arab Emirates); Tamura, J. [Dept. of EEE, Kitami Institute of Technology, 165 Koen-cho, Kitami 090-8507 (Japan)

    2011-07-15

    highlights: {yields} Current controlled voltage source inverter scheme for wind power application. {yields} Low voltage ride through of wind farm. {yields} Variable speed wind turbine driven permanent magnet synchronous generator-operation and control. -- Abstract: The present popular trend of wind power generation is to use variable speed wind turbine (VSWT) driving a doubly fed induction generator (DFIG), wound field synchronous generator (WFSG) or permanent magnet synchronous generator (PMSG). Among them, stability analyses of DFIG type of VSWT have already been reported in many literatures. However, transient stability and low voltage ride through (LVRT) characteristics analyses for synchronous generator type of VSWT is not sufficient enough. This paper focuses on detailed LVRT characteristic analysis of variable speed wind turbine driving a PMSG (VSWT-PMSG) with current controlled voltage source inverter (CC-VSI). Modeling and suitable control strategies for overall system are developed to augment the low voltage ride through capability of variable speed wind generator, considering recent wind farm grid code. Both symmetrical and unsymmetrical faults are analyzed as network disturbances in this paper. The permanent fault due to unsuccessful reclosing of circuit breakers is taken into consideration, which is a salient feature of this study. Moreover, the dynamic characteristic is analyzed using real wind speed data measured in Hokkaido Island, Japan. The proposed control scheme is simulated by using the standard power system simulation package PSCAD/EMTDC and results are verified by comparing that of voltage controlled voltage source inverter scheme available in power system literature.

  16. A 1.8 V LDO voltage regulator with foldback current limit and thermal protection

    Energy Technology Data Exchange (ETDEWEB)

    Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo, E-mail: zml1985@mail.ustc.edu.c [Department of Electronic Science and Technology, University of Science and Technology of China, Hefei 230027 (China)

    2009-08-15

    This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 {mu}m CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 {mu}s and the quiescent current is 20 {mu}A. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)

  17. Leakage Currents in Low-Voltage PME and BME Ceramic Capacitors

    Science.gov (United States)

    Teverovsky, Alexander

    2015-01-01

    Introduction of BME capacitors to high-reliability electronics as a replacement for PME capacitors requires better understanding of changes in performance and reliability of MLCCs to set justified screening and qualification requirements. In this work, absorption and leakage currents in various lots of commercial and military grade X7R MLCCs rated to 100V and less have been measured to reveal difference in behavior of PME and BME capacitors in a wide range of voltages and temperatures. Degradation of leakage currents and failures in virgin capacitors and capacitors with introduced cracks has been studied at different voltages and temperatures during step stress highly accelerated life testing. Mechanisms of charge absorption, conduction and degradation have been discussed and a failure model in capacitors with defects suggested.

  18. Calcium signaling properties of a thyrotroph cell line, mouse TαT1 cells.

    Science.gov (United States)

    Tomić, Melanija; Bargi-Souza, Paula; Leiva-Salcedo, Elias; Nunes, Maria Tereza; Stojilkovic, Stanko S

    2015-12-01

    TαT1 cells are mouse thyrotroph cell line frequently used for studies on thyroid-stimulating hormone beta subunit gene expression and other cellular functions. Here we have characterized calcium-signaling pathways in TαT1 cells, an issue not previously addressed in these cells and incompletely described in native thyrotrophs. TαT1 cells are excitable and fire action potentials spontaneously and in response to application of thyrotropin-releasing hormone (TRH), the native hypothalamic agonist for thyrotrophs. Spontaneous electrical activity is coupled to small amplitude fluctuations in intracellular calcium, whereas TRH stimulates both calcium mobilization from intracellular pools and calcium influx. Non-receptor-mediated depletion of intracellular pool also leads to a prominent facilitation of calcium influx. Both receptor and non-receptor stimulated calcium influx is substantially attenuated but not completely abolished by inhibition of voltage-gated calcium channels, suggesting that depletion of intracellular calcium pool in these cells provides a signal for both voltage-independent and -dependent calcium influx, the latter by facilitating the pacemaking activity. These cells also express purinergic P2Y1 receptors and their activation by extracellular ATP mimics TRH action on calcium mobilization and influx. The thyroid hormone triiodothyronine prolongs duration of TRH-induced calcium spikes during 30-min exposure. These data indicate that TαT1 cells are capable of responding to natively feed-forward TRH signaling and intrapituitary ATP signaling with acute calcium mobilization and sustained calcium influx. Amplification of TRH-induced calcium signaling by triiodothyronine further suggests the existence of a pathway for positive feedback effects of thyroid hormones probably in a non-genomic manner. Published by Elsevier Ltd.

  19. Simulation and investigation of SiPM’s leakage currents at low voltages

    International Nuclear Information System (INIS)

    Parygin, P P; Popova, E V; Grachev, V M

    2017-01-01

    Technology Computer-Aided Design (TCAD) allows us to use computers in order to develop semiconductor processing technologies and devices and optimize them. Within a framework of a study of silicon photomultipliers (SiPM) a simulation of these devices has been made. The simulation was performed for the irradiated SiPMs and current-voltage characteristics were obtained for the modeled devices. Investigation of current-voltage curve below breakdown with regard to the simulated structure was performed. Obtained curves are presented. (paper)

  20. Investigation of the double exponential in the current-voltage characteristics of silicon solar cells. [proton irradiation effects on ATS 1 cells

    Science.gov (United States)

    Wolf, M.; Noel, G. T.; Stirn, R. J.

    1977-01-01

    Difficulties in relating observed current-voltage characteristics of individual silicon solar cells to their physical and material parameters were underscored by the unexpected large changes in the current-voltage characteristics telemetered back from solar cells on the ATS-1 spacecraft during their first year in synchronous orbit. Depletion region recombination was studied in cells exhibiting a clear double-exponential dark characteristic by subjecting the cells to proton irradiation. A significant change in the saturation current, an effect included in the Sah, Noyce, Shockley formulation of diode current resulting from recombination in the depletion region, was caused by the introduction of shallow levels in the depletion region by the proton irradiation. This saturation current is not attributable only to diffusion current from outside the depletion region and only its temperature dependence can clarify its origin. The current associated with the introduction of deep-lying levels did not change significantly in these experiments.

  1. Enhanced Decoupled Double Synchronous Reference Frame Current Controller for Unbalanced Grid-Voltage Conditions

    DEFF Research Database (Denmark)

    Reyes, M.; Rodriguez, Pedro; Vazquez, S.

    2012-01-01

    . In these codes, the injection of positive- and negative-sequence current components becomes necessary for fulfilling, among others, the low-voltage ride-through requirements during balanced and unbalanced grid faults. However, the performance of classical dq current controllers, applied to power converters......, under unbalanced grid-voltage conditions is highly deficient, due to the unavoidable appearance of current oscillations. This paper analyzes the performance of the double synchronous reference frame controller and improves its structure by adding a decoupling network for estimating and compensating...

  2. PKA Controls Calcium Influx into Motor Neurons during a Rhythmic Behavior

    Science.gov (United States)

    Wang, Han; Sieburth, Derek

    2013-01-01

    Cyclic adenosine monophosphate (cAMP) has been implicated in the execution of diverse rhythmic behaviors, but how cAMP functions in neurons to generate behavioral outputs remains unclear. During the defecation motor program in C. elegans, a peptide released from the pacemaker (the intestine) rhythmically excites the GABAergic neurons that control enteric muscle contractions by activating a G protein-coupled receptor (GPCR) signaling pathway that is dependent on cAMP. Here, we show that the C. elegans PKA catalytic subunit, KIN-1, is the sole cAMP target in this pathway and that PKA is essential for enteric muscle contractions. Genetic analysis using cell-specific expression of dominant negative or constitutively active PKA transgenes reveals that knockdown of PKA activity in the GABAergic neurons blocks enteric muscle contractions, whereas constitutive PKA activation restores enteric muscle contractions to mutants defective in the peptidergic signaling pathway. Using real-time, in vivo calcium imaging, we find that PKA activity in the GABAergic neurons is essential for the generation of synaptic calcium transients that drive GABA release. In addition, constitutively active PKA increases the duration of calcium transients and causes ectopic calcium transients that can trigger out-of-phase enteric muscle contractions. Finally, we show that the voltage-gated calcium channels UNC-2 and EGL-19, but not CCA-1 function downstream of PKA to promote enteric muscle contractions and rhythmic calcium influx in the GABAergic neurons. Thus, our results suggest that PKA activates neurons during a rhythmic behavior by promoting presynaptic calcium influx through specific voltage-gated calcium channels. PMID:24086161

  3. PKA controls calcium influx into motor neurons during a rhythmic behavior.

    Directory of Open Access Journals (Sweden)

    Han Wang

    Full Text Available Cyclic adenosine monophosphate (cAMP has been implicated in the execution of diverse rhythmic behaviors, but how cAMP functions in neurons to generate behavioral outputs remains unclear. During the defecation motor program in C. elegans, a peptide released from the pacemaker (the intestine rhythmically excites the GABAergic neurons that control enteric muscle contractions by activating a G protein-coupled receptor (GPCR signaling pathway that is dependent on cAMP. Here, we show that the C. elegans PKA catalytic subunit, KIN-1, is the sole cAMP target in this pathway and that PKA is essential for enteric muscle contractions. Genetic analysis using cell-specific expression of dominant negative or constitutively active PKA transgenes reveals that knockdown of PKA activity in the GABAergic neurons blocks enteric muscle contractions, whereas constitutive PKA activation restores enteric muscle contractions to mutants defective in the peptidergic signaling pathway. Using real-time, in vivo calcium imaging, we find that PKA activity in the GABAergic neurons is essential for the generation of synaptic calcium transients that drive GABA release. In addition, constitutively active PKA increases the duration of calcium transients and causes ectopic calcium transients that can trigger out-of-phase enteric muscle contractions. Finally, we show that the voltage-gated calcium channels UNC-2 and EGL-19, but not CCA-1 function downstream of PKA to promote enteric muscle contractions and rhythmic calcium influx in the GABAergic neurons. Thus, our results suggest that PKA activates neurons during a rhythmic behavior by promoting presynaptic calcium influx through specific voltage-gated calcium channels.

  4. Inward rectifier potassium current IKir promotes intrinsic pacemaker activity of thalamocortical neurons.

    Science.gov (United States)

    Amarillo, Yimy; Tissone, Angela I; Mato, Germán; Nadal, Marcela S

    2018-06-01

    Slow repetitive burst firing by hyperpolarized thalamocortical (TC) neurons correlates with global slow rhythms (rectifier potassium current I Kir induces repetitive burst firing at slow and delta frequency bands. We demonstrate this in mouse TC neurons in brain slices by manipulating the Kir maximum conductance with dynamic clamp. We also performed a thorough theoretical analysis that explains how the unique properties of I Kir enable this current to induce slow periodic bursting in TC neurons. We describe a new ionic mechanism based on the voltage- and time-dependent interaction of I Kir and hyperpolarization-activated cationic current I h that endows TC neurons with the ability to oscillate spontaneously at very low frequencies, even below 0.5 Hz. Bifurcation analysis of conductance-based models of increasing complexity demonstrates that I Kir induces bistability of the membrane potential at the same time that it induces sustained oscillations in combination with I h and increases the robustness of low threshold-activated calcium current I T -mediated oscillations. NEW & NOTEWORTHY The strong inwardly rectifying potassium current I Kir of thalamocortical neurons displays a region of negative slope conductance in the current-voltage relationship that generates potassium currents activated by hyperpolarization. Bifurcation analysis shows that I Kir induces bistability of the membrane potential; generates sustained subthreshold oscillations by interacting with the hyperpolarization-activated cationic current I h ; and increases the robustness of oscillations mediated by the low threshold-activated calcium current I T . Upregulation of I Kir in thalamocortical neurons induces repetitive burst firing at slow and delta frequency bands (<4 Hz).

  5. New digital reference current generation for shunt active power filter under distorted voltage conditions

    Energy Technology Data Exchange (ETDEWEB)

    Abdusalam, Mohamed; Karimi, Shahram; Saadate, Shahrokh [Groupe de Recherche en Electrotechnique et Electronique de Nancy (GREEN), CNRS UMR 7037 (France); Poure, Philippe [Laboratoire d' Instrumentation Electronique de Nancy (LIEN), EA 3440, Universite Henri Poincare - Nancy Universite, B.P. 239, 54506 Vandoeuvre les Nancy Cedex (France)

    2009-05-15

    In this paper, a new reference current computation method suitable for shunt active power filter control under distorted voltage conditions is proposed. The active power filter control is based on the use of self-tuning filters (STF) for the reference current generation and on a modulated hysteresis current controller. This active filter is intended for harmonic compensation of a diode rectifier feeding a RL load under distorted voltage conditions. The study of the active filter control is divided in two parts. The first one deals with the harmonic isolator which generates the harmonic reference currents and is experimentally implemented in a DS1104 card of a DSPACE prototyping system. The second part focuses on the generation of the switching pattern of the inverter by using a modulated hysteresis current controller, implemented in an analogue card. The use of STF instead of classical extraction filters allows extracting directly the voltage and current fundamental components in the {alpha}-{beta} axis without phase locked loop (PLL). The performances are good even under distorted voltage conditions. First, the effectiveness of the new proposed method is mathematically studied and verified by computer simulation. Then, experimental results are presented using a DSPACE system associated with the analogue current controller for a real shunt active power filter. (author)

  6. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  7. Comparison between voltage by turn measured on different tokamaks operating in hybrid wave current drive regime

    International Nuclear Information System (INIS)

    Briffod, G.; Hoang, G.T.

    1987-06-01

    On a tokamak in a current drive operation with a hybrid wave, the R.F. current is estimated from the voltage drop by plasma turn generated by R.F. power application. This estimated current is not proportional to the injected power. There still exists in the plasma an electric field corresponding to the current part produced by induction. The role evaluation of this parameter on the current drive efficiency is important. In this report the relation voltage-R.F. current is studied on Petula and results on the voltage evolution by turn on different machines are compared [fr

  8. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  9. Cross talk among calcium, hydrogen peroxide, and nitric oxide and activation of gene expression involving calmodulins and calcium-dependent protein kinases in Ulva compressa exposed to copper excess.

    Science.gov (United States)

    González, Alberto; Cabrera, M de Los Ángeles; Henríquez, M Josefa; Contreras, Rodrigo A; Morales, Bernardo; Moenne, Alejandra

    2012-03-01

    To analyze the copper-induced cross talk among calcium, nitric oxide (NO), and hydrogen peroxide (H(2)O(2)) and the calcium-dependent activation of gene expression, the marine alga Ulva compressa was treated with the inhibitors of calcium channels, ned-19, ryanodine, and xestospongin C, of chloroplasts and mitochondrial electron transport chains, 3-(3,4-dichlorophenyl)-1,1-dimethylurea and antimycin A, of pyruvate dehydrogenase, moniliformin, of calmodulins, N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide, and of calcium-dependent protein kinases, staurosporine, as well as with the scavengers of NO, 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, and of H(2)O(2), ascorbate, and exposed to a sublethal concentration of copper (10 μm) for 24 h. The level of NO increased at 2 and 12 h. The first peak was inhibited by ned-19 and 3-(2,3-dichlorophenyl)-1,1-dimethylurea and the second peak by ned-19 and antimycin A, indicating that NO synthesis is dependent on calcium release and occurs in organelles. The level of H(2)O(2) increased at 2, 3, and 12 h and was inhibited by ned-19, ryanodine, xestospongin C, and moniliformin, indicating that H(2)O(2) accumulation is dependent on calcium release and Krebs cycle activity. In addition, pyruvate dehydrogenase, 2-oxoxglutarate dehydrogenase, and isocitrate dehydrogenase activities of the Krebs cycle increased at 2, 3, 12, and/or 14 h, and these increases were inhibited in vitro by EGTA, a calcium chelating agent. Calcium release at 2, 3, and 12 h was inhibited by 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide and ascorbate, indicating activation by NO and H(2)O(2). In addition, the level of antioxidant protein gene transcripts decreased with N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide and staurosporine. Thus, there is a copper-induced cross talk among calcium, H(2)O(2), and NO and a calcium-dependent activation of gene expression involving calmodulins and calcium-dependent protein

  10. Achievable peak electrode voltage reduction by neurostimulators using descending staircase currents to deliver charge.

    Science.gov (United States)

    Halpern, Mark

    2011-01-01

    This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.

  11. LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control

    Directory of Open Access Journals (Sweden)

    Hung-I Hsieh

    2017-02-01

    Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.

