WorldWideScience

Sample records for voltage-dependent anion-selective channels

  1. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  2. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  3. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  5. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  6. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  7. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  8. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  9. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  10. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  11. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  12. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  13. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  14. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  15. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  16. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  17. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  18. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  19. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  20. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  1. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  2. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  3. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  4. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  5. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  6. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  7. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  8. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  9. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  10. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  11. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  12. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  14. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  15. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  16. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  17. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  18. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  19. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  20. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.

    1990-01-01

    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  1. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  2. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  3. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  4. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef

    2009-01-01

    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  5. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  6. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  7. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  8. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  9. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  10. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  11. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  12. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  17. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  18. Corynebacterium jeikeium jk0268 constitutes for the 40 amino acid long PorACj, which forms a homooligomeric and anion-selective cell wall channel.

    Directory of Open Access Journals (Sweden)

    Narges Abdali

    Full Text Available Corynebacterium jeikeium, a resident of human skin, is often associated with multidrug resistant nosocomial infections in immunodepressed patients. C. jeikeium K411 belongs to mycolic acid-containing actinomycetes, the mycolata and contains a channel-forming protein as judged from reconstitution experiments with artificial lipid bilayer experiments. The channel-forming protein was present in detergent treated cell walls and in extracts of whole cells using organic solvents. A gene coding for a 40 amino acid long polypeptide possibly responsible for the pore-forming activity was identified in the known genome of C. jeikeium by its similar chromosomal localization to known porH and porA genes of other Corynebacterium strains. The gene jk0268 was expressed in a porin deficient Corynebacterium glutamicum strain. For purification temporarily histidine-tailed or with a GST-tag at the N-terminus, the homogeneous protein caused channel-forming activity with an average conductance of 1.25 nS in 1M KCl identical to the channels formed by the detergent extracts. Zero-current membrane potential measurements of the voltage dependent channel implied selectivity for anions. This preference is according to single-channel analysis caused by some excess of cationic charges located in the channel lumen formed by oligomeric alpha-helical wheels. The channel has a suggested diameter of 1.4 nm as judged from the permeability of different sized hydrated anions using the Renkin correction factor. Surprisingly, the genome of C. jeikeium contained only one gene coding for a cell wall channel of the PorA/PorH type found in other Corynebacterium species. The possible evolutionary relationship between the heterooligomeric channels formed by certain Corynebacterium strains and the homooligomeric pore of C. jeikeium is discussed.

  19. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  20. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  1. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  2. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  3. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  4. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  5. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  6. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  7. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  8. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  9. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  10. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  11. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  12. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  13. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  14. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  15. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  16. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  17. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  18. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  19. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  20. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  1. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  2. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  3. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  4. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  5. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  6. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  7. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  9. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  10. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  11. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  12. El Tor hemolysin of Vibrio cholerae O1 forms channels in planar lipid bilayer membranes.

    Science.gov (United States)

    Ikigai, H; Ono, T; Iwata, M; Nakae, T; Shimamura, T

    1997-05-15

    We investigated the channel formation by El Tor hemolysin (molecular mass, 65 kDa) of Vibrio cholerae O1 biotype El Tor in planar lipid bilayers. The El Tor hemolysin channel exhibited asymmetric and hyperbolic membrane current with increasing membrane potential, meaning that the channel is voltage dependent. The zero-current membrane potential measured in KCI solution showed that permeability ratio PK+/PCl- was 0.16, indicating that the channel is 6-fold more anion selective over cation. The hemolysin channel frequently flickered in the presence of divalent cations, suggesting that the channel spontaneously opens and closes. These data imply that the El Tor hemolysin damages target cells by the formation of transmembrane channels and, consequently, is the cause of osmotic cytolysis.

  13. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  14. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  15. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  16. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  17. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  18. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  19. Determination of the ion-exchange capacity of anion-selective membranes

    Czech Academy of Sciences Publication Activity Database

    Karas, F.; Hnát, J.; Paidar, M.; Schauer, Jan; Bouzek, K.

    2014-01-01

    Roč. 39, č. 10 (2014), s. 5054-5062 ISSN 0360-3199 Institutional support: RVO:61389013 Keywords : ion-exchange capacity * anion-selective membranes * titration Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.313, year: 2014

  20. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  1. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  2. Influence of Introduced Substituents on the Anion-selectivity of [14]Tetraazaannulene Complexes.

    Science.gov (United States)

    Moriuchi-Kawakami, Takayo; Obita, Minako; Tsujinaka, Toshiki; Shibutani, Yasuhiko

    2015-01-01

    Nickel(II) complexes of [14]tetraazaannulene derivatives incorporating aromatic rings into their azaannulene framework were synthesized, and the anion-selectivity of the [14]tetraazaannulene nickel complexes 1 - 4 was evaluated by potentiometric measurements with solvent polymeric membrane electrodes. All of the [14]Tetraazaannulene nickel complexes, except 3, were found to exhibit high selectivity for the I(-) ion over the SCN(-) ion, although considerable interference of the ClO4(-) ion was observed in all 1 - 4 complexes. Concerning the anion-selectivities of 1 and 4, the incorporation of naphthalene rings into the azaannulene framework decreased not only the interference of the ClO4(-) ion but also the I(-) ion-selectivity over the SCN(-) ion. Comparison studies between the dibenzotetraaza[14]annulene nickel complexes 1 - 3 indicated that differences in the attached substituents of the [14]tetraazaannulene nickel complexes greatly influenced the ion-selectivity as ionophores. According to our computational results, the ionophoric properties of [14]tetraazaannulene nickel complexes 1 - 4 were influenced by their electrostatic properties rather than their topological properties.

  3. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  4. Cl- channels of the gastric parietal cell that are active at low pH.

    Science.gov (United States)

    Cuppoletti, J; Baker, A M; Malinowska, D H

    1993-06-01

    HCl secretion across mammalian gastric parietal cell apical membrane may involve Cl- channels. H(+)-K(+)-ATPase-containing membranes isolated from gastric mucosa of histamine-stimulated rabbits were fused to planar lipid bilayers. Channels were recorded with symmetric 800 mM CsCl solutions, pH 7.4. A linear current-voltage (I-V) relationship was obtained, and conductance was 28 +/- 1 pS at 800 mM CsCl. Conductance was 6.9 +/- 2 pS at 150 mM CsCl. Reversal potential was +22 mV with a fivefold cis-trans CsCl concentration gradient, indicating that the channel was anion selective with a discrimination ratio of 6:1 for Cl- over Cs+. Anion selectivity of the channel was I- > Cl- > or = Br- > NO3-, and gluconate was impermeant. Channels obtained at pH 7.4 persisted when pH of medium bathing the trans side of the bilayer (pHtrans) was reduced to pH 3, without a change in conductance, linearity of I-V relationship, or ion selectivity. In contrast, asymmetric reduction of pH of medium bathing the cis side of the bilayer from 7.4 to 3 always resulted in loss of channel activity. At pH 7.4, open probability (Po) of the channel was voltage dependent, i.e., predominantly open at +80 mV but mainly closed at -80 mV. In contrast, with low pHtrans, channel Po at -80 mV was increased 3.5-fold. The Cl- channel was Ca2+ indifferent. In absence of ionophores, ion selectivity for support of H(+)-K(+)-ATPase activity and H+ transport was consistent with that exhibited by the channel and could be limited by substitution with NO3-, whereas maximal H(+)-K(+)-ATPase activity was indifferent to anion present, demonstrating that anion transport can be rate limiting. Cl- channels with similar characteristics (conductance, linear I-V relationship, and ion selectivity) were also present in H(+)-K(+)-ATPase-containing vesicles isolated from resting (cimetidine-treated) gastric mucosa, exhibiting at -80 mV a pH-independent approximately 3.5-fold lower Po than stimulated vesicle channels. At -80 m

  5. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  6. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  7. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  8. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  9. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  10. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  11. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  12. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  13. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  14. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-11-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl-/SO42- separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl-/SO42- permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later.

  15. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-01-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl−/SO42− separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl−/SO42− permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later. PMID:27853255

  16. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  17. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  18. Pharmacological dissection of K(v)7.1 channels in systemic and pulmonary arteries

    DEFF Research Database (Denmark)

    Chadha, Preet S; Zunke, Friederike; Davis, Alison J

    2012-01-01

    The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature.......The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature....

  19. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  20. Anion-selective materials with 1,4-diazabicyclo[2.2.2]octane functional groups for advanced alkaline water electrolysis

    Czech Academy of Sciences Publication Activity Database

    Hnát, J.; Plevová, M.; Žitka, Jan; Paidar, M.; Bouzek, K.

    2017-01-01

    Roč. 248, 10 September (2017), s. 547-555 ISSN 0013-4686 R&D Projects: GA ČR(CZ) GA16-20728S Institutional support: RVO:61389013 Keywords : water electrolysis * alkaline environment * anion-selective membrane Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 4.798, year: 2016

  1. Zeolite-like Metal–Organic Framework (MOF) Encaged Pt(II)-Porphyrin for Anion-Selective Sensing

    KAUST Repository

    Masih, Dilshad

    2018-03-26

    The selectivity and sensitivity of sensors are of great interest to the materials chemistry community, and a lot of effort is now devoted to improving these characteristics. More specifically, the selective sensing of anions is one of the largest challenges impeding the sensing-research area due to their similar physical and chemical behaviors. In this work, platinum–metalated porphyrin (Pt(II)TMPyP) was successfully encapsulated in a rho-type zeolite-like metal–organic framework (rho-ZMOF) and applied for anion-selective sensing. The sensing activity and selectivity of the MOF-encaged Pt(II)TMPyP for various anions in aqueous and methanolic media were compared to that of the free (nonencapsulated) Pt(II)TMPyP. While the photoinduced triplet-state electron transfer of Pt(II)TMPyP showed a very low detection limit for anions with no selectivity, the Pt(II)TMPyP encapsulated in the rho-ZMOF framework possessed a unique chemical structure to overcome such limitations. This new approach has the potential for use in other complex sensing applications, including biosensors, which require ion selectivity.

  2. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  4. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  5. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  6. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  7. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  8. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  9. Subunit Stoichiometry of Human Muscle Chloride Channels

    OpenAIRE

    Fahlke, Christoph; Knittle, Timothy; Gurnett, Christina A.; Campbell, Kevin P.; George, Alfred L.

    1997-01-01

    Voltage-gated Cl? channels belonging to the ClC family appear to function as homomultimers, but the number of subunits needed to form a functional channel is controversial. To determine subunit stoichiometry, we constructed dimeric human skeletal muscle Cl? channels in which one subunit was tagged by a mutation (D136G) that causes profound changes in voltage-dependent gating. Sucrose-density gradient centrifugation experiments indicate that both monomeric and dimeric hClC-1 channels in their ...

  10. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  11. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  12. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  13. Functional analysis of Kv1.2 and paddle chimera Kv channels in planar lipid bilayers

    Science.gov (United States)

    Tao, Xiao; MacKinnon, Roderick

    2010-01-01

    Summary Voltage-dependent K+ channels play key roles in shaping electrical signaling in both excitable as well as non-excitable cells. These channels open and close in response to the voltage changes across the cell membrane. Many studies have been carried out in order to understand the voltage sensing mechanism. Our laboratory recently determined the atomic structures of a mammalian voltage-dependent K+ channel Kv1.2 and a mutant of Kv1.2 named the ‘paddle-chimera’ channel, in which the voltage sensor paddle was transferred from Kv2.1 to Kv1.2. These two structures provide atomic descriptions of voltage-dependent channels with unprecedented clarity. Until now the functional integrity of these two channels biosynthesized in yeast cells have not been assessed. Here we report the electrophysiological and pharmacological properties of Kv1.2 and the paddle chimera channels in planar lipid bilayers. We demonstrate that Pichia yeast produce ‘normally functioning’ mammalian voltage-dependent K+ channels with qualitatively similar features to the Shaker K+ channel in the absence of the N-terminal inactivation gate, and that the paddle chimera mutant channel functions as well as Kv1.2. We find, however, that in several respects the Kv1.2 channel exhibits functional properties that are distinct from Kv1.2 channels reported in the literature. PMID:18638484

  14. Establishment of human sperm-specific voltage-dependent anion channel 3 recombinant vector for the production of a male contraceptive vaccine

    Directory of Open Access Journals (Sweden)

    Asmarinah Asmarinah

    2012-05-01

    Full Text Available Background: The aim of this study was to construct a recombinant vector of human sperm specific VDAC3 gene for production of VDAC3 antibody, which is potential as male contraception vaccine.Methods: Target fragment sequence of VDAC3 gene was obtained through amplification of human sperm VDAC3 cDNA with primers covering exon 5 to exon 8. Its PCR product in size of 435 bp was cloned to the pET101/D-TOPO expression vector (5753 bp. E. coli bacteria were transformed with this vector. Cloning of VDAC3 fragment gene to the vector was confirmed by the using of XbaI restriction enzyme and PCR colony method with primers covering exons 5-8 of the human VDAC3 gene.Results: Alignment analysis of amplified fragment covering exon 5 to exon 8 of VDAC3 gene showed 94% homology to human VDAC3 gene from databank. After cloning to the expression vector and transformation to E. coli competent cells, twelve colonies could grow in culture media. Gel electrophoresis of sliced VDAC3 recombinant vector showed a single band in the size of 6181 bp in 8 colonies. After application of PCR colony and amplicon sequencing, the result showed a single band in the size of 435 bp and fragment sequence with 94% identity to human VDAC3 gene.Conclusion: The construction of human sperm specific VDAC3 gene recombinant vector was established in this study. In the future, this recombinant vector will be used to produce VDAC3 antibody for the development of a male contraception vaccine. (Med J Indones. 2012;21:61-5Keywords: Contraception, recombinant vector, sperm, VDAC3

  15. Single-channel kinetics of BK (Slo1 channels

    Directory of Open Access Journals (Sweden)

    Yanyan eGeng

    2015-01-01

    Full Text Available Single-channel kinetics has proven a powerful tool to reveal information about the gating mechanisms that control the opening and closing of ion channels. This introductory review focuses on the gating of large conductance Ca2+- and voltage-activated K+ (BK or Slo1 channels at the single-channel level. It starts with single-channel current records and progresses to presentation and analysis of single-channel data and the development of gating mechanisms in terms of discrete state Markov (DSM models. The DSM models are formulated in terms of the tetrameric modular structure of BK channels, consisting of a central transmembrane pore-gate domain (PGD attached to four surrounding transmembrane voltage sensing domains (VSD and a large intracellular cytosolic domain (CTD, also referred to as the gating ring. The modular structure and data analysis shows that the Ca2+ and voltage dependent gating considered separately can each be approximated by 10-state two-tiered models with 5 closed states on the upper tier and 5 open states on the lower tier. The modular structure and joint Ca2+ and voltage dependent gating are consistent with a 50 state two-tiered model with 25 closed states on the upper tier and 25 open states on the lower tier. Adding an additional tier of brief closed (flicker states to the 10-state or 50-state models improved the description of the gating. For fixed experimental conditions a channel would gate in only a subset of the potential number of states. The detected number of states and the correlations between adjacent interval durations are consistent with the tiered models. The examined models can account for the single-channel kinetics and the bursting behavior of gating. Ca2+ and voltage activate BK channels by predominantly increasing the effective opening rate of the channel with a smaller decrease in the effective closing rate. Ca2+ and depolarization thus activate by mainly destabilizing the closed states.

  16. Ion channels in plants.

    Science.gov (United States)

    Hedrich, Rainer

    2012-10-01

    Since the first recordings of single potassium channel activities in the plasma membrane of guard cells more than 25 years ago, patch-clamp studies discovered a variety of ion channels in all cell types and plant species under inspection. Their properties differed in a cell type- and cell membrane-dependent manner. Guard cells, for which the existence of plant potassium channels was initially documented, advanced to a versatile model system for studying plant ion channel structure, function, and physiology. Interestingly, one of the first identified potassium-channel genes encoding the Shaker-type channel KAT1 was shown to be highly expressed in guard cells. KAT1-type channels from Arabidopsis thaliana and its homologs from other species were found to encode the K(+)-selective inward rectifiers that had already been recorded in early patch-clamp studies with guard cells. Within the genome era, additional Arabidopsis Shaker-type channels appeared. All nine members of the Arabidopsis Shaker family are localized at the plasma membrane, where they either operate as inward rectifiers, outward rectifiers, weak voltage-dependent channels, or electrically silent, but modulatory subunits. The vacuole membrane, in contrast, harbors a set of two-pore K(+) channels. Just very recently, two plant anion channel families of the SLAC/SLAH and ALMT/QUAC type were identified. SLAC1/SLAH3 and QUAC1 are expressed in guard cells and mediate Slow- and Rapid-type anion currents, respectively, that are involved in volume and turgor regulation. Anion channels in guard cells and other plant cells are key targets within often complex signaling networks. Here, the present knowledge is reviewed for the plant ion channel biology. Special emphasis is drawn to the molecular mechanisms of channel regulation, in the context of model systems and in the light of evolution.

  17. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  18. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  19. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

    Science.gov (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

    2013-09-01

    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  20. Anion channels: master switches of stress responses.

    Science.gov (United States)

    Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar

    2012-04-01

    During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  2. Single Nisoldipine-Sensitive Calcium Channels in Smooth Muscle Cells Isolated from Rabbit Mesenteric Artery

    Science.gov (United States)

    Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.

    1986-08-01

    Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.

  3. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  4. Channels formed by botulinum, tetanus, and diphtheria toxins in planar lipid bilayers: relevance to translocation of proteins across membranes.

    OpenAIRE

    Hoch, D H; Romero-Mira, M; Ehrlich, B E; Finkelstein, A; DasGupta, B R; Simpson, L L

    1985-01-01

    The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as "tunnel proteins" for translocation of active peptide fragments. These f...

  5. MITOCHONDRIAL BKCa CHANNEL

    Directory of Open Access Journals (Sweden)

    Enrique eBalderas

    2015-03-01

    Full Text Available Since its discovery in a glioma cell line 15 years ago, mitochondrial BKCa channel (mitoBKCa has been studied in brain cells and cardiomyocytes sharing general biophysical properties such as high K+ conductance (~300 pS, voltage-dependency and Ca2+-sensitivity. Main advances in deciphering the molecular composition of mitoBKCa have included establishing that it is encoded by the Kcnma1 gene, that a C-terminal splice insert confers mitoBKCa ability to be targeted to cardiac mitochondria, and evidence for its potential coassembly with β subunits. Notoriously, β1 subunit directly interacts with cytochrome c oxidase and mitoBKCa can be modulated by substrates of the respiratory chain. mitoBKCa channel has a central role in protecting the heart from ischemia, where pharmacological activation of the channel impacts the generation of reactive oxygen species and mitochondrial Ca2+ preventing cell death likely by impeding uncontrolled opening of the mitochondrial transition pore. Supporting this view, inhibition of mitoBKCa with Iberiotoxin, enhances cytochrome c release from glioma mitochondria. Many tantalizing questions remain. Some of them are: how is mitoBKCa coupled to the respiratory chain? Does mitoBKCa play non-conduction roles in mitochondria physiology? Which are the functional partners of mitoBKCa? What are the roles of mitoBKCa in other cell types? Answers to these questions are essential to define the impact of mitoBKCa channel in mitochondria biology and disease.

  6. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  7. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  8. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  9. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  10. PIP2 mediates functional coupling and pharmacology of neuronal KCNQ channels

    DEFF Research Database (Denmark)

    Kim, Robin Y; Pless, Stephan A; Kurata, Harley T

    2017-01-01

    Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation. To elucid......Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation....... These findings reveal an important role for PIP2 in coupling retigabine binding to altered VSD function. We identify a polybasic motif in the proximal C terminus of retigabine-sensitive KCNQ channels that contributes to VSD-pore coupling via PIP2, and thereby influences the unique gating effects of retigabine....

  11. Regulation of sodium channel function by bilayer elasticity: the importance of hydrophobic coupling. Effects of Micelle-forming amphiphiles and cholesterol

    DEFF Research Database (Denmark)

    Lundbæk, Jens August; Birn, Pia; Hansen, Anker J

    2004-01-01

    , Triton X-100, and reduced Triton X-100) that make lipid bilayers less "stiff", as measured using gA channels, shift the voltage dependence of sodium channel inactivation toward more hyperpolarized potentials. At low amphiphile concentration, the magnitude of the shift is linearly correlated to the change...

  12. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  13. Inactivation of Mechanically Activated Piezo1 Ion Channels Is Determined by the C-Terminal Extracellular Domain and the Inner Pore Helix

    Directory of Open Access Journals (Sweden)

    Jason Wu

    2017-11-01

    Full Text Available Piezo proteins form mechanically activated ion channels that are responsible for our sense of light touch, proprioception, and vascular blood flow. Upon activation by mechanical stimuli, Piezo channels rapidly inactivate in a voltage-dependent manner through an unknown mechanism. Inactivation of Piezo channels is physiologically important, as it modulates overall mechanical sensitivity, gives rise to frequency filtering of repetitive mechanical stimuli, and is itself the target of numerous human disease-related channelopathies that are not well understood mechanistically. Here, we identify the globular C-terminal extracellular domain as a structure that is sufficient to confer the time course of inactivation and a single positively charged lysine residue at the adjacent inner pore helix as being required for its voltage dependence. Our results are consistent with a mechanism for inactivation that is mediated through voltage-dependent conformations of the inner pore helix and allosteric coupling with the C-terminal extracellular domain.

  14. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca

    2012-09-01

    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  15. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-01

    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  16. ‘Sleepy’ inward rectifier channels in guinea-pig cardiomyocytes are activated only during strong hyperpolarization

    Science.gov (United States)

    Liu, Gong Xin; Daut, Jürgen

    2002-01-01

    K+ channels of isolated guinea-pig cardiomyocytes were studied using the patch-clamp technique. At transmembrane potentials between −120 and −220 mV we observed inward currents through an apparently novel channel. The novel channel was strongly rectifying, no outward currents could be recorded. Between −200 and −160 mV it had a slope conductance of 42.8 ± 3.0 pS (s.d.; n = 96). The open probability (Po) showed a sigmoid voltage dependence and reached a maximum of 0.93 at −200 mV, half-maximal activation was approximately −150 mV. The voltage dependence of Po was not affected by application of 50 μm isoproterenol. The open-time distribution could be described by a single exponential function, the mean open time ranged between 73.5 ms at −220 mV and 1.4 ms at −160 mV. At least two exponential components were required to fit the closed time distribution. Experiments with different external Na+, K+ and Cl− concentrations suggested that the novel channel is K+ selective. Extracellular Ba2+ ions gave rise to a voltage-dependent reduction in Po by inducing long closed states; Cs+ markedly reduced mean open time at −200 mV. In cell-attached recordings the novel channel frequently converted to a classical inward rectifier channel, and vice versa. This conversion was not voltage dependent. After excision of the patch, the novel channel always converted to a classical inward rectifier channel within 0–3 min. This conversion was not affected by intracellular Mg2+, phosphatidylinositol (4,5)-bisphosphate or spermine. Taken together, our findings suggest that the novel K+ channel represents a different ‘mode’ of the classical inward rectifier channel in which opening occurs only at very negative potentials. PMID:11897847

  17. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    International Nuclear Information System (INIS)

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-01-01

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  18. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    Science.gov (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  19. Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

    Science.gov (United States)

    Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

    2017-04-20

    Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

  20. Is there a role for T-type Ca2+ channels in regulation of vasomotor tone in mesenteric arterioles?

    DEFF Research Database (Denmark)

    Jensen, Lars Jørn; Holstein-Rathlou, Niels-Henrik

    2009-01-01

    The largest peripheral blood pressure drop occurs in terminal arterioles (microm lumen diameter). L-type voltage-dependent Ca2+ channels (VDCCs) are considered the primary pathway for Ca2+ influx during physiologic activation of vascular smooth muscle cells (VSMC). Recent evidence suggests...... was predominantly expressed in endothelial cells. Voltage-dependent Ca2+ entry was inhibited by the new specific T-type blockers R(-)-efonidipine and NNC 55-0396. The effect of NNC 55-0396 persisted in depolarized arterioles, suggesting an unusually high activation threshold of mesenteric T-type channels. T...... that T-type VDCCs are expressed in renal afferent and efferent arterioles, mesenteric arterioles, and skeletal muscle arterioles. T-type channels are small-conductance, low voltage-activated, fast-inactivating channels. Thus, their role in supplying Ca2+ for contraction of VSMC has been disputed. However...

  1. The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations.

    Science.gov (United States)

    Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J

    2017-10-01

    Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. The electrically silent Kv6.4 subunit confers hyperpolarized gating charge movement in Kv2.1/Kv6.4 heterotetrameric channels.

    Directory of Open Access Journals (Sweden)

    Elke Bocksteins

    Full Text Available The voltage-gated K(+ (Kv channel subunit Kv6.4 does not form functional homotetrameric channels but co-assembles with Kv2.1 to form functional Kv2.1/Kv6.4 heterotetrameric channels. Compared to Kv2.1 homotetramers, Kv6.4 exerts a ~40 mV hyperpolarizing shift in the voltage-dependence of Kv2.1/Kv6.4 channel inactivation, without a significant effect on activation gating. However, the underlying mechanism of this Kv6.4-induced modulation of Kv2.1 channel inactivation, and whether the Kv6.4 subunit participates in the voltage-dependent gating of heterotetrameric channels is not well understood. Here we report distinct gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels, compared to Kv2.1 homotetramers, as revealed by gating current recordings from mammalian cells expressing these channels. The gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels displayed an extra component around the physiological K(+ equilibrium potential, characterized by a second sigmoidal relationship of the voltage-dependence of gating charge movement. This distinct gating charge displacement reflects movement of the Kv6.4 voltage-sensing domain and has a voltage-dependency that matches the hyperpolarizing shift in Kv2.1/Kv6.4 channel inactivation. These results provide a mechanistic basis for the modulation of Kv2.1 channel inactivation gating kinetics by silent Kv6.4 subunits.

  3. Lycopene depresses glutamate release through inhibition of voltage-dependent Ca2+ entry and protein kinase C in rat cerebrocortical nerve terminals.

    Science.gov (United States)

    Lu, Cheng-Wei; Hung, Chi-Feng; Jean, Wei-Horng; Lin, Tzu-Yu; Huang, Shu-Kuei; Wang, Su-Jane

    2018-05-01

    Lycopene is a natural dietary carotenoid that was reported to exhibit a neuroprotective profile. Considering that excitotoxicity and cell death induced by glutamate are involved in many brain disorders, the effect of lycopene on glutamate release in rat cerebrocortical nerve terminals and the possible mechanism involved in such effect was investigated. We observed here that lycopene inhibited 4-aminopyridine (4-AP)-evoked glutamate release and intrasynaptosomal Ca 2+ concentration elevation. The inhibitory effect of lycopene on 4-AP-evoked glutamate release was markedly reduced in the presence of the Ca v 2.2 (N-type) and Ca v 2.1 (P/Q-type) channel blocker ω-conotoxin MVIIC, but was insensitive to the intracellular Ca 2+ -release inhibitors dantrolene and CGP37157. Furthermore, in the presence of the protein kinase C inhibitors GF109203X and Go6976, the action of lycopene on evoked glutamate release was prevented. These results are the first to suggest that lycopene inhibits glutamate release from rat cortical synaptosomes by suppressing presynaptic Ca 2+ entry and protein kinase C activity.

  4. Evolutionary origins of mechanosensitive ion channels.

    Science.gov (United States)

    Martinac, Boris; Kloda, Anna

    2003-01-01

    According to the recent revision, the universal phylogenetic tree is composed of three domains: Eukarya (eukaryotes), Bacteria (eubacteria) and Archaea (archaebacteria). Mechanosensitive (MS) ion channels have been documented in cells belonging to all three domains suggesting their very early appearance during evolution of life on Earth. The channels show great diversity in conductance, selectivity and voltage dependence, while sharing the property of being gated by mechanical stimuli exerted on cell membranes. In prokaryotes, MS channels were first documented in Bacteria followed by their discovery in Archaea. The finding of MS channels in archaeal cells helped to recognize and establish the evolutionary relationship between bacterial and archaeal MS channels and to show that this relationship extends to eukaryotic Fungi (Schizosaccharomyces pombe) and Plants (Arabidopsis thaliana). Similar to their bacterial and archaeal homologues, MS channels in eukaryotic cell-walled Fungi and Plants may serve in protecting the cellular plasma membrane from excessive dilation and rupture that may occur during osmotic stress. This review summarizes briefly some of the recent developments in the MS channel research field that may ultimately lead to elucidation of the biophysical and evolutionary principles underlying the mechanosensory transduction in living cells.

  5. [Compared Markov with fractal models by using single-channel experimental and simulation data].

    Science.gov (United States)

    Lan, Tonghan; Wu, Hongxiu; Lin, Jiarui

    2006-10-01

    The gating mechanical kinetical of ion channels has been modeled as a Markov process. In these models it is assumed that the channel protein has a small number of discrete conformational states and kinetic rate constants connecting these states are constant, the transition rate constants among the states is independent both of time and of the previous channel activity. It is assumed in Liebovitch's fractal model that the channel exists in an infinite number of energy states, consequently, transitions from one conductance state to another would be governed by a continuum of rate constants. In this paper, a statistical comparison is presented of Markov and fractal models of ion channel gating, the analysis is based on single-channel data from ion channel voltage-dependence K+ single channel of neuron cell and simulation data from three-states Markov model.

  6. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Channels Formed by Botulinum, Tetanus, and Diphtheria Toxins in Planar Lipid Bilayers: Relevance to Translocation of Proteins across Membranes

    Science.gov (United States)

    Hoch, David H.; Romero-Mira, Miryam; Ehrlich, Barbara E.; Finkelstein, Alan; Dasgupta, Bibhuti R.; Simpson, Lance L.

    1985-03-01

    The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as ``tunnel proteins'' for translocation of active peptide fragments. These findings support the hypothesis that the active fragments of botulinum neurotoxin and tetanus toxin, like that of diphtheria toxin, are translocated across the membranes of acidic vesicles.

  8. Molecular and kinetic determinants of local anaesthetic action on sodium channels.

    Science.gov (United States)

    French, R J; Zamponi, G W; Sierralta, I E

    1998-11-23

    (1) Local anaesthetics (LA) rely for their clinical actions on state-dependent inhibition of voltage-dependent sodium channels. (2) Single, batrachoxin-modified sodium channels in planar lipid bilayers allow direct observation of drug-channel interactions. Two modes of inhibition of single-channel current are observed: fast block of the open channels and prolongation of a long-lived closed state, some of whose properties resemble those of the inactivated state of unmodified channels. (3) Analogues of different parts of the LA molecule separately mimic each blocking mode: amines--fast block, and water-soluble aromatics--closed state prolongation. (4) Interaction between a mu-conotoxin derivative and diethylammonium indicate an intrapore site of fast, open-state block. (5) Site-directed mutagenesis studies suggest that hydrophobic residues in transmembrane segment 6 of repeat domain 4 of sodium channels are critical for both LA binding and stabilization of the inactivated state.

  9. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    International Nuclear Information System (INIS)

    Long, Yan; Lin, Zuoxian; Xia, Menghang; Zheng, Wei; Li, Zhiyuan

    2013-01-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC 50 values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds

  10. Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

    Directory of Open Access Journals (Sweden)

    RAMÓN LATORRE

    2006-01-01

    Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

  11. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Long, Yan; Lin, Zuoxian [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China); Xia, Menghang; Zheng, Wei [National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892 (United States); Li, Zhiyuan, E-mail: li_zhiyuan@gibh.ac.cn [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China)

    2013-03-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.

  12. Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

    Science.gov (United States)

    Carvalho-de-Souza, Joao L; Bezanilla, Francisco

    2018-02-05

    Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018

  13. KIR channels tune electrical communication in cerebral arteries

    DEFF Research Database (Denmark)

    Sancho, Maria; Samson, Nina C; Hald, Bjorn O

    2017-01-01

    The conducted vasomotor response reflects electrical communication in the arterial wall and the distance signals spread is regulated by three factors including resident ion channels. This study defined the role of inward-rectifying K(+) channels (KIR) in governing electrical communication along...... hamster cerebral arteries. Focal KCl application induced a vasoconstriction that conducted robustly, indicative of electrical communication among cells. Inhibiting dominant K(+) conductances had no attenuating effect, the exception being Ba(2+) blockade of KIR Electrophysiology and Q-PCR analysis...... and the increased feedback arising from voltage-dependent-K(+) channels. In summary, this study shows that two KIR populations work collaboratively to govern electrical communication and the spread of vasomotor responses along cerebral arteries....

  14. A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

    Science.gov (United States)

    Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

    2016-02-25

    Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Homeostatic Presynaptic Plasticity Is Specifically Regulated by P/Q-type Ca2+ Channels at Mammalian Hippocampal Synapses

    OpenAIRE

    Jeans, Alexander F.; van Heusden, Fran C.; Al-Mubarak, Bashayer; Padamsey, Zahid; Emptage, Nigel J.

    2017-01-01

    Voltage-dependent Ca2+ channels (VGCC) represent the principal source of Ca2+ ions driving evoked neurotransmitter release at presynaptic boutons. In mammals, presynaptic Ca2+ influx is mediated mainly via P/Q-type and N-type VGCC, which differ in their properties. Changes in their relative contributions tune neurotransmission both during development and in Hebbian plasticity. However, whether this represents a functional motif also present in other forms of activity-dependent ...

  16. The pan-Kv7 (KCNQ) Channel Opener Retigabine Inhibits Striatal Excitability by Direct Action on Striatal Neurons In Vivo

    DEFF Research Database (Denmark)

    Hansen, Henrik H; Weikop, Pia; Mikkelsen, Maria D

    2017-01-01

    Central Kv7 (KCNQ) channels are voltage-dependent potassium channels composed of different combinations of four Kv7 subunits, being differently expressed in the brain. Notably, striatal dopaminergic neurotransmission is strongly suppressed by systemic administration of the pan-Kv7 channel opener ...... by acute systemic haloperidol administration in the rat. The relative mRNA levels of Kv7 subunits in the rat striatum were found to be Kv7.2 = Kv7.3 = Kv7.5 > >Kv7.4. These data suggest that intrastriatal Kv7 channels play a direct role in regulating striatal excitability in vivo....

  17. Physiology and pathophysiology of ClC-K/barttin channels.

    Science.gov (United States)

    Fahlke, Christoph; Fischer, Martin

    2010-01-01

    ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology, and pathophysiology of ClC-K/barttin channels.

  18. Physiology and pathophysiology of ClC-K/barttin channels

    Directory of Open Access Journals (Sweden)

    Christoph eFahlke

    2010-11-01

    Full Text Available ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology and pathophysiology of ClC-K/barttin channels.

  19. Modification of sodium and potassium channel kinetics by diethyl ether and studies on sodium channel inactivation in the crayfish giant axon membrane

    Energy Technology Data Exchange (ETDEWEB)

    Bean, Bruce Palmer [Univ. of Rochester, NY (United States)

    1979-01-01

    The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.

  20. Effects of the small molecule HERG activator NS1643 on Kv11.3 channels.

    Directory of Open Access Journals (Sweden)

    Arne Bilet

    Full Text Available NS1643 is one of the small molecule HERG (Kv11.1 channel activators and has also been found to increase erg2 (Kv11.2 currents. We now investigated whether NS1643 is also able to act as an activator of Kv11.3 (erg3 channels expressed in CHO cells. Activation of rat Kv11.3 current occurred in a dose-dependent manner and maximal current increasing effects were obtained with 10 µM NS1643. At this concentration, steady-state outward current increased by about 80% and the current increase was associated with a significant shift in the voltage dependence of activation to more negative potentials by about 15 mV. In addition, activation kinetics were accelerated, whereas deactivation was slowed. There was no significant effect on the kinetics of inactivation and recovery from inactivation. The strong current-activating agonistic effect of NS1643 did not result from a shift in the voltage dependence of Kv11.3 channel inactivation and was independent from external Na(+ or Ca(2+. At the higher concentration of 20 µM, NS1643 induced clearly less current increase. The left shift in the voltage dependence of activation reversed and the voltage sensitivity of activation dramatically decreased along with a slowing of Kv11.3 channel activation. These data show that, in comparison to other Kv11 family members, NS1643 exerts distinct effects on Kv11.3 channels with especially pronounced partial antagonistic effects at higher concentration.

  1. Free-energy relationships in ion channels activated by voltage and ligand

    Science.gov (United States)

    Chowdhury, Sandipan

    2013-01-01

    Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

  2. Molecular Mechanisms Underlying Renin-Angiotensin-Aldosterone System Mediated Regulation of BK Channels

    Directory of Open Access Journals (Sweden)

    Zhen-Ye Zhang

    2017-09-01

    Full Text Available Large-conductance calcium-activated potassium channels (BK channels belong to a family of Ca2+-sensitive voltage-dependent potassium channels and play a vital role in various physiological activities in the human body. The renin-angiotensin-aldosterone system is acknowledged as being vital in the body's hormone system and plays a fundamental role in the maintenance of water and electrolyte balance and blood pressure regulation. There is growing evidence that the renin-angiotensin-aldosterone system has profound influences on the expression and bioactivity of BK channels. In this review, we focus on the molecular mechanisms underlying the regulation of BK channels mediated by the renin-angiotensin-aldosterone system and its potential as a target for clinical drugs.

