WorldWideScience

Sample records for voltage recording technique

  1. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  2. Modern recording techniques

    CERN Document Server

    Huber, David Miles

    2013-01-01

    As the most popular and authoritative guide to recording Modern Recording Techniques provides everything you need to master the tools and day to day practice of music recording and production. From room acoustics and running a session to mic placement and designing a studio Modern Recording Techniques will give you a really good grounding in the theory and industry practice. Expanded to include the latest digital audio technology the 7th edition now includes sections on podcasting, new surround sound formats and HD and audio.If you are just starting out or looking for a step up

  3. High-voltage test and measuring techniques

    CERN Document Server

    Hauschild, Wolfgang

    2014-01-01

    It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

  4. Artificial intelligence techniques for voltage control

    Energy Technology Data Exchange (ETDEWEB)

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  5. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Science.gov (United States)

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  6. Voltage Stabilizer Based on SPWM technique Using Microcontroller

    OpenAIRE

    K. N. Tarchanidis; J. N. Lygouras; P. Botsaris

    2013-01-01

    This paper presents an application of the well known SPWM technique on a voltage stabilizer, using a microcontroller. The stabilizer is AC/DC/AC type. So, the system rectifies the input AC voltage to a suitable DC level and the intelligent control of an embedded microcontroller regulates the pulse width of the output voltage in order to produce through a filter a perfect sinusoidal AC voltage. The control program on the microcontroller has the ability to change the FET transistor ...

  7. Energy harvesting in high voltage measuring techniques

    International Nuclear Information System (INIS)

    Żyłka, Pawel; Doliński, Marcin

    2016-01-01

    The paper discusses selected problems related to application of energy harvesting (that is, generating electricity from surplus energy present in the environment) to supply autonomous ultra-low-power measurement systems applicable in high voltage engineering. As a practical example of such implementation a laboratory model of a remote temperature sensor is presented, which is self-powered by heat generated in a current-carrying busbar in HV- switchgear. Presented system exploits a thermoelectric harvester based on a passively cooled Peltier module supplying micro-power low-voltage dc-dc converter driving energy-efficient temperature sensor, microcontroller and a fibre-optic transmitter. Performance of the model in laboratory simulated conditions are presented and discussed. (paper)

  8. Listening to membrane potential: photoacoustic voltage-sensitive dye recording

    Science.gov (United States)

    Zhang, Haichong K.; Yan, Ping; Kang, Jeeun; Abou, Diane S.; Le, Hanh N. D.; Jha, Abhinav K.; Thorek, Daniel L. J.; Kang, Jin U.; Rahmim, Arman; Wong, Dean F.; Boctor, Emad M.; Loew, Leslie M.

    2017-04-01

    Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.

  9. Voltage-sensitive dye recording from networks of cultured neurons

    Science.gov (United States)

    Chien, Chi-Bin

    This thesis describes the development and testing of a sensitive apparatus for recording electrical activity from microcultures of rat superior cervical ganglion (SCG) neurons by using voltage-sensitive fluorescent dyes.The apparatus comprises a feedback-regulated mercury arc light source, an inverted epifluorescence microscope, a novel fiber-optic camera with discrete photodiode detectors, and low-noise preamplifiers. Using an NA 0.75 objective and illuminating at 10 W/cm2 with the 546 nm mercury line, a typical SCG neuron stained with the styryl dye RH423 gives a detected photocurrent of 1 nA; the light source and optical detectors are quiet enough that the shot noise in this photocurrent--about.03% rms--dominates. The design, theory, and performance of this dye-recording apparatus are discussed in detail.Styryl dyes such as RH423 typically give signals of 1%/100 mV on these cells; the signals are linear in membrane potential, but do not appear to arise from a purely electrochromic mechanism. Given this voltage sensitivity and the noise level of the apparatus, it should be possible to detect both action potentials and subthreshold synaptic potentials from SCG cell bodies. In practice, dye recording can easily detect action potentials from every neuron in an SCG microculture, but small synaptic potentials are obscured by dye signals from the dense network of axons.In another microculture system that does not have such long and complex axons, this dye-recording apparatus should be able to detect synaptic potentials, making it possible to noninvasively map the synaptic connections in a microculture, and thus to study long-term synaptic plasticity.

  10. A technique to reduce plasma armature formation voltage

    International Nuclear Information System (INIS)

    Jamison, K.A.; Littrell, D.M.