  12. A role for barley calcium-dependent protein kinase CPK2a in the response to drought

    Directory of Open Access Journals (Sweden)

    Agata Cieśla

    2016-10-01

    Full Text Available Increasing the drought tolerance of crops is one of the most challenging goals in plant breeding. To improve crop productivity during periods of water deficit, it is essential to understand the complex regulatory pathways that adapt plant metabolism to environmental conditions. Among various plant hormones and second messengers, calcium ions are known to be involved in drought stress perception and signaling. Plants have developed specific calcium-dependent protein kinases that convert calcium signals into phosphorylation events. In this study we attempted to elucidate the role of a calcium-dependent protein kinase in the drought stress response of barley (Hordeum vulgare L., one of the most economically important crops worldwide. The ongoing barley genome project has provided useful information about genes potentially involved in the drought stress response, but information on the role of calcium-dependent kinases is still limited. We found that the gene encoding the calcium-dependent protein kinase HvCPK2a was significantly upregulated in response to drought. To better understand the role of HvCPK2a in drought stress signaling, we generated transgenic Arabidopsis plants that overexpressed the corresponding coding sequence. Overexpressing lines displayed drought sensitivity, reduced nitrogen balance index, an increase in total chlorophyll content and decreased relative water content. In addition, in vitro kinase assay experiments combined with mass spectrometry allowed HvCPK2a autophosphorylation sites to be identified. Our results suggest that HvCPK2a is a dual-specificity calcium-dependent protein kinase that functions as a negative regulator of the drought stress response in barley.

  13. Spin-dependent current in resonant tunneling diode with ferromagnetic GaMnN layers

    International Nuclear Information System (INIS)

    Tang, N.Y.

    2009-01-01

    The spin-polarized tunneling current through a double barrier resonant tunneling diode (RTD) with ferromagnetic GaMnN emitter/collector is investigated theoretically. Two distinct spin splitting peaks can be observed at current-voltage (I-V) characteristics at low temperature. The spin polarization decreases with the temperature due to the thermal effect of electron density of states. When charge polarization effect is considered at the heterostructure, the spin polarization is enhanced significantly. A highly spin-polarized current can be obtained depending on the polarization charge density.

  14. Effect of Electric Voltage and Current of X-ray Chamber on the Element inthe Zirconium Alloy Analysis X-ray by X-ray Fluorescence

    International Nuclear Information System (INIS)

    Yusuf-Nampira; Narko-Wibowo, L; Rosika-Krisnawati; Nudia-Barenzani

    2000-01-01

    The using of x-ray fluorescence in the chemical analysis depend heavilyon the parameters of x-ray chamber, for examples : electric voltage andelectric current. That parameter give effect in the result of determine ofSn, Cr, Fe and Ni in the zirconium alloy. 20 kV electric voltages are used onthe Mo x-ray chamber shall product x-ray of zirconium in the sample materialcan give effect in the stability of the analysis result (deviation more than5%). The result of analysis of elements in the zirconium alloy shall givedeviation less than 5% when using of electric voltage of the x-ray chamberless than 19 kV. The sensitivity of analysis can be reached by step upelectric current of x-ray chamber. (author)

  15. Pulsed Current-Voltage-Induced Perturbations of a Premixed Propane/Air Flame

    Directory of Open Access Journals (Sweden)

    Jacob. B. Schmidt

    2011-01-01

    Full Text Available The effect of millisecond wide sub-breakdown pulsed voltage-current induced flow perturbation has been measured in premixed laminar atmospheric pressure propane/air flame. The flame equivalence ratios were varied from 0.8 to 1.2 with the flow speeds near 1.1 meter/second. Spatio-temporal flame structure changes were observed through collection of CH (A-X and OH (A-X chemiluminescence and simultaneous spontaneous Raman scattering from N2. This optical collection scheme allows us to obtain a strong correlation between the measured gas temperature and the chemiluminescence intensity, verifying that chemiluminescence images provide accurate measurements of flame reaction zone structure modifications. The experimental results suggest that the flame perturbation is caused by ionic wind originating only from the radial positive space-charge distribution in/near the cathode fall. A net momentum transfer acts along the annular space discharge distribution in the reaction zone at or near the cathode fall which modifies the flow field near the cathodic burner head. This radially inward directed body force appears to enhance mixing similar to a swirl induced modification of the flame structure. The flame fluidic response exhibit a strong dependence on the voltage pulse width ≤10 millisecond.

  16. Current in heavy-current planar diode with discrete emission surface

    International Nuclear Information System (INIS)

    Belomyttsev, S.Ya.; Korovin, S.D.; Pegel', I.V

    1999-01-01

    Dependence of current in a high-current planar diode on the size of emission centres was studied. Essential effect of emission surface microstructure on the current value in the planar diode was demonstrated. It was determined that if the distance between the emitter essentially exceeded their size then current dependence on the ratio of size to the value of the diode gap was an exponential function with 3/2 index. Current dependence on voltage obeyed the exponential law with 3/2 index up to higher voltage values in the planar diode with discrete emission surface in contrast to the case of a planar diode with homogeneous emission surface [ru

  17. Effect of quantum noise and tunneling on the fluctuational voltage-current characteristics and the lifetime of the zero-voltage state in Josephson junctions

    International Nuclear Information System (INIS)

    Mel'nikov, V.I.; Suetoe, A.

    1986-01-01

    The minima of the potential energy for the dynamical variable phi of a Josephson junction are separated by barriers of height hI/sub c//e, where I/sub c/ is the critical current. At low temperatures, T hΩ/2π (Ω is the Josephson plasma frequency). We consider this problem for high-quality junctions (RCΩ>>1, R and C are the resistance and the capacitance of the junction), accounting for the effect of a Johnson-Nyquist noise and quantum tunneling at the barrier top. With a simplifying assumption, we derive a pair of integral equations containing an energy variable for the steady-state distribution of phi and phi-dot, and solve it by a modification of the Wiener-Hopf method. The result is a formula for the current dependence of the fluctuational voltage, valid for currents I 2 <<1

  18. Temperature dependence of the current in Schottky-barrier source-gated transistors

    Science.gov (United States)

    Sporea, R. A.; Overy, M.; Shannon, J. M.; Silva, S. R. P.

    2015-05-01

    The temperature dependence of the drain current is an important parameter in thin-film transistors. In this paper, we propose that in source-gated transistors (SGTs), this temperature dependence can be controlled and tuned by varying the length of the source electrode. SGTs comprise a reverse biased potential barrier at the source which controls the current. As a result, a large activation energy for the drain current may be present which, although useful in specific temperature sensing applications, is in general deleterious in many circuit functions. With support from numerical simulations with Silvaco Atlas, we describe how increasing the length of the source electrode can be used to reduce the activation energy of SGT drain current, while maintaining the defining characteristics of SGTs: low saturation voltage, high output impedance in saturation, and tolerance to geometry variations. In this study, we apply the dual current injection modes to obtain drain currents with high and low activation energies and propose mechanisms for their exploitation in future large-area integrated circuit designs.

  19. Current–voltage characteristics of manganite–titanite perovskite junctions

    Directory of Open Access Journals (Sweden)

    Benedikt Ifland

    2015-07-01

    Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

  20. An analytic current-voltage model for quasi-ballistic III-nitride high electron mobility transistors

    Science.gov (United States)

    Li, Kexin; Rakheja, Shaloo

    2018-05-01

    We present an analytic model to describe the DC current-voltage (I-V) relationship in scaled III-nitride high electron mobility transistors (HEMTs) in which transport within the channel is quasi-ballistic in nature. Following Landauer's transport theory and charge calculation based on two-dimensional electrostatics that incorporates negative momenta states from the drain terminal, an analytic expression for current as a function of terminal voltages is developed. The model interprets the non-linearity of access regions in non-self-aligned HEMTs. Effects of Joule heating with temperature-dependent thermal conductivity are incorporated in the model in a self-consistent manner. With a total of 26 input parameters, the analytic model offers reduced empiricism compared to existing GaN HEMT models. To verify the model, experimental I-V data of InAlN/GaN with InGaN back-barrier HEMTs with channel lengths of 42 and 105 nm are considered. Additionally, the model is validated against numerical I-V data obtained from DC hydrodynamic simulations of an unintentionally doped AlGaN-on-GaN HEMT with 50-nm gate length. The model is also verified against pulsed I-V measurements of a 150-nm T-gate GaN HEMT. Excellent agreement between the model and experimental and numerical results for output current, transconductance, and output conductance is demonstrated over a broad range of bias and temperature conditions.

  1. Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.

    Science.gov (United States)

    Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L

    2017-08-01

    POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.

  2. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  3. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    Directory of Open Access Journals (Sweden)

    Ana Laura Sanchez-Sandoval

    Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  4. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels

    Science.gov (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

  5. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    Science.gov (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  6. On the Distribution of Lightning Current among Interconnected Grounding Systems in Medium Voltage Grids

    Directory of Open Access Journals (Sweden)

    Guido Ala

    2018-03-01

    Full Text Available This paper presents the results of a first investigation on the effects of lightning stroke on medium voltage installations’ grounding systems, interconnected with the metal shields of the Medium Voltage (MV distribution grid cables or with bare buried copper ropes. The study enables us to evaluate the distribution of the lightning current among interconnected ground electrodes in order to estimate if the interconnection, usually created to reduce ground potential rise during a single-line-to-ground fault, can give place to dangerous situations far from the installation hit by the lightning stroke. Four different case studies of direct lightning stroke are presented and discussed: (1 two secondary substations interconnected by the cables’ shields; (2 two secondary substations interconnected by a bare buried conductor; (3 a high voltage/medium voltage station connected with a secondary substation by the medium voltage cables’ shields; (4 a high voltage/medium voltage station connected with a secondary substation by a bare buried conductor. The results of the simulations show that a higher peak-lowering action on the lighting-stroke current occurs due to the use of bare conductors as interconnection elements in comparison to the cables’ shields.

  7. Large-conductance calcium-dependent potassium channels prevent dendritic excitability in neocortical pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2009-03-01

    Large-conductance calcium-dependent potassium channels (BK channels) are homogeneously distributed along the somatodendritic axis of layer 5 pyramidal neurons of the rat somatosensory cortex. The relevance of this conductance for dendritic calcium electrogenesis was studied in acute brain slices using somatodendritic patch clamp recordings and calcium imaging. BK channel activation reduces the occurrence of dendritic calcium spikes. This is reflected in an increased critical frequency of somatic spikes necessary to activate the distal initiation zone. Whilst BK channels repolarise the somatic spike, they dampen it only in the distal dendrite. Their activation reduces dendritic calcium influx via glutamate receptors. Furthermore, they prevent dendritic calcium electrogenesis and subsequent somatic burst discharges. However, the time window for coincident somatic action potential and dendritic input to elicit dendritic calcium events is not influenced by BK channels. Thus, BK channel activation in layer 5 pyramidal neurons affects cellular excitability primarily by establishing a high threshold at the distal action potential initiation zone.

  8. Stability of high current diode under 100-nanosecond-pulse voltage

    International Nuclear Information System (INIS)

    Lai Dingguo; Qiu Aici; Zhang Yongmin; Huang Jianjun; Ren Shuqing; Yang Li

    2012-01-01

    Stability of high current diode under pulse voltage with 80 ns and 34 ns rise time was studied on the flash Ⅱ accelerator. Influence of rise time of diode voltage on startup time and cathode emission uniformity and repeatability of diode impedance was analyzed by comparing the experimental results with numerically simulated results, and the influence mechanism was discussed. The startup time of diode increases with the increasing of rise time of voltage, and the repeatability of diode impedance decreases. Discal plane cathode is prone to emit rays intensely in the center area, the time that plasma covers the surface of the cathode increases and the shielding effect has more impact on cathode emission according to the increase of rise time. Local intense emission on the cathode increases expansion speed of plasma and reduces the effective emission area. The stability of characteristic impedance of diode under a pulse voltage with slow rise time is decreased by the combined action of expansion speed of plasma and the effective emission area. (authors)

  9. Voltage imaging to understand connections and functions of neuronal circuits

    Science.gov (United States)

    Antic, Srdjan D.; Empson, Ruth M.

    2016-01-01

    Understanding of the cellular mechanisms underlying brain functions such as cognition and emotions requires monitoring of membrane voltage at the cellular, circuit, and system levels. Seminal voltage-sensitive dye and calcium-sensitive dye imaging studies have demonstrated parallel detection of electrical activity across populations of interconnected neurons in a variety of preparations. A game-changing advance made in recent years has been the conceptualization and development of optogenetic tools, including genetically encoded indicators of voltage (GEVIs) or calcium (GECIs) and genetically encoded light-gated ion channels (actuators, e.g., channelrhodopsin2). Compared with low-molecular-weight calcium and voltage indicators (dyes), the optogenetic imaging approaches are 1) cell type specific, 2) less invasive, 3) able to relate activity and anatomy, and 4) facilitate long-term recordings of individual cells' activities over weeks, thereby allowing direct monitoring of the emergence of learned behaviors and underlying circuit mechanisms. We highlight the potential of novel approaches based on GEVIs and compare those to calcium imaging approaches. We also discuss how novel approaches based on GEVIs (and GECIs) coupled with genetically encoded actuators will promote progress in our knowledge of brain circuits and systems. PMID:27075539

  10. Currents and voltages in the MFTF coils during the formation of a normal zone

    International Nuclear Information System (INIS)

    Owen, E.W.

    1980-08-01

    Expressions are obtained for the currents and voltages in a pair of inductively coupled superconducting coils under two conditions: formation of a normal zone and during a change in the level of the current in one coil. A dump resistor of low resistance and a detector bridge is connected across each coil. Calculated results are given for the MFTF coils. The circuit equations during formation of a normal zone are nonlinear and time-varying, consequently, only a series solution is possible. The conditions during a change in current are more easily found. After the transient has died away, the voltages in the coil associated with the changing source are all self-inductive, while the voltages in the other coil are all mutually inductive

  11. Calculation of DC Arc Plasma Torch Voltage- Current Characteristics Based on Steebeck Model

    International Nuclear Information System (INIS)

    Gnedenko, V.G.; Ivanov, A.A.; Pereslavtsev, A.V.; Tresviatsky, S.S.

    2006-01-01

    The work is devoted to the problem of the determination of plasma torches parameters and power sources parameters (working voltage and current of plasma torch) at the predesigning stage. The sequence of calculation of voltage-current characteristics of DC arc plasma torch is proposed. It is shown that the simple Steenbeck model of arc discharge in cylindrical channel makes it possible to carry out this calculation. The results of the calculation are confirmed by the experiments

  12. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  13. Decentralized energy management strategy based on predictive controllers for a medium voltage direct current photovoltaic electric vehicle charging station

    International Nuclear Information System (INIS)

    Torreglosa, Juan P.; García-Triviño, Pablo; Fernández-Ramirez, Luis M.; Jurado, Francisco

    2016-01-01

    Highlights: • Electric vehicle charging station supplied by photovoltaic, batteries and grid connection is analyzed. • The bus voltage is the key parameter for controlling the system by decentralized approach. • Decentralized control approach facilities the enlargement of the system. • Photovoltaic and battery systems are controlled by model predictive controllers. • Response by model predictive controllers improves that by PI controllers. - Abstract: The use of distributed charging stations based on renewable energy sources for electric vehicles has increased in recent years. Combining photovoltaic solar energy and batteries as energy storage system, directly tied into a medium voltage direct current bus, and with the grid support, results to be an interesting option for improving the operation and efficiency of electric vehicle charging stations. In this paper, an electric vehicle charging station supplied by photovoltaic solar panels, batteries and with grid connection is analysed and evaluated. A decentralized energy management system is developed for regulating the energy flow among the photovoltaic system, the battery and the grid in order to achieve the efficient charging of electric vehicles. The medium voltage direct current bus voltage is the key parameter for controlling the system. The battery is controlled by a model predictive controller in order to keep the bus voltage at its reference value. Depending on the state-of-charge of the battery and the bus voltage, the photovoltaic system can work at maximum power point tracking mode or at bus voltage sustaining mode, or even the grid support can be needed. The results demonstrate the proper operation and energy management of the electric vehicle charging station under study.

  14. High Dose Oral Calcium Treatment in Patients with Vitamin D-dependent Rickets Type II

    Directory of Open Access Journals (Sweden)

    R Vakili

    2017-02-01

    Full Text Available BACKGROUND AND OBJECTIVE: Vitamin D-dependent rickets type II (VDDR2 is a rare genetic disorder caused by mutations in vitamin D receptor (VDR and leads to resistance to biological effects of calcitriol. Based on the type of mutation, this disease is resistant to calcitriol even at high doses of calcitriol and successful treatment of these patients requires hypocalcemic modification through administration of high doses of calcium and bypassing the intestinal defect in VDR signaling. In addition to the need for frequent hospitalization and high costs, intravenous administration of calcium is associated with complications and problems such as arrhythmia and sepsis, venous catheter infection and hypercalciuria. This study aims to report the positive treatment effects of high doses of oral calcium in 4 patients with vitamin D-dependent rickets type II. CASE REPORT: In this study, 4 patients with vitamin D-dependent rickets type II, diagnosed based on clinical and biochemical symptoms of rickets with alopecia, underwent therapy using high doses of oral calcium (300 mg/kg/day in pediatric endocrinology and metabolism center of Imam Reza hospital. After a short period, increased growth rate in height, strength and elasticity of muscles was observed in addition to biochemical improvements without serious side effects and even one patient started walking independently within the first week of therapy for the first time. Patients were regularly followed up in terms of height and weight, growth rate and biochemical factors including calcium, phosphorus and alkaline phosphatase every 3 months for one year. CONCLUSION: Regardless of the type of mutation in vitamin D receptor, it is suggested that a 3-6 months trial of high dose oral calcium be started in each patient with vitamin D-dependent rickets type II, particularly for patients whose disease was diagnosed at lower ages.