  3. Effects of the β1 auxiliary subunit on modification of Rat Na{sub v}1.6 sodium channels expressed in HEK293 cells by the pyrethroid insecticides tefluthrin and deltamethrin

    Energy Technology Data Exchange (ETDEWEB)

    He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, Geneva, NY 14456 (United States)

    2016-01-15

    We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased in the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin

  4. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  5. A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

    Science.gov (United States)

    Kajma, Anna; Szewczyk, Adam

    2012-10-01

    Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Channel-forming activities in the glycosomal fraction from the bloodstream form of Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Melisa Gualdron-López

    Full Text Available BACKGROUND: Glycosomes are a specialized form of peroxisomes (microbodies present in unicellular eukaryotes that belong to the Kinetoplastea order, such as Trypanosoma and Leishmania species, parasitic protists causing severe diseases of livestock and humans in subtropical and tropical countries. The organelles harbour most enzymes of the glycolytic pathway that is responsible for substrate-level ATP production in the cell. Glycolysis is essential for bloodstream-form Trypanosoma brucei and enzymes comprising this pathway have been validated as drug targets. Glycosomes are surrounded by a single membrane. How glycolytic metabolites are transported across the glycosomal membrane is unclear. METHODS/PRINCIPAL FINDINGS: We hypothesized that glycosomal membrane, similarly to membranes of yeast and mammalian peroxisomes, contains channel-forming proteins involved in the selective transfer of metabolites. To verify this prediction, we isolated a glycosomal fraction from bloodstream-form T. brucei and reconstituted solubilized membrane proteins into planar lipid bilayers. The electrophysiological characteristics of the channels were studied using multiple channel recording and single channel analysis. Three main channel-forming activities were detected with current amplitudes 70-80 pA, 20-25 pA, and 8-11 pA, respectively (holding potential +10 mV and 3.0 M KCl as an electrolyte. All channels were in fully open state in a range of voltages ±150 mV and showed no sub-conductance transitions. The channel with current amplitude 20-25 pA is anion-selective (P(K+/P(Cl-∼0.31, while the other two types of channels are slightly selective for cations (P(K+/P(Cl- ratios ∼1.15 and ∼1.27 for the high- and low-conductance channels, respectively. The anion-selective channel showed an intrinsic current rectification that may suggest a functional asymmetry of the channel's pore. CONCLUSIONS/SIGNIFICANCE: These results indicate that the membrane of glycosomes

  7. Metaflumizone is a novel sodium channel blocker insecticide.

    Science.gov (United States)

    Salgado, V L; Hayashi, J H

    2007-12-15

    Metaflumizone is a novel semicarbazone insecticide, derived chemically from the pyrazoline sodium channel blocker insecticides (SCBIs) discovered at Philips-Duphar in the early 1970s, but with greatly improved mammalian safety. This paper describes studies confirming that the insecticidal action of metaflumizone is due to the state-dependent blockage of sodium channels. Larvae of the moth Spodoptera eridania injected with metaflumizone became paralyzed, concomitant with blockage of all nerve activity. Furthermore, tonic firing of abdominal stretch receptor organs from Spodoptera frugiperda was blocked by metaflumizone applied in the bath, consistent with the block of voltage-dependent sodium channels. Studies on native sodium channels, in primary-cultured neurons isolated from the CNS of the larvae of the moth Manduca sexta and on Para/TipE sodium channels heterologously expressed in Xenopus (African clawed frog) oocytes, confirmed that metaflumizone blocks sodium channels by binding selectively to the slow-inactivated state, which is characteristic of the SCBIs. The results confirm that metaflumizone is a novel sodium channel blocker insecticide.

  8. Channel sialic acids limit hERG channel activity during the ventricular action potential.

    Science.gov (United States)

    Norring, Sarah A; Ednie, Andrew R; Schwetz, Tara A; Du, Dongping; Yang, Hui; Bennett, Eric S

    2013-02-01

    Activity of human ether-a-go-go-related gene (hERG) 1 voltage-gated K(+) channels is responsible for portions of phase 2 and phase 3 repolarization of the human ventricular action potential. Here, we questioned whether and how physiologically and pathophysiologically relevant changes in surface N-glycosylation modified hERG channel function. Voltage-dependent hERG channel gating and activity were evaluated as expressed in a set of Chinese hamster ovary (CHO) cell lines under conditions of full glycosylation, no sialylation, no complex N-glycans, and following enzymatic deglycosylation of surface N-glycans. For each condition of reduced glycosylation, hERG channel steady-state activation and inactivation relationships were shifted linearly by significant depolarizing ∼9 and ∼18 mV, respectively. The hERG window current increased significantly by 50-150%, and the peak shifted by a depolarizing ∼10 mV. There was no significant change in maximum hERG current density. Deglycosylated channels were significantly more active (20-80%) than glycosylated controls during phases 2 and 3 of action potential clamp protocols. Simulations of hERG current and ventricular action potentials corroborated experimental data and predicted reduced sialylation leads to a 50-70-ms decrease in action potential duration. The data describe a novel mechanism by which hERG channel gating is modulated through physiologically and pathophysiologically relevant changes in N-glycosylation; reduced channel sialylation increases hERG channel activity during the action potential, thereby increasing the rate of action potential repolarization.

  9. Chloride channels as tools for developing selective insecticides.

    Science.gov (United States)

    Bloomquist, Jeffrey R

    2003-12-01

    Ligand-gated chloride channels underlie inhibition in excitable membranes and are proven target sites for insecticides. The gamma-aminobutyric acid (GABA(1)) receptor/chloride ionophore complex is the primary site of action for a number of currently used insecticides, such as lindane, endosulfan, and fipronil. These compounds act as antagonists by stabilizing nonconducting conformations of the chloride channel. Blockage of the GABA-gated chloride channel reduces neuronal inhibition, which leads to hyperexcitation of the central nervous system, convulsions, and death. We recently investigated the mode of action of the silphinenes, plant-derived natural compounds that structurally resemble picrotoxinin. These materials antagonize the action of GABA on insect neurons and block GABA-mediated chloride uptake into mouse brain synaptoneurosomes in a noncompetitive manner. In mammals, avermectins have a blocking action on the GABA-gated chloride channel consistent with a coarse tremor, whereas at longer times and higher concentrations, activation of the channel suppresses neuronal activity. Invertebrates display ataxia, paralysis, and death as the predominant signs of poisoning, with a glutamate-gated chloride channel playing a major role. Additional target sites for the avermectins or other chloride channel-directed compounds might include receptors gated by histamine, serotonin, or acetylcholine.The voltage-sensitive chloride channels form another large gene family of chloride channels. Voltage-dependent chloride channels are involved in a number of physiological processes including: maintenance of electrical excitability, chloride ion secretion and resorption, intravesicular acidification, and cell volume regulation. A subset of these channels is affected by convulsants and insecticides in mammals, although the role they play in acute lethality in insects is unclear. Given the wide range of functions that they mediate, these channels are also potential targets for

  10. A novel outer-membrane anion channel (porin) as part of a putatively two-component transport system for 4-toluenesulphonate in Comamonas testosteroni T-2

    OpenAIRE

    Mampel, Jörg; Maier, Elke; Tralau, Tewes; Ruff, Jürgen; Benz, Roland; Cook, Alasdair M.

    2004-01-01

    Inducible mineralization of TSA (4-toluenesulphonate) by Comamonas testosteroni T-2 is initiated by a secondary transport system, followed by oxygenation and oxidation by TsaMBCD to 4-sulphobenzoate under the regulation of TsaR and TsaQ. Evidence is presented for a novel, presumably two-component transport system (TsaST). It is proposed that TsaT, an outer-membrane porin, formed an anion-selective channel that works in co-operation with the putative secondary transporter, TsaS, located in the...

  11. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  12. Inhibition of GluR Current in Microvilli of Sensory Neurons via Na+-Microdomain Coupling Among GluR, HCN Channel, and Na+/K+ Pump

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kawasaki

    2018-04-01

    Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.

  13. The Kinetics and the Permeation Properties of Piezo Channels.

    Science.gov (United States)

    Gnanasambandam, R; Gottlieb, P A; Sachs, F

    2017-01-01

    Piezo channels are eukaryotic, cation-selective mechanosensitive channels (MSCs), which show rapid activation and voltage-dependent inactivation. The kinetics of these channels are largely consistent across multiple cell types and different stimulation paradigms with some minor variability. No accessory subunits that associate with Piezo channels have been reported. They are homotrimers and each ∼300kD monomer has an N-terminal propeller blade-like mechanosensing module, which can confer mechanosensing capabilities on ASIC-1 (the trimeric non-MSC, acid-sensing ion channel-1) and a C-terminal pore module, which influences conductance, selectivity, and channel inactivation. Repeated stimulation can cause domain fracture and diffusion of these channels leading to synchronous loss of inactivation. The reconstituted channels spontaneously open only in asymmetric bilayers but lack inactivation. Mutations that cause hereditary xerocytosis alter PIEZO1 kinetics. The kinetics of the wild-type PIEZO1 and alterations thereof in mutants (M2225R, R2456K, and DhPIEZO1) are summarized in the form of a quantitative model and hosted online. The pore is permeable to alkali ions although Li + permeates poorly. Divalent cations, notably Ca 2+ , traverse the channel and inhibit the flux of monovalents. The large monovalent organic cations such as tetramethyl ammonium and tetraethyl ammonium can traverse the channel, but slowly, suggesting a pore diameter of ∼8Å, and the estimated in-plane area change upon opening is around 6-20nm 2 . Ruthenium red can enter the channel only from the extracellular side and seems to bind in a pocket close to residue 2496. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Dysfunctional Hyperpolarization-Activated Cyclic Nucleotide-gated Ion Channels in Cardiac Diseases

    Directory of Open Access Journals (Sweden)

    Xiaoqi Zhao

    Full Text Available Abstract Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are reverse voltage-dependent, and their activation depends on the hyperpolarization of the membrane and may be directly or indirectly regulated by the cyclic adenosine monophosphate (cAMP or other signal-transduction cascades. The distribution, quantity and activation states of HCN channels differ in tissues throughout the body. Evidence exhibits that HCN channels play critical roles in the generation and conduction of the electrical impulse and the physiopathological process of some cardiac diseases. They may constitute promising drug targets in the treatment of these cardiac diseases. Pharmacological treatment targeting HCN channels is of benefit to these cardiac conditions.

  15. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

    Science.gov (United States)

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

    2013-03-01

    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  16. Ion channeling

    International Nuclear Information System (INIS)

    Erramli, H.; Blondiaux, G.

    1994-01-01

    Channeling phenomenon was predicted, many years ago, by stark. The first channeling experiments were performed in 1963 by Davies and his coworkers. Parallely Robinson and Oen have investigated this process by simulating trajectories of ions in monocrystals. This technique has been combined with many methods like Rutherford Backscattering Spectrometry (R.B.S.), Particles Induced X-rays Emission (P.I.X.E) and online Nuclear Reaction (N.R.A.) to localize trace elements in the crystal or to determine crystalline quality. To use channeling for material characterization we need data about the stopping power of the incident particle in the channeled direction. The ratios of channeled to random stopping powers of silicon for irradiation in the direction have been investigated and compared to the available theoretical results. We describe few applications of ion channeling in the field of materials characterization. Special attention is given to ion channeling combined with Charged Particle Activation Analysis (C.P.A.A.) for studying the behaviour of oxygen atoms in Czochralski silicon lattices under the influence of internal gettering and in different gaseous atmospheres. Association between ion channeling and C.P.A.A was also utilised for studying the influence of the growing conditions on concentration and position of carbon atoms at trace levels in the MOVPE Ga sub (1-x) Al sub x lattice. 6 figs., 1 tab., 32 refs. (author)

  17. Mechanosensitive gating of Kv channels.

    Directory of Open Access Journals (Sweden)

    Catherine E Morris

    Full Text Available K-selective voltage-gated channels (Kv are multi-conformation bilayer-embedded proteins whose mechanosensitive (MS Popen(V implies that at least one conformational transition requires the restructuring of the channel-bilayer interface. Unlike Morris and colleagues, who attributed MS-Kv responses to a cooperative V-dependent closed-closed expansion↔compaction transition near the open state, Mackinnon and colleagues invoke expansion during a V-independent closed↔open transition. With increasing membrane tension, they suggest, the closed↔open equilibrium constant, L, can increase >100-fold, thereby taking steady-state Popen from 0→1; "exquisite sensitivity to small…mechanical perturbations", they state, makes a Kv "as much a mechanosensitive…as…a voltage-dependent channel". Devised to explain successive gK(V curves in excised patches where tension spontaneously increased until lysis, their L-based model falters in part because of an overlooked IK feature; with recovery from slow inactivation factored in, their g(V datasets are fully explained by the earlier model (a MS V-dependent closed-closed transition, invariant L≥4. An L-based MS-Kv predicts neither known Kv time courses nor the distinctive MS responses of Kv-ILT. It predicts Kv densities (hence gating charge per V-sensor several-fold different from established values. If opening depended on elevated tension (L-based model, standard gK(V operation would be compromised by animal cells' membrane flaccidity. A MS V-dependent transition is, by contrast, unproblematic on all counts. Since these issues bear directly on recent findings that mechanically-modulated Kv channels subtly tune pain-related excitability in peripheral mechanoreceptor neurons we undertook excitability modeling (evoked action potentials. Kvs with MS V-dependent closed-closed transitions produce nuanced mechanically-modulated excitability whereas an L-based MS-Kv yields extreme, possibly excessive

  18. Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-23

    Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

  19. Channel box

    International Nuclear Information System (INIS)

    Tanabe, Akira.

    1993-01-01

    In a channel box of a BWR type reactor, protruding pads are disposed in axial position on the lateral side of a channel box opposing to a control rod and facing the outer side portion of the control rod in a reactor core loaded state. In the initial loading stage of fuel assemblies, channel fasteners and spacer pads are abutted against each other in the upper portion between the channel boxes sandwiching the control rod therebetween. Further, in the lower portion, a gap as a channel for the movement of the control rod is ensured by the support of fuel support metals. If the channel box is bent toward the control rod along with reactor operation, the pads are abutted against each other to always ensure the gap through which the control rod can move easily. Further, when the pads are brought into contact with each other, the bending deformation of the channel box is corrected by urging to each other. Thus, the control rod can always be moved smoothly to attain reactor safety operation. (N.H.)

  20. Cloning, functional expression, and characterization of a PKA-activated gastric Cl- channel.

    Science.gov (United States)

    Malinowska, D H; Kupert, E Y; Bahinski, A; Sherry, A M; Cuppoletti, J

    1995-01-01

    cDNA encoding a Cl- channel was isolated from a rabbit gastric library, sequenced, and expressed in Xenopus oocytes. The predicted protein (898 amino acids, relative molecular mass 98,433 Da) was overall 93% similar to the rat brain ClC-2 Cl- channel. However, a 151-amino acid stretch toward the COOH-terminus was 74% similar to ClC-2 with six amino acids deleted. Two new potential protein kinase A (PKA) phosphorylation sites (also protein kinase C phosphorylation sites) were introduced. cRNA-injected Xenopus oocytes expressed a Cl- channel that was active at pHtrans 3 and had a linear current-voltage (I-V) curve and a slope conductance of 29 +/- 1 pS at 800 mM CsCl. A fivefold Cl- gradient caused a rightward shift in the I-V curve with a reversal potential of +30 +/- 3 mV, indicating anion selectivity. The selectivity was I- > Cl- > NO3-. The native and recombinant Cl- channel were both activated in vitro by PKA catalytic subunit and ATP. The electrophysiological and regulatory properties of the cloned and the native channel were similar. The cloned protein may be the Cl- channel involved in gastric HCl secretion.

  1. Conductance of Ion Channels - Theory vs. Experiment

    Science.gov (United States)

    Pohorille, Andrew; Wilson, Michael; Mijajlovic, Milan

    2013-01-01

    . In addition, once the free energy profile becomes available the full current-voltage dependence can be readily obtained. For both channels we carried out calculations using both approaches. We also tested the main assumptions underlying the diffusive model, such as uncorrelated nature of individual crossing events and Fickian diffusion. The accuracy and consistency of different methods will be discussed. Finally we will discuss how comparisons between calculated and measured ionic conductance and selectivity of transport can be used for determining structural models of the channels.

  2. Surface channeling

    International Nuclear Information System (INIS)

    Sizmann, R.; Varelas, C.

    1976-01-01

    There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

  3. Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.

    Science.gov (United States)

    Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C

    2010-10-01

    Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.

  4. Pharmacological Conversion of a Cardiac Inward Rectifier into an Outward Rectifier Potassium Channel.

    Science.gov (United States)

    Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A

    2016-09-01

    Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  5. Spark Channels

    Energy Technology Data Exchange (ETDEWEB)

    Haydon, S. C. [Department of Physics, University of New England, Armidale, NSW (Australia)

    1968-04-15

    A brief summary is given of the principal methods used for initiating spark channels and the various highly time-resolved techniques developed recently for studies with nanosecond resolution. The importance of the percentage overvoltage in determining the early history and subsequent development of the various phases of the growth of the spark channel is discussed. An account is then given of the recent photographic, oscillographic and spectroscopic investigations of spark channels initiated by co-axial cable discharges of spark gaps at low [{approx} 1%] overvoltages. The phenomena observed in the development of the immediate post-breakdown phase, the diffuse glow structure, the growth of the luminous filament and the final formation of the spark channel in hydrogen are described. A brief account is also given of the salient features emerging from corresponding studies of highly overvolted spark gaps in which the spark channel develops from single avalanche conditions. The essential differences between the two types of channel formation are summarized and possible explanations of the general features are indicated. (author)

  6. Simple Ion Channels: From Structure to Electrophysiology and Back

    Science.gov (United States)

    Pohorille, Andrzej

    2018-01-01

    A reliable way to establish whether our understanding of a channel is satisfactory is to reproduce its measured ionic conductance over a broad range of applied voltages in computer simulations. In molecular dynamics (MD), this can be done by way of applying an external electric field to the system and counting the number of ions that traverse the channel per unit time. Since this approach is computationally very expensive, we have developed a markedly more efficient alternative in which MD is combined with the electrodiffusion (ED) equation. In this approach, the assumptions of the ED equation can be rigorously tested, and the precision and consistency of the calculated conductance can be determined. We have demonstrated that the full current/voltage dependence and the underlying free energy profile for a simple channel can be reliably calculated from equilibrium or non-equilibrium MD simulations at a single voltage. To carry out MD simulations, a structural model of a channel has to be assumed, which is an important constraint, considering that high-resolution structures are available for only very few simple channels. If the comparison of calculated ionic conductance with electrophysiological data is satisfactory, it greatly increases our confidence that the structure and the function are described sufficiently accurately. We examined the validity of the ED for several channels embedded in phospholipid membranes - four naturally occurring channels: trichotoxin, alamethicin, p7 from hepatitis C virus (HCV) and Vpu from the HIV-1 virus, and a synthetic, hexameric channel, formed by a 21-residue peptide that contains only leucine and serine. All these channels mediate transport of potassium and chloride ions. It was found that the ED equation is satisfactory for these systems. In some of them experimental and calculated electrophysiological properties are in good agreement, whereas in others there are strong indications that the structural models are incorrect.

  7. Identification of sodium channel isoforms that mediate action potential firing in lamina I/II spinal cord neurons

    Directory of Open Access Journals (Sweden)

    Smith Paula L

    2011-09-01

    Full Text Available Abstract Background Voltage-gated sodium channels play key roles in acute and chronic pain processing. The molecular, biophysical, and pharmacological properties of sodium channel currents have been extensively studied for peripheral nociceptors while the properties of sodium channel currents in dorsal horn spinal cord neurons remain incompletely understood. Thus far, investigations into the roles of sodium channel function in nociceptive signaling have primarily focused on recombinant channels or peripheral nociceptors. Here, we utilize recordings from lamina I/II neurons withdrawn from the surface of spinal cord slices to systematically determine the functional properties of sodium channels expressed within the superficial dorsal horn. Results Sodium channel currents within lamina I/II neurons exhibited relatively hyperpolarized voltage-dependent properties and fast kinetics of both inactivation and recovery from inactivation, enabling small changes in neuronal membrane potentials to have large effects on intrinsic excitability. By combining biophysical and pharmacological channel properties with quantitative real-time PCR results, we demonstrate that functional sodium channel currents within lamina I/II neurons are predominantly composed of the NaV1.2 and NaV1.3 isoforms. Conclusions Overall, lamina I/II neurons express a unique combination of functional sodium channels that are highly divergent from the sodium channel isoforms found within peripheral nociceptors, creating potentially complementary or distinct ion channel targets for future pain therapeutics.

  8. Skeletal muscle Kv7 (KCNQ) channels in myoblast differentiation and proliferation

    International Nuclear Information System (INIS)

    Roura-Ferrer, Meritxell; Sole, Laura; Martinez-Marmol, Ramon; Villalonga, Nuria; Felipe, Antonio

    2008-01-01

    Voltage-dependent K + channels (Kv) are involved in myocyte proliferation and differentiation by triggering changes in membrane potential and regulating cell volume. Since Kv7 channels may participate in these events, the purpose of this study was to investigate whether skeletal muscle Kv7.1 and Kv7.5 were involved during proliferation and myogenesis. Here we report that, while myotube formation did not regulate Kv7 channels, Kv7.5 was up-regulated during cell cycle progression. Although, Kv7.1 mRNA also increased during the G 1 -phase, pharmacological evidence mainly involves Kv7.5 in myoblast growth. Our results indicate that the cell cycle-dependent expression of Kv7.5 is involved in skeletal muscle cell proliferation

  9. Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro

    International Nuclear Information System (INIS)

    Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.

    1989-01-01

    The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)

  10. MARKETING CHANNELS

    Directory of Open Access Journals (Sweden)

    Ljiljana Stošić Mihajlović

    2014-07-01

    Full Text Available Marketing channel is a set of entities and institutions, completion of distribution and marketing activities, attend the efficient and effective networking of producers and consumers. Marketing channels include the total flows of goods, money and information taking place between the institutions in the system of marketing, establishing a connection between them. The functions of the exchange, the physical supply and service activities, inherent in the system of marketing and trade. They represent paths which products and services are moving after the production, which will ultimately end up buying and eating by the user.

  11. Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions.

    Science.gov (United States)

    Kang, Bok Eum; Baker, Bradley J

    2016-04-04

    An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.

  12. Kv1 channels and neural processing in vestibular calyx afferents

    Directory of Open Access Journals (Sweden)

    Frances L Meredith

    2015-06-01

    Full Text Available Potassium-selective ion channels are important for accurate transmission of signals from auditory and vestibular sensory end organs to their targets in the central nervous system. During different gravity conditions, astronauts experience altered input signals from the peripheral vestibular system resulting in sensorimotor dysfunction. Adaptation to altered sensory input occurs, but it is not explicitly known whether this involves synaptic modifications within the vestibular epithelia. Future investigations of such potential plasticity require a better understanding of the electrophysiological mechanisms underlying the known heterogeneity of afferent discharge under normal conditions. This study advances this understanding by examining the role of the Kv1 potassium channel family in mediating action potentials in specialized vestibular afferent calyx endings in the gerbil crista and utricle. Pharmacological agents selective for different sub-types of Kv1 channels were tested on membrane responses in whole cell recordings in the crista. Kv1 channels sensitive to α-dendrotoxin and dendrotoxin-K were found to prevail in the central regions, whereas K+ channels sensitive to margatoxin, which blocks Kv1.3 and 1.6 channels, were more prominent in peripheral regions. Margatoxin-sensitive currents showed voltage-dependent inactivation. Dendrotoxin-sensitive currents showed no inactivation and dampened excitability in calyces in central neuroepithelial regions. The differential distribution of Kv1 potassium channels in vestibular afferents supports their importance in accurately relaying gravitational and head movement signals through specialized lines to the central nervous system. Pharmacological modulation of specific groups of K+ channels could help alleviate vestibular dysfunction on earth and in space.

  13. Kv1 channels and neural processing in vestibular calyx afferents.

    Science.gov (United States)

    Meredith, Frances L; Kirk, Matthew E; Rennie, Katherine J

    2015-01-01

    Potassium-selective ion channels are important for accurate transmission of signals from auditory and vestibular sensory end organs to their targets in the central nervous system. During different gravity conditions, astronauts experience altered input signals from the peripheral vestibular system resulting in sensorimotor dysfunction. Adaptation to altered sensory input occurs, but it is not explicitly known whether this involves synaptic modifications within the vestibular epithelia. Future investigations of such potential plasticity require a better understanding of the electrophysiological mechanisms underlying the known heterogeneity of afferent discharge under normal conditions. This study advances this understanding by examining the role of the Kv1 potassium channel family in mediating action potentials in specialized vestibular afferent calyx endings in the gerbil crista and utricle. Pharmacological agents selective for different sub-types of Kv1 channels were tested on membrane responses in whole cell recordings in the crista. Kv1 channels sensitive to α-dendrotoxin and dendrotoxin-K were found to prevail in the central regions, whereas K(+) channels sensitive to margatoxin, which blocks Kv1.3 and 1.6 channels, were more prominent in peripheral regions. Margatoxin-sensitive currents showed voltage-dependent inactivation. Dendrotoxin-sensitive currents showed no inactivation and dampened excitability in calyces in central neuroepithelial regions. The differential distribution of Kv1 potassium channels in vestibular afferents supports their importance in accurately relaying gravitational and head movement signals through specialized lines to the central nervous system. Pharmacological modulation of specific groups of K(+) channels could help alleviate vestibular dysfunction on earth and in space.

  14. CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild

    2012-06-01

    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

  15. Identification of an HV 1 voltage-gated proton channel in insects.

    Science.gov (United States)

    Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

    2016-04-01

    The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

  16. On the mechanism of TBA block of the TRPV1 channel.

    Science.gov (United States)

    Oseguera, Andrés Jara; Islas, León D; García-Villegas, Refugio; Rosenbaum, Tamara

    2007-06-01

    The transient receptor potential vanilloid 1 (TRPV1) channel is a nonselective cation channel activated by capsaicin and responsible for thermosensation. To date, little is known about the gating characteristics of these channels. Here we used tetrabutylammonium (TBA) to determine whether this molecule behaves as an ion conduction blocker in TRPV1 channels and to gain insight into the nature of the activation gate of this protein. TBA belongs to a family of classic potassium channel blockers that have been widely used as tools for determining the localization of the activation gate and the properties of the pore of several ion channels. We found TBA to be a voltage-dependent pore blocker and that the properties of block are consistent with an open-state blocker, with the TBA molecule binding to multiple open states, each with different blocker affinities. Kinetics of channel closure and burst-length analysis in the presence of blocker are consistent with a state-dependent blocking mechanism, with TBA interfering with closing of an activation gate. This activation gate may be located cytoplasmically with respect to the binding site of TBA ions, similar to what has been observed in potassium channels. We propose an allosteric model for TRPV1 activation and block by TBA, which explains our experimental data.

  17. Properties of Single K+ and Cl− Channels in Asclepias tuberosa Protoplasts 1

    Science.gov (United States)

    Schauf, Charles L.; Wilson, Kathryn J.

    1987-01-01

    Potassium and chloride channels were characterized in Asclepias tuberosa suspension cell derived protoplasts by patch voltage-clamp. Whole-cell currents and single channels in excised patches had linear instantaneous current-voltage relations, reversing at the Nernst potentials for K+ and Cl−, respectively. Whole cell K+ currents activated exponentially during step depolarizations, while voltage-dependent Cl− channels were activated by hyperpolarizations. Single K+ channel conductance was 40 ± 5 pS with a mean open time of 4.5 milliseconds at 100 millivolts. Potassium channels were blocked by Cs+ and tetraethylammonium, but were insensitive to 4-aminopyridine. Chloride channels had a single-channel conductance of 100 ± 17 picosiemens, mean open time of 8.8 milliseconds, and were blocked by Zn2+ and ethacrynic acid. Whole-cell Cl− currents were inhibited by abscisic acid, and were unaffected by indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid. Since internal and external composition can be controlled, patch-clamped protoplasts are ideal systems for studying the role of ion channels in plant physiology and development. Images Fig. 5 PMID:16665712

  18. Channel Power in Multi-Channel Environments

    NARCIS (Netherlands)

    M.G. Dekimpe (Marnik); B. Skiera (Bernd)

    2004-01-01

    textabstractIn the literature, little attention has been paid to instances where companies add an Internet channel to their direct channel portfolio. However, actively managing multiple sales channels requires knowing the customers’ channel preferences and the resulting channel power. Two key

  19. Escitalopram block of hERG potassium channels.

    Science.gov (United States)

    Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June

    2014-01-01

    Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.

  20. β1 subunit stabilises sodium channel Nav1.7 against mechanical stress.

    Science.gov (United States)

    Körner, Jannis; Meents, Jannis; Machtens, Jan-Philipp; Lampert, Angelika

    2018-06-01

    The voltage-gated sodium channel Nav1.7 is a key player in neuronal excitability and pain signalling. In addition to voltage sensing, the channel is also modulated by mechanical stress. Using whole-cell patch-clamp experiments, we discovered that the sodium channel subunit β1 is able to prevent the impact of mechanical stress on Nav1.7. An intramolecular disulfide bond of β1 was identified to be essential for stabilisation of inactivation, but not activation, against mechanical stress using molecular dynamics simulations, homology modelling and site-directed mutagenesis. Our results highlight the role of segment 6 of domain IV in fast inactivation. We present a candidate mechanism for sodium channel stabilisation against mechanical stress, ensuring reliable channel functionality in living systems. Voltage-gated sodium channels are key players in neuronal excitability and pain signalling. Precise gating of these channels is crucial as even small functional alterations can lead to pathological phenotypes such as pain or heart failure. Mechanical stress has been shown to affect sodium channel activation and inactivation. This suggests that stabilising components are necessary to ensure precise channel gating in living organisms. Here, we show that mechanical shear stress affects voltage dependence of activation and fast inactivation of the Nav1.7 channel. Co-expression of the β1 subunit, however, protects both gating modes of Nav1.7 against mechanical shear stress. Using molecular dynamics simulation, homology modelling and site-directed mutagenesis, we identify an intramolecular disulfide bond of β1 (Cys21-Cys43) which is partially involved in this process: the β1-C43A mutant prevents mechanical modulation of voltage dependence of activation, but not of fast inactivation. Our data emphasise the unique role of segment 6 of domain IV for sodium channel fast inactivation and confirm previous reports that the intracellular process of fast inactivation can be

  1. The Voltage-Sensing Domain of Kv7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants

    Science.gov (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

    2010-01-01

    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499

  2. The voltage-sensing domain of kv7.2 channels as a molecular target for epilepsy-causing mutations and anticonvulsants

    Directory of Open Access Journals (Sweden)

    Francesco eMiceli

    2011-02-01

    Full Text Available Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically-determined channelopathies affecting heart rhythm (arrhythmias, neuronal excitability (epilepsy, pain or skeletal muscle contraction (periodic paralysis. Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function.In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2-5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically-determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  3. The Voltage-Sensing Domain of K(v)7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants.

    Science.gov (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

    2011-01-01

    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  4. Slick (Kcnt2 Sodium-Activated Potassium Channels Limit Peptidergic Nociceptor Excitability and Hyperalgesia

    Directory of Open Access Journals (Sweden)

    Danielle L Tomasello

    2017-09-01

    Full Text Available The Slick (Kcnt2 sodium-activated potassium (K Na channel is a rapidly gating and weakly voltage-dependent and sodium-dependent potassium channel with no clearly defined physiological function. Within the dorsal root ganglia (DRGs, we show Slick channels are exclusively expressed in small-sized and medium-sized calcitonin gene–related peptide (CGRP-containing DRG neurons, and a pool of channels are localized to large dense-core vesicles (LDCV-containing CGRP. We stimulated DRG neurons for CGRP release and found Slick channels contained within CGRP-positive LDCV translocated to the neuronal membrane. Behavioral studies in Slick knockout (KO mice indicated increased basal heat detection and exacerbated thermal hyperalgesia compared with wild-type littermate controls during neuropathic and chronic inflammatory pain. Electrophysiologic recordings of DRG neurons from Slick KO mice revealed that Slick channels contribute to outward current, propensity to fire action potentials (APs, and to AP properties. Our data suggest that Slick channels restrain the excitability of CGRP-containing neurons, diminishing pain behavior after inflammation and injury.

  5. A Tour de Force: The Discovery, Properties, and Function of Piezo Channels.

    Science.gov (United States)

    Gottlieb, P A

    2017-01-01

    Mechanical transducers appear throughout cell biology and are used to convert mechanical stress into chemical or electrical signals that allow the cell to respond to environmental changes. In the past six years, a eukaryotic mechanical channel family with two members, Piezo1 and Piezo2, has been identified. Piezo1 was shown to be a cation-selective channel that does not require ancillary proteins for activity. Mouse Piezo1 is large, with over 2500 amino acids, and is not homologous to other ion channels. Both piezo channels have rapid voltage-dependent inactivation with a reversal potential near 0mV. The CryoEm structure of Piezo1 at 4.8Å shows trimer stoichiometry. Since the discovery of the piezo channels, their roles in the physiological response of cells have started to emerge. Significant progress has been made in understanding the intrinsic properties of the channels and how these properties are modulated by cytoskeletal elements. Specific diseases, such as hereditary xerocytosis affecting red blood cells, have mutations in Piezo1 that alter the cell's response to force, typically slowing inactivation and introducing a latency for activation. A number of physiological functions for piezo channels have been identified. These range from sensing the stiffness of surrounding substrate, to the response to light touch, to serotonin release from the gut. This review provides a general overview of the properties and roles of Piezo1 and Piezo2 in eukaryotic mechanotransduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

    Science.gov (United States)

    Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

    2013-09-01

    Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

  7. Diclofenac distinguishes among homomeric and heteromeric potassium channels composed of KCNQ4 and KCNQ5 subunits.

    Science.gov (United States)

    Brueggemann, Lioubov I; Mackie, Alexander R; Martin, Jody L; Cribbs, Leanne L; Byron, Kenneth L

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V(0.5) values: -31, -44, and -38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels.

  8. Decreased expression of Kv7 channels in Hirchsprung's disease.

    Science.gov (United States)

    O'Donnell, Anne-Marie; Coyle, David; Puri, Prem

    2017-07-01

    Voltage-dependent K + channels (Kv channels) participate in electrical rhythmicity and smooth muscle responses and are regulated by excitatory and inhibitory neurotransmitters. Kv channels also participate in the interstitial cell of Cajal (ICC) and smooth muscle cell (SMC) responses to neural inputs. The Kv family consists of 12 subfamilies, Kv1-Kv12, with five members of the Kv7 family identified to date: Kv7.1-Kv7.5. A recent study identified the potassium channel Kv7.5 as having a role in the excitability of ICC-IM in the mouse colon. We therefore designed this study to test the hypothesis that Kv7 channels are present in the normal human colon and are reduced in Hirschprung's disease (HSCR). HSCR tissue specimens were collected at the time of pull-through surgery (n=10), while normal control tissue specimens were obtained at the time of colostomy closure in patients with imperforate anus (n=10). Kv7.3-Kv7.5 immunohistochemistry was performed and visualized using confocal microscopy to assess their distribution. Western blot analysis was undertaken to determine Kv7.3-Kv7.5 protein quantification. Kv7.3 and Kv7.4-immunoreactivity was co-localized with neuron and ICC markers, while Kv7.5 was found to be expressed on both ICCs and SMCs. Western blot analysis revealed similar levels of Kv7.3 and Kv7.5 expression in the normal colon and HSCR colon, while Kv7.4 proteins were found to be markedly decreased in ganglionic specimens and decreased further in aganglionic specimens. A deficiency of Kv7.4 channels in the ganglionic and aganglionic bowel may place a role in colonic dysmotility in HSCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Channelling and electromagnetic radiation of channelling particles

    International Nuclear Information System (INIS)

    Kalashnikov, N.

    1983-01-01

    A brief description is presented of the channelling of charged particles between atoms in the crystal lattice. The specificities are discussed of the transverse motion of channelling particles as are the origin and properties of quasi-characteristic radiation of channelling particles which accompany transfers from one band of permissible energies of the transverse motion of channelling particles to the other. (B.S.)

  10. [3H]PN200-110 and [3H]ryanodine binding and reconstitution of ion channel activity with skeletal muscle membranes

    International Nuclear Information System (INIS)

    Hamilton, S.L.; Alvarez, R.M.; Fill, M.; Hawkes, M.J.; Brush, K.L.; Schilling, W.P.; Stefani, E.

    1989-01-01

    Skeletal muscle membranes derived either from the tubular (T) network or from the sarcoplasmic reticulum (SR) were characterized with respect to the binding of the dihydropyridine, [ 3 H]PN200-110, and the alkaloid, [ 3 H]ryanodine; polypeptide composition; and ion channel activity. Conditions for optimizing the binding of these radioligands are discussed. A bilayer pulsing technique is described and is used to examine the channels present in these membranes. Fusion of T-tubule membranes into bilayers revealed the presence of chloride channels and dihydropyridine-sensitive calcium channels with three distinct conductances. The dihydropyridine-sensitive channels were further characterized with respect to their voltage dependence. Pulsing experiments indicated that two different populations of dihydropyridine-sensitive channels existed. Fusion of heavy SR vesicles revealed three different ion channels; the putative calcium release channel, a potassium channel, and a chloride channel. Thus, this fractionation procedure provides T-tubules and SR membranes which, with radioligand binding and single channel recording techniques, provide a useful tool to study the characteristics of skeletal muscle ion channels and their possible role in excitation-contraction coupling

  11. Modulation of cardiac ryanodine receptor channels by alkaline earth cations.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available Cardiac ryanodine receptor (RyR2 function is modulated by Ca(2+ and Mg(2+. To better characterize Ca(2+ and Mg(2+ binding sites involved in RyR2 regulation, the effects of cytosolic and luminal earth alkaline divalent cations (M(2+: Mg(2+, Ca(2+, Sr(2+, Ba(2+ were studied on RyR2 from pig ventricle reconstituted in bilayers. RyR2 were activated by M(2+ binding to high affinity activating sites at the cytosolic channel surface, specific for Ca(2+ or Sr(2+. This activation was interfered by Mg(2+ and Ba(2+ acting at low affinity M(2+-unspecific binding sites. When testing the effects of luminal M(2+ as current carriers, all M(2+ increased maximal RyR2 open probability (compared to Cs(+, suggesting the existence of low affinity activating M(2+-unspecific sites at the luminal surface. Responses to M(2+ vary from channel to channel (heterogeneity. However, with luminal Ba(2+or Mg(2+, RyR2 were less sensitive to cytosolic Ca(2+ and caffeine-mediated activation, openings were shorter and voltage-dependence was more marked (compared to RyR2 with luminal Ca(2+or Sr(2+. Kinetics of RyR2 with mixtures of luminal Ba(2+/Ca(2+ and additive action of luminal plus cytosolic Ba(2+ or Mg(2+ suggest luminal M(2+ differentially act on luminal sites rather than accessing cytosolic sites through the pore. This suggests the presence of additional luminal activating Ca(2+/Sr(2+-specific sites, which stabilize high P(o mode (less voltage-dependent and increase RyR2 sensitivity to cytosolic Ca(2+ activation. In summary, RyR2 luminal and cytosolic surfaces have at least two sets of M(2+ binding sites (specific for Ca(2+ and unspecific for Ca(2+/Mg(2+ that dynamically modulate channel activity and gating status, depending on SR voltage.