    1991-01-01

    The initiation of a plasma armature by foil vaporization in a railgun is often accompanied by a large, fast, voltage transient appearing on both the breech and muzzle of the gun. For a railgun driven by an inductor/opening switch power supply, this voltage transient becomes a concern during current commutation from the switch to the railgun. To lessen the requirements on the opening switch, techniques must be found to reduce the armature formation voltage. This paper presents the experimental results from railgun firings at AFATL's Electromagnetic Launcher Basic Research Facility (Site A-15, Eglin Air Force Base, Florida) using different shapes of initiation foils. These foils have been designed to vaporize into a plasma armature with reduced transient voltages. A design criteria was developed to ensure that all portions of the foil vaporize at slightly different times

  11. Recording membrane potential changes through photoacoustic voltage sensitive dye

    Science.gov (United States)

    Zhang, Haichong K.; Kang, Jeeun; Yan, Ping; Abou, Diane S.; Le, Hanh N. D.; Thorek, Daniel L. J.; Kang, Jin U.; Gjedde, Albert; Rahmim, Arman; Wong, Dean F.; Loew, Leslie M.; Boctor, Emad M.

    2017-03-01

    Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. Based on this concept, we synthesized a novel near infrared photoacoustic VSD (PA-VSD) whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. With a 3-9 μM VSD concentration, we measured a PA signal increase in the range of 5.3 % to 18.1 %, and observed a corresponding signal reduction in fluorescence emission of 30.0 % to 48.7 %. A theoretical model successfully accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize the characteristics of improved photoacoustic probes. Together, our results demonstrate photoacoustic sensing as a potential new modality for sub-second recording and external imaging of electrophysiological and neurochemical events in the brain.

  12. 30 CFR 75.812-2 - High-voltage power centers and transformers; record of examination.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage power centers and transformers; record of examination. 75.812-2 Section 75.812-2 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... High-Voltage Distribution § 75.812-2 High-voltage power centers and transformers; record of examination...

  13. Recording membrane potential changes through photoacoustic voltage sensitive dye

    DEFF Research Database (Denmark)

    Zhang, Haichong K.; Kang, Jeeun; Yan, Ping

    2017-01-01

    Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...

  14. Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

    Science.gov (United States)

    Masetto, S; Weng, T; Valli, P; Correia, M J

    1999-06-23

    Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

  15. Security Techniques for the Electronic Health Records.

    Science.gov (United States)

    Kruse, Clemens Scott; Smith, Brenna; Vanderlinden, Hannah; Nealand, Alexandra

    2017-08-01

    The privacy of patients and the security of their information is the most imperative barrier to entry when considering the adoption of electronic health records in the healthcare industry. Considering current legal regulations, this review seeks to analyze and discuss prominent security techniques for healthcare organizations seeking to adopt a secure electronic health records system. Additionally, the researchers sought to establish a foundation for further research for security in the healthcare industry. The researchers utilized the Texas State University Library to gain access to three online databases: PubMed (MEDLINE), CINAHL, and ProQuest Nursing and Allied Health Source. These sources were used to conduct searches on literature concerning security of electronic health records containing several inclusion and exclusion criteria. Researchers collected and analyzed 25 journals and reviews discussing security of electronic health records, 20 of which mentioned specific security methods and techniques. The most frequently mentioned security measures and techniques are categorized into three themes: administrative, physical, and technical safeguards. The sensitive nature of the information contained within electronic health records has prompted the need for advanced security techniques that are able to put these worries at ease. It is imperative for security techniques to cover the vast threats that are present across the three pillars of healthcare.

  16. A robust and fast generic voltage sag detection technique

    DEFF Research Database (Denmark)

    L. Dantas, Joacillo; Lima, Francisco Kleber A.; Branco, Carlos Gustavo C.

    2015-01-01

    In this paper, a fast and robust voltage sag detection algorithm, named VPS2D, is introduced. Using the DSOGI, the algorithm creates a virtual positive sequence voltage and monitories the fundamental voltage component of each phase. After calculating the aggregate value in the o:;3-reference fram...