  15. Iron mediates N-methyl-D-aspartate receptor-dependent stimulation of calcium-induced pathways and hippocampal synaptic plasticity.

    Science.gov (United States)

    Muñoz, Pablo; Humeres, Alexis; Elgueta, Claudio; Kirkwood, Alfredo; Hidalgo, Cecilia; Núñez, Marco T

    2011-04-15

    Iron deficiency hinders hippocampus-dependent learning processes and impairs cognitive performance, but current knowledge on the molecular mechanisms underlying the unique role of iron in neuronal function is sparse. Here, we investigated the participation of iron on calcium signal generation and ERK1/2 stimulation induced by the glutamate agonist N-methyl-D-aspartate (NMDA), and the effects of iron addition/chelation on hippocampal basal synaptic transmission and long-term potentiation (LTP). Addition of NMDA to primary hippocampal cultures elicited persistent calcium signals that required functional NMDA receptors and were independent of calcium influx through L-type calcium channels or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors; NMDA also promoted ERK1/2 phosphorylation and nuclear translocation. Iron chelation with desferrioxamine or inhibition of ryanodine receptor (RyR)-mediated calcium release with ryanodine-reduced calcium signal duration and prevented NMDA-induced ERK1/2 activation. Iron addition to hippocampal neurons readily increased the intracellular labile iron pool and stimulated reactive oxygen species production; the antioxidant N-acetylcysteine or the hydroxyl radical trapper MCI-186 prevented these responses. Iron addition to primary hippocampal cultures kept in calcium-free medium elicited calcium signals and stimulated ERK1/2 phosphorylation; RyR inhibition abolished these effects. Iron chelation decreased basal synaptic transmission in hippocampal slices, inhibited iron-induced synaptic stimulation, and impaired sustained LTP in hippocampal CA1 neurons induced by strong stimulation. In contrast, iron addition facilitated sustained LTP induction after suboptimal tetanic stimulation. Together, these results suggest that hippocampal neurons require iron to generate RyR-mediated calcium signals after NMDA receptor stimulation, which in turn promotes ERK1/2 activation, an essential step of sustained LTP.

  16. Modeling motoneuron firing properties: dependency on size and calcium dynamics

    NARCIS (Netherlands)

    van der Heyden, M. J.; Hilgevoord, A. A.; Bour, L. J.; Ongerboer de Visser, B. W.

    1994-01-01

    The origin of functional differences between motoneurons of varying size was investigated by employing a one-compartmental motoneuron model containing a slow K+ conductance dependent on the intracellular calcium concentration. The size of the cell was included as an explicit parameter. Simulations

  17. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  18. Calcium Occupancy of N-terminal Sites within Calmodulin Induces Inhibition of the Ryanodine Receptor Calcium Release Channel

    Energy Technology Data Exchange (ETDEWEB)

    Boschek, Curt B; Jones, Terry E; Squier, Thomas C; Bigelow, Diana J

    2007-08-01

    Calmodulin (CaM) regulates calcium release from intracellular stores in skeletal muscle through its association with the ryanodine receptor (RyR1) calcium release channel, where CaM association enhances channel opening at resting calcium levels and its closing at micromolar calcium levels associated with muscle contraction. A high-affinity CaM-binding sequence (RyRp) has been identified in RyR1, which corresponds to a 30-residue sequence (i.e., K3614 – N3643) located within the central portion of the primary sequence. However, it is currently unclear whether the identified CaM-binding sequence a) senses calcium over the physiological range of calcium-concentrations associated with RyR1 regulation or b) plays a structural role unrelated to the calcium-dependent modulation of RyR1 function. Therefore, we have measured the calcium-dependent activation of the individual domains of CaM in association with RyRp and their relationship to the CaM-dependent regulation of RyR1. These measurements utilize an engineered CaM, permitting the site-specific incorporation of N-(1-pyrene) maleimide at either T34C (PyN-CaM) or T110C (PyC-CaM) in the N- and C-domains, respectively. Consistent with prior measurements, we observe a high-affinity association between both apo- and calcium-activated CaM and RyRp. Upon association with RyRp, fluorescence changes in PyN-CaM or PyC-CaM permit the measurement of the calcium-activation of these individual domains. Fluorescence changes upon calcium-activation of PyC-CaM in association with RyRp are indicative of high-affinity calcium-dependent activation of the C-terminal domain of CaM bound to RyRp at resting calcium levels and the activation of the N-terminal domain at levels of calcium associated cellular activation. In comparison, occupancy of calcium-binding sites in the N-domain of CaM mirrors the calcium-dependence of RyR1 inhibition observed at activating calcium levels, where [Ca]1/2 = 4.3 0.4 μM, suggesting a direct regulation of Ry

  19. The L-Type Voltage-Gated Calcium Channel Ca [subscript V] 1.2 Mediates Fear Extinction and Modulates Synaptic Tone in the Lateral Amygdala

    Science.gov (United States)

    Temme, Stephanie J.; Murphy, Geoffrey G.

    2017-01-01

    L-type voltage-gated calcium channels (LVGCCs) have been implicated in both the formation and the reduction of fear through Pavlovian fear conditioning and extinction. Despite the implication of LVGCCs in fear learning and extinction, studies of the individual LVGCC subtypes, Ca[subscript V]1.2 and Ca[subscript V] 1.3, using transgenic mice have…

  20. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  1. Current-voltage characteristics of quantum-point contacts in the closed-channel regime: Transforming the bias voltage into an energy scale

    DEFF Research Database (Denmark)

    Gloos, K.; Utko, P.; Aagesen, M.

    2006-01-01

    We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...

  2. Cross Voltage Control with Inner Hysteresis Current Control for Multi-output Boost Converter

    DEFF Research Database (Denmark)

    Nami, Alireza; Zare, Firuz; Blaabjerg, Frede

    2009-01-01

    Multi-output boost (MOB) converter is a novel DC-DC converter unlike the regular boost converter, has the ability to share its total output voltage and to have different series output voltage from a given duty cycle for low and high power applications. In this paper, discrete voltage control...... with inner hysteresis current control loop has been proposed to keep the simplicity of the control law for the double-output MOB converter, which can be implemented by a combination of analogue and logical ICs or simple microcontroller to constrain the output voltages of MOB converter at their reference...... voltages against variation in load or input voltage. The salient features of the proposed control strategy are simplicity of implementation and ease to extend to multiple outputs in the MOB converter. Simulation and experimental results are presented to show the validity of control strategy....

  3. The effect of random dopant fluctuation on threshold voltage and drain current variation in junctionless nanotransistors

    International Nuclear Information System (INIS)

    Rezapour, Arash; Rezapour, Pegah

    2015-01-01

    We investigate the effect of dopant random fluctuation on threshold voltage and drain current variation in a two-gate nanoscale transistor. We used a quantum-corrected technology computer aided design simulation to run the simulation (10000 randomizations). With this simulation, we could study the effects of varying the dimensions (length and width), and thicknesses of oxide and dopant factors of a transistor on the threshold voltage and drain current in subthreshold region (off) and overthreshold (on). It was found that in the subthreshold region the variability of the drain current and threshold voltage is relatively fixed while in the overthreshold region the variability of the threshold voltage and drain current decreases remarkably, despite the slight reduction of gate voltage diffusion (compared with that of the subthreshold). These results have been interpreted by using previously reported models for threshold current variability, load displacement, and simple analytical calculations. Scaling analysis shows that the variability of the characteristics of this semiconductor increases as the effects of the short channel increases. Therefore, with a slight increase of length and a reduction of width, oxide thickness, and dopant factor, we could correct the effect of the short channel. (paper)

  4. Method and system for a gas tube switch-based voltage source high voltage direct current transmission system

    Science.gov (United States)

    She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William

    2016-12-13

    A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.

  5. Anti-addiction drug ibogaine inhibits voltage-gated ionic currents: A study to assess the drug's cardiac ion channel profile

    Energy Technology Data Exchange (ETDEWEB)

    Koenig, Xaver; Kovar, Michael; Rubi, Lena; Mike, Agnes K.; Lukacs, Peter; Gawali, Vaibhavkumar S.; Todt, Hannes [Center for Physiology and Pharmacology, Department of Neurophysiology and -pharmacology, Medical University of Vienna, 1090 Vienna (Austria); Hilber, Karlheinz, E-mail: karlheinz.hilber@meduniwien.ac.at [Center for Physiology and Pharmacology, Department of Neurophysiology and -pharmacology, Medical University of Vienna, 1090 Vienna (Austria); Sandtner, Walter [Center for Physiology and Pharmacology, Institute of Pharmacology, Medical University of Vienna, 1090 Vienna (Austria)

    2013-12-01

    The plant alkaloid ibogaine has promising anti-addictive properties. Albeit not licenced as a therapeutic drug, and despite hints that ibogaine may perturb the heart rhythm, this alkaloid is used to treat drug addicts. We have recently reported that ibogaine inhibits human ERG (hERG) potassium channels at concentrations similar to the drugs affinity for several of its known brain targets. Thereby the drug may disturb the heart's electrophysiology. Here, to assess the drug's cardiac ion channel profile in more detail, we studied the effects of ibogaine and its congener 18-Methoxycoronaridine (18-MC) on various cardiac voltage-gated ion channels. We confirmed that heterologously expressed hERG currents are reduced by ibogaine in low micromolar concentrations. Moreover, at higher concentrations, the drug also reduced human Na{sub v}1.5 sodium and Ca{sub v}1.2 calcium currents. Ion currents were as well reduced by 18-MC, yet with diminished potency. Unexpectedly, although blocking hERG channels, ibogaine did not prolong the action potential (AP) in guinea pig cardiomyocytes at low micromolar concentrations. Higher concentrations (≥ 10 μM) even shortened the AP. These findings can be explained by the drug's calcium channel inhibition, which counteracts the AP-prolonging effect generated by hERG blockade. Implementation of ibogaine's inhibitory effects on human ion channels in a computer model of a ventricular cardiomyocyte, on the other hand, suggested that ibogaine does prolong the AP in the human heart. We conclude that therapeutic concentrations of ibogaine have the propensity to prolong the QT interval of the electrocardiogram in humans. In some cases this may lead to cardiac arrhythmias. - Highlights: • We study effects of anti-addiction drug ibogaine on ionic currents in cardiomyocytes. • We assess the cardiac ion channel profile of ibogaine. • Ibogaine inhibits hERG potassium, sodium and calcium channels. • Ibogaine’s effects on

  6. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Xiquan Gao

    2014-03-01

    Full Text Available An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP, which is called PAMP-triggered immunity (PTI. The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI. Calcium (Ca2+ signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response.

  7. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    Science.gov (United States)

    Gao, Xiquan; Cox, Kevin L.; He, Ping

    2014-01-01

    An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498

  8. A Smart Voltage and Current Monitoring System for Three Phase Inverters Using an Android Smartphone Application.

    Science.gov (United States)

    Mnati, Mohannad Jabbar; Van den Bossche, Alex; Chisab, Raad Farhood

    2017-04-15

    In this paper, a new smart voltage and current monitoring system (SVCMS) technique is proposed. It monitors a three phase electrical system using an Arduino platform as a microcontroller to read the voltage and current from sensors and then wirelessly send the measured data to monitor the results using a new Android application. The integrated SVCMS design uses an Arduino Nano V3.0 as the microcontroller to measure the results from three voltage and three current sensors and then send this data, after calculation, to the Android smartphone device of an end user using Bluetooth HC-05. The Arduino Nano V3.0 controller and Bluetooth HC-05 are a cheap microcontroller and wireless device, respectively. The new Android smartphone application that monitors the voltage and current measurements uses the open source MIT App Inventor 2 software. It allows for monitoring some elementary fundamental voltage power quality properties. An effort has been made to investigate what is possible using available off-the-shelf components and open source software.

  9. Module Five: Relationships of Current, Voltage, and Resistance; Basic Electricity and Electronics Individualized Learning System.

    Science.gov (United States)

    Bureau of Naval Personnel, Washington, DC.

    This module covers the relationships between current and voltage; resistance in a series circuit; how to determine the values of current, voltage, resistance, and power in resistive series circuits; the effects of source internal resistance; and an introduction to the troubleshooting of series circuits. This module is divided into five lessons:…

  10. A fast high-voltage current-peak detection system for the ALICE transition radiation detector

    Energy Technology Data Exchange (ETDEWEB)

    Verclas, Robert [Physikalisches Institut, Ruprecht-Karls-Universitaet Heidelberg (Germany); Collaboration: ALICE-Collaboration

    2016-07-01

    During LHC operation in run 1, the gaseous detectors of ALICE occasionally experienced simultaneous trips in their high voltage which affected the majority of the high voltage channels. These trips are caused by large anode currents in the detector and are potentially related to LHC machine operations. We developed and installed a fast current-peak detection system for the ALICE Transition Radiation Detector. This system is based on FPGA technology and monitors 144 out 522 high voltage channels minimally invasively at a maximum readout rate of 2 MHz. It is an integral part of the LHC beam monitoring system. We report on the latest status.

  11. Micromolar-Affinity Benzodiazepine Receptors Regulate Voltage-Sensitive Calcium Channels in Nerve Terminal Preparations

    Science.gov (United States)

    Taft, William C.; Delorenzo, Robert J.

    1984-05-01

    Benzodiazepines in micromolar concentrations significantly inhibit depolarization-sensitive Ca2+ uptake in intact nerve-terminal preparations. Benzodiazepine inhibition of Ca2+ uptake is concentration dependent and stereospecific. Micromolar-affinity benzodiazepine receptors have been identified and characterized in brain membrane and shown to be distinct from nanomolar-affinity benzodiazepine receptors. Evidence is presented that micromolar, and not nanomolar, benzodiazepine binding sites mediate benzodiazepine inhibition of Ca2+ uptake. Irreversible binding to micromolar benzodiazepine binding sites also irreversibly blocked depolarization-dependent Ca2+ uptake in synaptosomes, indicating that these compounds may represent a useful marker for identifying the molecular components of Ca2+ channels in brain. Characterization of benzodiazepine inhibition of Ca2+ uptake demonstrates that these drugs function as Ca2+ channel antagonists, because benzodiazepines effectively blocked voltage-sensitive Ca2+ uptake inhibited by Mn2+, Co2+, verapamil, nitrendipine, and nimodipine. These results indicate that micromolar benzodiazepine binding sites regulate voltage-sensitive Ca2+ channels in brain membrane and suggest that some of the neuronal stabilizing effects of micromolar benzodiazepine receptors may be mediated by the regulation of Ca2+ conductance.

  12. Calcium-dependent smooth muscle excitatory effect elicited by the venom of the hydrocoral Millepora complanata.

    Science.gov (United States)

    Rojas, Alejandra; Torres, Mónica; Rojas, J Isela; Feregrino, Angélica; Heimer-de la Cotera, Edgar P

    2002-06-01

    In the present paper, we describe the results obtained from a preliminary pharmacological and biochemical study of the fire coral Millepora complanata, a regular component of coral reefs in the Mexican Caribbean. The protein-containing crude extract obtained from M. complanata (tested from 0.001 to 1000 microg protein/ml) caused a concentration-dependent stimulation of spontaneous contractions of the guinea pig ileum. The extract (EC(50)=11.55+/-2.36 microg/ml) was approximately 12-fold less potent than ionomycin (EC(50)=0.876+/-0.25 microg/ml) and its maximum induced contraction (1mg protein/ml) was equivalent to 68% of the response to 60mM KCl. FPLC size exclusion chromatography of the M. complanta extract afforded 12 primary fractions, of which only FV (containing proteins with molecular weights ranging from 17 to 44 kDa) and FVIII (consisting of peptides with molecular weights lesser than 1.8k Da) elicited an excitatory effect when tested at the EC(50) of the original extract. After incubation in Ca(2+)-free medium, the ileal response to FV and FVIII was significantly reduced. Blockage of L-type Ca(2+) channels with nifedipine (1 microM) inhibited FV and FVIII-evoked contractions. Cd(2+) (10 microM), an unspecific blocker of voltage-activated calcium channels, also antagonized FV and FVIII-induced effects, whereas the Na(+) channel blocker tetrodotoxin (10nM) did not significantly affect FV and FVIII responses. These results suggest that the contractions induced by the bioactive fractions obtained from the crude extract of M. complanata are caused mainly by a direct action on smooth muscle cells, via an increase in Ca(2+) permeability that occurs, at least partly, through L-type voltage-dependent Ca(2+) channels found in the cell membrane of smooth muscle. Copright 2002 Elsevier Science Ltd.