  12. Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

    Science.gov (United States)

    Naranjo, David; Wen, Hua; Brehm, Paul

    2015-01-01

    The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

  13. Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH.

    Science.gov (United States)

    Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Lourdel, Stéphane; Teulon, Jacques; Paulais, Marc

    2016-09-01

    ClC-K2, a member of the ClC family of Cl(-) channels and transporters, forms the major basolateral Cl(-) conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl(-) absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl(-), and Ca(2+) on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca(2+) strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl(-) has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl(-)/HCO3 (-) exchange in type B intercalated cells. © 2016 Pinelli et al.

  14. Channel Modeling

    Science.gov (United States)

    Schmitz, Arne; Schinnenburg, Marc; Gross, James; Aguiar, Ana

    For any communication system the Signal-to-Interference-plus-Noise-Ratio of the link is a fundamental metric. Recall (cf. Chapter 9) that the SINR is defined as the ratio between the received power of the signal of interest and the sum of all "disturbing" power sources (i.e. interference and noise). From information theory it is known that a higher SINR increases the maximum possible error-free transmission rate (referred to as Shannon capacity [417] of any communication system and vice versa). Conversely, the higher the SINR, the lower will be the bit error rate in practical systems. While one aspect of the SINR is the sum of all distracting power sources, another issue is the received power. This depends on the transmitted power, the used antennas, possibly on signal processing techniques and ultimately on the channel gain between transmitter and receiver.

  15. Channeling experiment

    International Nuclear Information System (INIS)

    Abelin, H.; Birgersson, L.; Widen, H.; Aagren, T.; Moreno, L.; Neretnieks, I.

    1990-07-01

    Channeling of water flow and tracer transport in real fractures in a granite body at Stripa have been investigated experimentally. The experimental site was located 360 m below the ground level. Two kinds of experiments were performed. In the single hole experiments, 20 cm diameter holes were drilled about 2.5 m into the rock in the plane of the fracture. Specially designed packers were used to inject water into the fracture in 5 cm intervals all along the fracture trace in the hole. The variation of the injection flowrates along the fracture were used to determine the transmissivity variations in the fracture plane. Detailed photographs were taken from inside the hole and the visual fracture aperture was compared with the injection flowrates in the same locations. Geostatistical methods were used to evaluate the results. Five holes were measured in great detail. In addition 7 holes were drilled and scanned by simpler packer systems. A double hole experiment was performed where two parallel holes were drilled in the same fracture plane at nearly 2 m distance. Pressure pulse tests were made between the holes in both directions. Tracers were injected in 5 locations in one hole and monitored for in many locations in the other hole. The single hole experiment and the double hole experiment show that most of the fracture planes are tight but that there are open sections which form connected channels over distances of at least 2 meters. It was also found in the double hole experiment that the investigated fracture was intersected by at least one fracture between the two holes which diverted a large amount of the injected tracers to several distant locations at the tunnel wall. (authours)

  16. Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

    Science.gov (United States)

    Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

    2012-02-14

    Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

  17. Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

    Science.gov (United States)

    Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

    2018-01-01

    Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

  18. Cortisone Dissociates the Shaker Family K Channels from their Beta Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Y.; Weng, J; Kabaleeswaran, V; Li, H; Cao, Y; Bholse, R; Zhou, M

    2008-01-01

    The Shaker family voltage-dependent potassium channels (Kv1) are expressed in a wide variety of cells and are essential for cellular excitability. In humans, loss-of-function mutations of Kv1 channels lead to hyperexcitability and are directly linked to episodic ataxia and atrial fibrillation. All Kv1 channels assemble with {Beta} subunits (Kv{Beta}s), and certain Kv{Beta}s, for example Kv{Beta}1, have an N-terminal segment that closes the channel by the N-type inactivation mechanism. In principle, dissociation of Kv{Beta}1, although never reported, should eliminate inactivation and thus potentiate Kv1 current. We found that cortisone increases rat Kv1 channel activity by binding to Kv{Beta}1. A crystal structure of the K{Beta}v-cortisone complex was solved to 1.82-{angstrom}resolution and revealed novel cortisone binding sites. Further studies demonstrated that cortisone promotes dissociation of Kv{Beta}. The new mode of channel modulation may be explored by native or synthetic ligands to fine-tune cellular excitability.

  19. Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family

    Science.gov (United States)

    2013-01-01

    Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

  20. History-dependent dynamics in a generic model of ion channels - an analytic study

    Directory of Open Access Journals (Sweden)

    Daniel Soudry

    2010-04-01

    Full Text Available Recent experiments have demonstrated that the timescale of adaptation of single neurons and ion channel populations to stimuli slows down as the length of stimulation increases; in fact, no upper bound on temporal time-scales seems to exist in such systems. Furthermore, patch clamp experiments on single ion channels have hinted at the existence of large, mostly unobservable, inactivation state spaces within a single ion channel. This raises the question of the relation between this multitude of inactivation states and the observed behavior. In this work we propose a minimal model for ion channel dynamics which does not assume any specific structure of the inactivation state space. The model is simple enough to render an analytical study possible. This leads to a clear and concise explanation of the experimentally observed exponential history-dependent relaxation in sodium channels in a voltage clamp setting, and shows that their recovery rate from slow inactivation must be voltage dependent. Furthermore, we predict that history-dependent relaxation cannot be created by overly sparse spiking activity. While the model was created with ion channel populations in mind, its simplicity and genericalness render it a good starting point for modeling similar effects in other systems, and for scaling up to higher levels such as single neurons which are also known to exhibit multiple time scales.

  1. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  2. Elementary properties of CaV1.3 Ca(2+) channels expressed in mouse cochlear inner hair cells.

    Science.gov (United States)

    Zampini, Valeria; Johnson, Stuart L; Franz, Christoph; Lawrence, Neil D; Münkner, Stefan; Engel, Jutta; Knipper, Marlies; Magistretti, Jacopo; Masetto, Sergio; Marcotti, Walter

    2010-01-01

    Mammalian cochlear inner hair cells (IHCs) are specialized to process developmental signals during immature stages and sound stimuli in adult animals. These signals are conveyed onto auditory afferent nerve fibres. Neurotransmitter release at IHC ribbon synapses is controlled by L-type Ca(V)1.3 Ca(2+) channels, the biophysics of which are still unknown in native mammalian cells. We have investigated the localization and elementary properties of Ca(2+) channels in immature mouse IHCs under near-physiological recording conditions. Ca(V)1.3 Ca(2+) channels at the cell pre-synaptic site co-localize with about half of the total number of ribbons present in immature IHCs. These channels activated at about 70 mV, showed a relatively short first latency and weak inactivation, which would allow IHCs to generate and accurately encode spontaneous Ca(2+) action potential activity characteristic of these immature cells. The Ca(V)1.3 Ca(2+) channels showed a very low open probability (about 0.15 at 20 mV: near the peak of an action potential). Comparison of elementary and macroscopic Ca(2+) currents indicated that very few Ca(2+) channels are associated with each docked vesicle at IHC ribbon synapses. Finally, we found that the open probability of Ca(2+) channels, but not their opening time, was voltage dependent. This finding provides a possible correlation between presynaptic Ca(2+) channel properties and the characteristic frequency/amplitude of EPSCs in auditory afferent fibres.

  3. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

    Science.gov (United States)

    Torres, Yolima P.; Granados, Sara T.; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca2+-activated K+ channel (BK) is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels) and a large C terminus composed of two regulators of K+ conductance domains (RCK domains), where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca2+ sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above. PMID:25346693

  4. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

    Directory of Open Access Journals (Sweden)

    Yolima P. Torres

    2014-10-01

    Full Text Available Coded by a single gene (Slo1, KCM and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca+2-activated K+ channel (BK is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels and a large C terminus composed of two regulators of K+ conductance domains (RCK domains, where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3 & β4 and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca+2 sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.

  5. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits.

    Science.gov (United States)

    Torres, Yolima P; Granados, Sara T; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca(2+) concentration, the large conductance voltage- and Ca(2+)-activated K(+) channel (BK) is unique among the superfamily of K(+) channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K(+) channels) and a large C terminus composed of two regulators of K(+) conductance domains (RCK domains), where the Ca(2+)-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca(2+) sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.

  6. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide.

    Science.gov (United States)

    Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício

    2015-02-01

    This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Structural implications of hERG K+ channel block by a high-affinity minimally structured blocker

    Science.gov (United States)

    Helliwell, Matthew V.; Zhang, Yihong; El Harchi, Aziza; Du, Chunyun; Hancox, Jules C.; Dempsey, Christopher E.

    2018-01-01

    Cardiac potassium channels encoded by human ether-à-go-go–related gene (hERG) are major targets for structurally diverse drugs associated with acquired long QT syndrome. This study characterized hERG channel inhibition by a minimally structured high-affinity hERG inhibitor, Cavalli-2, composed of three phenyl groups linked by polymethylene spacers around a central amino group, chosen to probe the spatial arrangement of side chain groups in the high-affinity drug-binding site of the hERG pore. hERG current (IhERG) recorded at physiological temperature from HEK293 cells was inhibited with an IC50 of 35.6 nm with time and voltage dependence characteristic of blockade contingent upon channel gating. Potency of Cavalli-2 action was markedly reduced for attenuated inactivation mutants located near (S620T; 54-fold) and remote from (N588K; 15-fold) the channel pore. The S6 Y652A and F656A mutations decreased inhibitory potency 17- and 75-fold, respectively, whereas T623A and S624A at the base of the selectivity filter also decreased potency (16- and 7-fold, respectively). The S5 helix F557L mutation decreased potency 10-fold, and both F557L and Y652A mutations eliminated voltage dependence of inhibition. Computational docking using the recent cryo-EM structure of an open channel hERG construct could only partially recapitulate experimental data, and the high dependence of Cavalli-2 block on Phe-656 is not readily explainable in that structure. A small clockwise rotation of the inner (S6) helix of the hERG pore from its configuration in the cryo-EM structure may be required to optimize Phe-656 side chain orientations compatible with high-affinity block. PMID:29545312

  8. Receptor model for the molecular basis of tissue selectivity of 1,4-dihydropyridine calcium channel drugs

    Science.gov (United States)

    Langs, David A.; Strong, Phyllis D.; Triggle, David J.

    1990-09-01

    Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.

  9. Ginseng gintonin activates the human cardiac delayed rectifier K+ channel: involvement of Ca2+/calmodulin binding sites.

    Science.gov (United States)

    Choi, Sun-Hye; Lee, Byung-Hwan; Kim, Hyeon-Joong; Jung, Seok-Won; Kim, Hyun-Sook; Shin, Ho-Chul; Lee, Jun-Hee; Kim, Hyoung-Chun; Rhim, Hyewhon; Hwang, Sung-Hee; Ha, Tal Soo; Kim, Hyun-Ji; Cho, Hana; Nah, Seung-Yeol

    2014-09-01

    Gintonin, a novel, ginseng-derived G protein-coupled lysophosphatidic acid (LPA) receptor ligand, elicits [Ca(2+)]i transients in neuronal and non-neuronal cells via pertussis toxin-sensitive and pertussis toxin-insensitive G proteins. The slowly activating delayed rectifier K(+) (I(Ks)) channel is a cardiac K(+) channel composed of KCNQ1 and KCNE1 subunits. The C terminus of the KCNQ1 channel protein has two calmodulin-binding sites that are involved in regulating I(Ks) channels. In this study, we investigated the molecular mechanisms of gintonin-mediated activation of human I(Ks) channel activity by expressing human I(Ks) channels in Xenopus oocytes. We found that gintonin enhances IKs channel currents in concentration- and voltage-dependent manners. The EC50 for the I(Ks) channel was 0.05 ± 0.01 μg/ml. Gintonin-mediated activation of the I(Ks) channels was blocked by an LPA1/3 receptor antagonist, an active phospholipase C inhibitor, an IP3 receptor antagonist, and the calcium chelator BAPTA. Gintonin-mediated activation of both the I(Ks) channel was also blocked by the calmodulin (CaM) blocker calmidazolium. Mutations in the KCNQ1 [Ca(2+)]i/CaM-binding IQ motif sites (S373P, W392R, or R539W)blocked the action of gintonin on I(Ks) channel. However, gintonin had no effect on hERG K(+) channel activity. These results show that gintonin-mediated enhancement of I(Ks) channel currents is achieved through binding of the [Ca(2+)]i/CaM complex to the C terminus of KCNQ1 subunit.

  10. Ion channel activity of membrane vesicles released from sea urchin sperm during the acrosome reaction

    International Nuclear Information System (INIS)

    Schulz, Joseph R.; Vega-Beltran, Jose L. de la; Beltran, Carmen; Vacquier, Victor D.; Darszon, Alberto

    2004-01-01

    The sperm acrosome reaction (AR) involves ion channel activation. In sea urchin sperm, the AR requires Ca 2+ and Na + influx and K + and H + efflux. During the AR, the plasma membrane fuses with the acrosomal vesicle membrane forming hybrid membrane vesicles that are released from sperm into the medium. This paper reports the isolation and preliminary characterization of these acrosome reaction vesicles (ARVs), using synaptosome-associated protein of 25 kDa (SNAP-25) as a marker. Isolated ARVs have a unique protein composition. The exocytosis regulatory proteins vesicle-associated membrane protein and SNAP-25 are inside ARVs, as judged by protease protection experiments, and membrane associated based on Triton X-114 partitioning. ARVs fused with planar bilayers display three main types of single channel activity. The most frequently recorded channel is cationic, weakly voltage dependent and has a low open probability that increases with negative potentials. This channel is activated by cAMP, blocked by Ba 2+ , and has a PK + /PNa + selectivity of 4.5. ARVs represent a novel membrane preparation suitable to deepen our understanding of ion channel activity in the AR and during fertilization

  11. Properties and function of KCNQ1 K+ channels isolated from the rectal gland of Squalus acanthias.

    Science.gov (United States)

    Kerst, G; Beschorner, U; Unsöld, B; von Hahn, T; Schreiber, R; Greger, R; Gerlach, U; Lang, H J; Kunzelmann, K; Bleich, M

    2001-10-01

    KCNQ1 (KVLQT1) K+ channels play an important role during electrolyte secretion in airways and colon. KCNQ1 was cloned recently from NaCl-secreting shark rectal glands. Here we study the properties and regulation of the cloned sKVLQT1 expressed in Xenopus oocytes and Chinese hamster ovary (CHO) cells and compare the results with those obtained from in vitro perfused rectal gland tubules (RGT). The expression of sKCNQ1 induced voltage-dependent, delayed activated K+ currents, which were augmented by an increase in intracellular cAMP and Ca2+. The chromanol derivatives 293B and 526B potently inhibited sKCNQ1 expressed in oocytes and CHO cells, but had little effect on RGT electrolyte transport. Short-circuit currents in RGT were activated by alkalinization and were decreased by acidification. In CHO cells an alkaline pH activated and an acidic pH inhibited 293B-sensitive KCNQ1 currents. Noise analysis of the cell-attached basolateral membrane of RGT indicated the presence of low-conductance (<3 pS) K+ channels, in parallel with other K+ channels. sKCNQ1 generated similar small-conductance K+ channels upon expression in CHO cells and Xenopus oocytes. The results suggest the presence of low-conductance KCNQ1 K+ channels in RGT, which are probably regulated by changes in intracellular cAMP, Ca2+ and pH.

  12. KV7 Channels Regulate Firing during Synaptic Integration in GABAergic Striatal Neurons

    Directory of Open Access Journals (Sweden)

    M. Belén Pérez-Ramírez

    2015-01-01

    Full Text Available Striatal projection neurons (SPNs process motor and cognitive information. Their activity is affected by Parkinson’s disease, in which dopamine concentration is decreased and acetylcholine concentration is increased. Acetylcholine activates muscarinic receptors in SPNs. Its main source is the cholinergic interneuron that responds with a briefer latency than SPNs during a cortical command. Therefore, an important question is whether muscarinic G-protein coupled receptors and their signaling cascades are fast enough to intervene during synaptic responses to regulate synaptic integration and firing. One of the most known voltage dependent channels regulated by muscarinic receptors is the KV7/KCNQ channel. It is not known whether these channels regulate the integration of suprathreshold corticostriatal responses. Here, we study the impact of cholinergic muscarinic modulation on the synaptic response of SPNs by regulating KV7 channels. We found that KV7 channels regulate corticostriatal synaptic integration and that this modulation occurs in the dendritic/spines compartment. In contrast, it is negligible in the somatic compartment. This modulation occurs on sub- and suprathreshold responses and lasts during the whole duration of the responses, hundreds of milliseconds, greatly altering SPNs firing properties. This modulation affected the behavior of the striatal microcircuit.

  13. Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

    Science.gov (United States)

    Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

    2011-05-06

    Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

  14. G-protein mediates voltage regulation of agonist binding to muscarinic receptors: effects on receptor-Na+ channel interaction

    International Nuclear Information System (INIS)

    Cohen-Armon, M.; Garty, H.; Sokolovsky, M.

    1988-01-01

    The authors previous experiments in membranes prepared from rat heart and brain led them to suggest that the binding of agonist to the muscarinic receptors and to the Na + channels is a coupled event mediated by guanine nucleotide binding protein(s) [G-protein(s)]. These in vitro findings prompted us to employ synaptoneurosomes from brain stem tissue to examine (i) the binding properties of [ 3 H] acetylcholine at resting potential and under depolarization conditions in the absence and presence of pertussis toxin; (ii) the binding of [ 3 H]batrachotoxin to Na + channel(s) in the presence of the muscarinic agonists; and (iii) muscarinically induced 22 Na + uptake in the presence and absence of tetrodotoxin, which blocks Na + channels. The findings indicate that agonist binding to muscarinic receptors is voltage dependent, that this process is mediated by G-protein(s), and that muscarinic agonists induce opening of Na + channels. The latter process persists even after pertussis toxin treatment, indicating that it is not likely to be mediated by pertussis toxin sensitive G-protein(s). The system with its three interacting components-receptor, G-protein, and Na + channel-is such that at resting potential the muscarinic receptor induces opening of Na + channels; this property may provide a possible physiological mechanism for the depolarization stimulus necessary for autoexcitation or repetitive firing in heart or brain tissues

  15. Discovery of talatisamine as a novel specific blocker for the delayed rectifier K+ channels in rat hippocampal neurons.

    Science.gov (United States)

    Song, M-K; Liu, H; Jiang, H-L; Yue, J-M; Hu, G-Y; Chen, H-Z

    2008-08-13

    Blocking specific K+ channels has been proposed as a promising strategy for the treatment of neurodegenerative diseases. Using a computational virtual screening approach and electrophysiological testing, we found four Aconitum alkaloids are potent blockers of the delayed rectifier K+ channel in rat hippocampal neurons. In the present study, we first tested the action of the four alkaloids on the voltage-gated K+, Na+ and Ca2+ currents in rat hippocampal neurons, and then identified that talatisamine is a specific blocker for the delayed rectifier K+ channel. External application of talatisamine reversibly inhibited the delayed rectifier K+ current (IK) with an IC50 value of 146.0+/-5.8 microM in a voltage-dependent manner, but exhibited very slight blocking effect on the voltage-gated Na+ and Ca2+ currents even at the high concentration of 1-3 mM. Moreover, talatisamine exerted a significant hyperpolarizing shift of the steady-state activation, but did not influence the steady state inactivation of IK and its recovery from inactivation, suggesting that talatisamine had no allosteric action on IK channel and was a pure blocker binding to the external pore entry of the channel. Our present study made the first discovery of potent and specific IK channel blocker from Aconitum alkaloids. It has been argued that suppressing K+ efflux by blocking IK channel may be favorable for Alzheimer's disease therapy. Talatisamine can therefore be considered as a leading compound worthy of further investigations.

  16. Bupivacaine inhibits large conductance, voltage- and Ca2+- activated K+ channels in human umbilical artery smooth muscle cells

    Science.gov (United States)

    Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica

    2012-01-01

    Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134

  17. Diclofenac Distinguishes among Homomeric and Heteromeric Potassium Channels Composed of KCNQ4 and KCNQ5 SubunitsS⃞

    Science.gov (United States)

    Brueggemann, Lioubov I.; Mackie, Alexander R.; Martin, Jody L.; Cribbs, Leanne L.

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V0.5 values: −31, −44, and −38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels. PMID:20876743

  18. The function and molecular identity of inward rectifier channels in vestibular hair cells of the mouse inner ear

    Science.gov (United States)

    Levin, Michaela E.

    2012-01-01

    Inner ear hair cells respond to mechanical stimuli with graded receptor potentials. These graded responses are modulated by a host of voltage-dependent currents that flow across the basolateral membrane. Here, we examine the molecular identity and the function of a class of voltage-dependent ion channels that carries the potassium-selective inward rectifier current known as IK1. IK1 has been identified in vestibular hair cells of various species, but its molecular composition and functional contributions remain obscure. We used quantitative RT-PCR to show that the inward rectifier gene, Kir2.1, is highly expressed in mouse utricle between embryonic day 15 and adulthood. We confirmed Kir2.1 protein expression in hair cells by immunolocalization. To examine the molecular composition of IK1, we recorded voltage-dependent currents from type II hair cells in response to 50-ms steps from −124 to −54 in 10-mV increments. Wild-type cells had rapidly activating inward currents with reversal potentials close to the K+ equilibrium potential and a whole-cell conductance of 4.8 ± 1.5 nS (n = 46). In utricle hair cells from Kir2.1-deficient (Kir2.1−/−) mice, IK1 was absent at all stages examined. To identify the functional contribution of Kir2.1, we recorded membrane responses in current-clamp mode. Hair cells from Kir2.1−/− mice had significantly (P < 0.001) more depolarized resting potentials and larger, slower membrane responses than those of wild-type cells. These data suggest that Kir2.1 is required for IK1 in type II utricle hair cells and contributes to hyperpolarized resting potentials and fast, small amplitude receptor potentials in response to current inputs, such as those evoked by hair bundle deflections. PMID:22496522

  19. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  20. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  1. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  2. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  3. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  4. Citizens and service channels: channel choice and channel management implications

    NARCIS (Netherlands)

    Pieterson, Willem Jan

    2010-01-01

    The arrival of electronic channels in the 1990s has had a huge impact on governmental service delivery. The new channels have led to many new opportunities to improve public service delivery, not only in terms of citizen satisfaction, but also in cost reduction for governmental agencies. However,

  5. Cerebrovascular endothelin-1 hyper-reactivity is associated with transient receptor potential canonical channels 1 and 6 activation and delayed cerebral hypoperfusion after forebrain ischaemia in rats

    DEFF Research Database (Denmark)

    Johansson, S E; Andersen, X E D R; Hansen, R H

    2015-01-01

    . METHODS: Experimental forebrain ischaemia was induced in Wistar male rats by a two-vessel occlusion model, and the cerebral blood flow was measured by magnetic resonance imaging two days after reperfusion. In vitro vasoreactivity studies, immunofluorescence and quantitative PCR were performed on cerebral...... in the vascular smooth muscle cells was enhanced and correlated with decreased cerebral blood flow two days after forebrain ischaemia. Furthermore, under conditions when voltage-dependent calcium channels were inhibited, endothelin-1-induced cerebrovascular contraction was enhanced and this enhancement...... was presumably mediated by Ca(2+) influx via upregulated transient receptor potential canonical channels 1 and 6. CONCLUSIONS: Our data demonstrates that endothelin-1-mediated influx of extracellular Ca(2+) activates transient receptor potential canonical channels 1 and 6 in cerebral vascular smooth muscle cells...

  6. MarkoLAB: A simulator to study ionic channel's stochastic behavior.

    Science.gov (United States)

    da Silva, Robson Rodrigues; Goroso, Daniel Gustavo; Bers, Donald M; Puglisi, José Luis

    2017-08-01

    Mathematical models of the cardiac cell have started to include markovian representations of the ionic channels instead of the traditional Hodgkin & Huxley formulations. There are many reasons for this: Markov models are not restricted to the idea of independent gates defining the channel, they allow more complex description with specific transitions between open, closed or inactivated states, and more importantly those states can be closely related to the underlying channel structure and conformational changes. We used the LabVIEW ® and MATLAB ® programs to implement the simulator MarkoLAB that allow a dynamical 3D representation of the markovian model of the channel. The Monte Carlo simulation was used to implement the stochastic transitions among states. The user can specify the voltage protocol by setting the holding potential, the step-to voltage and the duration of the stimuli. The most studied feature of a channel is the current flowing through it. This happens when the channel stays in the open state, but most of the time, as revealed by the low open probability values, the channel remains on the inactive or closed states. By focusing only when the channel enters or leaves the open state we are missing most of its activity. MarkoLAB proved to be quite useful to visualize the whole behavior of the channel and not only when the channel produces a current. Such dynamic representation provides more complete information about channel kinetics and will be a powerful tool to demonstrate the effect of gene mutations or drugs on the channel function. MarkoLAB provides an original way of visualizing the stochastic behavior of a channel. It clarifies concepts, such as recovery from inactivation, calcium- versus voltage-dependent inactivation, and tail currents. It is not restricted to ionic channels only but it can be extended to other transporters, such as exchangers and pumps. This program is intended as a didactical tool to illustrate the dynamical behavior of a

  7. Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain.

    Science.gov (United States)

    Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A

    2006-06-21

    Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.

  8. Heteromeric Kv7.2/7.3 channels differentially regulate action potential initiation and conduction in neocortical myelinated axons.

    Science.gov (United States)

    Battefeld, Arne; Tran, Baouyen T; Gavrilis, Jason; Cooper, Edward C; Kole, Maarten H P

    2014-03-05

    Rapid energy-efficient signaling along vertebrate axons is achieved through intricate subcellular arrangements of voltage-gated ion channels and myelination. One recently appreciated example is the tight colocalization of K(v)7 potassium channels and voltage-gated sodium (Na(v)) channels in the axonal initial segment and nodes of Ranvier. The local biophysical properties of these K(v)7 channels and the functional impact of colocalization with Na(v) channels remain poorly understood. Here, we quantitatively examined K(v)7 channels in myelinated axons of rat neocortical pyramidal neurons using high-resolution confocal imaging and patch-clamp recording. K(v)7.2 and 7.3 immunoreactivity steeply increased within the distal two-thirds of the axon initial segment and was mirrored by the conductance density estimates, which increased from ~12 (proximal) to 150 pS μm(-2) (distal). The axonal initial segment and nodal M-currents were similar in voltage dependence and kinetics, carried by K(v)7.2/7.3 heterotetramers, 4% activated at the resting membrane potential and rapidly activated with single-exponential time constants (~15 ms at 28 mV). Experiments and computational modeling showed that while somatodendritic K(v)7 channels are strongly activated by the backpropagating action potential to attenuate the afterdepolarization and repetitive firing, axonal K(v)7 channels are minimally recruited by the forward-propagating action potential. Instead, in nodal domains K(v)7.2/7.3 channels were found to increase Na(v) channel availability and action potential amplitude by stabilizing the resting membrane potential. Thus, K(v)7 clustering near axonal Na(v) channels serves specific and context-dependent roles, both restraining initiation and enhancing conduction of the action potential.

  9. PRRT2 controls neuronal excitability by negatively modulating Na+ channel 1.2/1.6 activity.

    Science.gov (United States)

    Fruscione, Floriana; Valente, Pierluigi; Sterlini, Bruno; Romei, Alessandra; Baldassari, Simona; Fadda, Manuela; Prestigio, Cosimo; Giansante, Giorgia; Sartorelli, Jacopo; Rossi, Pia; Rubio, Alicia; Gambardella, Antonio; Nieus, Thierry; Broccoli, Vania; Fassio, Anna; Baldelli, Pietro; Corradi, Anna; Zara, Federico; Benfenati, Fabio

    2018-04-01

    See Lerche (doi:10.1093/brain/awy073) for a scientific commentary on this article.Proline-rich transmembrane protein 2 (PRRT2) is the causative gene for a heterogeneous group of familial paroxysmal neurological disorders that include seizures with onset in the first year of life (benign familial infantile seizures), paroxysmal kinesigenic dyskinesia or a combination of both. Most of the PRRT2 mutations are loss-of-function leading to haploinsufficiency and 80% of the patients carry the same frameshift mutation (c.649dupC; p.Arg217Profs*8), which leads to a premature stop codon. To model the disease and dissect the physiological role of PRRT2, we studied the phenotype of neurons differentiated from induced pluripotent stem cells from previously described heterozygous and homozygous siblings carrying the c.649dupC mutation. Single-cell patch-clamp experiments on induced pluripotent stem cell-derived neurons from homozygous patients showed increased Na+ currents that were fully rescued by expression of wild-type PRRT2. Closely similar electrophysiological features were observed in primary neurons obtained from the recently characterized PRRT2 knockout mouse. This phenotype was associated with an increased length of the axon initial segment and with markedly augmented spontaneous and evoked firing and bursting activities evaluated, at the network level, by multi-electrode array electrophysiology. Using HEK-293 cells stably expressing Nav channel subtypes, we demonstrated that the expression of PRRT2 decreases the membrane exposure and Na+ current of Nav1.2/Nav1.6, but not Nav1.1, channels. Moreover, PRRT2 directly interacted with Nav1.2/Nav1.6 channels and induced a negative shift in the voltage-dependence of inactivation and a slow-down in the recovery from inactivation. In addition, by co-immunoprecipitation assays, we showed that the PRRT2-Nav interaction also occurs in brain tissue. The study demonstrates that the lack of PRRT2 leads to a hyperactivity of voltage-dependent

  10. PRRT2 controls neuronal excitability by negatively modulating Na+ channel 1.2/1.6 activity

    Science.gov (United States)

    Fruscione, Floriana; Valente, Pierluigi; Sterlini, Bruno; Romei, Alessandra; Baldassari, Simona; Fadda, Manuela; Prestigio, Cosimo; Giansante, Giorgia; Sartorelli, Jacopo; Rossi, Pia; Rubio, Alicia; Gambardella, Antonio; Nieus, Thierry; Broccoli, Vania; Fassio, Anna; Baldelli, Pietro; Corradi, Anna; Zara, Federico

    2018-01-01

    Abstract See Lerche (doi:10.1093/brain/awy073) for a scientific commentary on this article. Proline-rich transmembrane protein 2 (PRRT2) is the causative gene for a heterogeneous group of familial paroxysmal neurological disorders that include seizures with onset in the first year of life (benign familial infantile seizures), paroxysmal kinesigenic dyskinesia or a combination of both. Most of the PRRT2 mutations are loss-of-function leading to haploinsufficiency and 80% of the patients carry the same frameshift mutation (c.649dupC; p.Arg217Profs*8), which leads to a premature stop codon. To model the disease and dissect the physiological role of PRRT2, we studied the phenotype of neurons differentiated from induced pluripotent stem cells from previously described heterozygous and homozygous siblings carrying the c.649dupC mutation. Single-cell patch-clamp experiments on induced pluripotent stem cell-derived neurons from homozygous patients showed increased Na+ currents that were fully rescued by expression of wild-type PRRT2. Closely similar electrophysiological features were observed in primary neurons obtained from the recently characterized PRRT2 knockout mouse. This phenotype was associated with an increased length of the axon initial segment and with markedly augmented spontaneous and evoked firing and bursting activities evaluated, at the network level, by multi-electrode array electrophysiology. Using HEK-293 cells stably expressing Nav channel subtypes, we demonstrated that the expression of PRRT2 decreases the membrane exposure and Na+ current of Nav1.2/Nav1.6, but not Nav1.1, channels. Moreover, PRRT2 directly interacted with Nav1.2/Nav1.6 channels and induced a negative shift in the voltage-dependence of inactivation and a slow-down in the recovery from inactivation. In addition, by co-immunoprecipitation assays, we showed that the PRRT2-Nav interaction also occurs in brain tissue. The study demonstrates that the lack of PRRT2 leads to a hyperactivity of

  11. Functional roles of the amino terminal domain in determining biophysical properties of Cx50 gap junction channels

    Directory of Open Access Journals (Sweden)

    Li eXin

    2013-12-01

    Full Text Available Communication through gap junction channels is essential for synchronized and coordinated cellular activities. The gap junction channel pore size, its switch control for opening/closing, and the modulations by chemicals can be different depending on the connexin subtypes that compose the channel. Recent structural and functional studies provide compelling evidence that the amino terminal (NT domains of several connexins line the pore of gap junction channels and play an important role in single channel conductance (γj and transjunctional voltage-dependent gating (Vj-gating. This article reviews recent studies conducted on a series of mutations/chimeras in the NT domain of connexin50 (Cx50. Functional examination of the gap junction channels formed by these mutants/chimeras shows the net charge number at the NT domain to be an important factor in γj and in Vj-gating. Furthermore, with an increase in the net negative charge at the NT domain, we observed an increase in the γj, as well as changes in the parameters of the Boltzmann fit of the normalized steady-state conductance and Vj relationship. Our data are consistent with a structural model where the NT domain of Cx50 lines the gap junction pore and plays an important role in sensing Vj and in the subsequent conformational changes leading to gating, as well as in limiting the rate of ion permeation.

  12. Propylparaben reduces the excitability of hippocampal neurons by blocking sodium channels.

    Science.gov (United States)

    Lara-Valderrábano, Leonardo; Rocha, Luisa; Galván, Emilio J

    2016-12-01

    Propylparaben (PPB) is an antimicrobial preservative widely used in food, cosmetics, and pharmaceutics. Virtual screening methodologies predicted anticonvulsant activity of PPB that was confirmed in vivo. Thus, we explored the effects of PPB on the excitability of hippocampal neurons by using standard patch clamp techniques. Bath perfusion of PPB reduced the fast-inactivating sodium current (I Na ) amplitude, causing a hyperpolarizing shift in the inactivation curve of the I Na, and markedly delayed the sodium channel recovery from the inactivation state. Also, PPB effectively suppressed the riluzole-sensitive, persistent sodium current (I NaP ). PPB perfusion also modified the action potential kinetics, and higher concentrations of PPB suppressed the spike activity. Nevertheless, the modulatory effects of PPB did not occur when PPB was internally applied by whole-cell dialysis. These results indicate that PPB reduces the excitability of CA1 pyramidal neurons by modulating voltage-dependent sodium channels. The mechanistic basis of this effect is a marked delay in the recovery from inactivation state of the voltage-sensitive sodium channels. Our results indicate that similar to local anesthetics and anticonvulsant drugs that act on sodium channels, PPB acts in a use-dependent manner. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  14. Inversion of membrane surface charge by trivalent cations probed with a cation-selective channel.

    Science.gov (United States)

    Gurnev, Philip A; Bezrukov, Sergey M

    2012-11-13

    We demonstrate that the cation-selective channel formed by gramicidin A can be used as a reliable sensor for studying the multivalent ion accumulation at the surfaces of charged lipid membranes and the "charge inversion" phenomenon. In asymmetrically charged membranes with the individual leaflets formed from pure negative and positive lipids bathed by 0.1 M CsCl solutions the channel exhibits current rectification, which is comparable to that of a typical n/p semiconductor diode. We show that even at these highly asymmetrical conditions the channel conductance can be satisfactorily described by the electrodiffusion equation in the constant field approximation but, due to predictable limitations, only when the applied voltages do not exceed 50 mV. Analysis of the changes in the voltage-dependent channel conductance upon addition of trivalent cations allows us to gauge their interactions with the membrane surface. The inversion of the sign of the effective surface charge takes place at the concentrations, which correlate with the cation size. Specifically, these concentrations are close to 0.05 mM for lanthanum, 0.25 mM for hexaamminecobalt, and 4 mM for spermidine.

  15. Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

    Science.gov (United States)

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

    2016-02-25

    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Cryo-EM structures of the TMEM16A calcium-activated chloride channel.

    Science.gov (United States)

    Dang, Shangyu; Feng, Shengjie; Tien, Jason; Peters, Christian J; Bulkley, David; Lolicato, Marco; Zhao, Jianhua; Zuberbühler, Kathrin; Ye, Wenlei; Qi, Lijun; Chen, Tingxu; Craik, Charles S; Jan, Yuh Nung; Minor, Daniel L; Cheng, Yifan; Jan, Lily Yeh

    2017-12-21

    Calcium-activated chloride channels (CaCCs) encoded by TMEM16A control neuronal signalling, smooth muscle contraction, airway and exocrine gland secretion, and rhythmic movements of the gastrointestinal system. To understand how CaCCs mediate and control anion permeation to fulfil these physiological functions, knowledge of the mammalian TMEM16A structure and identification of its pore-lining residues are essential. TMEM16A forms a dimer with two pores. Previous CaCC structural analyses have relied on homology modelling of a homologue (nhTMEM16) from the fungus Nectria haematococca that functions primarily as a lipid scramblase, as well as subnanometre-resolution electron cryo-microscopy. Here we present de novo atomic structures of the transmembrane domains of mouse TMEM16A in nanodiscs and in lauryl maltose neopentyl glycol as determined by single-particle electron cryo-microscopy. These structures reveal the ion permeation pore and represent different functional states. The structure in lauryl maltose neopentyl glycol has one Ca 2+ ion resolved within each monomer with a constricted pore; this is likely to correspond to a closed state, because a CaCC with a single Ca 2+ occupancy requires membrane depolarization in order to open (C.J.P. et al., manuscript submitted). The structure in nanodiscs has two Ca 2+ ions per monomer and its pore is in a closed conformation; this probably reflects channel rundown, which is the gradual loss of channel activity that follows prolonged CaCC activation in 1 mM Ca 2+ . Our mutagenesis and electrophysiological studies, prompted by analyses of the structures, identified ten residues distributed along the pore that interact with permeant anions and affect anion selectivity, as well as seven pore-lining residues that cluster near pore constrictions and regulate channel gating. Together, these results clarify the basis of CaCC anion conduction.

  17. The Importance of the Dissociation Rate in Ion Channel Blocking

    Directory of Open Access Journals (Sweden)

    Hugo Zeberg

    2018-02-01

    Full Text Available Understanding the relationships between the rates and dynamics of current wave forms under voltage clamp conditions is essential for understanding phenomena such as state-dependence and use-dependence, which are fundamental for the action of drugs used as anti-epileptics, anti-arrhythmics, and anesthetics. In the present study, we mathematically analyze models of blocking mechanisms. In previous experimental studies of potassium channels we have shown that the effect of local anesthetics can be explained by binding to channels in the open state. We therefore here examine models that describe the effect of a blocking drug that binds to a non-inactivating channel in its open state. Such binding induces an inactivation-like current decay at higher potential steps. The amplitude of the induced peak depends on voltage and concentration of blocking drug. In the present study, using analytical methods, we (i derive a criterion for the existence of a peak in the open probability time evolution for a model with an arbitrary number of closed states, (ii derive formula for the relative height of the peak amplitude, and (iii determine the voltage dependence of the relative peak height. Two findings are apparent: (1 the dissociation (unbinding rate constant is important for the existence of a peak in the current waveform, while the association (binding rate constant is not, and (2 for a peak to exist it suffices that the dissociation rate must be smaller than the absolute value of all eigenvalues to the kinetic matrix describing the model.

  18. USACE Navigation Channels 2012

    Data.gov (United States)

    California Natural Resource Agency — This dataset represents both San Francisco and Los Angeles District navigation channel lines. All San Francisco District channel lines were digitized from CAD files...

  19. Calcium channel blocker overdose

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002580.htm Calcium-channel blocker overdose To use the sharing features on this page, please enable JavaScript. Calcium-channel blockers are a type of medicine used ...

  20. The action of blocking agents applied to the inner face of Ca(2+)-activated K+ channels from human erythrocytes.

    Science.gov (United States)

    Dunn, P M

    1998-09-15

    The actions of clotrimazole and cetiedil, two drugs known to inhibit the Gardos channel, have been studied on single intermediate conductance calcium-activated potassium (IKCa) channels in inside out patches from human red blood cells, and compared with those of TEA and Ba2+ applied to the cytoplasmic face of the membrane. TEA produced a fast block which was observed as a reduction in the amplitude of the single channel current. This effect was weakly voltage dependent with the fraction of the membrane potential sensed by TEA at its binding site (delta) of 0.18 and a Kd at 0 mV of 20.5 mM. Ba2+ was a very potent blocker of the channel, breaking the single channel activity up into bursts, inter-spersed with silent periods lasting several seconds. The effect of Ba2+ was very voltage sensitive, delta = 0.44, and a Kd at 0 mV of 0.15 microM. Clotrimazole applied to the inner face of the membrane at a concentration block resulting in bursts of channel activity separated by quiescent periods lasting many seconds. The effect of clotrimazole was mimicked by a quaternary derivative UCL 1559, in keeping with an action at the cytoplasmic face of the channel. A high concentration of cetiedil (100 microM) produced only a weak block of the channel. The kinetics of this action were very slow, with burst and inter-burst intervals lasting several minutes. While inhibition of the Gardos channel by cetiedil is unlikely to involve an intracellular site of action, if clotrimazole is able to penetrate the membrane, part of its effect may result from binding to an intracellular site on the channel.

  1. Differential association of GABAB receptors with their effector ion channels in Purkinje cells.

    Science.gov (United States)

    Luján, Rafael; Aguado, Carolina; Ciruela, Francisco; Cózar, Javier; Kleindienst, David; de la Ossa, Luis; Bettler, Bernhard; Wickman, Kevin; Watanabe, Masahiko; Shigemoto, Ryuichi; Fukazawa, Yugo

    2018-04-01

    Metabotropic GABA B receptors mediate slow inhibitory effects presynaptically and postsynaptically through the modulation of different effector signalling pathways. Here, we analysed the distribution of GABA B receptors using highly sensitive SDS-digested freeze-fracture replica labelling in mouse cerebellar Purkinje cells. Immunoreactivity for GABA B1 was observed on presynaptic and, more abundantly, on postsynaptic compartments, showing both scattered and clustered distribution patterns. Quantitative analysis of immunoparticles revealed a somato-dendritic gradient, with the density of immunoparticles increasing 26-fold from somata to dendritic spines. To understand the spatial relationship of GABA B receptors with two key effector ion channels, the G protein-gated inwardly rectifying K + (GIRK/Kir3) channel and the voltage-dependent Ca 2+ channel, biochemical and immunohistochemical approaches were performed. Co-immunoprecipitation analysis demonstrated that GABA B receptors co-assembled with GIRK and Ca V 2.1 channels in the cerebellum. Using double-labelling immunoelectron microscopic techniques, co-clustering between GABA B1 and GIRK2 was detected in dendritic spines, whereas they were mainly segregated in the dendritic shafts. In contrast, co-clustering of GABA B1 and Ca V 2.1 was detected in dendritic shafts but not spines. Presynaptically, although no significant co-clustering of GABA B1 and GIRK2 or Ca V 2.1 channels was detected, inter-cluster distance for GABA B1 and GIRK2 was significantly smaller in the active zone than in the dendritic shafts, and that for GABA B1 and Ca V 2.1 was significantly smaller in the active zone than in the dendritic shafts and spines. Thus, GABA B receptors are associated with GIRK and Ca V 2.1 channels in different subcellular compartments. These data provide a better framework for understanding the different roles played by GABA B receptors and their effector ion channels in the cerebellar network.

  2. Targeted deletion of Kcne2 impairs HCN channel function in mouse thalamocortical circuits.

    Directory of Open Access Journals (Sweden)

    Shui-Wang Ying

    Full Text Available Hyperpolarization-activated, cyclic nucleotide-gated (HCN channels generate the pacemaking current, I(h, which regulates neuronal excitability, burst firing activity, rhythmogenesis, and synaptic integration. The physiological consequence of HCN activation depends on regulation of channel gating by endogenous modulators and stabilization of the channel complex formed by principal and ancillary subunits. KCNE2 is a voltage-gated potassium channel ancillary subunit that also regulates heterologously expressed HCN channels; whether KCNE2 regulates neuronal HCN channel function is unknown.We investigated the effects of Kcne2 gene deletion on I(h properties and excitability in ventrobasal (VB and cortical layer 6 pyramidal neurons using brain slices prepared from Kcne2(+/+ and Kcne2(-/- mice. Kcne2 deletion shifted the voltage-dependence of I(h activation to more hyperpolarized potentials, slowed gating kinetics, and decreased I(h density. Kcne2 deletion was associated with a reduction in whole-brain expression of both HCN1 and HCN2 (but not HCN4, although co-immunoprecipitation from whole-brain lysates failed to detect interaction of KCNE2 with HCN1 or 2. Kcne2 deletion also increased input resistance and temporal summation of subthreshold voltage responses; this increased intrinsic excitability enhanced burst firing in response to 4-aminopyridine. Burst duration increased in corticothalamic, but not thalamocortical, neurons, suggesting enhanced cortical excitatory input to the thalamus; such augmented excitability did not result from changes in glutamate release machinery since miniature EPSC frequency was unaltered in Kcne2(-/- neurons.Loss of KCNE2 leads to downregulation of HCN channel function associated with increased excitability in neurons in the cortico-thalamo-cortical loop. Such findings further our understanding of the normal physiology of brain circuitry critically involved in cognition and have implications for our understanding of

  3. Quantum Channels With Memory

    International Nuclear Information System (INIS)

    Rybar, T.

    2012-01-01

    Quantum memory channels represent a very general, yet simple and comprehensible model for causal processes. As such they have attracted considerable research interest, mostly aimed on their transfer capabilities and structure properties. Most notably it was shown that memory channels can be implemented via physically naturally motivated collision models. We also define the concept of repeatable channels and show that only unital channels can be implemented repeat ably with pure memory channels. In the special case of qubit channels we also show that every unital qubit channel has a repeatable implementation. We also briefly explore the possibilities of stroboscopical simulation of channels and show that all random unitary channels can be stroboscopically simulated. Particularly in qubit case, all indivisible qubit channels are also random unitary, hence for qubit all indivisible channels can be stroboscopically simulated. Memory channels also naturally capture the framework of correlated experiments. We develop methods to gather and interpret data obtained in such setting and in detail examine the two qubit case. We also show that for control unitary interactions the measured data will never contradict a simple unitary evolution. Thus no memory effects can be spotted then. (author)

  4. Eight channel fast scalar

    Energy Technology Data Exchange (ETDEWEB)

    Waddoup, W D; Stubbs, R J [Durham Univ. (UK)

    1977-11-01

    An eight channel 64-bit scaler has been constructed with a static CMOS memory. Scaling frequencies are independently variable, at each channel, as are the number of bits/channel. The scaler, when used in conjunction with a multichannel charge to time converter results in a very flexible, gated multichannel ADC.

  5. KV7 potassium channels

    DEFF Research Database (Denmark)

    Stott, Jennifer B; Jepps, Thomas Andrew; Greenwood, Iain A

    2014-01-01

    Potassium channels are key regulators of smooth muscle tone, with increases in activity resulting in hyperpolarisation of the cell membrane, which acts to oppose vasoconstriction. Several potassium channels exist within smooth muscle, but the KV7 family of voltage-gated potassium channels have been...

  6. Differential state-dependent modification of rat Na{sub v}1.6 sodium channels expressed in human embryonic kidney (HEK293) cells by the pyrethroid insecticides tefluthrin and deltamethrin

    Energy Technology Data Exchange (ETDEWEB)

    He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456 (United States)

    2011-12-15

    We expressed rat Na{sub v}1.6 sodium channels in combination with the rat {beta}1 and {beta}2 auxiliary subunits in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on expressed sodium currents using the whole-cell patch clamp technique. Both pyrethroids produced concentration-dependent, resting modification of Na{sub v}1.6 channels, prolonging the kinetics of channel inactivation and deactivation to produce persistent 'late' currents during depolarization and tail currents following repolarization. Both pyrethroids also produced concentration dependent hyperpolarizing shifts in the voltage dependence of channel activation and steady-state inactivation. Maximal shifts in activation, determined from the voltage dependence of the pyrethroid-induced late and tail currents, were {approx} 25 mV for tefluthrin and {approx} 20 mV for deltamethrin. The highest attainable concentrations of these compounds also caused shifts of {approx} 5-10 mV in the voltage dependence of steady-state inactivation. In addition to their effects on the voltage dependence of inactivation, both compounds caused concentration-dependent increases in the fraction of sodium current that was resistant to inactivation following strong depolarizing prepulses. We assessed the use-dependent effects of tefluthrin and deltamethrin on Na{sub v}1.6 channels by determining the effect of trains of 1 to 100 5-ms depolarizing prepulses at frequencies of 20 or 66.7 Hz on the extent of channel modification. Repetitive depolarization at either frequency increased modification by deltamethrin by {approx} 2.3-fold but had no effect on modification by tefluthrin. Tefluthrin and deltamethrin were equally potent as modifiers of Na{sub v}1.6 channels in HEK293 cells using the conditions producing maximal modification as the basis for comparison. These findings show that the actions of tefluthrin and deltamethrin of Na{sub v}1.6 channels

  7. Fine Channel Networks

    Science.gov (United States)

    1997-01-01

    A color image of fine channel networks on Mars; north toward top. The scene shows heavily cratered highlands dissected by dendritic open channel networks that dissect steep slopes of impact crater walls. This image is a composite of Viking high-resolution images in black and white and low-resolution images in color. The image extends from latitude 9 degrees S. to 5 degrees S. and from longitude 312 degrees to 320 degrees; Mercator projection. The dendritic pattern of the fine channels and their location on steep slopes leads to the interpretation that these are runoff channels. The restriction of these types of channels to ancient highland rocks suggests that these channels are old and date from a time on Mars when conditions existed for precipitation to actively erode rocks. After the channels reach a low plain, they appear to end. Termination may have resulted from burial by younger deposits or perhaps the flows percolated into the surface materials and continued underground.

  8. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  9. Biphasic somatic A-type K channel downregulation mediates intrinsic plasticity in hippocampal CA1 pyramidal neurons.

    Directory of Open Access Journals (Sweden)

    Sung-Cherl Jung

    2009-08-01

    Full Text Available Since its original description, the induction of synaptic long-term potentiation (LTP has been known to be accompanied by a lasting increase in the intrinsic excitability (intrinsic plasticity of hippocampal neurons. Recent evidence shows that dendritic excitability can be enhanced by an activity-dependent decrease in the activity of A-type K(+ channels. In the present manuscript, we examined the role of A-type K(+ channels in regulating intrinsic excitability of CA1 pyramidal neurons of the hippocampus after synapse-specific LTP induction. In electrophysiological recordings we found that LTP induced a potentiation of excitability which was accompanied by a two-phased change in A-type K(+ channel activity recorded in nucleated patches from organotypic slices of rat hippocampus. Induction of LTP resulted in an immediate but short lasting hyperpolarization of the voltage-dependence of steady-state A-type K(+ channel inactivation along with a progressive, long-lasting decrease in peak A-current density. Blocking clathrin-mediated endocytosis prevented the A-current decrease and most measures of intrinsic plasticity. These results suggest that two temporally distinct but overlapping mechanisms of A-channel downregulation together contribute to the plasticity of intrinsic excitability. Finally we show that intrinsic plasticity resulted in a global enhancement of EPSP-spike coupling.

  10. Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors.

    Science.gov (United States)

    Mälkiä, Annika; Madrid, Rodolfo; Meseguer, Victor; de la Peña, Elvira; Valero, María; Belmonte, Carlos; Viana, Félix

    2007-05-15

    TRPM8, a member of the melastatin subfamily of transient receptor potential (TRP) cation channels, is activated by voltage, low temperatures and cooling compounds. These properties and its restricted expression to small sensory neurons have made it the ion channel with the most advocated role in cold transduction. Recent work suggests that activation of TRPM8 by cold and menthol takes place through shifts in its voltage-activation curve, which cause the channel to open at physiological membrane potentials. By contrast, little is known about the actions of inhibitors on the function of TRPM8. We investigated the chemical and thermal modulation of TRPM8 in transfected HEK293 cells and in cold-sensitive primary sensory neurons. We show that cold-evoked TRPM8 responses are effectively suppressed by inhibitor compounds SKF96365, 4-(3-chloro-pyridin-2-yl)-piperazine-1-carboxylic acid (4-tert-butyl-phenyl)-amide (BCTC) and 1,10-phenanthroline. These antagonists exert their effect by shifting the voltage dependence of TRPM8 activation towards more positive potentials. An opposite shift towards more negative potentials is achieved by the agonist menthol. Functionally, the bidirectional shift in channel gating translates into a change in the apparent temperature threshold of TRPM8-expressing cells. Accordingly, in the presence of the antagonist compounds, the apparent response-threshold temperature of TRPM8 is displaced towards colder temperatures, whereas menthol sensitizes the response, shifting the threshold in the opposite direction. Co-application of agonists and antagonists produces predictable cancellation of these effects, suggesting the convergence on a common molecular process. The potential for half maximal activation of TRPM8 activation by cold was approximately 140 mV more negative in native channels compared to recombinant channels, with a much higher open probability at negative membrane potentials in the former. In functional terms, this difference translates

  11. Impact of Dendrimer Terminal Group Chemistry on Blockage of the Anthrax Toxin Channel: A Single Molecule Study.

    Science.gov (United States)

    Yamini, Goli; Kalu, Nnanya; Nestorovich, Ekaterina M

    2016-11-15

    Nearly all the cationic molecules tested so far have been shown to reversibly block K⁺ current through the cation-selective PA 63 channels of anthrax toxin in a wide nM-mM range of effective concentrations. A significant increase in channel-blocking activity of the cationic compounds was achieved when multiple copies of positively charged ligands were covalently linked to multivalent scaffolds, such as cyclodextrins and dendrimers. Even though multivalent binding can be strong when the individual bonds are relatively weak, for drug discovery purposes we often strive to design multivalent compounds with high individual functional group affinity toward the respective binding site on a multivalent target. Keeping this requirement in mind, here we perform a single-channel/single-molecule study to investigate kinetic parameters of anthrax toxin PA 63 channel blockage by second-generation (G2) poly(amido amine) (PAMAM) dendrimers functionalized with different surface ligands, including G2-NH₂, G2-OH, G2-succinamate, and G2-COONa. We found that the previously reported difference in IC 50 values of the G2-OH/PA 63 and G2-NH₂/PA 63 binding was determined by both on- and off-rates of the reversible dendrimer/channel binding reaction. In 1 M KCl, we observed a decrease of about three folds in k o n and a decrease of only about ten times in t r e s with G2-OH compared to G2-NH₂. At the same time for both blockers, k o n and t r e s increased dramatically with transmembrane voltage increase. PAMAM dendrimers functionalized with negatively charged succinamate, but not carboxyl surface groups, still had some residual activity in inhibiting the anthrax toxin channels. At 100 mV, the on-rate of the G2-succinamate binding was comparable with that of G2-OH but showed weaker voltage dependence when compared to G2-OH and G2-NH₂. The residence time of G2-succinamate in the channel exhibited opposite voltage dependence compared to G2-OH and G2-NH₂, increasing with the cis

  12. Compound Wiretap Channels

    Directory of Open Access Journals (Sweden)

    Shlomo Shamai (Shitz

    2009-01-01

    Full Text Available This paper considers the compound wiretap channel, which generalizes Wyner's wiretap model to allow the channels to the (legitimate receiver and to the eavesdropper to take a number of possible states. No matter which states occur, the transmitter guarantees that the receiver decodes its message and that the eavesdropper is kept in full ignorance about the message. The compound wiretap channel can also be viewed as a multicast channel with multiple eavesdroppers, in which the transmitter sends information to all receivers and keeps the information secret from all eavesdroppers. For the discrete memoryless channel, lower and upper bounds on the secrecy capacity are derived. The secrecy capacity is established for the degraded channel and the semideterministic channel with one receiver. The parallel Gaussian channel is further studied. The secrecy capacity and the secrecy degree of freedom (s.d.o.f. are derived for the degraded case with one receiver. Schemes to achieve the s.d.o.f. for the case with two receivers and two eavesdroppers are constructed to demonstrate the necessity of a prefix channel in encoder design. Finally, the multi-antenna (i.e., MIMO compound wiretap channel is studied. The secrecy capacity is established for the degraded case and an achievable s.d.o.f. is given for the general case.

  13. Compound Wiretap Channels

    Directory of Open Access Journals (Sweden)

    Kramer Gerhard

    2009-01-01

    Full Text Available Abstract This paper considers the compound wiretap channel, which generalizes Wyner's wiretap model to allow the channels to the (legitimate receiver and to the eavesdropper to take a number of possible states. No matter which states occur, the transmitter guarantees that the receiver decodes its message and that the eavesdropper is kept in full ignorance about the message. The compound wiretap channel can also be viewed as a multicast channel with multiple eavesdroppers, in which the transmitter sends information to all receivers and keeps the information secret from all eavesdroppers. For the discrete memoryless channel, lower and upper bounds on the secrecy capacity are derived. The secrecy capacity is established for the degraded channel and the semideterministic channel with one receiver. The parallel Gaussian channel is further studied. The secrecy capacity and the secrecy degree of freedom ( are derived for the degraded case with one receiver. Schemes to achieve the for the case with two receivers and two eavesdroppers are constructed to demonstrate the necessity of a prefix channel in encoder design. Finally, the multi-antenna (i.e., MIMO compound wiretap channel is studied. The secrecy capacity is established for the degraded case and an achievable is given for the general case.

  14. ATP Release Channels

    Directory of Open Access Journals (Sweden)

    Akiyuki Taruno

    2018-03-01

    Full Text Available Adenosine triphosphate (ATP has been well established as an important extracellular ligand of autocrine signaling, intercellular communication, and neurotransmission with numerous physiological and pathophysiological roles. In addition to the classical exocytosis, non-vesicular mechanisms of cellular ATP release have been demonstrated in many cell types. Although large and negatively charged ATP molecules cannot diffuse across the lipid bilayer of the plasma membrane, conductive ATP release from the cytosol into the extracellular space is possible through ATP-permeable channels. Such channels must possess two minimum qualifications for ATP permeation: anion permeability and a large ion-conducting pore. Currently, five groups of channels are acknowledged as ATP-release channels: connexin hemichannels, pannexin 1, calcium homeostasis modulator 1 (CALHM1, volume-regulated anion channels (VRACs, also known as volume-sensitive outwardly rectifying (VSOR anion channels, and maxi-anion channels (MACs. Recently, major breakthroughs have been made in the field by molecular identification of CALHM1 as the action potential-dependent ATP-release channel in taste bud cells, LRRC8s as components of VRACs, and SLCO2A1 as a core subunit of MACs. Here, the function and physiological roles of these five groups of ATP-release channels are summarized, along with a discussion on the future implications of understanding these channels.

  15. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  16. Biochemical and structural analysis of the hyperpolarization-activated K(+) channel MVP.

    Science.gov (United States)

    Randich, Amelia M; Cuello, Luis G; Wanderling, Sherry S; Perozo, Eduardo

    2014-03-18

    In contrast to the majority of voltage-gated ion channels, hyperpolarization-activated channels remain closed at depolarizing potentials and are activated at hyperpolarizing potentials. The basis for this reverse polarity is thought to be a result of differences in the way the voltage-sensing domain (VSD) couples to the pore domain. In the absence of structural data, the molecular mechanism of this reverse polarity coupling remains poorly characterized. Here we report the characterization of the structure and local dynamics of the closed activation gate (lower S6 region) of MVP, a hyperpolarization-activated potassium channel from Methanococcus jannaschii, by electron paramagnetic resonance (EPR) spectroscopy. We show that a codon-optimized version of MVP has high expression levels in Escherichia coli, is purified as a stable tetramer, and exhibits expected voltage-dependent activity when reconstituted in liposomes. EPR analysis of the mid to lower S6 region revealed positions exhibiting strong spin-spin coupling, indicating that the activation gate of MVP is closed at 0 mV. A comparison of local environmental parameters along the activation gate for MVP and KcsA indicates that MVP adopts a different closed conformation. These structural details set the stage for future evaluations of reverse electromechanical coupling in MVP.

  17. Biochemical and Structural Analysis of the Hyperpolarization-Activated K+ Channel MVP

    Science.gov (United States)

    2015-01-01

    In contrast to the majority of voltage-gated ion channels, hyperpolarization-activated channels remain closed at depolarizing potentials and are activated at hyperpolarizing potentials. The basis for this reverse polarity is thought to be a result of differences in the way the voltage-sensing domain (VSD) couples to the pore domain. In the absence of structural data, the molecular mechanism of this reverse polarity coupling remains poorly characterized. Here we report the characterization of the structure and local dynamics of the closed activation gate (lower S6 region) of MVP, a hyperpolarization-activated potassium channel from Methanococcus jannaschii, by electron paramagnetic resonance (EPR) spectroscopy. We show that a codon-optimized version of MVP has high expression levels in Escherichia coli, is purified as a stable tetramer, and exhibits expected voltage-dependent activity when reconstituted in liposomes. EPR analysis of the mid to lower S6 region revealed positions exhibiting strong spin–spin coupling, indicating that the activation gate of MVP is closed at 0 mV. A comparison of local environmental parameters along the activation gate for MVP and KcsA indicates that MVP adopts a different closed conformation. These structural details set the stage for future evaluations of reverse electromechanical coupling in MVP. PMID:24490868

  18. Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Sheyda R Frolova

    Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

  19. Oestrogen directly inhibits the cardiovascular L-type Ca2+ channel Cav1.2

    International Nuclear Information System (INIS)

    Ullrich, Nina D.; Koschak, Alexandra; MacLeod, Kenneth T.

    2007-01-01

    Oestrogen can modify the contractile function of vascular smooth muscle and cardiomyocytes. The negative inotropic actions of oestrogen on the heart and coronary vasculature appear to be mediated by L-type Ca 2+ channel (Ca v 1.2) inhibition, but the underlying mechanisms remain elusive. We tested the hypothesis that oestrogen directly inhibits the cardiovascular L-type Ca 2+ current, I CaL . The effect of oestrogen on I CaL was measured in Ca v 1.2-transfected HEK-293 cells using the whole-cell patch-clamp technique. The current revealed typical activation and inactivation profiles of nifedipine- and cadmium-sensitive I CaL . Oestrogen (50 μM) rapidly reduced I CaL by 50% and shifted voltage-dependent activation and availability to more negative potentials. Furthermore, oestrogen blocked the Ca 2+ channel in a rate-dependent way, exhibiting higher efficiency of block at higher stimulation frequencies. Our data suggest that oestrogen inhibits I CaL through direct interaction of the steroid with the channel protein

  20. Inhibition of G protein-activated inwardly rectifying K+ channels by different classes of antidepressants.

    Directory of Open Access Journals (Sweden)

    Toru Kobayashi

    Full Text Available Various antidepressants are commonly used for the treatment of depression and several other neuropsychiatric disorders. In addition to their primary effects on serotonergic or noradrenergic neurotransmitter systems, antidepressants have been shown to interact with several receptors and ion channels. However, the molecular mechanisms that underlie the effects of antidepressants have not yet been sufficiently clarified. G protein-activated inwardly rectifying K(+ (GIRK, Kir3 channels play an important role in regulating neuronal excitability and heart rate, and GIRK channel modulation has been suggested to have therapeutic potential for several neuropsychiatric disorders and cardiac arrhythmias. In the present study, we investigated the effects of various classes of antidepressants on GIRK channels using the Xenopus oocyte expression assay. In oocytes injected with mRNA for GIRK1/GIRK2 or GIRK1/GIRK4 subunits, extracellular application of sertraline, duloxetine, and amoxapine effectively reduced GIRK currents, whereas nefazodone, venlafaxine, mianserin, and mirtazapine weakly inhibited GIRK currents even at toxic levels. The inhibitory effects were concentration-dependent, with various degrees of potency and effectiveness. Furthermore, the effects of sertraline were voltage-independent and time-independent during each voltage pulse, whereas the effects of duloxetine were voltage-dependent with weaker inhibition with negative membrane potentials and time-dependent with a gradual decrease in each voltage pulse. However, Kir2.1 channels were insensitive to all of the drugs. Moreover, the GIRK currents induced by ethanol were inhibited by sertraline but not by intracellularly applied sertraline. The present results suggest that GIRK channel inhibition may reveal a novel characteristic of the commonly used antidepressants, particularly sertraline, and contributes to some of the therapeutic effects and adverse effects.

  1. CO-independent modification of K+ channels by tricarbonyldichlororuthenium(II) dimer (CORM-2).

    Science.gov (United States)

    Gessner, Guido; Sahoo, Nirakar; Swain, Sandip M; Hirth, Gianna; Schönherr, Roland; Mede, Ralf; Westerhausen, Matthias; Brewitz, Hans Henning; Heimer, Pascal; Imhof, Diana; Hoshi, Toshinori; Heinemann, Stefan H

    2017-11-15

    Although toxic when inhaled in high concentrations, the gas carbon monoxide (CO) is endogenously produced in mammals, and various beneficial effects are reported. For potential medicinal applications and studying the molecular processes underlying the pharmacological action of CO, so-called CO-releasing molecules (CORMs), such as tricabonyldichlororuthenium(II) dimer (CORM-2), have been developed and widely used. Yet, it is not readily discriminated whether an observed effect of a CORM is caused by the released CO gas, the CORM itself, or any of its intermediate or final breakdown products. Focusing on Ca 2+ - and voltage-dependent K + channels (K Ca 1.1) and voltage-gated K + channels (Kv1.5, Kv11.1) relevant for cardiac safety pharmacology, we demonstrate that, in most cases, the functional impacts of CORM-2 on these channels are not mediated by CO. Instead, when dissolved in aqueous solutions, CORM-2 has the propensity of forming Ru(CO) 2 adducts, preferentially to histidine residues, as demonstrated with synthetic peptides using mass-spectrometry analysis. For K Ca 1.1 channels we show that H365 and H394 in the cytosolic gating ring structure are affected by CORM-2. For Kv11.1 channels (hERG1) the extracellularly accessible histidines H578 and H587 are CORM-2 targets. The strong CO-independent action of CORM-2 on Kv11.1 and Kv1.5 channels can be completely abolished when CORM-2 is applied in the presence of an excess of free histidine or human serum albumin; cysteine and methionine are further potential targets. Off-site effects similar to those reported here for CORM-2 are found for CORM-3, another ruthenium-based CORM, but are diminished when using iron-based CORM-S1 and absent for manganese-based CORM-EDE1. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  4. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  5. Volume Regulated Channels

    DEFF Research Database (Denmark)

    Klausen, Thomas Kjær

    of volume perturbations evolution have developed system of channels and transporters to tightly control volume homeostasis. In the past decades evidence has been mounting, that the importance of these volume regulated channels and transporters are not restricted to the defense of cellular volume...... but are also essential for a number of physiological processes such as proliferation, controlled cell death, migration and endocrinology. The thesis have been focusing on two Channels, namely the swelling activated Cl- channel (ICl, swell) and the transient receptor potential Vanilloid (TRPV4) channel. I: Cl......- serves a multitude of functions in the mammalian cell, regulating the membrane potential (Em), cell volume, protein activity and the driving force for facilitated transporters giving Cl- and Cl- channels a major potential of regulating cellular function. These functions include control of the cell cycle...

  6. HIPPI and Fibre Channel

    International Nuclear Information System (INIS)

    Tolmie, D.E.

    1992-01-01

    The High-Performance Parallel Interface (HIPPI) and Fibre Channel are near-gigabit per second data communications interfaces being developed in ANSI standards Task Group X3T9.3. HIPPI is the current interface of choice in the high-end and supercomputer arena, and Fibre Channel is a follow-on effort. HIPPI came from a local area network background, and Fibre Channel came from a mainframe to peripheral interface background

  7. Nuclear reactor coolant channels

    International Nuclear Information System (INIS)

    Macbeth, R.V.

    1978-01-01

    Reference is made to coolant channels for pressurised water and boiling water reactors and the arrangement described aims to improve heat transfer between the fuel rods and the coolant. Baffle means extending axially within the channel are provided and disposed relative to the fuel rods so as to restrict flow oscillations occurring within the coolant from being propagated transversely to the axis of the channel. (UK)

  8. Computer modeling of siRNA knockdown effects indicates an essential role of the Ca2+ channel alpha2delta-1 subunit in cardiac excitation-contraction coupling.

    Science.gov (United States)

    Tuluc, Petronel; Kern, Georg; Obermair, Gerald J; Flucher, Bernhard E

    2007-06-26

    L-type Ca(2+) currents determine the shape of cardiac action potentials (AP) and the magnitude of the myoplasmic Ca(2+) signal, which regulates the contraction force. The auxiliary Ca(2+) channel subunits alpha(2)delta-1 and beta(2) are important regulators of membrane expression and current properties of the cardiac Ca(2+) channel (Ca(V)1.2). However, their role in cardiac excitation-contraction coupling is still elusive. Here we addressed this question by combining siRNA knockdown of the alpha(2)delta-1 subunit in a muscle expression system with simulation of APs and Ca(2+) transients by using a quantitative computer model of ventricular myocytes. Reconstitution of dysgenic muscle cells with Ca(V)1.2 (GFP-alpha(1C)) recapitulates key properties of cardiac excitation-contraction coupling. Concomitant depletion of the alpha(2)delta-1 subunit did not perturb membrane expression or targeting of the pore-forming GFP-alpha(1C) subunit into junctions between the outer membrane and the sarcoplasmic reticulum. However, alpha(2)delta-1 depletion shifted the voltage dependence of Ca(2+) current activation by 9 mV to more positive potentials, and it slowed down activation and inactivation kinetics approximately 2-fold. Computer modeling revealed that the altered voltage dependence and current kinetics exert opposing effects on the function of ventricular myocytes that in total cause a 60% prolongation of the AP and a 2-fold increase of the myoplasmic Ca(2+) concentration during each contraction. Thus, the Ca(2+) channel alpha(2)delta-1 subunit is not essential for normal Ca(2+) channel targeting in muscle but is a key determinant of normal excitation and contraction of cardiac muscle cells, and a reduction of alpha(2)delta-1 function is predicted to severely perturb normal heart function.

  9. New Channels, New Possibilities

    DEFF Research Database (Denmark)

    Pieterson, Willem; Ebbers, Wolfgang; Østergaard Madsen, Christian

    2017-01-01

    In this contribution we discuss the characteristics of what we call the fourth generation of public sector service channels: social robots. Based on a review of relevant literature we discuss their characteristics and place into multi-channel models of service delivery. We argue that social robots......-channel models of service delivery. This is especially relevant given the current lack of evaluations of such models, the broad range of channels available, and their different stages of deployment at governments around the world. Nevertheless, social robots offer an potentially very relevant addition...

  10. Calcium Channel Blockers

    Science.gov (United States)

    ... Certain calcium channel blockers interact with grapefruit products. Kaplan NM, et al. Treatment of hypertension: Drug therapy. In: Kaplan's Clinical Hypertension. 11th ed. Philadelphia, Pa.: Wolters Kluwer ...

  11. A channel profile analyser

    International Nuclear Information System (INIS)

    Gobbur, S.G.

    1983-01-01

    It is well understood that due to the wide band noise present in a nuclear analog-to-digital converter, events at the boundaries of adjacent channels are shared. It is a difficult and laborious process to exactly find out the shape of the channels at the boundaries. A simple scheme has been developed for the direct display of channel shape of any type of ADC on a cathode ray oscilliscope display. This has been accomplished by sequentially incrementing the reference voltage of a precision pulse generator by a fraction of a channel and storing ADC data in alternative memory locations of a multichannel pulse height analyser. Alternative channels are needed due to the sharing at the boundaries of channels. In the flat region of the profile alternate memory locations are channels with zero counts and channels with the full scale counts. At the boundaries all memory locations will have counts. The shape of this is a direct display of the channel boundaries. (orig.)

  12. hERG1 channels are overexpressed in glioblastoma multiforme and modulate VEGF secretion in glioblastoma cell lines

    Science.gov (United States)

    Masi, A; Becchetti, A; Restano-Cassulini, R; Polvani, S; Hofmann, G; Buccoliero, A M; Paglierani, M; Pollo, B; Taddei, G L; Gallina, P; Di Lorenzo, N; Franceschetti, S; Wanke, E; Arcangeli, A

    2005-01-01

    Recent studies have led to considerable advancement in our understanding of the molecular mechanisms that underlie the relentless cell growth and invasiveness of human gliomas. Partial understanding of these mechanisms has (1) improved the classification for gliomas, by identifying prognostic subgroups, and (2) pointed to novel potential therapeutic targets. Some classes of ion channels have turned out to be involved in the pathogenesis and malignancy of gliomas. We studied the expression and properties of K+ channels in primary cultures obtained from surgical specimens: human ether a gò-gò related (hERG)1 voltage-dependent K+ channels, which have been found to be overexpressed in various human cancers, and human ether a gò-gò-like 2 channels, that share many of hERG1's biophysical features. The expression pattern of these two channels was compared to that of the classical inward rectifying K+ channels, IRK, that are widely expressed in astrocytic cells and classically considered a marker of astrocytic differentiation. In our study, hERG1 was found to be specifically overexpressed in high-grade astrocytomas, that is, glioblastoma multiforme (GBM). In addition, we present evidence that, in GBM cell lines, hERG1 channel activity actively contributes to malignancy by promoting vascular endothelial growth factor secretion, thus stimulating the neoangiogenesis typical of high-grade gliomas. Our data provide important confirmation for studies proposing the hERG1 channel as a molecular marker of tumour progression and a possible target for novel anticancer therapies. PMID:16175187

  13. Elementary properties of CaV1.3 Ca2+ channels expressed in mouse cochlear inner hair cells

    Science.gov (United States)

    Zampini, Valeria; Johnson, Stuart L; Franz, Christoph; Lawrence, Neil D; Münkner, Stefan; Engel, Jutta; Knipper, Marlies; Magistretti, Jacopo; Masetto, Sergio; Marcotti, Walter

    2010-01-01

    Mammalian cochlear inner hair cells (IHCs) are specialized to process developmental signals during immature stages and sound stimuli in adult animals. These signals are conveyed onto auditory afferent nerve fibres. Neurotransmitter release at IHC ribbon synapses is controlled by L-type CaV1.3 Ca2+ channels, the biophysics of which are still unknown in native mammalian cells. We have investigated the localization and elementary properties of Ca2+ channels in immature mouse IHCs under near-physiological recording conditions. CaV1.3 Ca2+ channels at the cell pre-synaptic site co-localize with about half of the total number of ribbons present in immature IHCs. These channels activated at about −70 mV, showed a relatively short first latency and weak inactivation, which would allow IHCs to generate and accurately encode spontaneous Ca2+ action potential activity characteristic of these immature cells. The CaV1.3 Ca2+ channels showed a very low open probability (about 0.15 at −20 mV: near the peak of an action potential). Comparison of elementary and macroscopic Ca2+ currents indicated that very few Ca2+ channels are associated with each docked vesicle at IHC ribbon synapses. Finally, we found that the open probability of Ca2+ channels, but not their opening time, was voltage dependent. This finding provides a possible correlation between presynaptic Ca2+ channel properties and the characteristic frequency/amplitude of EPSCs in auditory afferent fibres. PMID:19917569

  14. Functional identification of a GORK potassium channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f.

    Science.gov (United States)

    Li, Junlin; Zhang, Huanchao; Lei, Han; Jin, Man; Yue, Guangzhen; Su, Yanhua

    2016-04-01

    A GORK homologue K(+) channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. shows the functional conservation of the GORK channels among plant species. Guard cell K(+) release through the outward potassium channels eventually enables the closure of stomata which consequently prevents plant water loss from severe transpiration. Early patch-clamp studies with the guard cells have revealed many details of such outward potassium currents. However, genes coding for these potassium-release channels have not been sufficiently characterized from species other than the model plant Arabidopsis thaliana. We report here the functional identification of a GORK (for Gated or Guard cell Outward Rectifying K(+) channels) homologue from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. AmGORK was primary expressed in shoots, where the transcripts were regulated by stress factors simulated by PEG, NaCl or ABA treatments. Patch-clamp measurements on isolated guard cell protoplasts revealed typical depolarization voltage gated outward K(+) currents sensitive to the extracelluar K(+) concentration and pH, resembling the fundamental properties previously described in other species. Two-electrode voltage-clamp analysis in Xenopus lavies oocytes with AmGORK reconstituted highly similar characteristics as assessed in the guard cells, supporting that the function of AmGORK is consistent with a crucial role in mediating stomatal closure in Ammopiptanthus mongolicus. Furthermore, a single amino acid mutation D297N of AmGORK eventually abolishes both the voltage-gating and its outward rectification and converts the channel into a leak-like channel, indicating strong involvement of this residue in the gating and voltage dependence of AmGORK. Our results obtained from this anciently originated plant support a strong functional conservation of the GORK channels among plant species and maybe also along the progress of revolution.