  13. High-voltage integrated linear regulator with current sinking capabilities for portable ultrasound scanners

    DEFF Research Database (Denmark)

    Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger

    2017-01-01

    This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....

  14. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

    Science.gov (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

    2013-09-01

    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  15. Current-voltage relation for thin tunnel barriers: Parabolic barrier model

    DEFF Research Database (Denmark)

    Hansen, Kim; Brandbyge, Mads

    2004-01-01

    We derive a simple analytic result for the current-voltage curve for tunneling of electrons through a thin uniform insulating layer modeled by a parabolic barrier. Our model, which goes beyond the Wentzel–Kramers–Brillouin approximation, is applicable also in the limit of highly transparant...

  16. Glutathionylation-Dependence of Na+-K+-Pump Currents Can Mimic Reduced Subsarcolemmal Na+ Diffusion

    Science.gov (United States)

    Garcia, Alvaro; Liu, Chia-Chi; Cornelius, Flemming; Clarke, Ronald J.; Rasmussen, Helge H.

    2016-01-01

    The existence of a subsarcolemmal space with restricted diffusion for Na+ in cardiac myocytes has been inferred from a transient peak electrogenic Na+-K+ pump current beyond steady state on reexposure of myocytes to K+ after a period of exposure to K+-free extracellular solution. The transient peak current is attributed to enhanced electrogenic pumping of Na+ that accumulated in the diffusion-restricted space during pump inhibition in K+-free extracellular solution. However, there are no known physical barriers that account for such restricted Na+ diffusion, and we examined if changes of activity of the Na+-K+ pump itself cause the transient peak current. Reexposure to K+ reproduced a transient current beyond steady state in voltage-clamped ventricular myocytes as reported by others. Persistence of it when the Na+ concentration in patch pipette solutions perfusing the intracellular compartment was high and elimination of it with K+-free pipette solution could not be reconciled with restricted subsarcolemmal Na+ diffusion. The pattern of the transient current early after pump activation was dependent on transmembrane Na+- and K+ concentration gradients suggesting the currents were related to the conformational poise imposed on the pump. We examined if the currents might be accounted for by changes in glutathionylation of the β1 Na+-K+ pump subunit, a reversible oxidative modification that inhibits the pump. Susceptibility of the β1 subunit to glutathionylation depends on the conformational poise of the Na+-K+ pump, and glutathionylation with the pump stabilized in conformations equivalent to those expected to be imposed on voltage-clamped myocytes supported this hypothesis. So did elimination of the transient K+-induced peak Na+-K+ pump current when we included glutaredoxin 1 in patch pipette solutions to reverse glutathionylation. We conclude that transient K+-induced peak Na+-K+ pump current reflects the effect of conformation-dependent β1 pump subunit

  17. Glutathionylation-Dependence of Na(+)-K(+)-Pump Currents Can Mimic Reduced Subsarcolemmal Na(+) Diffusion.

    Science.gov (United States)

    Garcia, Alvaro; Liu, Chia-Chi; Cornelius, Flemming; Clarke, Ronald J; Rasmussen, Helge H

    2016-03-08

    The existence of a subsarcolemmal space with restricted diffusion for Na(+) in cardiac myocytes has been inferred from a transient peak electrogenic Na(+)-K(+) pump current beyond steady state on reexposure of myocytes to K(+) after a period of exposure to K(+)-free extracellular solution. The transient peak current is attributed to enhanced electrogenic pumping of Na(+) that accumulated in the diffusion-restricted space during pump inhibition in K(+)-free extracellular solution. However, there are no known physical barriers that account for such restricted Na(+) diffusion, and we examined if changes of activity of the Na(+)-K(+) pump itself cause the transient peak current. Reexposure to K(+) reproduced a transient current beyond steady state in voltage-clamped ventricular myocytes as reported by others. Persistence of it when the Na(+) concentration in patch pipette solutions perfusing the intracellular compartment was high and elimination of it with K(+)-free pipette solution could not be reconciled with restricted subsarcolemmal Na(+) diffusion. The pattern of the transient current early after pump activation was dependent on transmembrane Na(+)- and K(+) concentration gradients suggesting the currents were related to the conformational poise imposed on the pump. We examined if the currents might be accounted for by changes in glutathionylation of the β1 Na(+)-K(+) pump subunit, a reversible oxidative modification that inhibits the pump. Susceptibility of the β1 subunit to glutathionylation depends on the conformational poise of the Na(+)-K(+) pump, and glutathionylation with the pump stabilized in conformations equivalent to those expected to be imposed on voltage-clamped myocytes supported this hypothesis. So did elimination of the transient K(+)-induced peak Na(+)-K(+) pump current when we included glutaredoxin 1 in patch pipette solutions to reverse glutathionylation. We conclude that transient K(+)-induced peak Na(+)-K(+) pump current reflects the effect

  18. Functional domains of plant chimeric calcium/calmodulin-dependent protein kinase: regulation by autoinhibitory and visinin-like domains

    Science.gov (United States)

    Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.

    1997-01-01

    A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.

  19. Gas stream analysis using voltage-current time differential operation of electrochemical sensors

    Science.gov (United States)

    Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay; Wang, Gangqiang; Henderson, Brett Tamatea; Lourdhusamy, Anthoniraj; Steppan, James John; Allmendinger, Klaus Karl

    2018-01-02

    A method for analysis of a gas stream. The method includes identifying an affected region of an affected waveform signal corresponding to at least one characteristic of the gas stream. The method also includes calculating a voltage-current time differential between the affected region of the affected waveform signal and a corresponding region of an original waveform signal. The affected region and the corresponding region of the waveform signals have a sensitivity specific to the at least one characteristic of the gas stream. The method also includes generating a value for the at least one characteristic of the gas stream based on the calculated voltage-current time differential.

  20. Evidence for a possible calcium flux dependent cardiomyopathy in hyperthyroidism

    International Nuclear Information System (INIS)

    Barat, J.L.; Wicker, P.; Manley, W.

    1985-01-01

    This study was designed to test the hypothesis that the impaired functional cardiac reserve to exercise in hyperthyroidism is related to alterations in the regulation of calcium transport. In 2l hyperthyroid patients, the left ventricular ejection fraction (LVEF) was measured using equilibrium gated radionuclide angiocardiography at rest and during supine dynamic exercise. After a recovery period, the patients performed a second exercise study after random administration of Verapamil, a calcium entry blocker (11 pts), or propanolol, a beta adrenergic antagonist (10 pts) for comparison. The results showed i) normal resting LVEF with no significant change during exercise before any medication, ii) resting LVEF significantly decreased after Propanolol, and no significantly changed after Verapamil, iii) during exercise, significant increase of LVEF after Verapamil, and no significant change after Propanolol. These results are consistent with previous studies showing that abnormal change in LVEF during exercise in hyperthyroidism seems independent of beta adrenergic activation, and suggest a reversible functional cardiomyopathy dependent of calcium transporting systems

  1. Evidence for a possible calcium flux dependent cardiomyopathy in hyperthyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Barat, J.L.; Wicker, P.; Manley, W.; Brendel, A.J.; Lefort, G.; San Galli, F.; Commenges-Ducos, M.; Latapie, J.L.; Riviere, J.; Ducassou, D.

    1985-05-01

    This study was designed to test the hypothesis that the impaired functional cardiac reserve to exercise in hyperthyroidism is related to alterations in the regulation of calcium transport. In 2l hyperthyroid patients, the left ventricular ejection fraction (LVEF) was measured using equilibrium gated radionuclide angiocardiography at rest and during supine dynamic exercise. After a recovery period, the patients performed a second exercise study after random administration of Verapamil, a calcium entry blocker (11 pts), or propanolol, a beta adrenergic antagonist (10 pts) for comparison. The results showed i) normal resting LVEF with no significant change during exercise before any medication, ii) resting LVEF significantly decreased after Propanolol, and no significantly changed after Verapamil, iii) during exercise, significant increase of LVEF after Verapamil, and no significant change after Propanolol. These results are consistent with previous studies showing that abnormal change in LVEF during exercise in hyperthyroidism seems independent of beta adrenergic activation, and suggest a reversible functional cardiomyopathy dependent of calcium transporting systems.

  2. Calcium currents in a fast-twitch skeletal muscle of the rat

    OpenAIRE

    1983-01-01

    Slow ionic currents were measured in the rat omohyoid muscle with the three-microelectrode voltage-clamp technique. Sodium and delayed rectifier potassium currents were blocked pharmacologically. Under these conditions, depolarizing test pulses elicited an early outward current, followed by a transient slow inward current, followed in turn by a late outward current. The early outward current appeared to be a residual delayed rectifier current. The slow inward current was identified as a calci...

  3. Activation of a cGMP-sensitive calcium-dependent chloride channel may cause transition from calcium waves to whole-cell oscillations in smooth muscle cells

    DEFF Research Database (Denmark)

    Jacobsen, Jens Christian; Aalkjær, Christian; Nilsson, Holger

    2007-01-01

    waves sweeping through the cytoplasm when the SR is stimulated to release calcium. A rise in cyclic guanosine monophosphate (cGMP) leads to the experimentally observed transition from waves to whole-cell calcium oscillations. At the same time membrane potential starts to oscillate and the frequency...... approximately doubles. In this transition, the simulated results point to a key role for a recently discovered cGMP-sensitive calcium-dependent chloride channel. This channel depolarizes the membrane in response to calcium released from the SR. In turn, depolarization causes uniform opening of L-type calcium...... onset of oscillations in membrane potential within the individual cell may underlie sudden intercellular synchronization and the appearance of vasomotion. Key words: Vasomotion, Chloride channel, cGMP, Mathematical model, Calcium waves....

  4. Structural dynamics of the cell nucleus: basis for morphology modulation of nuclear calcium signaling and gene transcription.

    Science.gov (United States)

    Queisser, Gillian; Wiegert, Simon; Bading, Hilmar

    2011-01-01

    Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons.

  5. Current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization

    International Nuclear Information System (INIS)

    Stoyanov, D G

    2007-01-01

    The balances of particles and charges in the volume of parallel-plane ionization chamber are considered. Differential equations describing the distribution of current densities in the chamber volume are obtained. As a result of the differential equations solution an analytical form of the current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization in the volume is obtained

  6. Current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization

    Energy Technology Data Exchange (ETDEWEB)

    Stoyanov, D G [Faculty of Engineering and Pedagogy in Sliven, Technical University of Sofia, 59, Bourgasko Shaussee Blvd, 8800 Sliven (Bulgaria)

    2007-08-15

    The balances of particles and charges in the volume of parallel-plane ionization chamber are considered. Differential equations describing the distribution of current densities in the chamber volume are obtained. As a result of the differential equations solution an analytical form of the current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization in the volume is obtained.

  7. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  8. Modelling chloride penetration in concrete using electrical voltage and current approaches

    Directory of Open Access Journals (Sweden)

    Juan Lizarazo-Marriaga

    2011-03-01

    Full Text Available This paper reports a research programme aimed at giving a better understanding of the phenomena involved in the chloride penetration in cement-based materials. The general approach used was to solve the Nernst-Planck equation numerically for two physical ideal states that define the possible conditions under which chlorides will move through concrete. These conditions are named in this paper as voltage control and current control. For each condition, experiments and simulations were carried out in order to establish the importance of electrical variables such as voltage and current in modelling chloride transport in concrete. The results of experiments and simulations showed that if those electrical variables are included as key parameters in the modelling of chloride penetration through concrete, a better understanding of this complex phenomenon can be obtained.

  9. Separation of calcium isotopes by counter-current electromigration in molten salts (1962)

    International Nuclear Information System (INIS)

    Menes, F.; Dirian, G.; Roth, E.

    1962-01-01

    The method of counter-current electromigration in molten salts has been applied to calcium bromide with an alkali metal bromide added to the cathode compartment. Enrichments on calcium-46 greater than a factor of two were obtained at the anode. The mass effect was found to be about 0.06. An estimation of the cost of energy for a process based on this method has been made. (authors) [fr

  10. On the current-voltage relationship in fluid theory

    Directory of Open Access Journals (Sweden)

    P. Janhunen

    1999-01-01

    Full Text Available The kinetic theory of precipitating electrons with Maxwellian source plasma yields the well-known current-voltage relationship (CV-relationship; Knight formula, which can in most cases be accurately approximated by a reduced linear formula. Our question is whether it is possible to obtain this CV-relationship from fluid theory, and if so, to what extent it is physically equivalent with the more accurate kinetic counterpart. An answer to this question is necessary before trying to understand how one could combine time-dependent and transient phenomena such as Alfvénic waves with a slowly evolving background described by the CV-relationship. We first compute the fluid quantity profiles (density, pressure etc. along a flux tube based on kinetic theory solution. A parallel potential drop accumulates plasma (and pressure below it, which explains why the current is linearly proportional to the potential drop in the kinetic theory even though the velocity of the accelerated particles is only proportional to the square root of the accelerating voltage. Electron fluid theory reveals that the kinetic theory results can be reproduced, except for different numerical constants, if and only if the polytropic index γ is equal to three, corresponding to one-dimensional motion. The convective derivative term v·∇v provides the equivalent of the "mirror force" and is therefore important to include in a fluid theory trying to describe a CV-relationship. In one-fluid equations the parallel electric field, at least in its functional form, emerges self-consistently. We find that the electron density enhancement below the potential drop disappears because the magnetospheric ions would be unable to neutralize it, and a square root CV-relationship results, in disagreement with kinetic theory and observations. Also, the potential drop concentrates just above the ionosphere, which is at odds with observations as well. To resolve this puzzle, we show that considering

  11. On the current-voltage relationship in fluid theory

    Directory of Open Access Journals (Sweden)

    P. Janhunen

    Full Text Available The kinetic theory of precipitating electrons with Maxwellian source plasma yields the well-known current-voltage relationship (CV-relationship; Knight formula, which can in most cases be accurately approximated by a reduced linear formula. Our question is whether it is possible to obtain this CV-relationship from fluid theory, and if so, to what extent it is physically equivalent with the more accurate kinetic counterpart. An answer to this question is necessary before trying to understand how one could combine time-dependent and transient phenomena such as Alfvénic waves with a slowly evolving background described by the CV-relationship. We first compute the fluid quantity profiles (density, pressure etc. along a flux tube based on kinetic theory solution. A parallel potential drop accumulates plasma (and pressure below it, which explains why the current is linearly proportional to the potential drop in the kinetic theory even though the velocity of the accelerated particles is only proportional to the square root of the accelerating voltage. Electron fluid theory reveals that the kinetic theory results can be reproduced, except for different numerical constants, if and only if the polytropic index γ is equal to three, corresponding to one-dimensional motion. The convective derivative term v·∇v provides the equivalent of the "mirror force" and is therefore important to include in a fluid theory trying to describe a CV-relationship. In one-fluid equations the parallel electric field, at least in its functional form, emerges self-consistently. We find that the electron density enhancement below the potential drop disappears because the magnetospheric ions would be unable to neutralize it, and a square root CV-relationship results, in disagreement with kinetic theory and observations. Also, the potential drop concentrates just above the ionosphere, which is at odds with observations as well. To resolve this puzzle, we show that considering

  12. Performance and scalability of isolated DC-DC converter topologies in low voltage, high current applications

    Energy Technology Data Exchange (ETDEWEB)

    Vaisanen, V.

    2012-07-01

    Fuel cells are a promising alternative for clean and efficient energy production. A fuel cell is probably the most demanding of all distributed generation power sources. It resembles a solar cell in many ways, but sets strict limits to current ripple, common mode voltages and load variations. The typically low output voltage from the fuel cell stack needs to be boosted to a higher voltage level for grid interfacing. Due to the high electrical efficiency of the fuel cell, there is a need for high efficiency power converters, and in the case of low voltage, high current and galvanic isolation, the implementation of such converters is not a trivial task. This thesis presents galvanically isolated DC-DC converter topologies that have favorable characteristics for fuel cell usage and reviews the topologies from the viewpoint of electrical efficiency and cost efficiency. The focus is on evaluating the design issues when considering a single converter module having large current stresses. The dominating loss mechanism in low voltage, high current applications is conduction losses. In the case of MOSFETs, the conduction losses can be efficiently reduced by paralleling, but in the case of diodes, the effectiveness of paralleling depends strongly on the semiconductor material, diode parameters and output configuration. The transformer winding losses can be a major source of losses if the windings are not optimized according to the topology and the operating conditions. Transformer prototyping can be expensive and time consuming, and thus it is preferable to utilize various calculation methods during the design process in order to evaluate the performance of the transformer. This thesis reviews calculation methods for solid wire, litz wire and copper foil winding losses, and in order to evaluate the applicability of the methods, the calculations are compared against measurements and FEM simulations. By selecting a proper calculation method for each winding type, the winding

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. CURRENT-VOLTAGE CURVES FOR TREATING EFFLUENT CONTAINING HEDP: DETERMINATION OF THE LIMITING CURRENT

    Directory of Open Access Journals (Sweden)

    T. Scarazzato

    2015-12-01

    Full Text Available Abstract Membrane separation techniques have been explored for treating industrial effluents to allow water reuse and component recovery. In an electrodialysis system, concentration polarization causes undesirable alterations in the ionic transportation mechanism. The graphic construction of the current voltage curve is proposed for establishing the value of the limiting current density applied to the cell. The aim of this work was to determine the limiting current density in an electrodialysis bench stack, the function of which was the treatment of an electroplating effluent containing HEDP. For this, a system with five compartments was used with a working solution simulating the rinse waters of HEDP-based baths. The results demonstrated correlation between the regions defined by theory and the experimental data.