  15. The ladder-shaped polyether toxin gambierol anchors the gating machinery of Kv3.1 channels in the resting state

    Science.gov (United States)

    Kopljar, Ivan; Labro, Alain J.; de Block, Tessa; Rainier, Jon D.; Tytgat, Jan

    2013-01-01

    Voltage-gated potassium (Kv) and sodium (Nav) channels are key determinants of cellular excitability and serve as targets of neurotoxins. Most marine ciguatoxins potentiate Nav channels and cause ciguatera seafood poisoning. Several ciguatoxins have also been shown to affect Kv channels, and we showed previously that the ladder-shaped polyether toxin gambierol is a potent Kv channel inhibitor. Most likely, gambierol acts via a lipid-exposed binding site, located outside the K+ permeation pathway. However, the mechanism by which gambierol inhibits Kv channels remained unknown. Using gating and ionic current analysis to investigate how gambierol affected S6 gate opening and voltage-sensing domain (VSD) movements, we show that the resting (closed) channel conformation forms the high-affinity state for gambierol. The voltage dependence of activation was shifted by >120 mV in the depolarizing direction, precluding channel opening in the physiological voltage range. The (early) transitions between the resting and the open state were monitored with gating currents, and provided evidence that strong depolarizations allowed VSD movement up to the activated-not-open state. However, for transition to the fully open (ion-conducting) state, the toxin first needed to dissociate. These dissociation kinetics were markedly accelerated in the activated-not-open state, presumably because this state displayed a much lower affinity for gambierol. A tetrameric concatemer with only one high-affinity binding site still displayed high toxin sensitivity, suggesting that interaction with a single binding site prevented the concerted step required for channel opening. We propose a mechanism whereby gambierol anchors the channel’s gating machinery in the resting state, requiring more work from the VSD to open the channel. This mechanism is quite different from the action of classical gating modifier peptides (e.g., hanatoxin). Therefore, polyether toxins open new opportunities in structure

  16. A linearization of quantum channels

    Science.gov (United States)

    Crowder, Tanner

    2015-06-01

    Because the quantum channels form a compact, convex set, we can express any quantum channel as a convex combination of extremal channels. We give a Euclidean representation for the channels whose inverses are also valid channels; these are a subset of the extreme points. They form a compact, connected Lie group, and we calculate its Lie algebra. Lastly, we calculate a maximal torus for the group and provide a constructive approach to decomposing any invertible channel into a product of elementary channels.

  17. Effects of Tannic Acid, Green Tea and Red Wine on hERG Channels Expressed in HEK293 Cells.

    Directory of Open Access Journals (Sweden)

    Xi Chu

    Full Text Available Tannic acid presents in varying concentrations in plant foods, and in relatively high concentrations in green teas and red wines. Human ether-à-go-go-related gene (hERG channels expressed in multiple tissues (e.g. heart, neurons, smooth muscle and cancer cells, and play important roles in modulating cardiac action potential repolarization and tumor cell biology. The present study investigated the effects of tannic acid, green teas and red wines on hERG currents. The effects of tannic acid, teas and red wines on hERG currents stably transfected in HEK293 cells were studied with a perforated patch clamp technique. In this study, we demonstrated that tannic acid inhibited hERG currents with an IC50 of 3.4 μM and ~100% inhibition at higher concentrations, and significantly shifted the voltage dependent activation to more positive potentials (Δ23.2 mV. Remarkably, a 100-fold dilution of multiple types of tea (green tea, oolong tea and black tea or red wine inhibited hERG currents by ~90%, and significantly shifted the voltage dependent activation to more positive potentials (Δ30.8 mV and Δ26.0 mV, respectively. Green tea Lung Ching and red wine inhibited hERG currents, with IC50 of 0.04% and 0.19%, respectively. The effects of tannic acid, teas and red wine on hERG currents were irreversible. These results suggest tannic acid is a novel hERG channel blocker and consequently provide a new mechanistic evidence for understanding the effects of tannic acid. They also revealed the potential pharmacological basis of tea- and red wine-induced biology activities.

  18. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

    Science.gov (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

    2017-05-01

    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  19. Effects of Tannic Acid, Green Tea and Red Wine on hERG Channels Expressed in HEK293 Cells

    Science.gov (United States)

    Xu, Bingyuan; Li, Wenya; Lin, Yue; Sun, Xiaorun; Ding, Chunhua; Zhang, Xuan

    2015-01-01

    Tannic acid presents in varying concentrations in plant foods, and in relatively high concentrations in green teas and red wines. Human ether-à-go-go-related gene (hERG) channels expressed in multiple tissues (e.g. heart, neurons, smooth muscle and cancer cells), and play important roles in modulating cardiac action potential repolarization and tumor cell biology. The present study investigated the effects of tannic acid, green teas and red wines on hERG currents. The effects of tannic acid, teas and red wines on hERG currents stably transfected in HEK293 cells were studied with a perforated patch clamp technique. In this study, we demonstrated that tannic acid inhibited hERG currents with an IC50 of 3.4 μM and ~100% inhibition at higher concentrations, and significantly shifted the voltage dependent activation to more positive potentials (Δ23.2 mV). Remarkably, a 100-fold dilution of multiple types of tea (green tea, oolong tea and black tea) or red wine inhibited hERG currents by ~90%, and significantly shifted the voltage dependent activation to more positive potentials (Δ30.8 mV and Δ26.0 mV, respectively). Green tea Lung Ching and red wine inhibited hERG currents, with IC50 of 0.04% and 0.19%, respectively. The effects of tannic acid, teas and red wine on hERG currents were irreversible. These results suggest tannic acid is a novel hERG channel blocker and consequently provide a new mechanistic evidence for understanding the effects of tannic acid. They also revealed the potential pharmacological basis of tea- and red wine-induced biology activities. PMID:26625122

  20. Omni channel fashion shopping

    NARCIS (Netherlands)

    Kemperman, A.D.A.M.; van Delft, L.; Borgers, A.W.J.; Pantano, E.

    2015-01-01

    This chapter gives insight into consumers' online and offline fashion shopping behavior, consumers' omni-channel usage during the shopping process, and consumer fashion shopper segments. Based on a literature review, omni-channel shopping behavior during the shopping process was operationalized.

  1. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels.

    Science.gov (United States)

    Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P

    2012-09-01

    Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

  3. Highly selective water channel activity measured by voltage clamp: analysis of planar lipid bilayers reconstituted with purified AqpZ.

    Science.gov (United States)

    Pohl, P; Saparov, S M; Borgnia, M J; Agre, P

    2001-08-14

    Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.

  4. Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels.

    Science.gov (United States)

    Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron

    2013-08-01

    Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

  5. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

    Science.gov (United States)

    Minor, Daniel L; Findeisen, Felix

    2010-01-01

    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  6. Channel electron multipliers

    International Nuclear Information System (INIS)

    Seidman, A.; Avrahami, Z.; Sheinfux, B.; Grinberg, J.

    1976-01-01

    A channel electron multiplier is described having a tubular wall coated with a secondary-electron emitting material and including an electric field for accelerating the electrons, the electric field comprising a plurality of low-resistive conductive rings each alternating with a high-resistive insulating ring. The thickness of the low-resistive rings is many times larger than that of the high-resistive rings, being in the order of tens of microns for the low-resistive rings and at least one order of magnitude lower for the high-resistive rings; and the diameter of the channel tubular walls is also many times larger than the thickness of the high-resistive rings. Both single-channel and multiple-channel electron multipliers are described. A very important advantage, particularly in making multiple-channel multipliers, is the simplicity of the procedure that may be used in constructing such multipliers. Other operational advantages are described

  7. Cardiac potassium channel subtypes

    DEFF Research Database (Denmark)

    Schmitt, Nicole; Grunnet, Morten; Olesen, Søren-Peter

    2014-01-01

    About 10 distinct potassium channels in the heart are involved in shaping the action potential. Some of the K(+) channels are primarily responsible for early repolarization, whereas others drive late repolarization and still others are open throughout the cardiac cycle. Three main K(+) channels...... drive the late repolarization of the ventricle with some redundancy, and in atria this repolarization reserve is supplemented by the fairly atrial-specific KV1.5, Kir3, KCa, and K2P channels. The role of the latter two subtypes in atria is currently being clarified, and several findings indicate...... that they could constitute targets for new pharmacological treatment of atrial fibrillation. The interplay between the different K(+) channel subtypes in both atria and ventricle is dynamic, and a significant up- and downregulation occurs in disease states such as atrial fibrillation or heart failure...

  8. Cl- channels in apoptosis

    DEFF Research Database (Denmark)

    Wanitchakool, Podchanart; Ousingsawat, Jiraporn; Sirianant, Lalida

    2016-01-01

    A remarkable feature of apoptosis is the initial massive cell shrinkage, which requires opening of ion channels to allow release of K(+), Cl(-), and organic osmolytes to drive osmotic water movement and cell shrinkage. This article focuses on the role of the Cl(-) channels LRRC8, TMEM16/anoctamin......, and cystic fibrosis transmembrane conductance regulator (CFTR) in cellular apoptosis. LRRC8A-E has been identified as a volume-regulated anion channel expressed in many cell types. It was shown to be required for regulatory and apoptotic volume decrease (RVD, AVD) in cultured cell lines. Its presence also......(-) channels or as regulators of other apoptotic Cl(-) channels, such as LRRC8. CFTR has been known for its proapoptotic effects for some time, and this effect may be based on glutathione release from the cell and increase in cytosolic reactive oxygen species (ROS). Although we find that CFTR is activated...

  9. CHANNEL ESTIMATION TECHNIQUE

    DEFF Research Database (Denmark)

    2015-01-01

    A method includes determining a sequence of first coefficient estimates of a communication channel based on a sequence of pilots arranged according to a known pilot pattern and based on a receive signal, wherein the receive signal is based on the sequence of pilots transmitted over the communicat......A method includes determining a sequence of first coefficient estimates of a communication channel based on a sequence of pilots arranged according to a known pilot pattern and based on a receive signal, wherein the receive signal is based on the sequence of pilots transmitted over...... the communication channel. The method further includes determining a sequence of second coefficient estimates of the communication channel based on a decomposition of the first coefficient estimates in a dictionary matrix and a sparse vector of the second coefficient estimates, the dictionary matrix including...... filter characteristics of at least one known transceiver filter arranged in the communication channel....

  10. Orientation of the calcium channel beta relative to the alpha(12.2 subunit is critical for its regulation of channel activity.

    Directory of Open Access Journals (Sweden)

    Iuliia Vitko

    Full Text Available BACKGROUND: The Ca(vbeta subunits of high voltage-activated Ca(2+ channels control the trafficking and biophysical properties of the alpha(1 subunit. The Ca(vbeta-alpha(1 interaction site has been mapped by crystallographic studies. Nevertheless, how this interaction leads to channel regulation has not been determined. One hypothesis is that betas regulate channel gating by modulating movements of IS6. A key requirement for this direct-coupling model is that the linker connecting IS6 to the alpha-interaction domain (AID be a rigid structure. METHODOLOGY/PRINCIPAL FINDINGS: The present study tests this hypothesis by altering the flexibility and orientation of this region in alpha(12.2, then testing for Ca(vbeta regulation using whole cell patch clamp electrophysiology. Flexibility was induced by replacement of the middle six amino acids of the IS6-AID linker with glycine (PG6. This mutation abolished beta2a and beta3 subunits ability to shift the voltage dependence of activation and inactivation, and the ability of beta2a to produce non-inactivating currents. Orientation of Ca(vbeta with respect to alpha(12.2 was altered by deletion of 1, 2, or 3 amino acids from the IS6-AID linker (Bdel1, Bdel2, Bdel3, respectively. Again, the ability of Ca(vbeta subunits to regulate these biophysical properties were totally abolished in the Bdel1 and Bdel3 mutants. Functional regulation by Ca(vbeta subunits was rescued in the Bdel2 mutant, indicating that this part of the linker forms beta-sheet. The orientation of beta with respect to alpha was confirmed by the bimolecular fluorescence complementation assay. CONCLUSIONS/SIGNIFICANCE: These results show that the orientation of the Ca(vbeta subunit relative to the alpha(12.2 subunit is critical, and suggests additional points of contact between these subunits are required for Ca(vbeta to regulate channel activity.

  11. Coherifying quantum channels

    Science.gov (United States)

    Korzekwa, Kamil; Czachórski, Stanisław; Puchała, Zbigniew; Życzkowski, Karol

    2018-04-01

    Is it always possible to explain random stochastic transitions between states of a finite-dimensional system as arising from the deterministic quantum evolution of the system? If not, then what is the minimal amount of randomness required by quantum theory to explain a given stochastic process? Here, we address this problem by studying possible coherifications of a quantum channel Φ, i.e., we look for channels {{{Φ }}}{ \\mathcal C } that induce the same classical transitions T, but are ‘more coherent’. To quantify the coherence of a channel Φ we measure the coherence of the corresponding Jamiołkowski state J Φ. We show that the classical transition matrix T can be coherified to reversible unitary dynamics if and only if T is unistochastic. Otherwise the Jamiołkowski state {J}{{Φ }}{ \\mathcal C } of the optimally coherified channel is mixed, and the dynamics must necessarily be irreversible. To assess the extent to which an optimal process {{{Φ }}}{ \\mathcal C } is indeterministic we find explicit bounds on the entropy and purity of {J}{{Φ }}{ \\mathcal C }, and relate the latter to the unitarity of {{{Φ }}}{ \\mathcal C }. We also find optimal coherifications for several classes of channels, including all one-qubit channels. Finally, we provide a non-optimal coherification procedure that works for an arbitrary channel Φ and reduces its rank (the minimal number of required Kraus operators) from {d}2 to d.

  12. CANDU channel flow verification

    International Nuclear Information System (INIS)

    Mazalu, N.; Negut, Gh.

    1997-01-01

    The purpose of this evaluation was to obtain accurate information on each channel flow that enables us to assess precisely the level of reactor thermal power and, for reasons of safety, to establish which channel is boiling. In order to assess the channel flow parameters, computer simulations were done with the NUCIRC code and the results were checked by measurements. The complete channel flow measurements were made in the zero power cold condition. In hot conditions there were made flow measurements using the Shut Down System 1 (SDS 1) flow devices from 0.1 % F.P. up to 100 % F.P. The NUCIRC prediction for CANDU channel flows and the measurements by Ultrasonic Flow Meter at zero power cold conditions and SDS 1 flow channel measurements at different reactor power levels showed an acceptable agreement. The 100 % F.P. average errors for channel flow of R, shows that suitable NUCIRC flow assessment can be made. So, it can be done a fair prediction of the reactor power distribution. NUCIRC can predict accurately the onset of boiling and helps to warn at the possible power instabilities at high powers or it can detect the flow blockages. The thermal hydraulic analyst has in NUCIRC a suitable tool to do accurate predictions for the thermal hydraulic parameters for different steady state power levels which subsequently leads to an optimal CANDU reactor operation. (authors)

  13. Reconfigurable virtual electrowetting channels.

    Science.gov (United States)

    Banerjee, Ananda; Kreit, Eric; Liu, Yuguang; Heikenfeld, Jason; Papautsky, Ian

    2012-02-21

    Lab-on-a-chip systems rely on several microfluidic paradigms. The first uses a fixed layout of continuous microfluidic channels. Such lab-on-a-chip systems are almost always application specific and far from a true "laboratory." The second involves electrowetting droplet movement (digital microfluidics), and allows two-dimensional computer control of fluidic transport and mixing. The merging of the two paradigms in the form of programmable electrowetting channels takes advantage of both the "continuous" functionality of rigid channels based on which a large number of applications have been developed to date and the "programmable" functionality of digital microfluidics that permits electrical control of on-chip functions. In this work, we demonstrate for the first time programmable formation of virtual microfluidic channels and their continuous operation with pressure driven flows using an electrowetting platform. Experimental, theoretical, and numerical analyses of virtual channel formation with biologically relevant electrolyte solutions and electrically-programmable reconfiguration are presented. We demonstrate that the "wall-less" virtual channels can be formed reliably and rapidly, with propagation rates of 3.5-3.8 mm s(-1). Pressure driven transport in these virtual channels at flow rates up to 100 μL min(-1) is achievable without distortion of the channel shape. We further demonstrate that these virtual channels can be switched on-demand between multiple inputs and outputs. Ultimately, we envision a platform that would provide rapid prototyping of microfluidic concepts and would be capable of a vast library of functions and benefitting applications from clinical diagnostics in resource-limited environments to rapid system prototyping to high throughput pharmaceutical applications.

  14. Evaluation channel performance in multichannel environments

    NARCIS (Netherlands)

    Gensler, S.; Dekimpe, M.; Skiera, B.

    2007-01-01

    Evaluating channel performance is crucial for actively managing multiple sales channels, and requires understanding the customers' channel preferences. Two key components of channel performance are (i) the existing customers' intrinsic loyalty to a particular channel and (ii) the channel's ability

  15. Channel follower leakage restrictor

    International Nuclear Information System (INIS)

    Williamson, H.E.; Smith, B.A.

    1977-01-01

    An improved means is provided to control coolant leakage between the flow channel and the lower tie plate of a nuclear fuel assembly. The means includes an opening in the lower tie plate and a movable element adjacent thereto. The coolant pressure within the tie plate biases the movable means toward the inner surface of the surrounding flow channel to compensate for any movement of the flow channel away from the lower tie plate to thereby control the leakage of coolant flow from the fuel assemblies to the spaces among the fuel assemblies of the core. 9 figures

  16. Polarized axonal surface expression of neuronal KCNQ potassium channels is regulated by calmodulin interaction with KCNQ2 subunit.

    Directory of Open Access Journals (Sweden)

    John P Cavaretta

    Full Text Available KCNQ potassium channels composed of KCNQ2 and KCNQ3 subunits give rise to the M-current, a slow-activating and non-inactivating voltage-dependent potassium current that limits repetitive firing of action potentials. KCNQ channels are enriched at the surface of axons and axonal initial segments, the sites for action potential generation and modulation. Their enrichment at the axonal surface is impaired by mutations in KCNQ2 carboxy-terminal tail that cause benign familial neonatal convulsion and myokymia, suggesting that their correct surface distribution and density at the axon is crucial for control of neuronal excitability. However, the molecular mechanisms responsible for regulating enrichment of KCNQ channels at the neuronal axon remain elusive. Here, we show that enrichment of KCNQ channels at the axonal surface of dissociated rat hippocampal cultured neurons is regulated by ubiquitous calcium sensor calmodulin. Using immunocytochemistry and the cluster of differentiation 4 (CD4 membrane protein as a trafficking reporter, we demonstrate that fusion of KCNQ2 carboxy-terminal tail is sufficient to target CD4 protein to the axonal surface whereas inhibition of calmodulin binding to KCNQ2 abolishes axonal surface expression of CD4 fusion proteins by retaining them in the endoplasmic reticulum. Disruption of calmodulin binding to KCNQ2 also impairs enrichment of heteromeric KCNQ2/KCNQ3 channels at the axonal surface by blocking their trafficking from the endoplasmic reticulum to the axon. Consistently, hippocampal neuronal excitability is dampened by transient expression of wild-type KCNQ2 but not mutant KCNQ2 deficient in calmodulin binding. Furthermore, coexpression of mutant calmodulin, which can interact with KCNQ2/KCNQ3 channels but not calcium, reduces but does not abolish their enrichment at the axonal surface, suggesting that apo calmodulin but not calcium-bound calmodulin is necessary for their preferential targeting to the axonal

  17. Cellular hyper-excitability caused by mutations that alter the activation process of voltage-gated sodium channels

    Directory of Open Access Journals (Sweden)

    Mohamed-Yassine eAMAROUCH

    2015-02-01

    Full Text Available Voltage-gated sodium channels (Nav are widely expressed as macro-molecular complexes in both excitable and non-excitable tissues. In excitable tissues, the upstroke of the action potential is the result of the passage of a large and rapid influx of sodium ions through these channels. NaV dysfunction has been associated with an increasingly wide range of neurological, muscular and cardiac disorders. The purpose of this review is to summarize the recently identified sodium channel mutations that are linked to hyper-excitability phenotypes and associated with the alteration of the activation process of voltage gated sodium channels. Indeed, several clinical manifestations that demonstrate an alteration of tissue excitability were recently shown to be strongly associated with the presence of mutations that affect the activation process of the voltage-gated sodium channels. These emerging genotype-phenotype correlations have expanded the clinical spectrum of sodium channelopathies to include disorders which feature a hyper-excitability phenotype that may or may not be associated with a cardiomyopathy. The p.I141V mutation in SCN4A and SCN5A, as well as its homologous p.I136V mutation in SCN9A, are interesting examples of mutations that have been linked to inherited hyperexcitability myotonia, exercise-induced polymorphic ventricular arrhythmias and erythromelalgia, respectively. Regardless of which sodium channel isoform is investigated, the substitution of the isoleucine to valine in the locus 141 induces similar modifications in the biophysical properties of the voltage-gated sodium channels by shifting the voltage-dependence of steady state activation towards more negative potentials.

  18. Modulation of the transient outward current (Ito) in rat cardiac myocytes and human Kv4.3 channels by mefloquine

    International Nuclear Information System (INIS)

    Perez-Cortes, E.J.; Islas, A.A.; Arevalo, J.P.; Mancilla, C.; Monjaraz, E.; Salinas-Stefanon, E.M.

    2015-01-01

    The antimalarial drug mefloquine, is known to be a potassium channel blocker, although its mechanism of action has not being elucidated and its effects on the transient outward current (I to ) and the molecular correlate, the K v 4.3 channel has not being studied. Here, we describe the mefloquine-induced inhibition of the rat ventricular I to and of CHO cells co-transfected with human K v 4.3 and its accessory subunit hKChIP2C by whole-cell voltage-clamp. Mefloquine inhibited rat I to and hK v 4.3 + KChIP2C currents in a concentration-dependent manner with a limited voltage dependence and similar potencies (IC 50 = 8.9 μM and 10.5 μM for cardiac myocytes and K v 4.3 channels, respectively). In addition, mefloquine did not affect the activation of either current but significantly modified the hK v 4.3 steady-state inactivation and recovery from inactivation. The effects of this drug was compared with that of 4-aminopyridine (4-AP), a well-known potassium channel blocker and its binding site does not seem to overlap with that of 4-AP. - Highlights: • Mefloquine inhibited ventricular I to and hK v 4.3 channels. IC 50 = 8.9 and 10.5 μM. • Inactivation and recovery from inactivation in the hK v 4.3 channels were modified by mefloquine. • Mefloquine displayed a higher affinity for the inactivated state. • The binding site for mefloquine may be located in the extracellular side of the channel.

  19. Direct channel problems and phenomena

    International Nuclear Information System (INIS)

    Cutkosky, R.E.

    1975-01-01

    Direct channel problems and phenomena are considered covering the need for precision hadron spectroscopy, the data base for precision hadron spectroscopy, some relations between direct-channel and cross-channel effects, and spin rotation phenomena

  20. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  1. Many channel spectrum unfolding

    International Nuclear Information System (INIS)

    Najzer, M.; Glumac, B.; Pauko, M.

    1980-01-01

    The principle of the ITER unfolding code as used for the many channel spectrum unfolding is described. Its unfolding ability is tested on seven typical neutron spectra. The effect of the initial spectrum approximation upon the solution is discussed

  2. Channelized Streams in Iowa

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — This draft dataset consists of all ditches or channelized pieces of stream that could be identified using three input datasets; namely the1:24,000 National...

  3. Coding for optical channels

    CERN Document Server

    Djordjevic, Ivan; Vasic, Bane

    2010-01-01

    This unique book provides a coherent and comprehensive introduction to the fundamentals of optical communications, signal processing and coding for optical channels. It is the first to integrate the fundamentals of coding theory and optical communication.

  4. Sensing with Ion Channels

    CERN Document Server

    Martinac, Boris

    2008-01-01

    All living cells are able to detect and translate environmental stimuli into biologically meaningful signals. Sensations of touch, hearing, sight, taste, smell or pain are essential to the survival of all living organisms. The importance of sensory input for the existence of life thus justifies the effort made to understand its molecular origins. Sensing with Ion Channels focuses on ion channels as key molecules enabling biological systems to sense and process the physical and chemical stimuli that act upon cells in their living environment. Its aim is to serve as a reference to ion channel specialists and as a source of new information to non specialists who want to learn about the structural and functional diversity of ion channels and their role in sensory physiology.

  5. Calcium channel blocker poisoning

    Directory of Open Access Journals (Sweden)

    Miran Brvar

    2005-04-01

    Full Text Available Background: Calcium channel blockers act at L-type calcium channels in cardiac and vascular smooth muscles by preventing calcium influx into cells with resultant decrease in vascular tone and cardiac inotropy, chronotropy and dromotropy. Poisoning with calcium channel blockers results in reduced cardiac output, bradycardia, atrioventricular block, hypotension and shock. The findings of hypotension and bradycardia should suggest poisoning with calcium channel blockers.Conclusions: Treatment includes immediate gastric lavage and whole-bowel irrigation in case of ingestion of sustainedrelease products. All patients should receive an activated charcoal orally. Specific treatment includes calcium, glucagone and insulin, which proved especially useful in shocked patients. Supportive care including the use of catecholamines is not always effective. In the setting of failure of pharmacological therapy transvenous pacing, balloon pump and cardiopulmonary by-pass may be necessary.

  6. TRP channels: an overview

    DEFF Research Database (Denmark)

    Pedersen, Stine Falsig; Owsianik, Grzegorz; Nilius, Bernd

    2005-01-01

    The TRP ("transient receptor potential") family of ion channels now comprises more than 30 cation channels, most of which are permeable for Ca2+, and some also for Mg2+. On the basis of sequence homology, the TRP family can be divided in seven main subfamilies: the TRPC ('Canonical') family......, the TRPV ('Vanilloid') family, the TRPM ('Melastatin') family, the TRPP ('Polycystin') family, the TRPML ('Mucolipin') family, the TRPA ('Ankyrin') family, and the TRPN ('NOMPC') family. The cloning and characterization of members of this cation channel family has exploded during recent years, leading...... to a plethora of data on the roles of TRPs in a variety of tissues and species, including mammals, insects, and yeast. The present review summarizes the most pertinent recent evidence regarding the structural and functional properties of TRP channels, focusing on the regulation and physiology of mammalian TRPs....

  7. Authentication over Noisy Channels

    OpenAIRE

    Lai, Lifeng; Gamal, Hesham El; Poor, H. Vincent

    2008-01-01

    In this work, message authentication over noisy channels is studied. The model developed in this paper is the authentication theory counterpart of Wyner's wiretap channel model. Two types of opponent attacks, namely impersonation attacks and substitution attacks, are investigated for both single message and multiple message authentication scenarios. For each scenario, information theoretic lower and upper bounds on the opponent's success probability are derived. Remarkably, in both scenarios,...

  8. Channelling versus inversion

    DEFF Research Database (Denmark)

    Gale, A.S.; Surlyk, Finn; Anderskouv, Kresten

    2013-01-01

    Evidence from regional stratigraphical patterns in Santonian−Campanian chalk is used to infer the presence of a very broad channel system (5 km across) with a depth of at least 50 m, running NNW−SSE across the eastern Isle of Wight; only the western part of the channel wall and fill is exposed. W......−Campanian chalks in the eastern Isle of Wight, involving penecontemporaneous tectonic inversion of the underlying basement structure, are rejected....

  9. Stream Channel Stability.

    Science.gov (United States)

    1981-04-01

    Cycles of wetting and drying are also t ,v itiue swelling and shrinkage of the soil. S 11ied blocks or peds of soil fabric ,,ks. id downslope soil creep ...hydrographs of water and sediment at the point in question. By feeding the output from the hydrology-transport model into the finite element model...the banks as undercut banks fail. Channel irregularities such as seepage zones, cattle crossings, overbank drainage, buried channels, organic deposits

  10. Channeling and dynamic chaos

    Energy Technology Data Exchange (ETDEWEB)

    Bolotin, IU L; Gonchar, V IU; Truten, V I; Shulga, N F

    1986-01-01

    It is shown that axial channeling of relativistic electrons can give rise to the effect of dynamic chaos which involves essentially chaotic motion of a particle in the channel. The conditions leading to the effect of dynamic chaos and the manifestations of this effect in physical processes associated with the passage of particles through a crystal are examined using a silicon crystal as an example. 7 references.

  11. Course on Ionic Channels

    CERN Document Server

    1986-01-01

    This book is based on a series of lectures for a course on ionic channels held in Santiago, Chile, on November 17-20, 1984. It is intended as a tutorial guide on the properties, function, modulation, and reconstitution of ionic channels, and it should be accessible to graduate students taking their first steps in this field. In the presentation there has been a deliberate emphasis on the spe­ cific methodologies used toward the understanding of the workings and function of channels. Thus, in the first section, we learn to "read" single­ channel records: how to interpret them in the theoretical frame of kinetic models, which information can be extracted from gating currents in re­ lation to the closing and opening processes, and how ion transport through an open channel can be explained in terms of fluctuating energy barriers. The importance of assessing unequivocally the origin and purity of mem­ brane preparations and the use of membrane vesicles and optical tech­ niques in the stUGY of ionic channels a...

  12. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    Directory of Open Access Journals (Sweden)

    Ana Laura Sanchez-Sandoval

    Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  13. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels

    Science.gov (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

  14. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    Science.gov (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  15. Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity.

    Directory of Open Access Journals (Sweden)

    Céline M Bourdin

    Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be

  16. Distal C terminus of CaV1.2 channels plays a crucial role in the neural differentiation of dental pulp stem cells.

    Directory of Open Access Journals (Sweden)

    Jianping Ge

    Full Text Available L-type voltage-dependent CaV1.2 channels play an important role in the maintenance of intracellular calcium homeostasis, and influence multiple cellular processes. C-terminal cleavage of CaV1.2 channels was reported in several types of excitable cells, but its expression and possible roles in non-excitable cells is still not clear. The aim of this study was to determine whether distal C-terminal fragment of CaV1.2 channels is present in rat dental pulp stem cells and its possible role in the neural differentiation of rat dental pulp stem cells. We generated stable CaV1.2 knockdown cells via short hairpin RNA (shRNA. Rat dental pulp stem cells with deleted distal C-terminal of CaV1.2 channels lost the potential of differentiation to neural cells. Re-expression of distal C-terminal of CaV1.2 rescued the effect of knocking down the endogenous CaV1.2 on the neural differentiation of rat dental pulp stem cells, indicating that the distal C-terminal of CaV1.2 is required for neural differentiation of rat dental pulp stem cells. These results provide new insights into the role of voltage-gated Ca(2+ channels in stem cells during differentiation.

  17. Ion channelling in diamond

    International Nuclear Information System (INIS)

    Derry, T.E.

    1978-06-01

    Diamond is one of the most extreme cases from a channelling point of view, having the smallest thermal vibration amplitude and the lowest atomic number of commonly-encountered crystals. These are the two parameters most important for determining channelling behaviour. It is of consiberable interest therefore to see how well the theories explaining and predicting the channeling properties of other substance, succeed with diamond. Natural diamond, although the best available form for these experiments, is rather variable in its physical properties. Part of the project was devoted to considering and solving the problem of obtaining reproducible results representative of the ideal crystal. Channelling studies were performed on several good crystals, using the Rutherford backscattering method. Critical angles for proton channelling were measured for incident energies from 0.6 to 4.5 MeV, in the three most open axes and three most open planes of the diamond structure, and for α-particle channelling at 0.7 and 1.0 MeV (He + ) in the same axes and planes. For 1.0 MeV protons, the crystal temperature was varied from 20 degrees Celsius to 700 degrees Celsius. The results are presented as curves of backscattered yield versus angle in the region of each axis or plane, and summarised in the form of tables and graphs. Generally the critical angles, axial minimum yields, and temperature dependence are well predicted by the accepted theories. The most valuable overall conclusion is that the mean thermal vibration amplitude of the atoms in a crytical determines the critical approach distance to the channel walls at which an ion can remain channelled, even when this distance is much smaller than the Thomas-Fermi screening distance of the atomic potential, as is the case in diamond. A brief study was made of the radiation damage caused by α-particle bombardment, via its effect on the channelling phenomenon. It was possible to hold damage down to negligible levels during the

  18. Effects of haloperidol on Kv4.3 potassium channels.

    Science.gov (United States)

    Lee, Hong Joon; Sung, Ki-Wug; Hahn, Sang June

    2014-10-05

    Haloperidol is commonly used in clinical practice to treat acute and chronic psychosis, but it also has been associated with adverse cardiovascular events. We investigated the effects of haloperidol on Kv4.3 currents stably expressed in CHO cells using a whole-cell patch-clamp technique. Haloperidol did not significantly inhibit the peak amplitude of Kv4.3, but accelerated the decay rate of inactivation of Kv4.3 in a concentration-dependent manner. Thus, the effects of haloperidol on Kv4.3 were estimated from the integral of the Kv4.3 currents during the depolarization pulse. The Kv4.3 was decreased by haloperidol in a concentration-dependent manner with an IC50 value of 3.6 μM. Haloperidol accelerated the decay rate of Kv4.3 inactivation and activation kinetics in a concentration-dependent manner, thereby decreasing the time-to-peak. Haloperidol shifted the voltage dependence of the steady-state activation and inactivation of Kv4.3 in a hyperpolarizing direction. Haloperidol also caused an acceleration of the closed-state inactivation of Kv4.3. Haloperidol produced a use-dependent block of Kv4.3, which was accompanied by a slowing of recovery from the inactivation of Kv4.3. These results suggest that haloperidol blocks Kv4.3 by both interacting with the open state of Kv4.3 channels during depolarization and accelerating the closed-state inactivation at subthreshold membrane potentials. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. CaV3.1 isoform of T-type calcium channels supports excitability of rat and mouse ventral tegmental area neurons.

    Science.gov (United States)

    Tracy, Matthew E; Tesic, Vesna; Stamenic, Tamara Timic; Joksimovic, Srdjan M; Busquet, Nicolas; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M

    2018-03-23

    Recent data have implicated voltage-gated calcium channels in the regulation of the excitability of neurons within the mesolimbic reward system. While the attention of most research has centered on high voltage L-type calcium channel activity, the presence and role of the low voltage-gated T-type calcium channel (T-channels) has not been well explored. Hence, we investigated T-channel properties in the neurons of the ventral tegmental area (VTA) utilizing wild-type (WT) rats and mice, Ca V 3.1 knock-out (KO) mice, and TH-eGFP knock-in (KI) rats in acute horizontal brain slices of adolescent animals. In voltage-clamp experiments, we first assessed T-channel activity in WT rats with characteristic properties of voltage-dependent activation and inactivation, as well as characteristic crisscrossing patterns of macroscopic current kinetics. T-current kinetics were similar in WT mice and WT rats but T-currents were abolished in Ca V 3.1 KO mice. In ensuing current-clamp experiments, we observed the presence of hyperpolarization-induced rebound burst firing in a subset of neurons in WT rats, as well as dopaminergic and non-dopaminergic neurons in TH-eGFP KI rats. Following the application of a pan-selective T-channel blocker TTA-P2, rebound bursting was significantly inhibited in all tested cells. In a behavioral assessment, the acute locomotor increase induced by a MK-801 (Dizocilpine) injection in WT mice was abolished in Ca V 3.1 KO mice, suggesting a tangible role for 3.1 T-type channels in drug response. We conclude that pharmacological targeting of Ca V 3.1 isoform of T-channels may be a novel approach for the treatment of disorders of mesolimbic reward system. Copyright © 2018. Published by Elsevier Ltd.

  20. Optical Communications Channel Combiner

    Science.gov (United States)

    Quirk, Kevin J.; Quirk, Kevin J.; Nguyen, Danh H.; Nguyen, Huy

    2012-01-01

    NASA has identified deep-space optical communications links as an integral part of a unified space communication network in order to provide data rates in excess of 100 Mb/s. The distances and limited power inherent in a deep-space optical downlink necessitate the use of photon-counting detectors and a power-efficient modulation such as pulse position modulation (PPM). For the output of each photodetector, whether from a separate telescope or a portion of the detection area, a communication receiver estimates a log-likelihood ratio for each PPM slot. To realize the full effective aperture of these receivers, their outputs must be combined prior to information decoding. A channel combiner was developed to synchronize the log-likelihood ratio (LLR) sequences of multiple receivers, and then combines these into a single LLR sequence for information decoding. The channel combiner synchronizes the LLR sequences of up to three receivers and then combines these into a single LLR sequence for output. The channel combiner has three channel inputs, each of which takes as input a sequence of four-bit LLRs for each PPM slot in a codeword via a XAUI 10 Gb/s quad optical fiber interface. The cross-correlation between the channels LLR time series are calculated and used to synchronize the sequences prior to combining. The output of the channel combiner is a sequence of four-bit LLRs for each PPM slot in a codeword via a XAUI 10 Gb/s quad optical fiber interface. The unit is controlled through a 1 Gb/s Ethernet UDP/IP interface. A deep-space optical communication link has not yet been demonstrated. This ground-station channel combiner was developed to demonstrate this capability and is unique in its ability to process such a signal.

  1. Channel formation by the binding component of Clostridium botulinum C2 toxin: glutamate 307 of C2II affects channel properties in vitro and pH-dependent C2I translocation in vivo.

    Science.gov (United States)

    Blöcker, Dagmar; Bachmeyer, Christoph; Benz, Roland; Aktories, Klaus; Barth, Holger

    2003-05-13

    The binding component (C2II) of the binary Clostridium botulinum C2 toxin mediates transport of the actin ADP-ribosylating enzyme component (C2I) into the cytosol of target cells. C2II (80 kDa) is activated by trypsin cleavage, and proteolytically activated C2II (60 kDa) oligomerizes to heptamers in solution. Activated C2II forms channels in lipid bilayer membranes which are highly cation selective and voltage-gated. A role for this channel in C2I translocation across the cell membrane into the cytosol is discussed. Amino acid residues 303-331 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which likely facilitates membrane insertion and channel formation by creating two antiparallel beta-strands. Some of the residues are in strategic positions within the putative C2II channel, in particular, glutamate 307 (E307) localized in its center and glycine 316 (G316) localized on the trans side of the membrane. Here, single-lysine substitutions of these amino acids and the double mutant E307K/G316K of C2II were analyzed in vivo and in artificial lipid bilayer experiments. The pH dependence of C2I transport across cellular membranes was altered, and a pH of properties of C2II were substantially changed by the mutations, as evidenced by reduced cation selectivity. Interestingly, the voltage dependence of wild-type C2II was completely lost for the E307K mutant, which means that E307 is responsible for voltage gating. Chloroquine blocked the E307K mutant channel and intoxication of Vero cells by mutant C2II and C2I, indicating that chloroquine binding does not involve E307. Overall, the voltage gating and cation selectivity of the C2II channel do not play an important role in translocation of C2I into the cytosol.