  15. Two ways to model voltage-current curves of adiabatic MgB2 wires

    International Nuclear Information System (INIS)

    Stenvall, A; Korpela, A; Lehtonen, J; Mikkonen, R

    2007-01-01

    Usually overheating of the sample destroys attempts to measure voltage-current curves of conduction cooled high critical current MgB 2 wires at low temperatures. Typically, when a quench occurs a wire burns out due to massive heat generation and negligible cooling. It has also been suggested that high n values measured with MgB 2 wires and coils are not an intrinsic property of the material but arise due to heating during the voltage-current measurement. In addition, quite recently low n values for MgB 2 wires have been reported. In order to find out the real properties of MgB 2 an efficient computational model is required to simulate the voltage-current measurement. In this paper we go back to basics and consider two models to couple electromagnetic and thermal phenomena. In the first model the magnetization losses are computed according to the critical state model and the flux creep losses are considered separately. In the second model the superconductor resistivity is described by the widely used power law. Then the coupled current diffusion and heat conduction equations are solved with the finite element method. In order to compare the models, example runs are carried out with an adiabatic slab. Both models produce a similar significant temperature rise near the critical current which leads to fictitiously high n values

  16. A voltage-gated calcium channel regulates lysosomal fusion with endosomes and autophagosomes and is required for neuronal homeostasis.

    Directory of Open Access Journals (Sweden)

    Xuejun Tian

    2015-03-01

    Full Text Available Autophagy helps deliver sequestered intracellular cargo to lysosomes for proteolytic degradation and thereby maintains cellular homeostasis by preventing accumulation of toxic substances in cells. In a forward mosaic screen in Drosophila designed to identify genes required for neuronal function and maintenance, we identified multiple cacophony (cac mutant alleles. They exhibit an age-dependent accumulation of autophagic vacuoles (AVs in photoreceptor terminals and eventually a degeneration of the terminals and surrounding glia. cac encodes an α1 subunit of a Drosophila voltage-gated calcium channel (VGCC that is required for synaptic vesicle fusion with the plasma membrane and neurotransmitter release. Here, we show that cac mutant photoreceptor terminals accumulate AV-lysosomal fusion intermediates, suggesting that Cac is necessary for the fusion of AVs with lysosomes, a poorly defined process. Loss of another subunit of the VGCC, α2δ or straightjacket (stj, causes phenotypes very similar to those caused by the loss of cac, indicating that the VGCC is required for AV-lysosomal fusion. The role of VGCC in AV-lysosomal fusion is evolutionarily conserved, as the loss of the mouse homologues, Cacna1a and Cacna2d2, also leads to autophagic defects in mice. Moreover, we find that CACNA1A is localized to the lysosomes and that loss of lysosomal Cacna1a in cerebellar cultured neurons leads to a failure of lysosomes to fuse with endosomes and autophagosomes. Finally, we show that the lysosomal CACNA1A but not the plasma-membrane resident CACNA1A is required for lysosomal fusion. In summary, we present a model in which the VGCC plays a role in autophagy by regulating the fusion of AVs with lysosomes through its calcium channel activity and hence functions in maintaining neuronal homeostasis.

  17. Radio frequency glow discharge source with integrated voltage and current probes used for evaluation of discharge parameters

    International Nuclear Information System (INIS)

    Wilken, L.; Hoffmann, V.; Wetzig, K.

    2006-01-01

    A radio frequency (rf) Grimm-type glow discharge source for the chemical analysis of solid samples, with integrated voltage and current probes, was developed. All elements of a plasma equivalent circuit are determined from the measured current-voltage characteristics. The procedure is based on the independent evaluation of the ion current and electron current region. The physical meaning of the parameters is investigated by comparisons with measurements from dc glow discharges. We found that the reduced rf current of the powered electrode is comparable to the reduced current in dc discharges. A formula is developed that corrects the reduced current due to gas heating. The sheath thickness at the powered rf electrode is evaluated and is between 75 and 1100 μm. The voltage of the bulk plasma is in the range 2-15 V, and the resistance is between 30 and 400 Ω. The bulk plasma consumes about 3% of the total power, and the reduced voltage is comparable to the reduced electrical field in the positive column of direct current discharges. The sheath voltage at the grounded electrode is in the range 25-100 V, the capacities are between 10 and 400 pF, and the resistances are in the range 100 Ω-5000 Ω. We also found invariants for the evaluated sheath parameters

  18. Cathode voltage and discharge current oscillations in HiPIMS

    Czech Academy of Sciences Publication Activity Database

    Klein, P.; Hnilica, J.; Hubička, Zdeněk; Čada, Martin; Šlapanská, M.; Zemánek, M.; Vašina, P.

    2017-01-01

    Roč. 26, č. 5 (2017), s. 1-12, č. článku 055015. ISSN 0963-0252 R&D Projects: GA ČR(CZ) GA15-00863S Institutional support: RVO:68378271 Keywords : HiPIMS * voltage and current oscillations * spokes Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 3.302, year: 2016

  19. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  20. A FAST study of quasi-static structure ("Inverted-V") potential drops and their latitudinal dependence in the premidnight sector and ramifications for the current-voltage relationship

    Science.gov (United States)

    Dombeck, J.; Cattell, C.; McFadden, J.

    2013-09-01

    Utilizing FAST satellite electron measurements, we present the first reported investigation of the dependency on latitude of quasi-static structure ("inverted-V") potential drop magnitude (Φ). A trend of lower Φ at lower latitudes in the premidnight sector on field lines with dark foot points was observed. This trend is supported both statistically and in individual satellite crossings. The existence of two distinct peaks in occurrence probability for Φ was also observed: one between ~2 kV and 10 kV and the other at somewhat less than 1 kV. The relative occurrence of structures with Φ in the higher (>2 kV) peak is significantly reduced with decreasing latitude. This partially accounts for the statistical trend of lower potential drop magnitudes at lower latitudes. The two Φ occurrence frequency peaks correspond to two different regimes (one with eΦ/kTe ~ or > 1 and one with eΦ/kTe current-voltage relation where source electron density rather than Φ is most directly controlled by the field-aligned current density. These observations and their ramifications represent a significant step forward in the understanding of field-aligned currents, auroral acceleration, and magnetospheric-ionospheric coupling.

  1. An Annotated Bibliography of High-Voltage Direct-Current Transmission and Flexible AC Transmission (FACTS) Devices, 1991-1993.

    Energy Technology Data Exchange (ETDEWEB)

    Litzenberger, Wayne; Lava, Val

    1994-08-01

    References are contained for HVDC systems, converter stations and components, overhead transmission lines, cable transmission, system design and operations, simulation of high voltage direct current systems, high-voltage direct current installations, and flexible AC transmission system (FACTS).

  2. Photonic characterization of capacitance-voltage characteristics in MOS capacitors and current-voltage characteristics in MOSFETs

    International Nuclear Information System (INIS)

    Kim, H. C.; Kim, H. T.; Cho, S. D.; Song, S. J.; Kim, Y. C.; Kim, S. K.; Chi, S. S.; Kim, D. J.; Kim, D. M.

    2002-01-01

    Based on the photonic high-frequency capacitance-voltage (HF-CV) response of MOS capacitors, a new characterization method is reported for the analysis of interface states in MOS systems. An optical source with a photonic energy less than the silicon band-gap energy (hv g ) is employed for the photonic HF-CV characterization of interface states distributed in the photoresponsive energy band (E C - hv t C ). If a uniform distribution of trap levels is assumed, the density of interface states (D it ) in the photoresponsive energy band of MOS capacitors, characterized by the new photonic HF-CV method, was observed to be D it = 1 ∼ 5 x 10 11 eV -1 cm -2 . Photonic current-voltage characteristics (I D - V GS , V DS ) of MOSFETs, which are under control of the photoconductive and the photovoltaic effects, are also investigated under optical illumination

  3. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

    Science.gov (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

    2010-01-01

    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  5. Activation of a cGMP-sensitive calcium-dependent chloride channel may cause transition from calcium waves to whole-cell oscillations in smooth muscle cells

    DEFF Research Database (Denmark)

    Jacobsen, Jens Christian; Aalkjær, Christian; Nilsson, Holger

    2007-01-01

    approximately doubles. In this transition, the simulated results point to a key role for a recently discovered cGMP-sensitive calcium-dependent chloride channel. This channel depolarizes the membrane in response to calcium released from the SR. In turn, depolarization causes uniform opening of L-type calcium...... channels on the cell surface stimulating synchronized release of SR-calcium and inducing the shift from waves to whole-cell oscillations. The effect of the channel is therefore to couple the processes of the SR with those of the membrane. We hypothesize that the shift in oscillatory mode and the associated...

  6. The nonideality coefficient of current-voltage characteristics for p-n junctions in a high ultrahigh-frequency (microwave) field

    International Nuclear Information System (INIS)

    Shamirzaev, S. H.; Gulyamov, G.; Dadamirzaev, M. G.; Gulyamov, A. G.

    2009-01-01

    The effect of heating of electrons and holes on the nonideality coefficient of the current-voltage characteristic for a p-n junction in a high microwave field is studied. It is established that the nonideality coefficient for a diode depends on the type of charge carriers that make the major contribution to the current in the p-n junction. It is shown that, in some cases in silicon samples, the nonideality coefficient for the diode is governed by the temperature for holes in spite of the fact that the temperature for electrons is higher than the temperature for holes.

  7. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Directory of Open Access Journals (Sweden)

    R. N. Bhowmik

    2015-06-01

    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  8. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Science.gov (United States)

    Bhowmik, R. N.; Vijayasri, G.

    2015-06-01

    We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  9. Nonlinear current-voltage characteristics of WO3-x nano-/micro-rods

    Science.gov (United States)

    Shen, Zhenguang; Peng, Zhijian; Zhao, Zengying; Fu, Xiuli

    2018-04-01

    A series of crystalline tungsten oxide nano-/micro-rods with different compositions of WO3, WO2.90, W19O55 (WO2.89) and W18O49 (WO2.72) but identical morphology feature were first prepared. Then, various nanoscaled electrical devices were fabricated from them by micro-fabrication through a focused ion beam technique. Interestingly, the devices from the oxygen-deficient WO3-x display significantly nonlinear current-voltage characteristics. The calculated nonlinear coefficients of the WO2.90, WO2.83, and WO2.72 varistors are 2.52, 3.32 and 4.91, respectively. The breakdown voltage of the WO2.90, WO2.83, and WO2.72 varistors are 1.93, 1.28 and 0.93 V, respectively. Such WO3-x nano-varistors might be promising for low-voltage electrical/electronic devices.

  10. Inhibition of parathyroid hormone release by maitotoxin, a calcium channel activator

    International Nuclear Information System (INIS)

    Fitzpatrick, L.A.; Yasumoto, T.; Aurbach, G.D.

    1989-01-01

    Maitotoxin, a toxin derived from a marine dinoflagellate, is a potent activator of voltage-sensitive calcium channels. To further test the hypothesis that inhibition of PTH secretion by calcium is mediated via a calcium channel we studied the effect of maitotoxin on dispersed bovine parathyroid cells. Maitotoxin inhibited PTH release in a dose-dependent fashion, and inhibition was maximal at 1 ng/ml. Chelation of extracellular calcium by EGTA blocked the inhibition of PTH by maitotoxin. Maitotoxin enhanced the effects of the dihydropyridine calcium channel agonist (+)202-791 and increased the rate of radiocalcium uptake in parathyroid cells. Pertussis toxin, which ADP-ribosylates and inactivates a guanine nucleotide regulatory protein that interacts with calcium channels in the parathyroid cell, did not affect the inhibition of PTH secretion by maitotoxin. Maitotoxin, by its action on calcium channels allows entry of extracellular calcium and inhibits PTH release. Our results suggest that calcium channels are involved in the release of PTH. Inhibition of PTH release by maitotoxin is not sensitive to pertussis toxin, suggesting that maitotoxin may act distal to the site interacting with a guanine nucleotide regulatory protein, or maitotoxin could interact with other ions or second messengers to inhibit PTH release

  11. Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

    Science.gov (United States)

    Masetto, S; Weng, T; Valli, P; Correia, M J

    1999-06-23

    Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

  12. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. Mitigation of Grid-Current Distortion for LCL-Filtered Voltage-Source Inverter with Inverter-Current Feedback Control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2018-01-01

    harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...

  14. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

    2010-01-01

    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  15. The Effect of Current-Limiting Reactors on the Tripping of Short Circuits in High-Voltage Electrical Equipment

    International Nuclear Information System (INIS)

    Volkov, M. S.; Gusev, Yu. P.; Monakov, Yu. V.; Cho, Gvan Chun

    2016-01-01

    The insertion of current-limiting reactors into electrical equipment operating at a voltage of 110 and 220 kV produces a change in the parameters of the transient recovery voltages at the contacts of the circuit breakers for disconnecting short circuits, which could be the reason for the increase in the duration of the short circuit, damage to the electrical equipment and losses in the power system. The results of mathematical modeling of the transients, caused by tripping of the short circuit in a reactive electric power transmission line are presented, and data are given on the negative effect of a current-limiting resistor on the rate of increase and peak value of the transient recovery voltages. Methods of ensuring the standard requirements imposed on the parameters of the transient recovery voltages when using current-limiting reactors in the high-voltage electrical equipment of power plants and substations are proposed and analyzed

  16. The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma

    International Nuclear Information System (INIS)

    Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.

    2006-01-01

    The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)

  17. Performance of unified power quality conditioner (UPQC) based on fuzzy controller for attenuating of voltage and current harmonics

    Science.gov (United States)

    Milood Almelian, Mohamad; Mohd, Izzeldin I.; Asghaiyer Omran, Mohamed; Ullah Sheikh, Usman

    2018-04-01

    Power quality-related issues such as current and voltage distortions can adversely affect home and industrial appliances. Although several conventional techniques such as the use of passive and active filters have been developed to increase power quality standards, these methods have challenges and are inadequate due to the increasing number of applications. The Unified Power Quality Conditioner (UPQC) is a modern strategy towards correcting the imperfections of voltage and load current supply. A UPQC is a combination of both series and shunt active power filters in a back-to-back manner with a common DC link capacitor. The control of the voltage of the DC link capacitor is important in achieving a desired UPQC performance. In this paper, the UPQC with a Fuzzy logic controller (FLC) was used to precisely eliminate the imperfections of voltage and current harmonics. The results of the simulation studies using MATLAB/Simulink and Simpower system programming for R-L load associated through an uncontrolled bridge rectifier was used to assess the execution process. The UPQC with FLC was simulated for a system with distorted load current and a system with distorted source voltage and load current. The outcome of the comparison of %THD in the load current and source voltage before and after using UPQC for the two cases was presented.

  18. Coordinated control for low voltage ride-through of a PMSG-based wind power plant

    Directory of Open Access Journals (Sweden)

    Khagendra Thapa

    2016-01-01

    Full Text Available Wind turbine generators should be kept connected to a power grid, while supporting the voltage recovery in the case of a grid fault to meet low voltage ride-through requirement in some grid codes. This paper proposes a coordinated control scheme that prevents the increase in the DC-link voltage by reducing the active power in the machine side converter of permanent magnet synchronous generators (PMSGs in proportion to the voltage dip at the terminal of PMSGs. The proposed scheme changes the current priorities from the active current to the reactive current to inject more reactive power for a severe fault depending on the voltage dip. In addition, the grid-side converter operates in a voltage control mode with the slope, which is the ratio of reactive current capability to the voltage tolerance around a rated value. Moreover, during the fault, the slope is changed depending on the voltage dip to inject more reactive current. The performance of the proposed scheme is validated for a wind power plant consisting of 20 units of 5-MW PMSGs using an EMTP-RV simulator. The results demonstrate that the scheme enables the PMSGs not only to survive during the fault, but also to provide a dynamic reactive power support.

  19. Temperature dependent current-voltage characteristics of Au/n-Si Schottky barrier diodes and the effect of transition metal oxides as an interface layer

    Science.gov (United States)

    Mahato, Somnath; Puigdollers, Joaquim

    2018-02-01

    Temperature dependent current-voltage (I‒V) characteristics of Au/n-type silicon (n-Si) Schottky barrier diodes have been investigated. Three transition metal oxides (TMO) are used as an interface layer between gold and silicon. The basic Schottky diode parameters such as ideality factor (n), barrier height (ϕb 0) and series resistance (Rs) are calculated and successfully explained by the thermionic emission (TE) theory. It has been found that ideality factor decreased and barrier height increased with increased of temperature. The conventional Richardson plot of ln(I0/T2) vs. 1000/T is determined the activation energy (Ea) and Richardson constant (A*). Whereas value of 'A*' is much smaller than the known theoretical value of n-type Si. The temperature dependent I-V characteristics obtained the mean value of barrier height (ϕb 0 bar) and standard deviation (σs) from the linear plot of ϕap vs. 1000/T. From the modified Richardson plot of ln(I0/T2) ˗ (qσ)2/2(kT)2 vs. 1000/T gives Richardson constant and homogeneous barrier height of Schottky diodes. Main observation in this present work is the barrier height and ideality factor shows a considerable change but the series resistance value exhibits negligible change due to TMO as an interface layer.

  20. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  1. Induction of divalent cation permeability by heterologous expression of a voltage sensor domain.

    Science.gov (United States)

    Arima, Hiroki; Tsutsui, Hidekazu; Sakamoto, Ayako; Yoshida, Manabu; Okamura, Yasushi

    2018-01-06

    The voltage sensor domain (VSD) is a protein domain that confers sensitivity to membrane potential in voltage-gated ion channels as well as the voltage-sensing phosphatase. Although VSDs have long been considered to function as regulatory units acting on adjacent effectors, recent studies have revealed the existence of direct ion permeation paths in some mutated VSDs and in the voltage-gated proton channel. In this study, we show that calcium currents are evoked upon membrane hyperpolarization in cells expressing a VSD derived from an ascidian voltage-gated ion channel superfamily. Unlike the previously reported omega-pore in the Shaker K + channel and rNav1.4, mutations are not required. From electrophysiological experiments in heterologous expression systems, we found that the conductance is directly mediated by the VSD itself and is carried by both monovalent and divalent cations. This is the first report of divalent cation permeation through a VSD-like structure. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Research of the voltage and current stabilization processes by using the silicon field-effect transistor

    International Nuclear Information System (INIS)

    Karimov, A.V.; Yodgorova, D.M.; Kamanov, B.M.; Giyasova, F.A.; Yakudov, A.A.

    2012-01-01

    The silicon field-effect transistors were investigated to use in circuits for stabilization of current and voltage. As in gallium arsenide field-effect transistors, in silicon field-effect transistors with p-n-junction a new mechanism of saturation of the drain current is experimentally found out due to both transverse and longitudinal compression of channel by additional resistance between the source and the gate of the transistor. The criteria for evaluating the coefficients of stabilization of transient current suppressors and voltage stabilizator based on the field-effect transistor are considered. (authors)

  3. Single cell wound generates electric current circuit and cell membrane potential variations that requires calcium influx.

    Science.gov (United States)

    Luxardi, Guillaume; Reid, Brian; Maillard, Pauline; Zhao, Min

    2014-07-24

    Breaching of the cell membrane is one of the earliest and most common causes of cell injury, tissue damage, and disease. If the compromise in cell membrane is not repaired quickly, irreversible cell damage, cell death and defective organ functions will result. It is therefore fundamentally important to efficiently repair damage to the cell membrane. While the molecular aspects of single cell wound healing are starting to be deciphered, its bio-physical counterpart has been poorly investigated. Using Xenopus laevis oocytes as a model for single cell wound healing, we describe the temporal and spatial dynamics of the wound electric current circuitry and the temporal dynamics of cell membrane potential variation. In addition, we show the role of calcium influx in controlling electric current circuitry and cell membrane potential variations. (i) Upon wounding a single cell: an inward electric current appears at the wound center while an outward electric current is observed at its sides, illustrating the wound electric current circuitry; the cell membrane is depolarized; calcium flows into the cell. (ii) During cell membrane re-sealing: the wound center current density is maintained for a few minutes before decreasing; the cell membrane gradually re-polarizes; calcium flow into the cell drops. (iii) In conclusion, calcium influx is required for the formation and maintenance of the wound electric current circuitry, for cell membrane re-polarization and for wound healing.

  4. Radiation effects on the current-voltage and capacitance-voltage characteristics of advanced p-n junction diodes surrounded by shallow trench isolation

    International Nuclear Information System (INIS)

    Poyai, A.; Simoen, E.; Claeys, C.; Hayama, K.; Kobayashi, K.; Ohyama, H.

    2002-01-01

    This paper investigates the impact of 20 MeV proton irradiation on the current-voltage (I-V) and capacitance-voltage (C-V) characteristics of different geometry n + -p-well junction diodes surrounded by shallow trench isolation and processed in a 0.18 μm CMOS technology. From I-V characteristics, a higher current damage coefficient was found for the bulk than for the peripheral component. The radiation-induced boron de-activation resulted in a lowering of the p-well doping, which has been derived from high-frequency C-V measurements. This was confirmed by deep level transient spectroscopy (DLTS) analysis, revealing the presence of interstitial boron related radiation defects. As will be demonstrated for the bulk leakage-current damage coefficient, the electric field enhanced generation rate of charge carriers and the radiation-induced boron de-activation should be accounted for properly

  5. Calcium regulates caveolin-1 expression at the transcriptional level

    International Nuclear Information System (INIS)

    Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

    2012-01-01

    Highlights: ► Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. ► An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. ► Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. ► Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca 2+ /calcineurin/NFAT.

  6. The effects of 3,4-methylenedioxymethamphetamine (MDMA) on nicotinic receptors: Intracellular calcium increase, calpain/caspase 3 activation, and functional upregulation

    International Nuclear Information System (INIS)

    Garcia-Rates, Sara; Camarasa, Jordi; Sanchez-Garcia, Ana I.; Gandia, Luis; Escubedo, Elena; Pubill, David

    2010-01-01

    Previous work by our group demonstrated that homomeric α7 nicotinic acetylcholine receptors (nAChR) play a role in the neurotoxicity induced by 3,4-methylenedioxymethamphetamine (MDMA), as well as the binding affinity of this drug to these receptors. Here we studied the effect of MDMA on the activation of nAChR subtypes, the consequent calcium mobilization, and calpain/caspase 3 activation because prolonged Ca 2+ increase could contribute to cytotoxicity. As techniques, we used fluorimetry in Fluo-4-loaded PC12 cells and electrophysiology in Xenopus oocytes. MDMA produced a rapid and sustained increase in calcium without reaching the maximum effect induced by ACh. It also concentration-dependently inhibited the response induced by ACh, nicotine, and the specific α7 agonist PNU 282987 with IC 50 values in the low micromolar range. Similarly, MDMA induced inward currents in Xenopus oocytes transfected with human α7 but not with α4β2 nAChR and inhibited ACh-induced currents in both receptors in a concentration-dependent manner. The calcium response was inhibited by methyllycaconitine (MLA) and α-bungarotoxin but not by dihydro-β-erythroidine. These results therefore indicate that MDMA acts as a partial agonist on α7 nAChRs and as an antagonist on the heteromeric subtypes. Subsequently, calcium-induced Ca 2+ release from the endoplasmic reticulum and entry through voltage-operated calcium channels are also implicated as proved using specific antagonists. In addition, treatment with MDMA for 24 h significantly increased basal Ca 2+ levels and induced an increase in α-spectrin breakdown products, which indicates that calpain and caspase 3 were activated. These effects were inhibited by pretreatment with MLA. Moreover, pretreatment with MDMA induced functional upregulation of calcium responses to specific agonists of both heteromeric and α7 nAChR. Sustained calcium entry and calpain activation could favor the activation of Ca 2+ -dependent enzymes such as

  7. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  8. Plug-and-Play Voltage/Current Stabilization DC Microgrid Clusters with Grid-Forming/Feeding Converters

    DEFF Research Database (Denmark)

    Han, Renke; Tucci, Michele; Martinelli, Andrea

    2018-01-01

    In this paper, we propose a new decentralized control scheme for Microgrid (MG) clusters, given by the interconnection of atomic dc MGs, each composed by grid-forming and grid-feeding converters. In particular, we develop a new Plug-and-Play (PnP) voltage/current controller for each MG in order...... to achieve simultaneous voltage support and current feeding function with local references. The coefficients of each stabilizing controller are characterized by explicit inequalities, which are related only to local electrical parameters of the MG. With the proposed controller, each MG can plug...

  9. High voltage power supplies for ITER RF heating and current drive systems

    International Nuclear Information System (INIS)

    Gassmann, T.; Arambhadiya, B.; Beaumont, B.; Baruah, U.K.; Bonicelli, T.; Darbos, C.; Purohit, D.; Decamps, H.; Albajar, F.; Gandini, F.; Henderson, M.; Kazarian, F.; Lamalle, P.U.; Omori, T.; Parmar, D.; Patel, A.; Rathi, D.; Singh, N.P.

    2011-01-01

    The RF heating and current drive (H and CD) systems to be installed for the ITER fusion machine are the electron cyclotron (EC), ion cyclotron (IC) and, although not in the first phase of the project, lower hybrid (LH). These systems require high voltage, high current power supplies (HVPS) in CW operation. These HVPS should deliver around 50 MW electrical power to each of the RF H and CD systems with stringent requirements in terms of accuracy, voltage ripple, response time, turn off time and fault energy. The PSM (Pulse Step Modulation) technology has demonstrated over the past 20 years its ability to fulfill these requirements in many industrial facilities and other fusion reactors and has therefore been chosen as reference design for the IC and EC HVPS systems. This paper describes the technical specifications, including interfaces, the resulting constraints on the design, the conceptual design proposed for ITER EC and IC HVPS systems and the current status.

  10. Investigation of calcium-dependent activity and conformational dynamics of zebra fish 12-lipoxygenase.

    Science.gov (United States)

    Mittal, Monica; Hasan, Mahmudul; Balagunaseelan, Navisraj; Fauland, Alexander; Wheelock, Craig; Rådmark, Olof; Haeggström, Jesper Z; Rinaldo-Matthis, Agnes

    2017-08-01

    A 12-lipoxygenase in zebra fish (zf12-LOX) was found to be required for normal embryonic development and LOXs are of great interest for targeted drug designing. In this study, we investigate the structural-functional aspects of zf12-LOX in response to calcium. A soluble version of zf12-LOX was created by mutagenesis. Based on multiple sequence alignment, we mutated the putative calcium-responsive amino acids in N-PLAT domain of soluble zf12-LOX. Using a series of biophysical methods, we ascertained the oligomeric state, stability, structural integrity and conformational changes of zf12-LOX in response to calcium. We also compared the biophysical properties of soluble zf12-LOX with the mutant in the absence and presence of calcium. Here we provide a detailed characterization of soluble zf12-LOX and the mutant. Both proteins exist as compact monomers in solution, however the enzyme activity of soluble zf12-LOX is significantly increased in presence of calcium. We find that the stimulatory effect of calcium on zf12-LOX is related to a change in protein structure as observed by SAXS, adopting an open-state. In contrast, enzyme with a mutated calcium regulatory site has reduced activity-response to calcium and restricted large re-modeling, suggesting that it retains a closed-state in response to calcium. Taken together, our study suggests that Ca 2+ -dependent regulation is associated with different domain conformation(s) that might change the accessibility to substrate-binding site in response to calcium. The study can be broadly implicated in better understanding the mode(s) of action of LOXs, and the enzymes regulated by calcium in general. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Development of a prototype solid state fault current limiting and interrupting device for low voltage distribution networks.

    OpenAIRE

    Ahmed, M.; Putrus, G. A.; Ran, L.; Penlington, R.

    2006-01-01

    This paper describes the development of a solid-state Fault Current Limiting and Interrupting Device (FCLID) suitable for low voltage distribution networks. The main components of the FCLID are a bidirectional semiconductor switch that can disrupt the short-circuit current, and a voltage clamping element that helps in controlling the current and absorbing the inductive energy stored in the network during current interruption. Using a hysteresis type control algorithm, the short-circuit curren...

  12. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  13. MAGY: An innovative high voltage-low current power supply for gyrotron

    International Nuclear Information System (INIS)

    Siravo, Ugo; Alex, Juergen; Bader, Michael; Carpita, Mauro; Fasel, Damien; Gavin, Serge; Perez, Albert

    2011-01-01

    From the electrical point of view, the body and the anode of high power gyrotrons behave as capacitive loads. A highly dynamic power supply is, therefore, hard to achieve. The MAGY concept (Modulator for the Anode of a triode type GYrotron) embodies an innovative solution to manage the capacitive current ensuring a very low ripple on the output voltage. It consists of a series of independent, bi-directional and regulated DC sources. Compared to existing topologies, this solution requires a smaller number of power modules. It avoids internal high frequency modulation and simultaneously offers high resolution of the output voltage and a wide range of operating scenarios.

  14. Magnetic field dependence of the current flowing in the spin-coated chlorophyll thin films

    Science.gov (United States)

    Aji, J. R. P.; Kusumandari; Purnama, B.

    2018-03-01

    The magnetic dependence of the current flowing in the spin coated chlorophyll films on a patterned Cu PCB substrate has been presented. Chlorophyll was isolated from Spirulina sp and deposited by spin coated methods. The reducing of current by the change of magnetic field (magneto conductance effect) was performed by inducing the magnetic field parallel to the inplane of film at room temp. The magnetoconductance ratio decreases as the increase of voltage. It was indicated that the origin of carrier charge in chlorophyll films should be different with the carrier charge injection (electron).

  15. Estimating the biophysical properties of neurons with intracellular calcium dynamics.

    Science.gov (United States)

    Ye, Jingxin; Rozdeba, Paul J; Morone, Uriel I; Daou, Arij; Abarbanel, Henry D I

    2014-06-01

    We investigate the dynamics of a conductance-based neuron model coupled to a model of intracellular calcium uptake and release by the endoplasmic reticulum. The intracellular calcium dynamics occur on a time scale that is orders of magnitude slower than voltage spiking behavior. Coupling these mechanisms sets the stage for the appearance of chaotic dynamics, which we observe within certain ranges of model parameter values. We then explore the question of whether one can, using observed voltage data alone, estimate the states and parameters of the voltage plus calcium (V+Ca) dynamics model. We find the answer is negative. Indeed, we show that voltage plus another observed quantity must be known to allow the estimation to be accurate. We show that observing both the voltage time course V(t) and the intracellular Ca time course will permit accurate estimation, and from the estimated model state, accurate prediction after observations are completed. This sets the stage for how one will be able to use a more detailed model of V+Ca dynamics in neuron activity in the analysis of experimental data on individual neurons as well as functional networks in which the nodes (neurons) have these biophysical properties.

  16. A novel current mode controller for a static compensator utilizing Goertzel algorithm to mitigate voltage sags

    International Nuclear Information System (INIS)

    Najafi, E.; Yatim, A.H.M.

    2011-01-01

    Research highlights: → We proposed a new current control method for STATCOM. → The current control method maintains a fixed switching frequency. → It also produces fewer harmonics compared to conventional hysteresis method. → A new voltage dip (sag) detection method was used in STATCOM. → The control method can mitigate voltage sag in each phase separately. -- Abstract: Static compensator (STATCOM) has been widely proposed for power quality and network stability improvement. It is easily connected in parallel to the electric network and has many advantages for electrical grids. It can improve network stability; power factor, power transfer rating and can avoid some disturbances such as sags and swells. Most of STATCOM controllers are based on voltage controllers that are based on balanced d-q transform. However, they are not thorough solutions for network disturbances since in most cases single-phase disturbances occur in electrical networks that cannot be avoided by the conventional controllers. Voltage mode controllers are also not capable of responding fast enough to the changes expected of a network system. This paper proposes a new current mode controller to overcome the mentioned problem. The approach uses a fixed frequency current controller to maintain voltage levels in voltage sags (dips). This approach is also simple and can be easily implemented by digitally. It has superior performance over conventional methods in terms of harmonic reduction in STATCOM output current. Another important factor for STATCOM effectiveness in sag mitigation is its sag detection method. This paper also introduces a new sag detection method based on Goertzel algorithm which is both effective and simple for practical applications. The simulation results presented illustrate the superiority of the proposed controller and sag detection algorithm to be utilized in the STATCOM.

  17. Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro

    International Nuclear Information System (INIS)

    Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.

    1989-01-01

    The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)

  18. The Marine Guanidine Alkaloid Crambescidin 816 Induces Calcium Influx and Cytotoxicity in Primary Cultures of Cortical Neurons through Glutamate Receptors.