  2. CLC-Nt1, a putative chloride channel protein of tobacco, co-localizes with mitochondrial membrane markers.

    Science.gov (United States)

    Lurin, C; Güclü, J; Cheniclet, C; Carde, J P; Barbier-Brygoo, H; Maurel, C

    2000-06-01

    The voltage-dependent chloride channel (CLC) family of membrane proteins has cognates in animals, yeast, bacteria and plants, and chloride-channel activity has been assigned to most of the animal homologues. Lack of evidence of CLC functions in plants prompted us to characterize the cellular localization of the tobacco CLC-Nt1 protein. Specific polyclonal antibodies were raised against an N-terminal polypeptide of CLC-Nt1. These antibodies were used to probe membrane proteins prepared by various cell-fractionation methods. These included aqueous two-phase partitioning (for plasma membranes), free-flow electrophoresis (for vacuolar and plasma membranes), intact vacuole isolation, Percoll-gradient centrifugation (for plastids and mitochondria) and stepped, linear, sucrose-density-gradient centrifugation (for mitochondria). Each purified membrane fraction was characterized with specific marker enzyme activities or antibodies. Our studies ruled out the possibility that the major cell localization of CLC-Nt1 was the vacuolar or plasma membranes, the endoplasmic reticulum, the Golgi apparatus or the plastids. In contrast, we showed that the tobacco CLC-Nt1 specifically co-localized with the markers of the mitochondrial inner membrane, cytochrome c oxidase and NAD9 protein. CLC-Nt1 may correspond to the inner membrane anion channel ('IMAC') described previously in animal and plant mitochondria.

  3. Agmatine suppresses peripheral sympathetic tone by inhibiting N-type Ca(2+) channel activity via imidazoline I2 receptor activation.

    Science.gov (United States)

    Kim, Young-Hwan; Jeong, Ji-Hyun; Ahn, Duck-Sun; Chung, Seungsoo

    2016-08-26

    Agmatine, a putative endogenous ligand of imidazoline receptors, suppresses cardiovascular function by inhibiting peripheral sympathetic tone. However, the molecular identity of imidazoline receptor subtypes and its cellular mechanism underlying the agmatine-induced sympathetic suppression remains unknown. Meanwhile, N-type Ca(2+) channels are important for the regulation of NA release in the peripheral sympathetic nervous system. Therefore, it is possible that agmatine suppresses NA release in peripheral sympathetic nerve terminals by inhibiting Ca(2+) influx through N-type Ca(2+) channels. We tested this hypothesis by investigating agmatine effect on electrical field stimulation (EFS)-evoked contraction and NA release in endothelium-denuded rat superior mesenteric arterial strips. We also investigated the effect of agmatine on the N-type Ca(2+) current in superior cervical ganglion (SCG) neurons in rats. Our study demonstrates that agmatine suppresses peripheral sympathetic outflow via the imidazoline I2 receptor in rat mesenteric arteries. In addition, the agmatine-induced suppression of peripheral vascular sympathetic tone is mediated by modulating voltage-dependent N-type Ca(2+) channels in sympathetic nerve terminals. These results suggest a potential cellular mechanism for the agmatine-induced suppression of peripheral sympathetic tone. Furthermore, they provide basic and theoretical information regarding the development of new agents to treat hypertension. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Vitamin E isomer δ-tocopherol enhances the efficiency of neural stem cell differentiation via L-type calcium channel.

    Science.gov (United States)

    Deng, Sihao; Hou, Guoqiang; Xue, Zhiqin; Zhang, Longmei; Zhou, Yuye; Liu, Chao; Liu, Yanqing; Li, Zhiyuan

    2015-01-12

    The effects of the vitamin E isomer δ-tocopherol on neural stem cell (NSC) differentiation have not been investigated until now. Here we investigated the effects of δ-tocopherol on NSC neural differentiation, maturation and its possible mechanisms. Neonatal rat NSCs were grown in suspended neurosphere cultures, and were identified by their expression of nestin protein and their capacity for self-renewal. Treatment with a low concentration of δ-tocopherol induced a significant increase in the percentage of β-III-tubulin-positive cells. δ-Tocopherol also stimulated morphological maturation of neurons in culture. We further observed that δ-tocopherol stimulation increased the expression of voltage-dependent Ca(2+) channels. Moreover, a L-type specific Ca(2+) channel blocker verapamil reduced the percentage of differentiated neurons after δ-tocopherol treatment, and blocked the effects of δ-tocopherol on NSC differentiation into neurons. Together, our study demonstrates that δ-tocopherol may act through elevation of L-type calcium channel activity to increase neuronal differentiation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Modeling of the Channel Thickness Influence on Electrical Characteristics and Series Resistance in Gate-Recessed Nanoscale SOI MOSFETs

    Directory of Open Access Journals (Sweden)

    A. Karsenty

    2013-01-01

    Full Text Available Ultrathin body (UTB and nanoscale body (NSB SOI-MOSFET devices, sharing a similar W/L but with a channel thickness of 46 nm and lower than 5 nm, respectively, were fabricated using a selective “gate-recessed” process on the same silicon wafer. Their current-voltage characteristics measured at room temperature were found to be surprisingly different by several orders of magnitude. We analyzed this result by considering the severe mobility degradation and the influence of a huge series resistance and found that the last one seems more coherent. Then the electrical characteristics of the NSB can be analytically derived by integrating a gate voltage-dependent drain source series resistance. In this paper, the influence of the channel thickness on the series resistance is reported for the first time. This influence is integrated to the analytical model in order to describe the trends of the saturation current with the channel thickness. This modeling approach may be useful to interpret anomalous electrical behavior of other nanodevices in which series resistance and/or mobility degradation is of a great concern.

  6. Mutation of I696 and W697 in the TRP box of vanilloid receptor subtype I modulates allosteric channel activation.

    Science.gov (United States)

    Gregorio-Teruel, Lucia; Valente, Pierluigi; González-Ros, José Manuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio

    2014-03-01

    The transient receptor potential vanilloid receptor subtype I (TRPV1) channel acts as a polymodal sensory receptor gated by chemical and physical stimuli. Like other TRP channels, TRPV1 contains in its C terminus a short, conserved domain called the TRP box, which is necessary for channel gating. Substitution of two TRP box residues-I696 and W697-with Ala markedly affects TRPV1's response to all activating stimuli, which indicates that these two residues play a crucial role in channel gating. We systematically replaced I696 and W697 with 18 native l-amino acids (excluding cysteine) and evaluated the effect on voltage- and capsaicin-dependent gating. Mutation of I696 decreased channel activation by either voltage or capsaicin; furthermore, gating was only observed with substitution of hydrophobic amino acids. Substitution of W697 with any of the 18 amino acids abolished gating in response to depolarization alone, shifting the threshold to unreachable voltages, but not capsaicin-mediated gating. Moreover, vanilloid-activated responses of W697X mutants showed voltage-dependent gating along with a strong voltage-independent component. Analysis of the data using an allosteric model of activation indicates that mutation of I696 and W697 primarily affects the allosteric coupling constants of the ligand and voltage sensors to the channel pore. Together, our findings substantiate the notion that inter- and/or intrasubunit interactions at the level of the TRP box are critical for efficient coupling of stimulus sensing and gate opening. Perturbation of these interactions markedly reduces the efficacy and potency of the activating stimuli. Furthermore, our results identify these interactions as potential sites for pharmacological intervention.

  7. Channel Choice: A Literature Review

    DEFF Research Database (Denmark)

    Østergaard Madsen, Christian; Kræmmergaard, Pernille

    2015-01-01

    The channel choice branch of e-government studies citizens’ and businesses’ choice of channels for interacting with government, and how government organizations can integrate channels and migrate users towards the most cost-efficient channels. In spite of the valuable contributions offered...

  8. Channel Identification Machines

    Directory of Open Access Journals (Sweden)

    Aurel A. Lazar

    2012-01-01

    Full Text Available We present a formal methodology for identifying a channel in a system consisting of a communication channel in cascade with an asynchronous sampler. The channel is modeled as a multidimensional filter, while models of asynchronous samplers are taken from neuroscience and communications and include integrate-and-fire neurons, asynchronous sigma/delta modulators and general oscillators in cascade with zero-crossing detectors. We devise channel identification algorithms that recover a projection of the filter(s onto a space of input signals loss-free for both scalar and vector-valued test signals. The test signals are modeled as elements of a reproducing kernel Hilbert space (RKHS with a Dirichlet kernel. Under appropriate limiting conditions on the bandwidth and the order of the test signal space, the filter projection converges to the impulse response of the filter. We show that our results hold for a wide class of RKHSs, including the space of finite-energy bandlimited signals. We also extend our channel identification results to noisy circuits.

  9. Channel identification machines.

    Science.gov (United States)

    Lazar, Aurel A; Slutskiy, Yevgeniy B

    2012-01-01

    We present a formal methodology for identifying a channel in a system consisting of a communication channel in cascade with an asynchronous sampler. The channel is modeled as a multidimensional filter, while models of asynchronous samplers are taken from neuroscience and communications and include integrate-and-fire neurons, asynchronous sigma/delta modulators and general oscillators in cascade with zero-crossing detectors. We devise channel identification algorithms that recover a projection of the filter(s) onto a space of input signals loss-free for both scalar and vector-valued test signals. The test signals are modeled as elements of a reproducing kernel Hilbert space (RKHS) with a Dirichlet kernel. Under appropriate limiting conditions on the bandwidth and the order of the test signal space, the filter projection converges to the impulse response of the filter. We show that our results hold for a wide class of RKHSs, including the space of finite-energy bandlimited signals. We also extend our channel identification results to noisy circuits.

  10. Cryogenic microwave channelized receiver

    International Nuclear Information System (INIS)

    Rauscher, C.; Pond, J.M.; Tait, G.B.

    1996-01-01

    The channelized receiver being presented demonstrates the use of high temperature superconductor technology in a microwave system setting where superconductor, microwave-monolithic-integrated-circuit, and hybrid-integrated-circuit components are united in one package and cooled to liquid-nitrogen temperatures. The receiver consists of a superconducting X-band four-channel demultiplexer with 100-MHz-wide channels, four commercial monolithically integrated mixers, and four custom-designed hybrid-circuit detectors containing heterostructure ramp diodes. The composite receiver unit has been integrated into the payload of the second-phase NRL high temperature superconductor space experiment (HTSSE-II). Prior to payload assembly, the response characteristics of the receiver were measured as functions of frequency, temperature, and drive levels. The article describes the circuitry, discusses the key issues related to design and implementation, and summarizes the experimental results

  11. Chaos in quantum channels

    Energy Technology Data Exchange (ETDEWEB)

    Hosur, Pavan; Qi, Xiao-Liang [Department of Physics, Stanford University,476 Lomita Mall, Stanford, California 94305 (United States); Roberts, Daniel A. [Center for Theoretical Physics and Department of Physics, Massachusetts Institute of Technology,77 Massachusetts Ave, Cambridge, Massachusetts 02139 (United States); Yoshida, Beni [Perimeter Institute for Theoretical Physics,31 Caroline Street North, Waterloo, Ontario N2L 2Y5 (Canada); Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena CA 91125 (United States)

    2016-02-01

    We study chaos and scrambling in unitary channels by considering their entanglement properties as states. Using out-of-time-order correlation functions to diagnose chaos, we characterize the ability of a channel to process quantum information. We show that the generic decay of such correlators implies that any input subsystem must have near vanishing mutual information with almost all partitions of the output. Additionally, we propose the negativity of the tripartite information of the channel as a general diagnostic of scrambling. This measures the delocalization of information and is closely related to the decay of out-of-time-order correlators. We back up our results with numerics in two non-integrable models and analytic results in a perfect tensor network model of chaotic time evolution. These results show that the butterfly effect in quantum systems implies the information-theoretic definition of scrambling.

  12. Distribution Channels Conflict and Management

    OpenAIRE

    Kiran, Dr Vasanth; Majumdar, Dr Mousumi; Kishore, Dr Krishna

    2012-01-01

    Relationships in distribution channels tend to be long-term oriented and members of the channel rely on each other to jointly realize their goals by serving buyers. Despite the channels focus on serving buyers, conflicts often arise between channel members because of each members self-interest. When conflicts arise, the perceptions of a channel member based on normative, rational/instrumental, or emotional reasoning will influence relational norms like trust and commitment that characterize t...

  13. Fuel channel refilling

    International Nuclear Information System (INIS)

    Shoukri, M.; Abdul-Razzak, A.

    1992-11-01

    This report extends the work reported in document INFO-0370 on fuel channel refilling by providing analysis of the refilling tests conducted using the RD-14 and RD-14M test facilities. The analysis focuses on the general thermal-hydraulic characteristics of the facilities following various small and large inlet and outlet header breaks with emergency coolant injection. The two-fluid model thermal-hydraulic computer code CATHENA was tested against results obtained from selected experiments carried out in the two facilities. Conclusions related to the effect of break size, mode of emergency core injection, primary pump operation and parallel channels are presented. (Author) (116 figs., 17 tabs., 53 refs.)

  14. Ion channels in glioblastoma.

    Science.gov (United States)

    Molenaar, Remco J

    2011-01-01

    Glioblastoma is the most common primary brain tumor with the most dismal prognosis. It is characterized by extensive invasion, migration, and angiogenesis. Median survival is only 15 months due to this behavior, rendering focal surgical resection ineffective and adequate radiotherapy impossible. At this moment, several ion channels have been implicated in glioblastoma proliferation, migration, and invasion. This paper summarizes studies on potassium, sodium, chloride, and calcium channels of glioblastoma. It provides an up-to-date overview of the literature that could ultimately lead to new therapeutic targets.

  15. Fuel channel refilling

    International Nuclear Information System (INIS)

    Shoukri, M.; Abdul-Razzak, A.

    1990-04-01

    Analysis of existing data on fuel channel refilling is presented. The analysis focuses on the data obtained using the Stern Laboratories Cold Water Injection Test (CWIT) Facility. The two-fluid model thermal-hydraulics computer code CATHENA is also used to simulate experimental results on fuel channel refilling from both the CWIT and RD-14 facilities. Conclusions related to single and double break tests, including the effect of non-condensible gases, are presented. A set of recommendations is given for further analysis and separate effect experiments. (67 figs., 5 tabs., 24 refs.)

  16. Crystallization and preliminary X-ray diffraction studies of the tetramerization domain derived from the human potassium channel Kv1.3

    International Nuclear Information System (INIS)

    Winklmeier, Andreas; Weyand, Michael; Schreier, Christina; Kalbitzer, Hans Robert; Kremer, Werner

    2009-01-01

    The tetramerization domain of human Kv1.3 was cloned, expressed, purified and crystallized. The crystals belonged to space group I4 and diffracted to 1.2 Å resolution using synchrotron radiation. The tetramerization domain (T1 domain) derived from the voltage-dependent potassium channel Kv1.3 of Homo sapiens was recombinantly expressed in Escherichia coli and purified. The crystals were first grown in an NMR tube in 150 mM potassium phosphate pH 6.5 in the absence of additional precipitants. The crystals showed I4 symmetry characteristic of the naturally occurring tetrameric assembly of the single subunits. A complete native data set was collected to 1.2 Å resolution at 100 K using synchrotron radiation

  17. Potassium channels in brain mitochondria.

    Science.gov (United States)

    Bednarczyk, Piotr

    2009-01-01

    Potassium channels are the most widely distributed class of ion channels. These channels are transmembrane proteins known to play important roles in both normal and pathophysiological functions in all cell types. Various potassium channels are recognised as potential therapeutic targets in the treatment of Parkinson's disease, Alzheimer's disease, brain/spinal cord ischaemia and sepsis. In addition to their importance as therapeutic targets, certain potassium channels are known for their beneficial roles in anaesthesia, cardioprotection and neuroprotection. Some types of potassium channels present in the plasma membrane of various cells have been found in the inner mitochondrial membrane as well. Potassium channels have been proposed to regulate mitochondrial membrane potential, respiration, matrix volume and Ca(+) ion homeostasis. It has been proposed that mitochondrial potassium channels mediate ischaemic preconditioning in various tissues. However, the specificity of a pharmacological agents and the mechanisms underlying their effects on ischaemic preconditioning remain controversial. The following potassium channels from various tissues have been identified in the inner mitochondrial membrane: ATP-regulated (mitoK(ATP)) channel, large conductance Ca(2+)-regulated (mitoBK(Ca)) channel, intermediate conductance Ca(2+)-regulated (mitoIK(Ca)) channel, voltage-gated (mitoKv1.3 type) channel, and twin-pore domain (mitoTASK-3) channel. It has been shown that increased potassium flux into brain mitochondria induced by either the mitoK(ATP) channel or mitoBK(Ca) channel affects the beneficial effects on neuronal cell survival under pathological conditions. Recently, differential distribution of mitoBK(Ca) channels has been observed in neuronal mitochondria. These findings may suggest a neuroprotective role for the mitoBK(Ca) channel in specific brain structures. This minireview summarises current data on brain mitochondrial potassium channels and the efforts to identify

  18. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  19. Kaempferol stimulates large conductance Ca2+-activated K+ (BKCa) channels in human umbilical vein endothelial cells via a cAMP/PKA-dependent pathway

    Science.gov (United States)

    Xu, Y C; Leung, G P H; Wong, P Y D; Vanhoutte, P M; Man, R Y K

    2008-01-01

    Background and purpose: Kaempferol has been shown to possess a vasodilator effect but its mechanism of action remains unclear. In this study, experiments were carried out to study the effect of kaempferol on K+ channels in endothelial cells. Experimental approach: K+ channel activities in human umbilical vein endothelial cells (HUVECs) were studied by conventional whole cell and cell-attached patch-clamp electrophysiology. Key results: Kaempferol stimulated an outward-rectifying current in HUVECs in a dose-dependent manner with an EC50 value of 2.5±0.02 μM. This kaempferol-induced current was abolished by large conductance Ca2+-activated K+ (BKCa) channel blockers, such as iberiotoxin (IbTX) and charybdotoxin (ChTX), whereas the small conductance Ca2+-activated K+ (SKCa) channel blocker, apamin, and the voltage-dependent K+ (KV) channel blocker, 4-aminopyridine, had no effect. Cell-attached patches demonstrated that kaempferol increased the open probability of BkCa channels in HUVECs. Clamping intracellular Ca2+ did not prevent kaempferol-induced increases in outward current. In addition, the kaempferol-induced current was diminished by the adenylyl cyclase inhibitor SQ22536, the cAMP antagonist Rp-8-Br-cAMP and the PKA inhibitor KT5720, but was not affected by the guanylyl cyclase inhibitor ODQ, the cGMP antagonist Rp-8-Br-cGMP and the PKG inhibitor KT5823. The activation of BKCa channels by kaempferol caused membrane hyperpolarization of HUVECs. Conclusion and implications: These results demonstrate that kaempferol activates the opening of BKCa channels in HUVECs via a cAMP/PKA-dependent pathway, resulting in membrane hyperpolarization. This mechanism may partly account for the vasodilator effects of kaempferol. PMID:18493242

  20. Chemistry in Microfluidic Channels

    Science.gov (United States)

    Chia, Matthew C.; Sweeney, Christina M.; Odom, Teri W.

    2011-01-01

    General chemistry introduces principles such as acid-base chemistry, mixing, and precipitation that are usually demonstrated in bulk solutions. In this laboratory experiment, we describe how chemical reactions can be performed in a microfluidic channel to show advanced concepts such as laminar fluid flow and controlled precipitation. Three sets of…

  1. Workshop on Gas Channels

    Science.gov (United States)

    2013-02-07

    Effect of pressure on gas permeability. In Fish … Different channels or splice variants at different depth.  HRE (hypoxia-response elements): which...proteins unexpectedly have HREs . HIF-1.  Shear stress:  expression of NOS  Are different splice variants used under different conditions?  Size

  2. Fluorescence-tracking of activation gating in human ERG channels reveals rapid S4 movement and slow pore opening.

    Directory of Open Access Journals (Sweden)

    Zeineb Es-Salah-Lamoureux

    2010-05-01

    Full Text Available hERG channels are physiologically important ion channels which mediate cardiac repolarization as a result of their unusual gating properties. These are very slow activation compared with other mammalian voltage-gated potassium channels, and extremely rapid inactivation. The mechanism of slow activation is not well understood and is investigated here using fluorescence as a direct measure of S4 movement and pore opening.Tetramethylrhodamine-5-maleimide (TMRM fluorescence at E519 has been used to track S4 voltage sensor movement, and channel opening and closing in hERG channels. Endogenous cysteines (C445 and C449 in the S1-S2 linker bound TMRM, which caused a 10 mV hyperpolarization of the V((1/2 of activation to -27.5+/-2.0 mV, and showed voltage-dependent fluorescence signals. Substitution of S1-S2 linker cysteines with valines allowed unobstructed recording of S3-S4 linker E519C and L520C emission signals. Depolarization of E519C channels caused rapid initial fluorescence quenching, fit with a double Boltzmann relationship, F-V(ON, with V((1/2 (,1 = -37.8+/-1.7 mV, and V((1/2 (,2 = 43.5+/-7.9 mV. The first phase, V((1/2 (,1, was approximately 20 mV negative to the conductance-voltage relationship measured from ionic tail currents (G-V((1/2 = -18.3+/-1.2 mV, and relatively unchanged in a non-inactivating E519C:S620T mutant (V((1/2 = -34.4+/-1.5 mV, suggesting the fast initial fluorescence quenching tracked S4 voltage sensor movement. The second phase of rapid quenching was absent in the S620T mutant. The E519C fluorescence upon repolarization (V((1/2 = -20.6+/-1.2, k = 11.4 mV and L520C quenching during depolarization (V((1/2 = -26.8+/-1.0, k = 13.3 mV matched the respective voltage dependencies of hERG ionic tails, and deactivation time constants from -40 to -110 mV, suggesting they detected pore-S4 rearrangements related to ionic current flow during pore opening and closing.THE DATA INDICATE: 1 that rapid environmental changes occur at the

  3. A complicated complex: Ion channels, voltage sensing, cell membranes and peptide inhibitors.

    Science.gov (United States)

    Zhang, Alan H; Sharma, Gagan; Undheim, Eivind A B; Jia, Xinying; Mobli, Mehdi

    2018-04-21

    Voltage-gated ion channels (VGICs) are specialised ion channels that have a voltage dependent mode of action, where ion conduction, or gating, is controlled by a voltage-sensing mechanism. VGICs are critical for electrical signalling and are therefore important pharmacological targets. Among these, voltage-gated sodium channels (Na V s) have attracted particular attention as potential analgesic targets. Na V s, however, comprise several structurally similar subtypes with unique localisations and distinct functions, ranging from amplification of action potentials in nociception (e.g. Na V 1.7) to controlling electrical signalling in cardiac function (Na V 1.5). Understanding the structural basis of Na V function is therefore of great significance, both to our knowledge of electrical signalling and in development of subtype and state selective drugs. An important tool in this pursuit has been the use of peptides from animal venoms as selective Na V modulators. In this review, we look at peptides, particularly from spider venoms, that inhibit Na V s by binding to the voltage sensing domain (VSD) of this channel, known as gating modifier toxins (GMT). In the first part of the review, we look at the structural determinants of voltage sensing in VGICs, the gating cycle and the conformational changes that accompany VSD movement. Next, the modulation of the analgesic target Na V 1.7 by GMTs is reviewed to develop bioinformatic tools that, based on sequence information alone, can identify toxins that are likely to inhibit this channel. The same approach is also used to define VSD sequences, other than that from Na V 1.7, which are likely to be sensitive to this class of toxins. The final section of the review focuses on the important role of the cellular membrane in channel modulation and also how the lipid composition affects measurements of peptide-channel interactions both in binding kinetics measurements in solution and in cell-based functional assays. Copyright © 2018

  4. A permeation theory for single-file ion channels: one- and two-step models.

    Science.gov (United States)

    Nelson, Peter Hugo

    2011-04-28

    How many steps are required to model permeation through ion channels? This question is investigated by comparing one- and two-step models of permeation with experiment and MD simulation for the first time. In recent MD simulations, the observed permeation mechanism was identified as resembling a Hodgkin and Keynes knock-on mechanism with one voltage-dependent rate-determining step [Jensen et al., PNAS 107, 5833 (2010)]. These previously published simulation data are fitted to a one-step knock-on model that successfully explains the highly non-Ohmic current-voltage curve observed in the simulation. However, these predictions (and the simulations upon which they are based) are not representative of real channel behavior, which is typically Ohmic at low voltages. A two-step association/dissociation (A/D) model is then compared with experiment for the first time. This two-parameter model is shown to be remarkably consistent with previously published permeation experiments through the MaxiK potassium channel over a wide range of concentrations and positive voltages. The A/D model also provides a first-order explanation of permeation through the Shaker potassium channel, but it does not explain the asymmetry observed experimentally. To address this, a new asymmetric variant of the A/D model is developed using the present theoretical framework. It includes a third parameter that represents the value of the "permeation coordinate" (fractional electric potential energy) corresponding to the triply occupied state n of the channel. This asymmetric A/D model is fitted to published permeation data through the Shaker potassium channel at physiological concentrations, and it successfully predicts qualitative changes in the negative current-voltage data (including a transition to super-Ohmic behavior) based solely on a fit to positive-voltage data (that appear linear). The A/D model appears to be qualitatively consistent with a large group of published MD simulations, but no

  5. Computational model based approach to analysis ventricular arrhythmias: Effects of dysfunction calcium channels

    Science.gov (United States)

    Gulothungan, G.; Malathi, R.

    2018-04-01

    Disturbed sodium (Na+) and calcium (Ca2+) handling is known to be a major predisposing factor for life-threatening cardiac arrhythmias. Cardiac contractility in ventricular tissue is prominent by Ca2+ channels like voltage dependent Ca2+ channels, sodium-calcium exchanger (Na+-Ca2+x) and sacroplasmicrecticulum (SR) Ca2+ pump and leakage channels. Experimental and clinical possibilities for studying cardiac arrhythmias in human ventricular myocardium are very limited. Therefore, the use of alternative methods such as computer simulations is of great importance. Our aim of this article is to study the impact on action potential (AP) generation and propagation in single ventricular myocyte and ventricular tissue under different dysfunction Ca2+ channels condition. In enhanced activity of Na+-Ca2+x, single myocyte produces AP duration (APD90) and APD50 is significantly smaller (266 ms and 235 ms). Its Na+-Ca2+x current at depolarization is increases 60% from its normal level and repolarization current goes more negative (nonfailing= -0.28 pA/pF and failing= -0.47 pA/pF). Similarly, same enhanced activity of Na+-Ca2+x in 10 mm region of ventricular sheet, raises the plateau potential abruptly, which ultimately affects the diastolic repolarization. Compare with normal ventricular sheet region of 10 mm, 10% of ventricular sheet resting state is reduces and ventricular sheet at time 250 ms is goes to resting state very early. In hypertrophy condition, single myocyte produces APD90 and APD50 is worthy of attention smaller (232 mS and 198 ms). Its sodium-potassium (Na+-K+) pump current is 75% reduces from its control conditions (0.13 pA/pF). Hypertrophy condition, 50% of ventricular sheet is reduces to minimum plateau potential state, that starts the repolarization process very early and reduces the APD. In a single failing SR Ca2+ channels myocyte, recovery of Ca2+ concentration level in SR reduces upto 15% from its control myocytes. At time 290 ms, 70% of ventricular sheet

  6. Activity of the anticonvulsant lacosamide in experimental and human epilepsy via selective effects on slow Na+ channel inactivation.

    Science.gov (United States)

    Holtkamp, Dominik; Opitz, Thoralf; Niespodziany, Isabelle; Wolff, Christian; Beck, Heinz

    2017-01-01

    In human epilepsy, pharmacoresistance to antiepileptic drug therapy is a major problem affecting ~30% of patients with epilepsy. Many classical antiepileptic drugs target voltage-gated sodium channels, and their potent activity in inhibiting high-frequency firing has been attributed to their strong use-dependent blocking action. In chronic epilepsy, a loss of use-dependent block has emerged as a potential cellular mechanism of pharmacoresistance for anticonvulsants acting on voltage-gated sodium channels. The anticonvulsant drug lacosamide (LCM) also targets sodium channels, but has been shown to preferentially affect sodium channel slow inactivation processes, in contrast to most other anticonvulsants. We used whole-cell voltage clamp recordings in acutely isolated cells to investigate the effects of LCM on transient Na + currents. Furthermore, we used whole-cell current clamp recordings to assess effects on repetitive action potential firing in hippocampal slices. We show here that LCM exerts its effects primarily via shifting the slow inactivation voltage dependence to more hyperpolarized potentials in hippocampal dentate granule cells from control and epileptic rats, and from patients with epilepsy. It is important to note that this activity of LCM was maintained in chronic experimental and human epilepsy. Furthermore, we demonstrate that the efficacy of LCM in inhibiting high-frequency firing is undiminished in chronic experimental and human epilepsy. Taken together, these results show that LCM exhibits maintained efficacy in chronic epilepsy, in contrast to conventional use-dependent sodium channel blockers such as carbamazepine. They also establish that targeting slow inactivation may be a promising strategy for overcoming target mechanisms of pharmacoresistance. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  7. Native pyroglutamation of huwentoxin-IV: a post-translational modification that increases the trapping ability to the sodium channel.

    Science.gov (United States)

    Rong, Mingqiang; Duan, Zhigui; Chen, Juliang; Li, Jianglin; Xiao, Yuchen; Liang, Songping

    2013-01-01

    Huwentoxin-IV (HWTX-IV), a tetrodotoxin-sensitive (TTX-s) sodium channel antagonist, is found in the venom of the Chinese spider Ornithoctonus huwena. A naturally modified HWTX-IV (mHWTX-IV), having a molecular mass 18 Da lower than HWTX-IV, has also been isolated from the venom of the same spider. By a combination of enzymatic fragmentation and MS/MS de novo sequencing, mHWTX-IV has been shown to have the same amino acid sequence as that of HWTX-IV, except that the N-terminal glutamic acid replaced by pyroglutamic acid. mHWTX-IV inhibited tetrodotoxin-sensitive voltage-gated sodium channels of dorsal root ganglion neurons with an IC50 nearly equal to native HWTX-IV. mHWTX-IV showed the same activation and inactivation kinetics seen for native HWTX-IV. In contrast with HWTX-IV, which dissociates at moderate voltage depolarization voltages (+50 mV, 180000 ms), mHWTX-IV inhibition of TTX-sensitive sodium channels is not reversed by strong depolarization voltages (+200 mV, 500 ms). Recovery of Nav1.7current was voltage-dependent and was induced by extreme depolarization in the presence of HWTX-IV, but no obvious current was elicited after application of mHWTX-IV. Our data indicate that the N-terminal modification of HWTX-IV gives the peptide toxin a greater ability to trap the voltage sensor in the sodium channel. Loss of a negative charge, caused by cyclization at the N-terminus, is a possible reason why the modified toxin binds much stronger. To our knowledge, this is the first report of a pyroglutamic acid residue in a spider toxin; this modification seems to increase the trapping ability of the voltage sensor in the sodium channel.

  8. Native pyroglutamation of huwentoxin-IV: a post-translational modification that increases the trapping ability to the sodium channel.

    Directory of Open Access Journals (Sweden)

    Mingqiang Rong

    Full Text Available Huwentoxin-IV (HWTX-IV, a tetrodotoxin-sensitive (TTX-s sodium channel antagonist, is found in the venom of the Chinese spider Ornithoctonus huwena. A naturally modified HWTX-IV (mHWTX-IV, having a molecular mass 18 Da lower than HWTX-IV, has also been isolated from the venom of the same spider. By a combination of enzymatic fragmentation and MS/MS de novo sequencing, mHWTX-IV has been shown to have the same amino acid sequence as that of HWTX-IV, except that the N-terminal glutamic acid replaced by pyroglutamic acid. mHWTX-IV inhibited tetrodotoxin-sensitive voltage-gated sodium channels of dorsal root ganglion neurons with an IC50 nearly equal to native HWTX-IV. mHWTX-IV showed the same activation and inactivation kinetics seen for native HWTX-IV. In contrast with HWTX-IV, which dissociates at moderate voltage depolarization voltages (+50 mV, 180000 ms, mHWTX-IV inhibition of TTX-sensitive sodium channels is not reversed by strong depolarization voltages (+200 mV, 500 ms. Recovery of Nav1.7current was voltage-dependent and was induced by extreme depolarization in the presence of HWTX-IV, but no obvious current was elicited after application of mHWTX-IV. Our data indicate that the N-terminal modification of HWTX-IV gives the peptide toxin a greater ability to trap the voltage sensor in the sodium channel. Loss of a negative charge, caused by cyclization at the N-terminus, is a possible reason why the modified toxin binds much stronger. To our knowledge, this is the first report of a pyroglutamic acid residue in a spider toxin; this modification seems to increase the trapping ability of the voltage sensor in the sodium channel.

  9. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  10. Molecular basis of inhibition of acid sensing ion channel 1A by diminazene.

    Directory of Open Access Journals (Sweden)

    Aram J Krauson

    Full Text Available Acid-sensing ion channels (ASICs are trimeric proton-gated cation permeable ion channels expressed primarily in neurons. Here we employed site-directed mutagenesis and electrophysiology to investigate the mechanism of inhibition of ASIC1a by diminazene. This compound inhibits mouse ASIC1a with a half-maximal inhibitory concentration (IC50 of 2.4 μM. At first, we examined whether neutralizing mutations of Glu79 and Glu416 alter diminazene block. These residues form a hexagonal array in the lower palm domain that was previously shown to contribute to pore opening in response to extracellular acidification. Significantly, single Gln substitutions at positions 79 and 416 in ASIC1a reduced diminazene apparent affinity by 6-7 fold. This result suggests that diminazene inhibits ASIC1a in part by limiting conformational rearrangement in the lower palm domain. Because diminazene is charged at physiological pHs, we assessed whether it inhibits ASIC1a by blocking the ion channel pore. Consistent with the notion that diminazene binds to a site within the membrane electric field, diminazene block showed a strong dependence with the membrane potential. Moreover, a Gly to Ala mutation at position 438, in the ion conduction pathway of ASIC1a, increased diminazene IC50 by one order of magnitude and eliminated the voltage dependence of block. Taken together, our results indicate that the inhibition of ASIC1a by diminazene involves both allosteric modulation and blocking of ion flow through the conduction pathway. Our findings provide a foundation for the development of more selective and potent ASIC pore blockers.

  11. Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel.

    Science.gov (United States)

    Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu

    2007-12-28

    Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.

  12. Relative transmembrane segment rearrangements during BK channel activation resolved by structurally assigned fluorophore–quencher pairing

    Science.gov (United States)

    Pantazis, Antonios

    2012-01-01

    Voltage-activated proteins can sense, and respond to, changes in the electric field pervading the cell membrane by virtue of a transmembrane helix bundle, the voltage-sensing domain (VSD). Canonical VSDs consist of four transmembrane helices (S1–S4) of which S4 is considered a principal component because it possesses charged residues immersed in the electric field. Membrane depolarization compels the charges, and by extension S4, to rearrange with respect to the field. The VSD of large-conductance voltage- and Ca-activated K+ (BK) channels exhibits two salient inconsistencies from the canonical VSD model: (1) the BK channel VSD possesses an additional nonconserved transmembrane helix (S0); and (2) it exhibits a “decentralized” distribution of voltage-sensing charges, in helices S2 and S3, in addition to S4. Considering these unique features, the voltage-dependent rearrangements of the BK VSD could differ significantly from the standard model of VSD operation. To understand the mode of operation of this unique VSD, we have optically tracked the relative motions of the BK VSD transmembrane helices during activation, by manipulating the quenching environment of site-directed fluorescent labels with native and introduced Trp residues. Having previously reported that S0 and S4 diverge during activation, in this work we demonstrate that S4 also diverges from S1 and S2, whereas S2, compelled by its voltage-sensing charged residues, moves closer to S1. This information contributes spatial constraints for understanding the BK channel voltage-sensing process, revealing the structural rearrangements in a non-canonical VSD. PMID:22802360

  13. Differential Regulation of Action Potential Shape and Burst-Frequency Firing by BK and Kv2 Channels in Substantia Nigra Dopaminergic Neurons.

    Science.gov (United States)

    Kimm, Tilia; Khaliq, Zayd M; Bean, Bruce P

    2015-12-16

    Little is known about the voltage-dependent potassium currents underlying spike repolarization in midbrain dopaminergic neurons. Studying mouse substantia nigra pars compacta dopaminergic neurons both in brain slice and after acute dissociation, we found that BK calcium-activated potassium channels and Kv2 channels both make major contributions to the depolarization-activated potassium current. Inhibiting Kv2 or BK channels had very different effects on spike shape and evoked firing. Inhibiting Kv2 channels increased spike width and decreased the afterhyperpolarization, as expected for loss of an action potential-activated potassium conductance. BK inhibition also increased spike width but paradoxically increased the afterhyperpolarization. Kv2 channel inhibition steeply increased the slope of the frequency-current (f-I) relationship, whereas BK channel inhibition had little effect on the f-I slope or decreased it, sometimes resulting in slowed firing. Action potential clamp experiments showed that both BK and Kv2 current flow during spike repolarization but with very different kinetics, with Kv2 current activating later and deactivating more slowly. Further experiments revealed that inhibiting either BK or Kv2 alone leads to recruitment of additional current through the other channel type during the action potential as a consequence of changes in spike shape. Enhancement of slowly deactivating Kv2 current can account for the increased afterhyperpolarization produced by BK inhibition and likely underlies the very different effects on the f-I relationship. The cross-regulation of BK and Kv2 activation illustrates that the functional role of a channel cannot be defined in isolation but depends critically on the context of the other conductances in the cell. This work shows that BK calcium-activated potassium channels and Kv2 voltage-activated potassium channels both regulate action potentials in dopamine neurons of the substantia nigra pars compacta. Although both

  14. Quantum communication under channel uncertainty

    International Nuclear Information System (INIS)

    Noetzel, Janis Christian Gregor

    2012-01-01

    This work contains results concerning transmission of entanglement and subspaces as well as generation of entanglement in the limit of arbitrary many uses of compound- and arbitrarily varying quantum channels (CQC, AVQC). In both cases, the channel is described by a set of memoryless channels. Only forward communication between one sender and one receiver is allowed. A code is said to be ''good'' only, if it is ''good'' for every channel out of the set. Both settings describe a scenario, in which sender and receiver have only limited channel knowledge. For different amounts of information about the channel available to sender or receiver, coding theorems are proven for the CQC. For the AVQC, both deterministic and randomised coding schemes are considered. Coding theorems are proven, as well as a quantum analogue of the Ahlswede-dichotomy. The connection to zero-error capacities of stationary memoryless quantum channels is investigated. The notion of symmetrisability is defined and used for both classes of channels.

  15. VAX CAMAC channel

    International Nuclear Information System (INIS)

    Nelson, D.J.; Breidenbach, M.; Granieri, C.D.; Grund, J.E.; Patrick, J.F.; Weaver, L.J.

    1980-10-01

    A new generation CAMAC System has been developed for the Mark II Detector at SLAC's PEP storage ring. This flexible system can efficiently transfer data between a host computer and a very large set of CAMAC data acquisition and control modules. A bipolar microprocessor operates as a Channel interface by supervising the CAMAC system and minimizing the host computer's work. This programmable channel couples the host to a set of System Crates; each System Crate houses Branch Drivers that can directly control a set of crates or communicate over differential parallel highways to Branch Receivers for control of distant crates. A coherent software package integrates the high level programs, system driver level programs, and microcode control of the system

  16. Geysering in boiling channels

    Energy Technology Data Exchange (ETDEWEB)

    Aritomi, Masanori; Takemoto, Takatoshi [Tokyo Institute of Technology, Tokyo (Japan); Chiang, Jing-Hsien [Japan NUS Corp. Ltd., Toyko (Japan)] [and others

    1995-09-01

    A concept of natural circulation BWRs such as the SBWR has been proposed and seems to be promising in that the primary cooling system can be simplified. The authors have been investigating thermo-hydraulic instabilities which may appear during the start-up in natural circulation BWRs. In our previous works, geysering was investigated in parallel boiling channels for both natural and forced circulations, and its driving mechanism and the effect of system pressure on geysering occurrence were made clear. In this paper, geysering is investigated in a vertical column and a U-shaped vertical column heated in the lower parts. It is clarified from the results that the occurrence mechanism of geysering and the dependence of system pressure on geysering occurrence coincide between parallel boiling channels in circulation systems and vertical columns in non-circulation systems.

  17. Coolant channel module CCM

    International Nuclear Information System (INIS)

    Hoeld, Alois

    2007-01-01

    A complete and detailed description of the theoretical background of an '(1D) thermal-hydraulic drift-flux based mixture-fluid' coolant channel model and its resulting module CCM will be presented. The objective of this module is to simulate as universally as possible the steady state and transient behaviour of the key characteristic parameters of a single- or two-phase fluid flowing within any type of heated or non-heated coolant channel. Due to the possibility that different flow regimes can appear along any channel, such a 'basic (BC)' 1D channel is assumed to be subdivided into a number of corresponding sub-channels (SC-s). Each SC can belong to only two types of flow regime, an SC with just a single-phase fluid, containing exclusively either sub-cooled water or superheated steam, or an SC with a two-phase mixture flow. After an appropriate nodalisation of such a BC (and therefore also its SC-s) a 'modified finite volume method' has been applied for the spatial discretisation of the partial differential equations (PDE-s) which represent the basic conservation equations of thermal-hydraulics. Special attention had to be given to the possibility of variable SC entrance or outlet positions (which describe boiling boundaries or mixture levels) and thus the fact that an SC can even disappear or be created anew. The procedure yields for each SC type (and thus the entire BC), a set of non-linear ordinary 1st order differential equations (ODE-s). To link the resulting mean nodal with the nodal boundary function values, both of which are present in the discretised differential equations, a special quadratic polygon approximation procedure (PAX) had to be constructed. Together with the very thoroughly tested packages for drift-flux, heat transfer and single- and two-phase friction factors this procedure represents the central part of the here presented 'Separate-Region' approach, a theoretical model which provides the basis to the very effective working code package CCM

  18. Tourism distribution channels

    OpenAIRE

    Camilleri, Mark Anthony

    2017-01-01

    The distribution channels link the customers with the businesses. For many years, the tourism businesses may have distributed their products and services through intermediaries. However, the latest advances in technology have brought significant changes in this regard. More individuals and corporate customers are increasingly benefiting of ubiquitous technologies, including digital media. The development of mobile devices and their applications, are offering a wide range of possibilities to t...

  19. Athermal channeled spectropolarimeter

    Science.gov (United States)

    Jones, Julia Craven

    2015-12-08

    A temperature insensitive (athermal) channeled spectropolarimeter (CSP) is described. The athermal CSP includes a crystal retarder formed of a biaxial crystal. The crystal retarder has three crystal axes, wherein each axis has its own distinct index of refraction. The axes are oriented in a particular manner, causing an amplitude modulating carrier frequency induced by the crystal retarder to be thermally invariant. Accordingly, a calibration beam technique can be used over a relatively wide range of ambient temperatures, with a common calibration data set.

  20. Nuclear reactor coolant channels

    International Nuclear Information System (INIS)

    Macbeth, R.V.

    1978-01-01

    A nuclear reactor coolant channel is described that is suitable for sub-cooled reactors as in pressurised water reactors as well as for bulk boiling, as in boiling water reactors and steam generating nuclear reactors. The arrangement aims to improve heat transfer between the fuel elements and the coolant. Full constructional details are given. See also other similar patents by the author. (U.K.)

  1. The M2 Channel

    DEFF Research Database (Denmark)

    Santner, Paul

    Drug resistance of Influenza A against antivirals is an increasing problem. No effective Influenza A drugs targeting the crucial viral protein, the proton transporter M2 are available anymore due to widespread resistance. Thanks to research efforts elucidating M2 protein structure, function and i...... resistance escape routes from drug inhibition. We thereby were hopefully able to provide a platform for the large-scale evaluation of M2 channel activity, inhibitors and resistance....

  2. Aquaglyceroporins: generalized metalloid channels

    Science.gov (United States)

    Mukhopadhyay, Rita; Bhattacharjee, Hiranmoy; Rosen, Barry P.

    2014-01-01

    Background: Aquaporins (AQPs), members of a superfamily of transmembrane channel proteins, are ubiquitous in all domains of life. They fall into a number of branches that can be functionally categorized into two major sub-groups: i) orthodox aquaporins, which are water-specific channels, and ii) aquaglyceroporins, which allow the transport of water, non-polar solutes, such as urea or glycerol, the reactive oxygen species hydrogen peroxide, and gases such as ammonia, carbon dioxide and nitric oxide and, as described in this review, metalloids. Scope of Review: This review summarizes the key findings that AQP channels conduct bidirectional movement of metalloids into and out of cells. Major Conclusions: As(OH)3 and Sb(OH)3 behave as inorganic molecular mimics of glycerol, a property that allows their passage through AQP channels. Plant AQPs also allow the passage of boron and silicon as their hydroxyacids, boric acid (B(OH)3) and orthosilicic acid (Si(OH)4), respectively. Genetic analysis suggests that germanic acid (GeO2) is also a substrate. While As(III), Sb(III) and Ge(IV) are toxic metalloids, borate (B(III)) and silicate (Si(IV)) are essential elements in higher plants. General Significance: The uptake of environmental metalloids by aquaporins provides an understanding of (i) how toxic elements such as arsenic enter the food chain; (ii) the delivery of arsenic and antimony containing drugs in the treatment of certain forms of leukemia and chemotherapy of diseases caused by pathogenic protozoa; and (iii) the possibility that food plants such as rice could be made safer by genetically modifying them to exclude arsenic while still accumulating boron and silicon. PMID:24291688

  3. Matching Dyadic Distributions to Channels

    OpenAIRE

    Böcherer, Georg; Mathar, Rudolf

    2010-01-01

    Many communication channels with discrete input have non-uniform capacity achieving probability mass functions (PMF). By parsing a stream of independent and equiprobable bits according to a full prefix-free code, a modu-lator can generate dyadic PMFs at the channel input. In this work, we show that for discrete memoryless channels and for memoryless discrete noiseless channels, searching for good dyadic input PMFs is equivalent to minimizing the Kullback-Leibler distance between a dyadic PMF ...

  4. Radar channel balancing with commutation

    Energy Technology Data Exchange (ETDEWEB)

    Doerry, Armin Walter

    2014-02-01

    When multiple channels are employed in a pulse-Doppler radar, achieving and maintaining balance between the channels is problematic. In some circumstances the channels may be commutated to achieve adequate balance. Commutation is the switching, trading, toggling, or multiplexing of the channels between signal paths. Commutation allows modulating the imbalance energy away from the balanced energy in Doppler, where it can be mitigated with filtering.

  5. Microstructural information from channeling measurements

    International Nuclear Information System (INIS)

    Quere, Y.

    1984-09-01

    Channeling is sensitive to nearly all structural changes in solids. One briefly recalls how particles are dechanneled by lattice defects and describes the main applications of channeling to materials science: detection of radiation damage, location of impurity atoms, precipitations in alloys... Channeling being a phenomenon characteristic of perfect crystals, any type of lattice imperfection (phonons, crystal defects, precipitation etc.) is expected to produce dechanneling. Consequently channeling and its opposite, dechanneling, have both been used to study structure and structural changes of materials

  6. Ion channeling revisited

    Energy Technology Data Exchange (ETDEWEB)

    Doyle, Barney Lee [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Corona, Aldo [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Nguyen, Anh [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2014-09-01

    A MS Excel program has been written that calculates accidental, or unintentional, ion channeling in cubic bcc, fcc and diamond lattice crystals or polycrystalline materials. This becomes an important issue when simulating the creation by energetic neutrons of point displacement damage and extended defects using beams of ions. All of the tables and graphs in the three Ion Beam Analysis Handbooks that previously had to be manually looked up and read from were programed into Excel in handy lookup tables, or parameterized, for the case of the graphs, using rather simple exponential functions with different powers of the argument. The program then offers an extremely convenient way to calculate axial and planar half-angles and minimum yield or dechanneling probabilities, effects on half-angles of amorphous overlayers, accidental channeling probabilities for randomly oriented crystals or crystallites, and finally a way to automatically generate stereographic projections of axial and planar channeling half-angles. The program can generate these projections and calculate these probabilities for axes and [hkl] planes up to (555).

  7. The alpha channeling effect

    Science.gov (United States)

    Fisch, N. J.

    2015-12-01

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  8. A polyether biotoxin binding site on the lipid-exposed face of the pore domain of Kv channels revealed by the marine toxin gambierol

    Science.gov (United States)

    Kopljar, Ivan; Labro, Alain J.; Cuypers, Eva; Johnson, Henry W. B.; Rainier, Jon D.; Tytgat, Jan; Snyders, Dirk J.

    2009-01-01

    Gambierol is a marine polycyclic ether toxin belonging to the group of ciguatera toxins. It does not activate voltage-gated sodium channels (VGSCs) but inhibits Kv1 potassium channels by an unknown mechanism. While testing whether Kv2, Kv3, and Kv4 channels also serve as targets, we found that Kv3.1 was inhibited with an IC50 of 1.2 ± 0.2 nM, whereas Kv2 and Kv4 channels were insensitive to 1 μM gambierol. Onset of block was similar from either side of the membrane, and gambierol did not compete with internal cavity blockers. The inhibition did not require channel opening and could not be reversed by strong depolarization. Using chimeric Kv3.1–Kv2.1 constructs, the toxin sensitivity was traced to S6, in which T427 was identified as a key determinant. In Kv3.1 homology models, T427 and other molecular determinants (L348, F351) reside in a space between S5 and S6 outside the permeation pathway. In conclusion, we propose that gambierol acts as a gating modifier that binds to the lipid-exposed surface of the pore domain, thereby stabilizing the closed state. This site may be the topological equivalent of the neurotoxin site 5 of VGSCs. Further elucidation of this previously undescribed binding site may explain why most ciguatoxins activate VGSCs, whereas others inhibit voltage-dependent potassium (Kv) channels. This previously undescribed Kv neurotoxin site may have wide implications not only for our understanding of channel function at the molecular level but for future development of drugs to alleviate ciguatera poisoning or to modulate electrical excitability in general. PMID:19482941

  9. TRP channels in kidney disease.

    NARCIS (Netherlands)

    Hsu, Y.J.; Hoenderop, J.G.J.; Bindels, R.J.M.

    2007-01-01

    Mammalian TRP channel proteins form six-transmembrane cation-permeable channels that may be grouped into six subfamilies on the basis of amino acid sequence homology (TRPC, TRPV, TRPM, TRPA, TRPP, and TRPML). Recent studies of TRP channels indicate that they are involved in numerous fundamental cell

  10. Parallel inter channel interaction mechanisms

    International Nuclear Information System (INIS)

    Jovic, V.; Afgan, N.; Jovic, L.

    1995-01-01

    Parallel channels interactions are examined. For experimental researches of nonstationary regimes flow in three parallel vertical channels results of phenomenon analysis and mechanisms of parallel channel interaction for adiabatic condition of one-phase fluid and two-phase mixture flow are shown. (author)

  11. Fluoxetine-induced inhibition of synaptosomal [3H]5-HT release: Possible Ca2+-channel inhibition

    International Nuclear Information System (INIS)

    Stauderman, K.A.; Gandhi, V.C.; Jones, D.J.

    1992-01-01

    Fluoxetine, a selective 5-Ht uptake inhibitor, inhibited 15 mM K + -induced [ 3 H]5-HT release from rat spinal cord and cortical synaptosomes at concentrations > 0.5 uM. This effect reflected a property shared by another selective 5-HT uptake inhibitor paroxetine but not by less selective uptake inhibitors such as amitriptyline, desipramine, imipramine or nortriptyline. Inhibition of release by fluoxetine was inversely related to both the concentration of K + used to depolarize the synaptosomes and the concentration of external Ca 2+ . Experiments aimed at determining a mechanism of action revealed that fluoxetine did not inhibit voltage-independent release of [ 3 H]5-HT release induced by the Ca 2+ -ionophore A 23187 or Ca 2+ -independent release induced by fenfluramine. Moreover the 5-HT autoreceptor antagonist methiothepin did not reverse the inhibitory actions of fluoxetine on K + -induced release. Further studies examined the effects of fluoxetine on voltage-dependent Ca 2+ channels and Ca 2+ entry

  12. A novel 13 residue acyclic peptide from the marine snail, Conus monile, targets potassium channels.

    Science.gov (United States)

    Sudarslal, Sadasivannair; Singaravadivelan, Govindaswamy; Ramasamy, Palanisamy; Ananda, Kuppanna; Sarma, Siddhartha P; Sikdar, Sujit K; Krishnan, K S; Balaram, Padmanabhan

    2004-05-07

    A novel 13-residue peptide Mo1659 has been isolated from the venom of a vermivorous cone snail, Conus monile. HPLC fractions of the venom extract yielded an intense UV absorbing fraction with a mass of 1659Da. De novo sequencing using both matrix assisted laser desorption and ionization and electrospray MS/MS methods together with analysis of proteolytic fragments successfully yielded the amino acid sequence, FHGGSWYRFPWGY-NH(2). This was further confirmed by comparison with the chemically synthesized peptide and by conventional Edman sequencing. Mo1659 has an unusual sequence with a preponderance of aromatic residues and the absence of apolar, aliphatic residues like Ala, Val, Leu, and Ile. Mo1659 has no disulfide bridges distinguishing it from the conotoxins and bears no sequence similarity with any of the acyclic peptides isolated thus far from the venom of cone snails. Electrophysiological studies on the effect of Mo1659 on measured currents in dorsal root ganglion neurons suggest that the peptide targets non-inactivating voltage-dependent potassium channels.

  13. Multiple sodium channel isoforms mediate the pathological effects of Pacific ciguatoxin-1

    Science.gov (United States)

    Inserra, Marco C.; Israel, Mathilde R.; Caldwell, Ashlee; Castro, Joel; Deuis, Jennifer R.; Harrington, Andrea M.; Keramidas, Angelo; Garcia-Caraballo, Sonia; Maddern, Jessica; Erickson, Andelain; Grundy, Luke; Rychkov, Grigori Y.; Zimmermann, Katharina; Lewis, Richard J.; Brierley, Stuart M.; Vetter, Irina

    2017-01-01

    Human intoxication with the seafood poison ciguatoxin, a dinoflagellate polyether that activates voltage-gated sodium channels (NaV), causes ciguatera, a disease characterised by gastrointestinal and neurological disturbances. We assessed the activity of the most potent congener, Pacific ciguatoxin-1 (P-CTX-1), on NaV1.1–1.9 using imaging and electrophysiological approaches. Although P-CTX-1 is essentially a non-selective NaV toxin and shifted the voltage-dependence of activation to more hyperpolarising potentials at all NaV subtypes, an increase in the inactivation time constant was observed only at NaV1.8, while the slope factor of the conductance-voltage curves was significantly increased for NaV1.7 and peak current was significantly increased for NaV1.6. Accordingly, P-CTX-1-induced visceral and cutaneous pain behaviours were significantly decreased after pharmacological inhibition of NaV1.8 and the tetrodotoxin-sensitive isoforms NaV1.7 and NaV1.6, respectively. The contribution of these isoforms to excitability of peripheral C- and A-fibre sensory neurons, confirmed using murine skin and visceral single-fibre recordings, reflects the expression pattern of NaV isoforms in peripheral sensory neurons and their contribution to membrane depolarisation, action potential initiation and propagation. PMID:28225079

  14. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  15. Arabidopsis thaliana defense response to the ochratoxin A-producing strain (Aspergillus ochraceus 3.4412).

    Science.gov (United States)

    Hao, Junran; Wu, Weihong; Wang, Yan; Yang, Zhuojun; Liu, Yang; Lv, Yangjun; Zhai, Yanan; Yang, Jing; Liang, Zhihong; Huang, Kunlun; Xu, Wentao

    2015-05-01

    OTA-producing strain Aspergillus ochraceus induced necrotic lesions, ROS accumulation and defense responses in Arabidopsis . Primary metabolic and defense-related proteins changed in proteomics. Ascorbate-glutathione cycle and voltage-dependent anion-selective channel proteins fluctuated. Mycotoxigenic fungi, as widespread contaminants by synthesizing mycotoxins in pre-/post-harvest infected plants and even stored commercial cereals, could usually induce plant-fungi defense responses. Notably, ochratoxin A (OTA) is a nephrotoxic, hepatotoxic, teratogenic, immunotoxic and phytotoxic mycotoxin. Herein, defense responses of model system Arabidopsis thaliana detached leaves to infection of Aspergillus ochraceus 3.4412, an OTA high-producing strain, were studied from physiological, proteomic and transcriptional perspectives. During the first 72 h after inoculation (hai), the newly formed hypersensitive responses-like lesions, decreased chlorophyll content, accumulated reactive oxygen species and upregulated defense genes expressions indicated the defense response was induced in the leaves with the possible earlier motivated jasmonic acid/ethylene signaling pathways and the later salicylic acid-related pathway. Moreover, proteomics using two-dimensional gel electrophoresis 72 hai showed 16 spots with significantly changed abundance and 13 spots corresponding to 12 unique proteins were successfully identified by MALDI-TOF/TOF MS/MS. Of these, six proteins were involved in basic metabolism and four in defense-related processes, which included glutathione-S-transferase F7, voltage-dependent anion-selective channel protein 3 (VDAC-3), osmotin-like protein OSM34 and blue copper-binding protein. Verified from proteomic and/or transcriptional perspectives, it is concluded that the primary metabolic pathways were suppressed with the ascorbate-glutathione cycle fluctuated in response to A. ochraceus and the modulation of VDACs suggested the possibility of structural damage and

  16. Phosphatidylinositol (4,5)bisphosphate inhibits K+-efflux channel activity in NT1 tobacco cultured cells.

    Science.gov (United States)

    Ma, Xiaohong; Shor, Oded; Diminshtein, Sofia; Yu, Ling; Im, Yang Ju; Perera, Imara; Lomax, Aaron; Boss, Wendy F; Moran, Nava

    2009-02-01

    In the animal world, the regulation of ion channels by phosphoinositides (PIs) has been investigated extensively, demonstrating a wide range of channels controlled by phosphatidylinositol (4,5)bisphosphate (PtdInsP2). To understand PI regulation of plant ion channels, we examined the in planta effect of PtdInsP2 on the K+-efflux channel of tobacco (Nicotiana tabacum), NtORK (outward-rectifying K channel). We applied a patch clamp in the whole-cell configuration (with fixed "cytosolic" Ca2+ concentration and pH) to protoplasts isolated from cultured tobacco cells with genetically manipulated plasma membrane levels of PtdInsP2 and cellular inositol (1,4,5)trisphosphate: "Low PIs" had depressed levels of these PIs, and "High PIs" had elevated levels relative to controls. In all of these cells, K channel activity, reflected in the net, steady-state outward K+ currents (IK), was inversely related to the plasma membrane PtdInsP2 level. Consistent with this, short-term manipulations decreasing PtdInsP2 levels in the High PIs, such as pretreatment with the phytohormone abscisic acid (25 microM) or neutralizing the bath solution from pH 5.6 to pH 7, increased IK (i.e. NtORK activity). Moreover, increasing PtdInsP2 levels in controls or in abscisic acid-treated high-PI cells, using the specific PI-phospholipase C inhibitor U73122 (2.5-4 microM), decreased NtORK activity. In all cases, IK decreases stemmed largely from decreased maximum attainable NtORK channel conductance and partly from shifted voltage dependence of channel gating to more positive potentials, making it more difficult to activate the channels. These results are consistent with NtORK inhibition by the negatively charged PtdInsP2 in the internal plasma membrane leaflet. Such effects are likely to underlie PI signaling in intact plant cells.

  17. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  18. Beyond the Manual Channel

    DEFF Research Database (Denmark)

    , the main focus there is on spoken languages in their written and spoken forms. This series of workshops, however, offers a forum for researchers focussing on sign languages. For the fourth time, the workshop had sign language corpora as its main topic. This time, the focus was on any aspect beyond...... the manual channel. Not surprisingly, most papers deal with non-manuals on the face. Once again, the papers at this workshop clearly identify the potentials of even closer cooperation between sign linguists and sign language engineers, and we think it is events like this that contribute a lot to a better...

  19. Ion Channels in Leukocytes

    Science.gov (United States)

    1991-07-01

    muscle k142), heart muscle (80), bo- are released. In recent years much has been learned vine pulmonar arter endothelial cells (251), and rat about the...b3 Zn or cytes from cystic fibrosis patients lack a Cl current that Ni (1 mM)-added to the cytoplasmic side of the mem- can be acti% ated b3 the...that at37’C hu- to be defectiv.- in cystic fibrosis (55, 277), and Chen et al. man T-cell CiL channels are active at rest, implies that (25) have shown

  20. A Micromechanical RF Channelizer

    Science.gov (United States)

    Akgul, Mehmet

    The power consumption of a radio generally goes as the number and strength of the RF signals it must process. In particular, a radio receiver would consume much less power if the signal presented to its electronics contained only the desired signal in a tiny percent bandwidth frequency channel, rather than the typical mix of signals containing unwanted energy outside the desired channel. Unfortunately, a lack of filters capable of selecting single channel bandwidths at RF forces the front-ends of contemporary receivers to accept unwanted signals, and thus, to operate with sub-optimal efficiency. This dissertation focuses on the degree to which capacitive-gap transduced micromechanical resonators can achieve the aforementioned RF channel-selecting filters. It aims to first show theoretically that with appropriate scaling capacitive-gap transducers are strong enough to meet the needed coupling requirements; and second, to fully detail an architecture and design procedure needed to realize said filters. Finally, this dissertation provides an actual experimentally demonstrated RF channel-select filter designed using the developed procedures and confirming theoretical predictions. Specifically, this dissertation introduces four methods that make possible the design and fabrication of RF channel-select filters. The first of these introduces a small-signal equivalent circuit for parallel-plate capacitive-gap transduced micromechanical resonators that employs negative capacitance to model the dependence of resonance frequency on electrical stiffness in a way that facilitates the analysis of micromechanical circuits loaded with arbitrary electrical impedances. The new circuit model not only correctly predicts the dependence of electrical stiffness on the impedances loading the input and output electrodes of parallel-plate capacitive-gap transduced micromechanical device, but does so in a visually intuitive way that identifies current drive as most appropriate for

  1. TRPV6 channels.

    Science.gov (United States)

    Fecher-Trost, Claudia; Weissgerber, Petra; Wissenbach, Ulrich

    2014-01-01

    TRPV6 (former synonyms ECAC2, CaT1, CaT-like) displays several specific features which makes it unique among the members of the mammalian Trp gene family (1) TRPV6 (and its closest relative, TRPV5) are the only highly Ca(2+)-selective channels of the entire TRP superfamily (Peng et al. 1999; Wissenbach et al. 2001; Voets et al. 2004). (2) Translation of Trpv6 initiates at a non-AUG codon, at ACG, located upstream of the annotated AUG, which is not used for initiation (Fecher-Trost et al. 2013). The ACG codon is nevertheless decoded by methionine. Not only a very rare event in eukaryotic biology, the full-length TRPV6 protein existing in vivo comprises an amino terminus extended by 40 amino acid residues compared to the annotated truncated TRPV6 protein which has been used in most studies on TRPV6 channel activity so far. (In the following numbering occurs according to this full-length protein, with the numbers of the so far annotated truncated protein in brackets). (3) Only in humans a coupled polymorphism of Trpv6 exists causing three amino acid exchanges and resulting in an ancestral Trpv6 haplotype and a so-called derived Trpv6 haplotype (Wissenbach et al. 2001). The ancestral allele encodes the amino acid residues C197(157), M418(378) and M721(681) and the derived alleles R197(157), V418(378) and T721(681). The ancestral haplotype is found in all species, the derived Trpv6 haplotype has only been identified in humans, and its frequency increases with the distance to the African continent. Apparently the Trpv6 gene has been a strong target for selection in humans, and its derived variant is one of the few examples showing consistently differences to the orthologues genes of other primates (Akey et al. 2004, 2006; Stajich and Hahn 2005; Hughes et al. 2008). (4) The Trpv6 gene expression is significantly upregulated in several human malignancies including the most common cancers, prostate and breast cancer (Wissenbach et al. 2001; Zhuang et al. 2002; Fixemer et al

  2. Identification of a functional interaction between Kv4.3 channels and c-Src tyrosine kinase.

    Science.gov (United States)

    Gomes, Pedro; Saito, Tomoaki; Del Corsso, Cris; Alioua, Abderrahmane; Eghbali, Mansoureh; Toro, Ligia; Stefani, Enrico

    2008-10-01

    Voltage-gated K(+) (Kv) channels are key determinants of cardiac and neuronal excitability. A substantial body of evidence has accumulated in support of a role for Src family tyrosine kinases in the regulation of Kv channels. In this study, we examined the possibility that c-Src tyrosine kinase participates in the modulation of the transient voltage-dependent K(+) channel Kv4.3. Supporting a mechanistic link between Kv4.3 and c-Src, confocal microscopy analysis of HEK293 cells stably transfected with Kv4.3 showed high degree of co-localization of the two proteins at the plasma membrane. Our results further demonstrate an association between Kv4.3 and c-Src by co-immunoprecipitation and GST pull-down assays, this interaction being mediated by the SH2 and SH3 domains of c-Src. Furthermore, we show that Kv4.3 is tyrosine phosphorylated under basal conditions. The functional relevance of the observed interaction between Kv4.3 and c-Src was established in patch-clamp experiments, where application of the Src inhibitor PP2 caused a decrease in Kv4.3 peak current amplitude, but not the inactive structural analogue PP3. Conversely, intracellular application of recombinant c-Src kinase or the protein tyrosine phosphatase inhibitor bpV(phen) increased Kv4.3 peak current amplitude. In conclusion, our findings provide evidence that c-Src-induced Kv4.3 channel activation involves their association in a macromolecular complex and suggest a role for c-Src-Kv4.3 pathway in regulating cardiac and neuronal excitability.

  3. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  4. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  5. Anion concurrence and anion selectivity in the sorption of radionuclides by organotones

    International Nuclear Information System (INIS)

    Behnsen, Julia G.

    2007-01-01

    Some long-lived and radiologically important nuclear fission products, such as I-129 (half-life t 1/2 = 1,6 . 10 7 a), Tc-99 (t 1/2 = 2,1 . 10 5 a), and Se-79 (t 1/2 = 6,5 . 10 4 a) are anionic in aqueous environments. This study focuses on the adsorption of such anions to organoclays and the understanding of the selectivity of the process. The organoclays used in this study were prepared from a bentonite (MX-80) and a vermiculite clay, and the cationic surfactants hexadcylpyridium, hexadecyltrimethylammonium, and benzethonium. Surfactant adsorption to the bentonite exceeds the cation exchange capacity of the clay, with the surplus positive charge being balanced by the co-adsorption of chloride. The interlayer distance of the bentonites is increased sufficiently to contain bi- and pseudotrimolecular structures of the surfactants. Adsorption experiments were carried out using the batch technique. Anion adsorption of iodide, perrhenate, selenite, nitrate, and sulphate is mainly due to ion exchange with chloride. As an additional adsorption mechanism, the incorporation of inorganic ion pairs into the interlayer space of the clay is proposed as a result of experiments showing differences in the adsorption levels of sodium and potassium iodide. Anion adsorption results show a clear selectivity of the organoclays, with the affinity sequence being: ReO - 4 > I - > NO - 3 > Cl - > SO 2- 4 > SeO 2- 3 . This sequence corresponds to the sequence of increasing hydration energies of the anions, thus selectivity could be due to the process of minimization of free energy of the system. (orig.)

  6. Mimicking multi-channel scattering with single-channel approaches

    OpenAIRE

    Grishkevich, Sergey; Schneider, Philipp-Immanuel; Vanne, Yulian V.; Saenz, Alejandro

    2009-01-01

    The collision of two atoms is an intrinsic multi-channel (MC) problem as becomes especially obvious in the presence of Feshbach resonances. Due to its complexity, however, single-channel (SC) approximations, which reproduce the long-range behavior of the open channel, are often applied in calculations. In this work the complete MC problem is solved numerically for the magnetic Feshbach resonances (MFRs) in collisions between generic ultracold 6Li and 87Rb atoms in the ground state and in the ...

  7. Readthrough of long-QT syndrome type 1 nonsense mutations rescues function but alters the biophysical properties of the channel.

    Science.gov (United States)

    Harmer, Stephen C; Mohal, Jagdeep S; Kemp, Duncan; Tinker, Andrew

    2012-05-01

    The nonsense mutations R518X-KCNQ1 and Q530X-KCNQ1 cause LQT1 (long-QT syndrome type 1) and result in a complete loss of I(Ks) channel function. In the present study we attempted to rescue the function of these mutants, in HEK (human embryonic kidney)-293 cells, by promoting readthrough of their PTCs (premature termination codons) using the pharmacological agents G-418, gentamicin and PTC124. Gentamicin and G-418 acted to promote full-length channel protein expression from R518X at 100 μM and from Q530X at 1 mM. In contrast, PTC124 did not, at any dose tested, induce readthrough of either mutant. G-418 (1 mM) treatment also acted to significantly (Pbiophysical properties of the currents produced from R518X, while similar, were not identical with wild-type as the voltage-dependence of activation was significantly (P<0.05) shifted by +25 mV. Overall, these findings indicate that although functional rescue of LQT1 nonsense mutations is possible, it is dependent on the degree of readthrough achieved and the effect on channel function of the amino acid substituted for the PTC. Such considerations will determine the success of future therapies.

  8. Single-channel L-type Ca2+ currents in chicken embryo semicircular canal type I and type II hair cells.

    Science.gov (United States)

    Zampini, Valeria; Valli, Paolo; Zucca, Giampiero; Masetto, Sergio

    2006-08-01

    Few data are available concerning single Ca channel properties in inner ear hair cells and particularly none in vestibular type I hair cells. By using the cell-attached configuration of the patch-clamp technique in combination with the semicircular canal crista slice preparation, we determined the elementary properties of voltage-dependent Ca channels in chicken embryo type I and type II hair cells. The pipette solutions included Bay K 8644. With 70 mM Ba(2+) in the patch pipette, Ca channel activity appeared as very brief openings at -60 mV. Ca channel properties were found to be similar in type I and type II hair cells; therefore data were pooled. The mean inward current amplitude was -1.3 +/- 0.1 (SD) pA at - 30 mV (n = 16). The average slope conductance was 21 pS (n = 20). With 5 mM Ba(2+) in the patch pipette, very brief openings were already detectable at -80 mV. The mean inward current amplitude was -0.7 +/- 0.2 pA at -40 mV (n = 9). The average slope conductance was 11 pS (n = 9). The mean open time and the open probability increased significantly with depolarization. Ca channel activity was still present and unaffected when omega-agatoxin IVA (2 microM) and omega-conotoxin GVIA (3.2 microM) were added to the pipette solution. Our results show that types I and II hair cells express L-type Ca channels with similar properties. Moreover, they suggest that in vivo Ca(2+) influx might occur at membrane voltages more negative than -60 mV.

  9. miR-1 is increased in pulmonary hypertension and downregulates Kv1.5 channels in rat pulmonary arteries.

    Science.gov (United States)

    Mondejar-Parreño, Gema; Callejo, María; Barreira, Bianca; Morales-Cano, Daniel; Esquivel-Ruiz, Sergio; Moreno, Laura; Cogolludo, Angel; Perez-Vizcaino, Francisco

    2018-05-02

    ■The expression of miR-1 is increased in lungs from the Hyp/Su5416 PAH rat model. ■PASMC from this animal model are more depolarised and show decreased expression and activity of Kv1.5. ■miR-1 directly targets Kv1.5 channels, reduces Kv1.5 activity and induces membrane depolarization. ■Antagomir-1 prevents Kv1.5 channel downregulation and the depolarization induced by hypoxia/Su5416 exposition. Impairment of voltage-dependent potassium channel (Kv) plays a central role in the development of cardiovascular diseases, including pulmonary arterial hypertension (PAH). MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the 3'-UTR region of specific mRNAs. The aim of this study was to analyze the effects of miR-1 on Kv channel function in pulmonary arteries (PA). Kv channel activity was studied in PA from healthy animals transfected with miR-1 or scrambled-miR. Kv currents were studied using the whole-cell configuration of patch-clamp technique. The characterization of the Kv1.5 currents was performed with the selective inhibitor DPO-1. miR-1 expression was increased and Kv1.5 channels were decreased in lungs from a rat model of PAH induced by hypoxia and Su5416. miR-1 transfection increased cell capacitance, reduced Kv1.5 currents and induced membrane depolarization in isolated pulmonary artery smooth muscle cells (PASMCs). Luciferase reporter assay indicated that KCNA5, which encodes Kv1.5 channels, is a direct target gene of miR-1. Incubation of PA with Su5416 and hypoxia (3% O 2 ) increased miR-1 and induced a decline in Kv1.5 currents, which was prevented by antagomiR-1. In conclusion, these data indicate that miR-1 induces PASMC hypertrophy and reduces the activity and expression of Kv channels, suggesting a pathophysiological role in PAH. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Inward rectifier potassium channels in the HL-1 cardiomyocyte-derived cell line.

    Science.gov (United States)

    Goldoni, Dana; Zhao, YouYou; Green, Brian D; McDermott, Barbara J; Collins, Anthony

    2010-11-01

    HL-1 is a line of immortalized cells of cardiomyocyte origin that are a useful complement to native cardiomyocytes in studies of cardiac gene regulation. Several types of ion channel have been identified in these cells, but not the physiologically important inward rectifier K(+) channels. Our aim was to identify and characterize inward rectifier K(+) channels in HL-1 cells. External Ba(2+) (100 µM) inhibited 44 ± 0.05% (mean ± s.e.m., n = 11) of inward current in whole-cell patch-clamp recordings. The reversal potential of the Ba(2+)-sensitive current shifted with external [K(+)] as expected for K(+)-selective channels. The slope conductance of the inward Ba(2+)-sensitive current increased with external [K(+)]. The apparent Kd for Ba(2+) was voltage dependent, ranging from 15 µM at -150  mV to 148 µM at -75  mV in 120  mM external K(+). This current was insensitive to 10 µM glybenclamide. A component of whole-cell current was sensitive to 150 µM 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), although it did not correspond to the Ba(2+)-sensitive component. The effect of external 1 mM Cs(+) was similar to that of Ba(2+). Polymerase chain reaction using HL-1 cDNA as template and primers specific for the cardiac inward rectifier K(ir)2.1 produced a fragment of the expected size that was confirmed to be K(ir)2.1 by DNA sequencing. In conclusion, HL-1 cells express a current that is characteristic of cardiac inward rectifier K(+) channels, and express K(ir)2.1 mRNA. This cell line may have use as a system for studying inward rectifier gene regulation in a cardiomyocyte phenotype. © 2010 Wiley-Liss, Inc.

  11. Recording ion channels across soy-extracted lecithin bilayer generated by water-soluble quantum dots

    Science.gov (United States)

    Sarma, Runjun; Mohanta, Dambarudhar

    2014-02-01

    We report on the quantum dot (QD)-induced ion channels across a soya-derived lecithin bilayer supported on a laser drilled of ~100 μm aperture of cellulose acetate substrate that separates two electrolytic chambers. Adequate current bursts were observed when the bilayer was subjected to a gating voltage. The voltage-dependent current fluctuation, across the bilayer, was attributed to the insertion of ~20 nm sized water-soluble CdSe QDs, forming nanopores due to their spontaneous aggregation. Apart from a closed state, the first observable conductance levels were found as 6.3 and 11 nS, as for the respective biasing voltages of -10 and -20 mV. The highest observable conductance states, at corresponding voltages were ~14.3 and 21.1 nS. Considering two simplified models, we predict that the non-spherical pores (dnspore) can be a better approximation over spherical nanopores (dspore) for exhibiting a definite conductance level. At times, even dnspore ≤ 4dspore and that the non-spherical nanopores were associated with a smaller No. of QDs than the case for spherical nanopores, for a definite conductance state. It seems like the current events are partly stochastic, possibly due to thermal effects on the aggregated QDs that would form nanopores. The dwell time of the states was predicted in the range of 384-411 μs. The ion channel mechanism in natural phospholipid bilayers over artificial ones will provide a closer account to understand ion transport mechanism in live cells and signaling activity including labelling with fluorescent QDs.