    Science.gov (United States)

    Mendez, Aida G; Juncal, Andrea Boente; Silva, Siguara B L; Thomas, Olivier P; Martín Vázquez, Víctor; Alfonso, Amparo; Vieytes, Mercedes R; Vale, Carmen; Botana, Luís M

    2017-07-19

    Crambescidin 816 is a guanidine alkaloid produced by the sponge Crambe crambe with known antitumoral activity. While the information describing the effects of this alkaloid in central neurons is scarce, Cramb816 is known to block voltage dependent calcium channels being selective for L-type channels. Moreover, Cramb816 reduced neuronal viability through an unknown mechanism. Here, we aimed to describe the toxic activity of Cramb816 in cortical neurons. Since calcium influx is considered the main mechanism responsible for neuronal cell death, the effects of Cramb816 in the cytosolic calcium concentration of cortical neurons were studied. The alkaloid decreased neuronal viability and induced a dose-dependent increase in cytosolic calcium that was also related to the presence of calcium in the extracellular media. The increase in calcium influx was age dependent, being higher in younger neurons. Moreover, this effect was prevented by glutamate receptor antagonists, which did not fully block the cytotoxic effect of Cramb816 after 24 h of treatment but completely prevented Cramb816 cytotoxicity after 10 min exposure. Therefore, the findings presented herein provide new insights into the cytotoxic effect of Cramb816 in cortical neurons.

  19. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  20. Current-Voltage Characteristics of DC Discharge in Micro Gas Jet Injected into Vacuum Environment

    International Nuclear Information System (INIS)

    Matra, K; Furuta, H; Hatta, A

    2013-01-01

    A current-voltage characteristic of direct current (DC) gas discharge operated in a micro gas jet injected into a secondary electron microscope (SEM) chamber is presented. Ar gas was injected through a 30 μm orifice gas nozzle (OGN) and was evacuated by an additional pump to keep the high vacuum environment. Gas discharges were ignited between the OGN as anode and a counter electrode of Si wafer. The discharge was self-pulsating in most of the cases while it was stable at lower pressure, larger gap length, and larger time averaged current. The self-pulsating discharge was oscillated by the RC circuit consisting of a stray capacitor and a large ballast resistor. The real time plots of voltage and current during the pulsating was investigated using a discharge model.

  1. Paclitaxel Induces Apoptosis in Breast Cancer Cells through Different Calcium—Regulating Mechanisms Depending on External Calcium Conditions

    Science.gov (United States)

    Pan, Zhi; Avila, Andrew; Gollahon, Lauren

    2014-01-01

    Previously, we reported that endoplasmic reticulum calcium stores were a direct target for paclitaxel initiation of apoptosis. Furthermore, the actions of paclitaxel attenuated Bcl-2 resistance to apoptosis through endoplasmic reticulum-mediated calcium release. To better understand the calcium-regulated mechanisms of paclitaxel-induced apoptosis in breast cancer cells, we investigated the role of extracellular calcium, specifically; whether influx of extracellular calcium contributed to and/or was necessary for paclitaxel-induced apoptosis. Our results demonstrated that paclitaxel induced extracellular calcium influx. This mobilization of extracellular calcium contributed to subsequent cytosolic calcium elevation differently, depending on dosage. Under normal extracellular calcium conditions, high dose paclitaxel induced apoptosis-promoting calcium influx, which did not occur in calcium-free conditions. In the absence of extracellular calcium an “Enhanced Calcium Efflux” mechanism in which high dose paclitaxel stimulated calcium efflux immediately, leading to dramatic cytosolic calcium decrease, was observed. In the absence of extracellular calcium, high dose paclitaxel’s stimulatory effects on capacitative calcium entry and apoptosis could not be completely restored. Thus, normal extracellular calcium concentrations are critical for high dose paclitaxel-induced apoptosis. In contrast, low dose paclitaxel mirrored controls, indicating that it occurs independent of extracellular calcium. Thus, extracellular calcium conditions only affect efficacy of high dose paclitaxel-induced apoptosis. PMID:24549172

  2. Investigation of the Effects of Facility Background Pressure on the Performance and Voltage-Current Characteristics of the High Voltage Hall Accelerator

    Science.gov (United States)

    Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav

    2014-01-01

    The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.

  3. Effect of temperature on current voltage characteristics in ZnO/CdS/CuGaSe2 single crystal solar cells

    International Nuclear Information System (INIS)

    Saad, M.; Kassis, A.

    2005-03-01

    Current voltage characteristics of Zn O/CdS/CuGaSe 2 single crystal solar cells, which have gone through repetitive annealing treatment and have been measured at different values of temperature and illumination intensity, were analyzed using the two-diode equation. The analysis revealed that current transport in these cells is governed by two competing transport mechanisms relating strongly to interface states and that both mechanisms are thermally and light activated. These two mechanisms are interface recombination and tunneling enhanced interface recombination. The activation energy values of the saturation current density in both mechanisms were calculated from the temperature dependence of the parameters describing each of them. It was found that these values depend on temperature and illumination intensity. Furthermore, the behavior of the photovoltaic parameters could be explained relying on the results of the analysis. (Authors)

  4. Input-current-shaper based on a modified SEPIC converter with low voltage stress

    DEFF Research Database (Denmark)

    Petersen, Lars

    2001-01-01

    The boost topology is often the designer's first choice when dealing with PFC front-ends. This topology is well documented in the literature and has obvious advantages like continuous input current and low voltage- and current-stress compared to other PFC topologies. The PFC SEPIC converter also...

  5. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  6. Effect of electric and magnetic fields on current-voltage characteristics of a lyotropic liquid crystal

    International Nuclear Information System (INIS)

    Minasyants, M.Kh.; Badalyan, G. G.; Shahinian, A. A.

    1997-01-01

    The effect of electric and magnetic fields on current-voltage characteristics is studied for the lamellar phase in the lyotropic liquid-crystal sodium pentadecylsulfonate (SPDS)-water and lecithin-water systems. It has been found that the current-voltage characteristics of both systems have hysteresis. In the case of ionogenic SPDS, the hysteresis is formed due to ion current caused by the spatial reorientation of domains consisting of parallel lamellar fragments; in the case of lecithin, whose molecules contain dipoles, the hysteresis is formed due to the spatial reorientation of domains caused by the interaction of the resultant dipole moment of the domains with the electric field. It is shown that the introduction into lamellae of cetylpyridine bromide, which has an intrinsic magnetic moment, changes the resultant magnetic moment of domains and, thus, also the hysteresis loop of the current-voltage characteristic. The systems studied show the 'memory' effect with respect to both the electric and magnetic fields. Field-induced processes of domain reorientation were recorded by the method of small-angle x-ray scattering

  7. Voltage Quench Dynamics of a Kondo System.

    Science.gov (United States)

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  8. Calculation of current-voltage characteristics of electron-capture detectors

    International Nuclear Information System (INIS)

    Hinneburg, D.; Grosse, H.J.; Leonhardt, J.; Popp, P.

    1983-01-01

    Starting from the law of conservation of charge a stationary one-dimensional non-linear differential equation system is derived, which is applied to the direct-current mode of an electron-capture detector with parallel electrode plates. The theory takes into account space-charge, recombination, and inhomogeneous ionization and it deals with three kinds of charge carriers with different mobilities (positive and negative ions, electrons). Terms due to diffusion and gas-flow losses are excluded. The equations so constructed were programmed to get a means of calculating the charge and field distributions and the current-voltage characteristics as functions of various parameters of the detectors, the attaching gas and the ionization. For two cases the results are given. (author)

  9. The Calcium-Activated Slow AHP: Cutting Through the Gordian Knot

    Directory of Open Access Journals (Sweden)

    Rodrigo eAndrade

    2012-10-01

    Full Text Available The phenomenon known as the slow afterhyperpolarization (sAHP was originally described more than 30 years ago in pyramidal cells as a slow, Ca2+-dependent afterpotential controlling spike frequency adaptation. Subsequent work showed that similar sAHPs were widely expressed in the brain and were mediated by a Ca2+-activated potassium current that was voltage independent, insensitive to most potassium channel blockers, and strongly modulated by neurotransmitters. However the molecular basis for this current has remained poorly understood. The sAHP was initially imagined to reflect the activation of a potassium channel directly gated by Ca2+ but recent studies have begun to question this idea. The sAHP is distinct from the Ca2+-dependent fast and medium AHPs in that it appears to sense cytoplasmic [Ca2+]i and recent evidence implicates proteins of the neuronal calcium sensor family as diffusible cytoplasmic Ca2+ sensors for the sAHP. Translocation of Ca2+-bound sensor to the plasma membrane would then be an intermediate step between Ca2+ and the sAHP channels. Parallel studies strongly suggest that the sAHP current is carried by different potassium channel types depending on the cell type. Finally, the sAHP current is dependent on membrane PtdIns(4,5P2 and Ca2+ appears to gate this current by increasing PtdIns(4,5P2 levels. Because membrane PtdIns(4,5P2 is essential for the activity of many potassium channels, these finding have led us to hypothesize that the sAHP reflects a transient Ca2+-induced increase in the local availability of PtdIns(4,5P2 which then activates a variety of potassium channels. If this view is correct, the sAHP current would not represent a unitary ionic current but the embodiment of a generalized potassium channel gating mechanism. This model can potentially explain the cardinal features of the sAHP, including its cellular heterogeneity, slow kinetics, dependence on cytoplasmic [Ca2+], high temperature-dependence, and

  10. Influence of process parameters on threshold voltage and leakage current in 18nm NMOS device

    Science.gov (United States)

    Atan, Norani Binti; Ahmad, Ibrahim Bin; Majlis, Burhanuddin Bin Yeop; Fauzi, Izzati Binti Ahmad

    2015-04-01

    The process parameters are very crucial factor in the development of transistors. There are many process parameters that influenced in the development of the transistors. In this research, we investigate the effects of the process parameters variation on response characteristics such as threshold voltage (VTH) and sub-threshold leakage current (IOFF) in 18nm NMOS device. The technique to identify semiconductor process parameters whose variability would impact most on the device characteristic is realized through the process by using Taguchi robust design method. This paper presents the process parameters that influenced in threshold voltage (VTH) and sub-threshold leakage current (IOFF) which includes the Halo Implantation, Compensation Implantation, Adjustment Threshold voltage Implantation and Source/Drain Implantation. The design, fabrication and characterization of 18nm HfO2/TiSi2 NMOS device is simulated and performed via a tool called Virtual Wafer Fabrication (VWF) Silvaco TCAD Tool known as ATHENA and ATLAS simulators. These two simulators were combined with Taguchi L9 Orthogonal method to aid in the design and the optimization of the process parameters to achieve the optimum average of threshold voltage (VTH) and sub-threshold leakage current, (IOFF) in 18nm device. Results from this research were obtained; where Halo Implantation dose was identified as one of the process parameter that has the strongest effect on the response characteristics. Whereby the Compensation Implantation dose was identified as an adjustment factor to get the nominal values of threshold voltage VTH, and sub-threshold leakage current, IOFF for 18nm NMOS devices equal to 0.302849 volts and 1.9123×10-16 A/μm respectively. The design values are referred to ITRS 2011 prediction.

  11. Experimental and theoretical studies of a high temperature cesium-barium tacitron, with application to low voltage-high current inversion

    International Nuclear Information System (INIS)

    Murray, C.S.; El-Genk, M.S.

    1994-02-01

    A low voltage/high current switch refer-red as ''Cs-Ba tacitron'' is studied for use as a dc to ac inverter in high temperature and/or ionizing radiation environments. The operational characteristics of the Cs-Ba tacitron as a switch were investigated experimentally in three modes: (a) breakdown mode, (b) I-V mode, and (c) current modulation mode. Operation parameters measured include switching frequencies up to 20 kHz, hold-off voltages up to 200 V, current densities in excess of 15 A/CM 2 , switch power density of 1 kW/cm 2 , and a switching efficiency in excess of 90 % at collector voltages greater than 30 V. Also, if the discharge current is circuit limited to a value below the maximum thermal emission current density, the voltage drop is constant and below 3 V

  12. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  13. Calcium electrotransfer for termination of transgene expression in muscle

    DEFF Research Database (Denmark)

    Hojman, Pernille; Spanggaard, Iben; Olsen, Caroline Holkman

    2011-01-01

    Gene electrotransfer is expanding in clinical use, thus we have searched for an emergency procedure to stop transgene expression in case of serious adverse events. Calcium is cytotoxic at high intracellular levels, so we tested effects of calcium electrotransfer on transgene expression in muscle....... A clinical grade calcium solution (20 μl, 168 mM) was injected into transfected mouse or rat tibialis cranialis muscle. Ca(2+) uptake was quantified using calcium 45 ((45)Ca), and voltage and time between injection and pulsation were varied. Extinction of transgene expression was investigated by using both...... voltage pulses of 1000 V/cm. Using these parameters, in vivo imaging showed that transgene expression significantly decreased 4 hr after Ca(2+) electrotransfer and was eliminated within 24 hr. Similarly, serum erythropoietin was reduced by 46% at 4 hr and to control levels at 2 days. Histological analyses...

  14. Development of a Compensation Scheme for a Measurement Voltage Transformer Using the Hysteresis Characteristics of a Core

    Directory of Open Access Journals (Sweden)

    Hyewon Lee

    2015-04-01

    Full Text Available This paper describes the design, evaluation, and implementation of a compensation scheme for a measurement voltage transformer (VT using the hysteresis characteristics of the core. The error of a VT is caused by the primary winding voltage and secondary winding voltage. The latter depends on the secondary current, whereas the former depends on the primary current, which is an aggregate of the exciting and secondary currents. The secondary current is obtained directly from the secondary voltage and is used to obtain the voltage across the secondary winding. For the primary current, the exciting current is decomposed into two components: core-loss and magnetizing currents. The magnetizing current is obtained by the flux-magnetizing current curve instead of the hysteresis loop to minimize the required loops for compensation. The core-loss current is obtained by dividing the primary induced voltage by the core-loss resistance. Finally, the estimated voltages across the primary and secondary windings are added to the measured secondary voltage for compensation. The scheme can significantly improve the accuracy of a VT. The results of the performance of compensator are shown in the experimental test. The accuracy of the measurement VT improves from 1.0C class to 0.1C class. The scheme can help to significantly reduce the required core cross section of a measurement VT in an electrical energy system.

  15. Comment on: "Current-voltage characteristics and zero-resistance state in 2DEG"

    OpenAIRE

    Cheremisin, M. V.

    2003-01-01

    We demonstrate that N(S)-shape current-voltage characteristics proposed to explain zero-resistance state in Corbino(Hall bar) geometry 2DEG (cond-mat/0302063, cond-mat/0303530) cannot account essential features of radiation-induced magnetoresistance oscillations experiments.

  16. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  17. Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

    Directory of Open Access Journals (Sweden)

    RAMÓN LATORRE

    2006-01-01

    Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

  18. Biased low differential input impedance current receiver/converter device and method for low noise readout from voltage-controlled detectors

    Science.gov (United States)

    Degtiarenko, Pavel V [Williamsburg, VA; Popov, Vladimir E [Newport News, VA

    2011-03-22

    A first stage electronic system for receiving charge or current from voltage-controlled sensors or detectors that includes a low input impedance current receiver/converter device (for example, a transimpedance amplifier), which is directly coupled to the sensor output, a source of bias voltage, and the device's power supply (or supplies), which use the biased voltage point as a baseline.

  19. Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

    International Nuclear Information System (INIS)

    Povzner, A.A.; Volkov, A.G.

    2017-01-01

    Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

  20. Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

    Energy Technology Data Exchange (ETDEWEB)

    Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru

    2017-06-15

    Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

  1. Peculiarities on voltage - current characteristics of HTS tapes at overloading conditions cooled by liquid nitrogen

    International Nuclear Information System (INIS)

    Vysotsky, V S; Fetisov, S S; Sytnikov, V E

    2008-01-01

    Electro - technical devices are considered as the most prospective use for high temperature superconductors. For such devices the overload currents due to faults in grids are the operational reality. In these cases the fault currents may forcibly go to superconductors being sometimes dozens times more than the critical currents of HTS. Overloads are the working modes for fault current limiters also. To understand the behavior of HTS devices at overloads it is important to study voltage-current characteristics (VCC) of basic HTS tapes in real cooling conditions. The knowledge of VCC permits to model and to simulate properly HTS devices behavior at overloads. We performed the study of VCC of several HTS tapes at currents several times more than their critical ones. Both, 1-G and 2-G tapes were tested. There were found peculiarities or 'spikes' on VCC at rising currents that vanished at decaying currents. It was shown that such peculiarities are determined by the change of cooling conditions from the convective heat exchange to the nucleate boiling. Nucleate boiling activation and development times were determined. Their dependencies on heat release were measured. The data obtained can be used in simulation of heating of real superconducting devices at overload conditions

  2. Glow-to-arc transition events in H2-Ar direct current pulsed plasma: Automated measurement of current and voltage

    International Nuclear Information System (INIS)

    Mendes, Luciano A.; Rodrigues, Jhonatam C.; Mafra, Marcio

    2012-01-01

    The glow-to-arc transition phenomena (arcing) observed in plasma reactors used in materials processing was studied through the arcs characteristic current and voltage waveforms. In order to capture these arcs signals, a LABVIEW based automated instrumentation system (ARCVIEW) was developed, including the integration of an oscilloscope equipped with proper current and voltage probes. The system also allows capturing the process parameters at the arc occurrence moments, which were used to map the arcs events conditions. Experiments in H 2 -Ar DC pulsed plasma returned signals data from 215 arcs events, which were analyzed through software routines. According to the results, an anti-arcing system should react in the time order of few microseconds to prevent most of the damage caused by the undesired arcing phenomena.

  3. Pacemaker neuron and network oscillations depend on a neuromodulator-regulated linear current

    Directory of Open Access Journals (Sweden)

    Shunbing Zhao

    2010-05-01

    Full Text Available Linear leak currents have been implicated in the regulation of neuronal excitability, generation of neuronal and network oscillations, and network state transitions. Yet, few studies have directly tested the dependence of network oscillations on leak currents or explored the role of leak currents on network activity. In the oscillatory pyloric network of decapod crustaceans neuromodulatory inputs are necessary for pacemaker activity. A large subset of neuromodulators is known to activate a single voltage-gated inward current IMI, which has been shown to regulate the rhythmic activity of the network and its pacemaker neurons. Using the dynamic clamp technique, we show that the crucial component of IMI for the generation of oscillatory activity is only a close-to-linear portion of the current-voltage relationship. The nature of this conductance is such that the presence or the absence of neuromodulators effectively regulates the amount of leak current and the input resistance in the pacemaker neurons. When deprived of neuromodulatory inputs, pyloric oscillations are disrupted; yet, a linear reduction of the total conductance in a single neuron within the pacemaker group recovers not only the pacemaker activity in that neuron, but also leads to a recovery of oscillations in the entire pyloric network. The recovered activity produces proper frequency and phasing that is similar to that induced by neuromodulators. These results show that the passive properties of pacemaker neurons can significantly affect their capacity to generate and regulate the oscillatory activity of an entire network, and that this feature is exploited by neuromodulatory inputs.

  4. The Design of Operational Amplifier for Low Voltage and Low Current Sound Energy Harvesting System

    Science.gov (United States)

    Fang, Liew Hui; Rahim, Rosemizi Bin Abd; Isa, Muzamir; Idris Syed Hassan, Syed; Ismail, Baharuddin Bin

    2018-03-01

    The objective of this paper is to design a combination of an operational amplifier (op-amp) with a rectifier used in an alternate current (ac) to direct current (dc) power conversion. The op-amp was designed to specifically work at low voltage and low current for a sound energy harvesting system. The goal of the op-amp design with adjustable gain was to control output voltage based on the objectives of the experiment conducted. The op-amp was designed for minimum power dissipation performance, with the means of increasing the output current when receiving a large amount of load. The harvesting circuits which designed further improved the power output efficiency by shortening the fully charged time needed by a supercapacitor bank. It can fulfil the long-time power demands for low power device. Typically, a small amount of energy sources were converted to electricity and stored in the supercapacitor bank, which was built by 10 pieces of capacitors with 0.22 F each, arranged in parallel connection. The highest capacitance was chosen based on the characteristic that have the longest discharging time to support the applications of a supercapacitor bank. Testing results show that the op-amp can boost the low input ac voltage (∼3.89 V) to high output dc voltage (5.0 V) with output current of 30 mA and stored the electrical energy in a big supercapacitor bank having a total of 2.2 F, effectively. The measured results agree well with the calculated results.

  5. Regulation of granule cell excitability by a low-threshold calcium spike in turtle olfactory bulb

    DEFF Research Database (Denmark)

    Pinato, Giulietta; Midtgaard, Jens

    2003-01-01

    of the cell usually increased their amplitude so that they more easily boosted Na spike initiation. The LTS persisted in the presence of TTX but was antagonized by blockers of T-type calcium channels. The voltage dependence, kinetics, and inactivation properties of the LTS were characteristic of a low......-threshold calcium spike. The threshold of the LTS was slightly above the resting potential but well below the Na spike threshold, and the LTS was often evoked in isolation in normal medium. Tetraethylammonium (TEA) and 4-aminopyridine (4-AP) had only minimal effects on the LTS but revealed the presence of a high...

  6. Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission

    Energy Technology Data Exchange (ETDEWEB)

    Myhre, Joergen Chr.

    2001-07-01

    of the main features when the details of the transients are of less importance. The study indicates that power supply by HVDC transmission from land to offshore oil installations could be technically feasible, even without the large synchronous compensators normally required. It has been shown that in a network only supplied by an inverter, variations of active and reactive loads have significant influence on both voltage and frequency. Particularly it should be noted that the frequency shows a positive sensitivity to increases in load. This could make the system intrinsically unstable in the case of a frequency dependent load such as motors. It was not a part of the study to optimize controllers, but even with simple controllers it was possible to keep the frequency within limits given by norms and regulations, but the voltages were dynamically outside the limits, though not very far. These voltage overswings take place in the first few instances after a disturbance, so it takes unrealistically fast controllers to handle them. They are partly due to the model, where the land based rectifier and the DC reactors are simulated by a constant current source, but partly they have to be handled by overdimensioning of the system. The simulations indicate that it should be technically possible to supply an oil platform with electrical power from land by means of HVDC transmission with small synchronous compensators. Whether this is financially feasible has not been investigated. Neither has it been considered whether the necessary equipment can actually be installed on an oil platform. Recently both ABB and Siemens have presented solutions for HVDC transmission in the lower and medium power range based on voltage source converters based on IGBTs. Fully controllable voltage source HVDC converters have properties that may be better suited than conventional line commutated current source thyristor inverters, to supply weak or passive networks, such as offshore oil installations

  7. Depolarization-stimulated 42K+ efflux in rat aorta is calcium- and cellular volume-dependent

    International Nuclear Information System (INIS)

    Magliola, L.; Jones, A.W.

    1987-01-01

    The purpose of this study was to investigate the factors controlling membrane permeability to potassium of smooth muscle cells from rat aorta stimulated by depolarization. The increase 42 K+ efflux (change in the rate constant) induced by depolarization (application of high concentrations of potassium chloride) was inhibited significantly by the calcium antagonists diltiazem and nisoldipine. Parallel inhibitory effects on contraction were observed. Diltiazem also inhibited potassium-stimulated 36 Cl- efflux. The addition of 25-150 mM KCl to normal physiologic solution stimulated 42 K+ efflux in a concentration-dependent manner. Diltiazem suppressed potassium-stimulated 42 K+ efflux approximately 90% at 25 mM KCl and approximately 40% at 150 mM KCl. The ability of nisoldipine to inhibit 42 K+ efflux also diminished as the potassium chloride concentration was elevated. The component of efflux that was resistant to calcium antagonists probably resulted from a decrease in the electrochemical gradient for potassium. Cellular water did not change during potassium addition. Substitution of 80 and 150 mM KCl for sodium chloride produced cellular swelling and enhanced potassium-stimulated 42 K+ efflux compared with potassium chloride addition. The addition of sucrose to prevent cellular swelling reduced efflux response to potassium substitution toward that of potassium addition. A hypoosmolar physiologic solution produced an increase in the 42 K+ efflux and a contracture that were both prevented by the addition of sucrose. We concluded that the depolarization-mediated 42 K+ efflux has three components: one is calcium dependent; a second is dependent on cellular volume; and a third is resistant to inhibition by calcium antagonists

  8. Effect of Reverse Bias Stress on Leakage Currents and Breakdown Voltages of Solid Tantalum Capacitors

    Science.gov (United States)

    Teverovsky, Alexander A.

    2011-01-01

    The majority of solid tantalum capacitors are produced by high-temperature sintering of a fine tantalum powder around a tantalum wire followed by electrolytic anodization that forms a thin amorphous Ta2O5 dielectric layer and pyrolysis of manganese nitrite on the oxide to create a conductive manganese dioxide electrode. A contact to tantalum wire is used as anode terminal and to the manganese layer as a cathode terminal of the device. This process results in formation of an asymmetric Ta -- Ta2O5 -- MnO2 capacitor that has different characteristics at forward (positive bias applied to tantalum) and reverse (positive bias applied to manganese cathode) voltages. Reverse bias currents might be several orders of magnitude larger than forward leakage currents so I-V characteristics of tantalum capacitors resemble characteristics of semiconductor rectifiers. Asymmetric I-V characteristics of Ta -- anodic Ta2O5 systems have been observed at different top electrode materials including metals, electrolytes, conductive polymers, and manganese oxide thus indicating that this phenomenon is likely related to the specifics of the Ta -- Ta2O5 interface. There have been multiple attempts to explain rectifying characteristics of capacitors employing anodic tantalum pentoxide dielectrics. A brief review of works related to reverse bias (RB) behavior of tantalum capacitors shows that the mechanism of conduction in Ta -- Ta2O5 systems is still not clear and more testing and analysis is necessary to understand the processes involved. If tantalum capacitors behave just as rectifiers, then the assessment of the safe reverse bias operating conditions would be a relatively simple task. Unfortunately, these parts can degrade with time under reverse bias significantly, and this further complicates analysis of the I-V characteristics and establishing safe operating areas of the parts. On other hand, time dependence of reverse currents might provide additional information for investigation of

  9. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  10. A sensorless control method for capacitor voltage balance and circulating current suppression of modular multilevel converter

    DEFF Research Database (Denmark)

    Liu, Hui; Ma, Ke; Loh, Poh Chiang

    2015-01-01

    There are several problems in the Modular Multilevel Converter (MMC), such as the appearance of circulating current, capacitor voltage unbalance and the requirement for a high number of sensors. All these problems will decrease the reliability and raise the cost/uncertainty of using MMC solutions....... As a result, a sensorless control method is proposed in this paper, which targets to improve the performances of MMC in respect to the above mentioned disadvantages: To decrease the cost and simplify the physical implementation, a state observer is proposed and designed to estimate both the capacitor voltages...... and the circulating currents in order to replace the high numbers of sensors. Furthermore, a control method combining the circulating current suppression and the capacitor voltage balancing is conducted based on the proposed state observer. It is concluded that the proposed state observer and control method can...

  11. A Circulating Current Suppression Method for Parallel Connected Voltage-Source-Inverters (VSI) with Common DC and AC Buses

    DEFF Research Database (Denmark)

    Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2016-01-01

    This paper describes a theoretical with experiment study on a control strategy for the parallel operation of threephase voltage source inverters (VSI), to be applied to uninterruptible power systems (UPS). A circulating current suppression strategy for parallel VSIs is proposed in this paper based...... on circulating current control loops used to modify the reference currents by compensating the error currents among parallel inverters. Both of the cross and zero-sequence circulating currents are considered. The proposed method is coordinated together with droop and virtual impedance control. In this paper......, droop control is used to generate the reference voltage of each inverter, and the virtual impedance is used to fix the output impedance of the inverters. In addition, a secondary control is used in order to recover the voltage deviation caused by the virtual impedance. And the auxiliary current control...

  12. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes

    2018-05-01

    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  13. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  14. Differential B-dot and D-dot monitors for current and voltage measurements on a 20-MA 3-MV pulsed-power accelerator

    International Nuclear Information System (INIS)

    Shoup, Roy Willlam; Gilliland, Terrance Leo; Lee, James R.; Speas, Christopher Shane; Kim, Alexandre A.; Struve, Kenneth William; York, Mathew William; Leifeste, Gordon T.; Rochau, Gregory Alan; Sharpe, Arthur William; Stygar, William A.; Porter, John Larry Jr.; Wagoner, Tim C.; Reynolds, Paul Gerard; Slopek, Jeffrey Scott; Moore, William B.S.; Dinwoodie, Thomas Albert; Woodring, R.M.; Broyles, Robin Scott; Mills, Jerry Alan; Melville, J.A.; Dudley, M.E.; Androlewicz, K.E.; Mourning, R.W.; Moore, J.K.; Serrano, Jason Dimitri; Ives, H.C.; Johnson, M.F.; Peyton, B.P.; Leeper, Ramon Joe; Savage, Mark Edward; Donovan, Guy Louis; Spielman, R.B.; Seamen, Johann F.

    2007-01-01

    not combined in a balun; they are instead numerically processed for common-mode-noise rejection after digitization. All the current monitors are calibrated on a 76-cm-diameter axisymmetric radial transmission line that is driven by a 10-kA current pulse. The reference current is measured by a current-viewing resistor (CVR). The stack voltage monitors are also differential-output gauges, consisting of one 1.8-cm-diameter D-dot sensor and one null sensor. Hence, each voltage monitor is also a differential detector with two output signals, processed as described above. The voltage monitors are calibrated in situ at 1.5 MV on dedicated accelerator shots with a short-circuit load. Faraday's law of induction is used to generate the reference voltage: currents are obtained from calibrated outer-MITL B-dot monitors, and inductances from the system geometry. In this way, both current and voltage measurements are traceable to a single CVR. Dependable and consistent measurements are thus obtained with this system of calibrated diagnostics. On accelerator shots that deliver 22 MA to a low-impedance z-pinch load, the peak lineal current densities at the stack, outer-MITL, and inner-MITL monitor locations are 0.5, 1, and 58 MA/m, respectively. On such shots the peak currents measured at these three locations agree to within 1%

  15. The Studies of a Vacuum Gap Breakdown after High-Current Arc Interruption with Increasing the Voltage

    Science.gov (United States)

    Schneider, A. V.; Popov, S. A.; Batrakov, A. V.; Dubrovskaya, E. L.; Lavrinovich, V. A.

    2017-12-01

    Vacuum-gap breakdown has been studied after high-current arc interruption with a subsequent increase in the transient recovery voltage across a gap. The effects of factors, such as the rate of the rise in the transient voltage, the potential of the shield that surrounds a discharge gap, and the arc burning time, have been determined. It has been revealed that opening the contacts earlier leads to the formation of an anode spot, which is the source of electrode material vapors into the discharge gap after current zero moment. Under the conditions of increasing voltage, this fact results in the breakdown. Too late opening leads to the breakdown of a short gap due to the high electric fields.

  16. Low Noise Bias Current/Voltage References Based on Floating-Gate MOS Transistors

    DEFF Research Database (Denmark)

    Igor, Mucha

    1997-01-01

    The exploitation of floating-gate MOS transistors as reference current and voltage sources is investigated. Test structures of common source and common drain floating-gate devices have been implemented in a commercially available 0.8 micron double-poly CMOS process. The measurements performed...

  17. Four-point probe measurements using current probes with voltage feedback to measure electric potentials

    Science.gov (United States)

    Lüpke, Felix; Cuma, David; Korte, Stefan; Cherepanov, Vasily; Voigtländer, Bert

    2018-02-01

    We present a four-point probe resistance measurement technique which uses four equivalent current measuring units, resulting in minimal hardware requirements and corresponding sources of noise. Local sample potentials are measured by a software feedback loop which adjusts the corresponding tip voltage such that no current flows to the sample. The resulting tip voltage is then equivalent to the sample potential at the tip position. We implement this measurement method into a multi-tip scanning tunneling microscope setup such that potentials can also be measured in tunneling contact, allowing in principle truly non-invasive four-probe measurements. The resulting measurement capabilities are demonstrated for \

  18. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  19. Cell-type-dependent action potentials and voltage-gated currents in mouse fungiform taste buds.

    Science.gov (United States)

    Kimura, Kenji; Ohtubo, Yoshitaka; Tateno, Katsumi; Takeuchi, Keita; Kumazawa, Takashi; Yoshii, Kiyonori

    2014-01-01

    Taste receptor cells fire action potentials in response to taste substances to trigger non-exocytotic neurotransmitter release in type II cells and exocytotic release in type III cells. We investigated possible differences between these action potentials fired by mouse taste receptor cells using in situ whole-cell recordings, and subsequently we identified their cell types immunologically with cell-type markers, an IP3 receptor (IP3 R3) for type II cells and a SNARE protein (SNAP-25) for type III cells. Cells not immunoreactive to these antibodies were examined as non-IRCs. Here, we show that type II cells and type III cells fire action potentials using different ionic mechanisms, and that non-IRCs also fire action potentials with either of the ionic mechanisms. The width of action potentials was significantly narrower and their afterhyperpolarization was deeper in type III cells than in type II cells. Na(+) current density was similar in type II cells and type III cells, but it was significantly smaller in non-IRCs than in the others. Although outwardly rectifying current density was similar between type II cells and type III cells, tetraethylammonium (TEA) preferentially suppressed the density in type III cells and the majority of non-IRCs. Our mathematical model revealed that the shape of action potentials depended on the ratio of TEA-sensitive current density and TEA-insensitive current one. The action potentials of type II cells and type III cells under physiological conditions are discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  20. "Water-in-salt" electrolytes enable the use of cost-effective aluminum current collectors for aqueous high-voltage batteries.

    Science.gov (United States)

    Kühnel, R-S; Reber, D; Remhof, A; Figi, R; Bleiner, D; Battaglia, C

    2016-08-16

    The extended electrochemical stability window offered by highly concentrated electrolytes allows the operation of aqueous batteries at voltages significantly above the thermodynamic stability limit of water, at which the stability of the current collector potentially limits the cell voltage. Here we report the observation of suppressed anodic dissolution of aluminum in "water-in-salt" electrolytes enabling roll-to-roll electrode fabrication for high-voltage aqueous lithium-ion batteries on cost-effective light-weight aluminum current collectors using established lithium-ion battery technology.