  12. Characterization of Na+ and Ca2+ channels in zebrafish dorsal root ganglion neurons.

    Directory of Open Access Journals (Sweden)

    Yu-Jin Won

    Full Text Available BACKGROUND: Dorsal root ganglia (DRG somata from rodents have provided an excellent model system to study ion channel properties and modulation using electrophysiological investigation. As in other vertebrates, zebrafish (Danio rerio DRG are organized segmentally and possess peripheral axons that bifurcate into each body segment. However, the electrical properties of zebrafish DRG sensory neurons, as compared with their mammalian counterparts, are relatively unexplored because a preparation suitable for electrophysiological studies has not been available. METHODOLOGY/PRINCIPAL FINDINGS: We show enzymatically dissociated DRG neurons from juvenile zebrafish expressing Isl2b-promoter driven EGFP were easily identified with fluorescence microscopy and amenable to conventional whole-cell patch-clamp studies. Two kinetically distinct TTX-sensitive Na(+ currents (rapidly- and slowly-inactivating were discovered. Rapidly-inactivating I(Na were preferentially expressed in relatively large neurons, while slowly-inactivating I(Na was more prevalent in smaller DRG neurons. RT-PCR analysis suggests zscn1aa/ab, zscn8aa/ab, zscn4ab and zscn5Laa are possible candidates for these I(Na components. Voltage-gated Ca(2+ currents (I(Ca were primarily (87% comprised of a high-voltage activated component arising from ω-conotoxin GVIA-sensitive Ca(V2.2 (N-type Ca(2+ channels. A few DRG neurons (8% displayed a miniscule low-voltage-activated component. I(Ca in zebrafish DRG neurons were modulated by neurotransmitters via either voltage-dependent or -independent G-protein signaling pathway with large cell-to-cell response variability. CONCLUSIONS/SIGNIFICANCE: Our present results indicate that, as in higher vertebrates, zebrafish DRG neurons are heterogeneous being composed of functionally distinct subpopulations that may correlate with different sensory modalities. These findings provide the first comparison of zebrafish and rodent DRG neuron electrical properties and

  13. Multiplicative properties of quantum channels

    Science.gov (United States)

    Rahaman, Mizanur

    2017-08-01

    In this paper, we study the multiplicative behaviour of quantum channels, mathematically described by trace preserving, completely positive maps on matrix algebras. It turns out that the multiplicative domain of a unital quantum channel has a close connection to its spectral properties. A structure theorem (theorem 2.5), which reveals the automorphic property of an arbitrary unital quantum channel on a subalgebra, is presented. Various classes of quantum channels (irreducible, primitive, etc) are then analysed in terms of this stabilising subalgebra. The notion of the multiplicative index of a unital quantum channel is introduced, which measures the number of times a unital channel needs to be composed with itself for the multiplicative algebra to stabilise. We show that the maps that have trivial multiplicative domains are dense in completely bounded norm topology in the set of all unital completely positive maps. Some applications in quantum information theory are discussed.

  14. Upgrading a marketing channels role

    Directory of Open Access Journals (Sweden)

    Tišma-Borota Ankica

    2002-01-01

    Full Text Available As one of the marketing mix instruments, marketing channels were usually behind other instruments (product, price and promotion. Many companies regarded marketing channels as something that was 'left' after more important strategies of price, product and promotion were created. In recent past, things have changed and marketing channels became more interesting for research. This change came as a result of change in global market functioning especially in competitive advantage, distributors' strength and increasing technology.

  15. UMTS Common Channel Sensitivity Analysis

    DEFF Research Database (Denmark)

    Pratas, Nuno; Rodrigues, António; Santos, Frederico

    2006-01-01

    and as such it is necessary that both channels be available across the cell radius. This requirement makes the choice of the transmission parameters a fundamental one. This paper presents a sensitivity analysis regarding the transmission parameters of two UMTS common channels: RACH and FACH. Optimization of these channels...... is performed and values for the key transmission parameters in both common channels are obtained. On RACH these parameters are the message to preamble offset, the initial SIR target and the preamble power step while on FACH it is the transmission power offset....

  16. Demystifying Mechanosensitive Piezo Ion Channels.

    Science.gov (United States)

    Xu, X Z Shawn

    2016-06-01

    Mechanosensitive channels mediate touch, hearing, proprioception, and blood pressure regulation. Piezo proteins, including Piezo1 and Piezo2, represent a new class of mechanosensitive channels that have been reported to play key roles in most, if not all, of these modalities. The structural architecture and molecular mechanisms by which Piezos act as mechanosensitive channels, however, remain mysterious. Two new studies have now provided critical insights into the atomic structure and molecular basis of the ion permeation and mechano-gating properties of the Piezo1 channel.

  17. Defect Distributions in Channeling Experiments

    DEFF Research Database (Denmark)

    Andersen, Hans Henrik; Sigmund, P.

    1965-01-01

    A simple collision model allows to calculate energy losses of perfectly channeled particles. The maximum energy loss is related in a simple way to the displacement energy of lattice atoms perpendicular to the channel. From that, one obtains rather definite predictions on the possibility...... of radiation damage by channeled particles. As an application, one gets a necessary criterion for the occurence of super tails in channeling experiments. The theory involves some assumptions on the behaviour of Born-Mayer potentials which are verified by comparison to experimental displacement energies....

  18. Preservation of meandering river channels in uniformly aggrading channel belts

    NARCIS (Netherlands)

    Lageweg, W.I. van de; Schuurman, F.; Cohen, K.M.; Dijk, W.M. van; Shimizu, Y.; Kleinhans, M.G.

    2016-01-01

    Channel belt deposits from meandering river systems commonly display an internal architecture of stacked depositional features with scoured basal contacts due to channel and bedform migration across a range of scales. Recognition and correct interpretation of these bounding surfaces is essential to

  19. MONETARY TRANSMISSION CHANNELS IN ROMANIA – THE CREDIT CHANNEL

    Directory of Open Access Journals (Sweden)

    Magdalena RĂDULESCU

    2009-12-01

    Full Text Available The theoretical – intuitive analysis applied to the segment of monetary transmission evidences the fact that forming the traditional monetary impulses transmission channels are in a starting phase due to the long financial non – intermediary process which Romanian economy had known. In these conditions, the exchange rate channel, and also NBR currency purchases was, for a long time, an important way through which monetary authorities actions influenced macro economical behaviors. But starting with 2000, it is observed a credit channel reactivation and, especially, interest rate channel. Anyhow, the credit channel continues to be undermined by the existence of liquidity surplus within the system, by the phenomena of substitution of national currency credit with currency credits, and also moral hazardous displays. Albeit some of these phenomena also affect the interest rate channel, its role in sending monetary policy impulses is in a continuous progress. Apparently, it acts by way of nominal interest rates, their real level seeming less relevant. Once with remaking the two traditional channels, the companies and households balance is configured and consolidated, which shall potentate in the future the efficiency of the monetary policy. This paper analyses the credit channel in Romania, through an unrestricted VAR analysis.. It shows the responses of exchange rate, inflation rate, GDP, interest rate, imports and exports to a shock on non-governmental credit

  20. ZnO-channel thin-film transistors: Channel mobility

    International Nuclear Information System (INIS)

    Hoffman, R.L.

    2004-01-01

    ZnO-channel thin-film transistor (TFT) test structures are fabricated using a bottom-gate structure on thermally oxidized Si; ZnO is deposited via RF sputtering from an oxide target, with an unheated substrate. Electrical characteristics are evaluated, with particular attention given to the extraction and interpretation of transistor channel mobility. ZnO-channel TFT mobility exhibits severe deviation from that assumed by ideal TFT models; mobility extraction methodology must accordingly be recast so as to provide useful insight into device operation. Two mobility metrics, μ avg and μ inc , are developed and proposed as relevant tools in the characterization of nonideal TFTs. These mobility metrics are employed to characterize the ZnO-channel TFTs reported herein; values for μ inc as high as 25 cm2/V s are measured, comprising a substantial increase in ZnO-channel TFT mobility as compared to previously reported performance for such devices

  1. Na+K+-ATPase activity and K+ channels differently contribute to vascular relaxation in male and female rats.

    Directory of Open Access Journals (Sweden)

    Fernanda Moura Vargas Dias

    Full Text Available Gender associated differences in vascular reactivity regulation might contribute to the low incidence of cardiovascular disease in women. Cardiovascular protection is suggested to depend on female sex hormones' effects on endothelial function and vascular tone regulation. We tested the hypothesis that potassium (K+ channels and Na+K+-ATPase may be involved in the gender-based vascular reactivity differences. Aortic rings from female and male rats were used to examine the involvement of K+ channels and Na+K+-ATPase in vascular reactivity. Acetylcholine (ACh-induced relaxation was analyzed in the presence of L-NAME (100 µM and the following K+ channels blockers: tetraethylammonium (TEA, 2 mM, 4-aminopyridine (4-AP, 5 mM, iberiotoxin (IbTX, 30 nM, apamin (0.5 µM and charybdotoxin (ChTX, 0.1 µM. The ACh-induced relaxation sensitivity was greater in the female group. After incubation with 4-AP the ACh-dependent relaxation was reduced in both groups. However, the dAUC was greater in males, suggesting that the voltage-dependent K+ channel (Kv participates more in males. Inhibition of the three types of Ca2+-activated K+ channels induced a greater reduction in Rmax in females than in males. The functional activity of the Na+K+-ATPase was evaluated by KCl-induced relaxation after L-NAME and OUA incubation. OUA reduced K+-induced relaxation in female and male groups, however, it was greater in males, suggesting a greater Na+K+-ATPase functional activity. L-NAME reduced K+-induced relaxation only in the female group, suggesting that nitric oxide (NO participates more in their functional Na+K+-ATPase activity. These results suggest that the K+ channels involved in the gender-based vascular relaxation differences are the large conductance Ca2+-activated K+ channels (BKCa in females and Kv in males and in the K+-induced relaxation and the Na+K+-ATPase vascular functional activity is greater in males.

  2. An improved channel assessment scheme

    KAUST Repository

    Bader, Ahmed

    2014-01-01

    A source node in a multihop network determines whether to transmit in a channel based on whether the channel is occupied by a packet transmission with a large number of relays; whether the source node is in the data tones back-off zone; and the source node is in the busy tone back-off zone.

  3. Quantum communication under channel uncertainty

    Energy Technology Data Exchange (ETDEWEB)

    Noetzel, Janis Christian Gregor

    2012-09-06

    This work contains results concerning transmission of entanglement and subspaces as well as generation of entanglement in the limit of arbitrary many uses of compound- and arbitrarily varying quantum channels (CQC, AVQC). In both cases, the channel is described by a set of memoryless channels. Only forward communication between one sender and one receiver is allowed. A code is said to be ''good'' only, if it is ''good'' for every channel out of the set. Both settings describe a scenario, in which sender and receiver have only limited channel knowledge. For different amounts of information about the channel available to sender or receiver, coding theorems are proven for the CQC. For the AVQC, both deterministic and randomised coding schemes are considered. Coding theorems are proven, as well as a quantum analogue of the Ahlswede-dichotomy. The connection to zero-error capacities of stationary memoryless quantum channels is investigated. The notion of symmetrisability is defined and used for both classes of channels.

  4. Perceived quality of channel zapping

    NARCIS (Netherlands)

    Kooij, R.E.; Ahmed, K.; Brunnström, K.

    2006-01-01

    The end user experience of service quality is critical to the success of a service provider's IPTV deployment program. A key element involved in validating IPTV quality of experience (QoE) is how quickly and reliably users can change TV channels, often referred to as channel zapping. Currently there

  5. Channel's Concurrence and Quantum Teleportation

    Institute of Scientific and Technical Information of China (English)

    LING Yin-Sheng

    2005-01-01

    Concurrence can measure the entanglement property of a system. If the channel is a pure state, positive concurrence state can afford the good performance in the teleportation process. If the channel ia a mixed state, positive concurrence state cannot assure the good performance in the teleportation. The conditions of the positive concurrence and the quantum teleportation in the Heisenberg spin ring is derived.

  6. An improved channel assessment scheme

    KAUST Repository

    Bader, Ahmed

    2014-05-01

    A source node in a multihop network determines whether to transmit in a channel based on whether the channel is occupied by a packet transmission with a large number of relays; whether the source node is in the data tones back-off zone; and the source node is in the busy tone back-off zone.

  7. Decreasing vortex flux in channels

    International Nuclear Information System (INIS)

    Migaj, V.K.; Nosova, I.S.

    1979-01-01

    A new method for reducing vortex flow losses in power plant channels is suggested. The method is based on vortex splitting in vortex flow areas with transverse barriers placed on the channel walls. The upper barrier ends are at the level of the upper boundary of the vortex area and don't protrude to the active flow beyond this boundary. The effectiveness of the method suggested is illustrated taking as an example the investigation of square and flat channels with abrupt widening in one plane, diffusers with widening in one plane, or a rectangualr bend. It is shown that splitting the vortex areas with transverse barriers in the channels results in reduction of hydraulic losses by 10-25%. The above method is characteristic of an extreme simplicity, its application doesn't require changes in the channel shape nor installation of any devices in the flow

  8. Channel box dimension measuring method

    International Nuclear Information System (INIS)

    Oshima, Hirotake; Jo, Hiroto.

    1994-01-01

    The present invention provides a method for measuring the entire length of a channel box of a fuel assembly of a BWR type reactor. Namely, four sensors are used as one set that generate ultrasonic waves from oblique upper portion, oblique lower portion, upper portion and lower portion of the channel box respectively. The distances between the four sensors and each of the portions of the channel box are measured respectively for both of a reference member and a member to be measured. The entire length of the channel box is measured by calculating the measured values and the angles of the obliquely disposed sensors according to a predetermined formula. According to the method of the present invention, the inclination of the channel box to be measured can be corrected. In addition, accuracy of the measurement is improved and the measuring time is saved as well as the measuring device and operation can be simplified. (I.S.)

  9. Marketing channels and competitive advantage

    Directory of Open Access Journals (Sweden)

    Jovičić Dragoljub

    2005-01-01

    Full Text Available Issue that can already be seen and will be very clear in the future is that the central problem in the market of tube caps will not be the product or the price or promotion, but marketing channels. Therefore, the competitive advantage will most probably be built on marketing channels and not the production - as it has been so far, so, the questions of choice functioning and modification of marketing channels, as well as selection of the most appropriate members of channels will become more and more important. Accordingly, it may freely be said that the choice, i.e. the movement of marketing channels represents one of the strategic decisions which has to be made by a company management and which will subsequently very significantly influence the functioning and efficacy of not only the system of distribution, but also the entire business transactions.

  10. Active zone protein Bassoon co-localizes with presynaptic calcium channel, modifies channel function, and recovers from aging related loss by exercise.

    Science.gov (United States)

    Nishimune, Hiroshi; Numata, Tomohiro; Chen, Jie; Aoki, Yudai; Wang, Yonghong; Starr, Miranda P; Mori, Yasuo; Stanford, John A

    2012-01-01

    The P/Q-type voltage-dependent calcium channels (VDCCs) are essential for synaptic transmission at adult mammalian neuromuscular junctions (NMJs); however, the subsynaptic location of VDCCs relative to active zones in rodent NMJs, and the functional modification of VDCCs by the interaction with active zone protein Bassoon remain unknown. Here, we show that P/Q-type VDCCs distribute in a punctate pattern within the NMJ presynaptic terminals and align in three dimensions with Bassoon. This distribution pattern of P/Q-type VDCCs and Bassoon in NMJs is consistent with our previous study demonstrating the binding of VDCCs and Bassoon. In addition, we now show that the interaction between P/Q-type VDCCs and Bassoon significantly suppressed the inactivation property of P/Q-type VDCCs, suggesting that the Ca(2+) influx may be augmented by Bassoon for efficient synaptic transmission at NMJs. However, presynaptic Bassoon level was significantly attenuated in aged rat NMJs, which suggests an attenuation of VDCC function due to a lack of this interaction between VDCC and Bassoon. Importantly, the decreased Bassoon level in aged NMJs was ameliorated by isometric strength training of muscles for two months. The training increased Bassoon immunoreactivity in NMJs without affecting synapse size. These results demonstrated that the P/Q-type VDCCs preferentially accumulate at NMJ active zones and play essential role in synaptic transmission in conjunction with the active zone protein Bassoon. This molecular mechanism becomes impaired by aging, which suggests altered synaptic function in aged NMJs. However, Bassoon level in aged NMJs can be improved by muscle exercise.

  11. Methods of channeling simulation

    International Nuclear Information System (INIS)

    Barrett, J.H.

    1989-06-01

    Many computer simulation programs have been used to interpret experiments almost since the first channeling measurements were made. Certain aspects of these programs are important in how accurately they simulate ions in crystals; among these are the manner in which the structure of the crystal is incorporated, how any quantity of interest is computed, what ion-atom potential is used, how deflections are computed from the potential, incorporation of thermal vibrations of the lattice atoms, correlations of thermal vibrations, and form of stopping power. Other aspects of the programs are included to improve the speed; among these are table lookup, importance sampling, and the multiparameter method. It is desirable for programs to facilitate incorporation of special features of interest in special situations; examples are relaxations and enhanced vibrations of surface atoms, easy substitution of an alternate potential for comparison, change of row directions from layer to layer in strained-layer lattices, and different vibration amplitudes for substitutional solute or impurity atoms. Ways of implementing all of these aspects and features and the consequences of them will be discussed. 30 refs., 3 figs

  12. Based on Channel Characteristics

    Directory of Open Access Journals (Sweden)

    Zhuo Hao

    2013-01-01

    Full Text Available A number of key agreement schemes based on wireless channel characteristics have been proposed recently. However, previous key agreement schemes require that two nodes which need to agree on a key are within the communication range of each other. Hence, they are not suitable for multihop wireless networks, in which nodes do not always have direct connections with each other. In this paper, we first propose a basic multihop key agreement scheme for wireless ad hoc networks. The proposed basic scheme is resistant to external eavesdroppers. Nevertheless, this basic scheme is not secure when there exist internal eavesdroppers or Man-in-the-Middle (MITM adversaries. In order to cope with these adversaries, we propose an improved multihop key agreement scheme. We show that the improved scheme is secure against internal eavesdroppers and MITM adversaries in a single path. Both performance analysis and simulation results demonstrate that the improved scheme is efficient. Consequently, the improved key agreement scheme is suitable for multihop wireless ad hoc networks.

  13. Dysregulation of Ca(v)1.4 channels disrupts the maturation of photoreceptor synaptic ribbons in congenital stationary night blindness type 2.

    Science.gov (United States)

    Liu, Xiaoni; Kerov, Vasily; Haeseleer, Françoise; Majumder, Anurima; Artemyev, Nikolai; Baker, Sheila A; Lee, Amy

    2013-01-01

    Mutations in the gene encoding Cav 1.4, CACNA1F, are associated with visual disorders including X-linked incomplete congenital stationary night blindness type 2 (CSNB2). In mice lacking Cav 1.4 channels, there are defects in the development of "ribbon" synapses formed between photoreceptors (PRs) and second-order neurons. However, many CSNB2 mutations disrupt the function rather than expression of Cav 1.4 channels. Whether defects in PR synapse development due to altered Cav 1.4 function are common features contributing to the pathogenesis of CSNB2 is unknown. To resolve this issue, we profiled changes in the subcellular distribution of Cav 1.4 channels and synapse morphology during development in wild-type (WT) mice and mouse models of CSNB2. Using Cav 1.4-selective antibodies, we found that Cav 1.4 channels associate with ribbon precursors early in development and are concentrated at both rod and cone PR synapses in the mature retina. In mouse models of CSNB2 in which the voltage-dependence of Cav 1.4 activation is either enhanced (Cav 1.4I756T) or inhibited (CaBP4 KO), the initial stages of PR synaptic ribbon formation are largely unaffected. However, after postnatal day 13, many PR ribbons retain the immature morphology. This synaptic abnormality corresponds in severity to the defect in synaptic transmission in the adult mutant mice, suggesting that lack of sufficient mature synapses contributes to vision impairment in Cav 1.4I756T and CaBP4 KO mice. Our results demonstrate the importance of proper Cav 1.4 function for efficient PR synapse maturation, and that dysregulation of Cav 1.4 channels in CSNB2 may have synaptopathic consequences.

  14. The topogenic function of S4 promotes membrane insertion of the voltage-sensor domain in the KvAP channel.

    Science.gov (United States)

    Mishima, Eriko; Sato, Yoko; Nanatani, Kei; Hoshi, Naomi; Lee, Jong-Kook; Schiller, Nina; von Heijne, Gunnar; Sakaguchi, Masao; Uozumi, Nobuyuki

    2016-12-01

    Voltage-dependent K + (K V ) channels control K + permeability in response to shifts in the membrane potential. Voltage sensing in K V channels is mediated by the positively charged transmembrane domain S4. The best-characterized K V channel, KvAP, lacks the distinct hydrophilic region corresponding to the S3-S4 extracellular loop that is found in other K + channels. In the present study, we evaluated the topogenic properties of the transmembrane regions within the voltage-sensing domain in KvAP. S3 had low membrane insertion activity, whereas S4 possessed a unique type-I signal anchor (SA-I) function, which enabled it to insert into the membrane by itself. S4 was also found to function as a stop-transfer signal for retention in the membrane. The length and structural nature of the extracellular S3-S4 loop affected the membrane insertion of S3 and S4, suggesting that S3 membrane insertion was dependent on S4. Replacement of charged residues within the transmembrane regions with residues of opposite charge revealed that Asp 72 in S2 and Glu 93 in S3 contributed to membrane insertion of S3 and S4, and increased the stability of S4 in the membrane. These results indicate that the SA-I function of S4, unique among K + channels studied to date, promotes the insertion of S3 into the membrane, and that the charged residues essential for voltage sensing contribute to the membrane-insertion of the voltage sensor domain in KvAP. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  15. Evidence for the functional involvement of members of the TRP channel family in the uptake of Na(+) and NH4 (+) by the ruminal epithelium.

    Science.gov (United States)

    Rosendahl, Julia; Braun, Hannah S; Schrapers, Katharina T; Martens, Holger; Stumpff, Friederike

    2016-08-01

    Large quantities of protein are degraded in the fermentative parts of the gut to ammonia, which is absorbed, detoxified to urea, and excreted, leading to formation of nitrogenous compounds such as N2O that are associated with global warming. In ruminants, channel-mediated uptake of NH4 (+) from the rumen predominates. The molecular identity of these channels remains to be clarified. Ruminal cells and epithelia from cows and sheep were investigated using patch clamp, Ussing chamber, microelectrode techniques, and qPCR. In patch clamp experiments, bovine ruminal epithelial cells expressed a conductance for NH4 (+) that could be blocked in a voltage-dependent manner by divalent cations. In the native epithelium, NH4 (+) depolarized the apical potential, acidified the cytosol and induced a rise in short-circuit current (I sc) that persisted after the removal of Na(+), was blocked by verapamil, enhanced by the removal of divalent cations, and was sensitive to certain transient receptor potential (TRP) channel modulators. Menthol or thymol stimulated the I sc in Na(+) or NH4 (+) containing solutions in a dose-dependent manner and modulated transepithelial Ca(2+) fluxes. On the level of messenger RNA (mRNA), ovine and bovine ruminal epithelium expressed TRPA1, TRPV3, TRPV4, TRPM6, and TRPM7, with any expression of TRPV6 marginal. No bands were detected for TRPV1, TRPV5, or TRPM8. Functional and molecular biological data suggest that the transport of NH4 (+), Na(+), and Ca(2+) across the rumen involves TRP channels, with TRPV3 and TRPA1 emerging as prime candidate genes. TRP channels may also contribute to the transport of NH4 (+) across other epithelia.

  16. Calcium channel blockers ameliorate iron overload-associated hepatic fibrosis by altering iron transport and stellate cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ying [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Department of Pathology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Chinese Medicine Research on Cardio-Cerebrovascular Disease, Shijiazhuang 050200, Hebei (China); Zhao, Xin [Department of Hepatobiliary Surgery, The Third Hospital of Hebei Medical University, Shijiazhuang 050051, Hebei (China); Chang, Yanzhong [Laboratory of Molecular Iron Metabolism, College of Life Science, Hebei Normal University, Shijiazhuang 050024, Hebei (China); Zhang, Yuanyuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Xi [Department of Pharmacy, The Forth Hospital of Hebei Medical University, Shijiazhuang 050011, Hebei (China); Zhang, Xuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Liu, Zhenyi; Guo, Hui [Department of Medicinal Chemistry, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Wang, Na [Department of Physiology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Gao, Yonggang [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Zhang, Jianping, E-mail: zhangjianping14@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Li, E-mail: chuli0614@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Integrative Medicine on Liver-Kidney Patterns, Shijiazhuang 050200, Hebei (China)

    2016-06-15

    Liver fibrosis is the principal cause of morbidity and mortality in patients with iron overload. Calcium channel blockers (CCBs) can antagonize divalent cation entry into renal and myocardial cells and inhibit fibrogenic gene expression. We investigated the potential of CCBs to resolve iron overload-associated hepatic fibrosis. Kunming mice were assigned to nine groups (n = 8 per group): control, iron overload, deferoxamine, high and low dose verapamil, high and low dose nimodipine, and high and low dose diltiazem. Iron deposition and hepatic fibrosis were measured in mouse livers. Expression levels of molecules associated with transmembrane iron transport were determined by molecular biology approaches. In vitro HSC-T6 cells were randomized into nine groups (the same groups as the mice). Changes in proliferation, apoptosis, and metalloproteinase expression in cells were detected to assess the anti-fibrotic effects of CCBs during iron overload conditions. We found that CCBs reduced hepatic iron content, intracellular iron deposition, the number of hepatic fibrotic areas, collagen expression levels, and hydroxyproline content. CCBs rescued abnormal expression of α1C protein in L-type voltage-dependent calcium channel (LVDCC) and down-regulated divalent metal transporter-1 (DMT-1) expression in mouse livers. In iron-overloaded HSC-T6 cells, CCBs reduced iron deposition, inhibited proliferation, induced apoptosis, and elevated expression of matrix metalloproteinase-13 (MMP-13) and tissue inhibitor of metalloproteinase-1 (TIMP-1). CCBs are potential therapeutic agents that can be used to address hepatic fibrosis during iron overload. They resolve hepatic fibrosis probably correlated with regulating transmembrane iron transport and inhibiting HSC growth. - Highlights: • Calcium channel blockers (CCBs) reduced hepatic iron content. • CCBs decreased hepatic fibrotic areas and collagen expression levels. • CCBs resolve fibrosis by regulating iron transport and

  17. Arylbenzazepines Are Potent Modulators for the Delayed Rectifier K+ Channel: A Potential Mechanism for Their Neuroprotective Effects

    Science.gov (United States)

    Chen, Xue-Qin; Zhang, Jing; Neumeyer, John L.; Jin, Guo-Zhang; Hu, Guo-Yuan; Zhang, Ao; Zhen, Xuechu

    2009-01-01

    (±) SKF83959, like many other arylbenzazepines, elicits powerful neuroprotection in vitro and in vivo. The neuroprotective action of the compound was found to partially depend on its D1-like dopamine receptor agonistic activity. The precise mechanism for the (±) SKF83959-mediated neuroprotection remains elusive. We report here that (±) SKF83959 is a potent blocker for delayed rectifier K+ channel. (±) SKF83959 inhibited the delayed rectifier K+ current (I K) dose-dependently in rat hippocampal neurons. The IC 50 value for inhibition of I K was 41.9±2.3 µM (Hill coefficient = 1.81±0.13, n = 6), whereas that for inhibition of I A was 307.9±38.5 µM (Hill coefficient = 1.37±0.08, n = 6). Thus, (±) SKF83959 is 7.3-fold more potent in suppressing I K than I A. Moreover, the inhibition of I K by (±) SKF83959 was voltage-dependent and not related to dopamine receptors. The rapidly onset of inhibition and recovery suggests that the inhibition resulted from a direct interaction of (±) SKF83959 with the K+ channel. The intracellular application of (±) SKF83959 had no effects of on I K, indicating that the compound most likely acts at the outer mouth of the pore of K+ channel. We also tested the enantiomers of (±) SKF83959, R-(+) SKF83959 (MCL-201), and S-(−) SKF83959 (MCL-202), as well as SKF38393; all these compounds inhibited I K. However, (±) SKF83959, at either 0.1 or 1 mM, exhibited the strongest inhibition on the currents among all tested drug. The present findings not only revealed a new potent blocker of I K , but also provided a novel mechanism for the neuroprotective action of arylbenzazepines such as (±) SKF83959. PMID:19503734

  18. C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

    Science.gov (United States)

    Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

    2014-04-01

    Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

  19. Mutation I136V alters electrophysiological properties of the NaV1.7 channel in a family with onset of erythromelalgia in the second decade

    Directory of Open Access Journals (Sweden)

    Dib-Hajj Sulayman D

    2008-01-01

    Full Text Available Abstract Background Primary erythromelalgia is an autosomal dominant pain disorder characterized by burning pain and skin redness in the extremities, with onset of symptoms during the first decade in the families whose mutations have been physiologically studied to date. Several mutations of voltage-gated Na+ channel NaV1.7 have been linked with primary erythromelalgia. Recently, a new substitution NaV1.7/I136V has been reported in a Taiwanese family, in which pain appeared at later ages (9–22 years, with onset at 17 years of age or later in 5 of 7 family members, with relatively slow progression (8–10 years to involvement of the hands. The proband reported onset of symptoms first in his feet at the age of 11, which then progressed to his hands at the age of 19. The new mutation is located in transmembrane segment 1 (S1 of domain I (DI in contrast to all NaV1.7 mutations reported to date, which have been localized in the voltage sensor S4, the linker joining segments S4 and S5 or pore-lining segments S5 and S6 in DI, II and III. Results In this study, we characterized the gating and kinetic properties of I136V mutant channels in HEK293 cells using whole-cell patch clamp. I136V shifts the voltage-dependence of activation by -5.7 mV, a smaller shift in activation than the other erythromelalgia mutations that have been characterized. I136V also decreases the deactivation rate, and generates larger ramp currents. Conclusion The I136V substitution in NaV1.7 alters channel gating and kinetic properties. Each of these changes may contribute to increased excitability of nociceptive dorsal root ganglion neurons, which underlies pain in erythromelalgia. The smaller shift in voltage-dependence of activation of NaV1.7, compared to the other reported cases of inherited erythromelalgia, may contribute to the later age of onset and slower progression of the symptoms reported in association with this mutation.

  20. Information geometry of Gaussian channels

    International Nuclear Information System (INIS)

    Monras, Alex; Illuminati, Fabrizio

    2010-01-01

    We define a local Riemannian metric tensor in the manifold of Gaussian channels and the distance that it induces. We adopt an information-geometric approach and define a metric derived from the Bures-Fisher metric for quantum states. The resulting metric inherits several desirable properties from the Bures-Fisher metric and is operationally motivated by distinguishability considerations: It serves as an upper bound to the attainable quantum Fisher information for the channel parameters using Gaussian states, under generic constraints on the physically available resources. Our approach naturally includes the use of entangled Gaussian probe states. We prove that the metric enjoys some desirable properties like stability and covariance. As a by-product, we also obtain some general results in Gaussian channel estimation that are the continuous-variable analogs of previously known results in finite dimensions. We prove that optimal probe states are always pure and bounded in the number of ancillary modes, even in the presence of constraints on the reduced state input in the channel. This has experimental and computational implications. It limits the complexity of optimal experimental setups for channel estimation and reduces the computational requirements for the evaluation of the metric: Indeed, we construct a converging algorithm for its computation. We provide explicit formulas for computing the multiparametric quantum Fisher information for dissipative channels probed with arbitrary Gaussian states and provide the optimal observables for the estimation of the channel parameters (e.g., bath couplings, squeezing, and temperature).

  1. Channel Simulation in Quantum Metrology

    Directory of Open Access Journals (Sweden)

    Laurenza Riccardo

    2018-04-01

    Full Text Available In this review we discuss how channel simulation can be used to simplify the most general protocols of quantum parameter estimation, where unlimited entanglement and adaptive joint operations may be employed. Whenever the unknown parameter encoded in a quantum channel is completely transferred in an environmental program state simulating the channel, the optimal adaptive estimation cannot beat the standard quantum limit. In this setting, we elucidate the crucial role of quantum teleportation as a primitive operation which allows one to completely reduce adaptive protocols over suitable teleportation-covariant channels and derive matching upper and lower bounds for parameter estimation. For these channels,wemay express the quantum Cramér Rao bound directly in terms of their Choi matrices. Our review considers both discrete- and continuous-variable systems, also presenting some new results for bosonic Gaussian channels using an alternative sub-optimal simulation. It is an open problem to design simulations for quantum channels that achieve the Heisenberg limit.

  2. Skeletal Muscle Na+ Channel Disorders

    Directory of Open Access Journals (Sweden)

    Dina eSimkin

    2011-10-01

    Full Text Available Five inherited human disorders affecting skeletal muscle contraction have been traced to mutations in the gene encoding the voltage-gated sodium channel Nav1.4. The main symptoms of these disorders are myotonia or periodic paralysis caused by changes in skeletal muscle fiber excitability. Symptoms of these disorders vary from mild or latent disease to incapacitating or even death in severe cases. As new human sodium channel mutations corresponding to disease states become discovered, the importance of understanding the role of the sodium channel in skeletal muscle function and disease state grows.

  3. Homeostatic Presynaptic Plasticity Is Specifically Regulated by P/Q-type Ca2+ Channels at Mammalian Hippocampal Synapses.

    Science.gov (United States)

    Jeans, Alexander F; van Heusden, Fran C; Al-Mubarak, Bashayer; Padamsey, Zahid; Emptage, Nigel J

    2017-10-10

    Voltage-dependent Ca 2+ channels (VGCC) represent the principal source of Ca 2+ ions driving evoked neurotransmitter release at presynaptic boutons. In mammals, presynaptic Ca 2+ influx is mediated mainly via P/Q-type and N-type VGCC, which differ in their properties. Changes in their relative contributions tune neurotransmission both during development and in Hebbian plasticity. However, whether this represents a functional motif also present in other forms of activity-dependent regulation is unknown. Here, we study the role of VGCC in homeostatic plasticity (HSP) in mammalian hippocampal neurons using optical techniques. We find that changes in evoked Ca 2+ currents specifically through P/Q-type, but not N-type, VGCC mediate bidirectional homeostatic regulation of both neurotransmitter release efficacy and the size of the major synaptic vesicle pools. Selective dependence of HSP on P/Q-type VGCC in mammalian terminals has important implications for phenotypes associated with P/Q-type channelopathies, including migraine and epilepsy. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Homeostatic Presynaptic Plasticity Is Specifically Regulated by P/Q-type Ca2+ Channels at Mammalian Hippocampal Synapses

    Directory of Open Access Journals (Sweden)

    Alexander F. Jeans

    2017-10-01

    Full Text Available Voltage-dependent Ca2+ channels (VGCC represent the principal source of Ca2+ ions driving evoked neurotransmitter release at presynaptic boutons. In mammals, presynaptic Ca2+ influx is mediated mainly via P/Q-type and N-type VGCC, which differ in their properties. Changes in their relative contributions tune neurotransmission both during development and in Hebbian plasticity. However, whether this represents a functional motif also present in other forms of activity-dependent regulation is unknown. Here, we study the role of VGCC in homeostatic plasticity (HSP in mammalian hippocampal neurons using optical techniques. We find that changes in evoked Ca2+ currents specifically through P/Q-type, but not N-type, VGCC mediate bidirectional homeostatic regulation of both neurotransmitter release efficacy and the size of the major synaptic vesicle pools. Selective dependence of HSP on P/Q-type VGCC in mammalian terminals has important implications for phenotypes associated with P/Q-type channelopathies, including migraine and epilepsy.

  5. Kv4 channels underlie the subthreshold-operating A-type K+-current in nociceptive dorsal root ganglion neurons

    Directory of Open Access Journals (Sweden)

    Thanawath R Na Phuket

    2009-07-01

    Full Text Available The dorsal root ganglion (DRG contains heterogeneous populations of sensory neurons including primary nociceptive neurons and C-fibers implicated in pain signaling.  Recent studies have demonstrated DRG hyperexcitability associated with downregulation of A-type K+ channels; however, the molecular correlate of the corresponding A-type K+ current (IA has remained hypothetical.  Kv4 channels may underlie the IA in DRG neurons.  We combined electrophysiology, molecular biology (whole-tissue and single-cell RT-PCR and immunohistochemistry to investigate the molecular basis of the IA in acutely dissociated DRG neurons from 7-8 day-old rats.  Whole-cell recordings demonstrate a robust tetraethylammonium-resistant (20 mM and 4-aminopyridine-sensitive (5 mM IA.  Matching Kv4 channel properties, activation and inactivation of this IA occur in the subthreshold range of membrane potentials and the rate of recovery from inactivation is rapid and voltage-dependent.  Among Kv4 transcripts, the DRG expresses significant levels of Kv4.1 and Kv4.3 mRNAs.  Also, single small-medium diameter DRG neurons (~30 mm exhibit correlated frequent expression of mRNAs encoding Kv4.1 and Nav1.8, a known nociceptor marker.  In contrast, the expressions of Kv1.4 and Kv4.2 mRNAs at the whole-tissue and single-cell levels are relatively low and infrequent.  Kv4 protein expression in nociceptive DRG neurons was confirmed by immunohistochemistry, which demonstrates colocalization of Kv4.3 and Nav1.8, and negligible expression of Kv4.2.  Furthermore, specific dominant-negative suppression and overexpression strategies confirmed the contribution of Kv4 channels to IA in DRG neurons.  Contrasting the expression patterns of Kv4 channels in the central and peripheral nervous systems, we discuss possible functional roles of these channels in primary sensory neurons.

  6. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  7. Phosphatidylinositol (4,5)Bisphosphate Inhibits K+-Efflux Channel Activity in NT1 Tobacco Cultured Cells1[W][OA

    Science.gov (United States)

    Ma, Xiaohong; Shor, Oded; Diminshtein, Sofia; Yu, Ling; Im, Yang Ju; Perera, Imara; Lomax, Aaron; Boss, Wendy F.; Moran, Nava

    2009-01-01

    In the animal world, the regulat