  17. Using a Voltage Domain Programmable Technique for Low-Power Management Cell-Based Design

    Directory of Open Access Journals (Sweden)

    Ching-Hwa Cheng

    2011-09-01

    Full Text Available The Multi-voltage technique is an effective way to reduce power consumption. In the proposed cell-based voltage domain programmable (VDP technique, the high and low voltages applied to logic gates are programmable. The flexible voltage domain reassignment allows the chip performance and power consumption to be dynamically adjusted. In the proposed technique, the power switches possess the feature of flexible programming after chip manufacturing. This VDP method does not use an external voltage regulator to regulate the supply voltage level from outside of the chip but can be easily integrated within the design. This novel technique is proven by use of a video decoder test chip, which shows 55% and 61% power reductions compared to conventional single-Vdd and low-voltage designs, respectively. This power-aware performance adjusting mechanism shows great power reduction with a good power-performance management mechanism.

  18. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Science.gov (United States)

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  19. An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

    Science.gov (United States)

    Tanaka, Kazuyuki; Sakashita, Tadashi

    The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

  20. Harmonic elimination technique for a single-phase multilevel converter with unequal DC link voltage levels

    DEFF Research Database (Denmark)

    Ghasemi, N.; Zare, F.; Boora, A.A.

    2012-01-01

    Multilevel converters, because of the benefits they attract in generating high quality output voltage, are used in several applications. Various modulation and control techniques are introduced by several researchers to control the output voltage of the multilevel converters like space vector...... modulation and harmonic elimination (HE) methods. Multilevel converters may have a DC link with equal or unequal DC voltages. In this study a new HE technique based on the HE method is proposed for multilevel converters with unequal DC link voltage. The DC link voltage levels are considered as additional...

  1. A Comparison Study of Sinusoidal PWM and Space Vector PWM Techniques for Voltage Source Inverter

    Directory of Open Access Journals (Sweden)

    Ömer Türksoy

    2017-06-01

    Full Text Available In this paper, the methods used to control voltage source inverters which have been intensively investigated in recent years are compared. Although the most efficient result is obtained with the least number of switching elements in the inverter topologies, the method used in the switching is at least as effective as the topology. Besides, the selected switching method to control the inverter will play an effective role in suppressing harmonic components while producing the ideal output voltage. There are many derivatives of pulse width modulation techniques that are commonly used to control voltage source inverters. Some of widespread methods are sinusoidal pulse width modulation and space vector pulse width modulation techniques. These modulation techniques used for generating variable frequency and amplitude output voltage in voltage source inverters, have been simulated by using MATLAB/SIMULINK. And, the total harmonic distortions of the output voltages are compared. As a result of simulation studies, sinusoidal pulse width modulation has been found to have more total harmonic distortion in output voltages of voltage source inverters in the simulation. Space vector pulse width modulation has been shown to produce a more efficient output voltage with less total harmonic distortion.

  2. Suppression of Spiral Waves by Voltage Clamp Techniques in a Conductance-Based Cardiac Tissue Model

    International Nuclear Information System (INIS)

    Lian-Chun, Yu; Guo-Yong, Zhang; Yong, Chen; Jun, Ma

    2008-01-01

    A new control method is proposed to control the spatio-temporal dynamics in excitable media, which is described by the Morris–Lecar cells model. It is confirmed that successful suppression of spiral waves can be obtained by spatially clamping the membrane voltage of the excitable cells. The low voltage clamping induces breakup of spiral waves and the fragments are soon absorbed by low voltage obstacles, whereas the high voltage clamping generates travel waves that annihilate spiral waves through collision with them. However, each method has its shortcomings. Furthermore, a two-step method that combines both low and high voltage clamp techniques is then presented as a possible way of out this predicament. (cross-disciplinary physics and related areas of science and technology)

  3. A Hybrid Islanding Detection Technique Using Average Rate of Voltage Change and Real Power Shift

    DEFF Research Database (Denmark)

    Mahat, Pukar; Chen, Zhe; Bak-Jensen, Birgitte

    2009-01-01

    The mainly used islanding detection techniques may be classified as active and passive techniques. Passive techniques don't perturb the system but they have larger nondetection znes, whereas active techniques have smaller nondetection zones but they perturb the system. In this paper, a new hybrid...... technique is proposed to solve this problem. An average rate of voltage change (passive technique) has been used to initiate a real power shift (active technique), which changes the eal power of distributed generation (DG), when the passive technique cannot have a clear discrimination between islanding...

  4. Process, Voltage and Temperature Compensation Technique for Cascode Modulated PAs

    DEFF Research Database (Denmark)

    Sira, Daniel; Larsen, Torben

    2013-01-01

    , that represents a transistor level model (empirical model) of the cascode modulated PA, is utilized in a PA analog predistorter. The analog predistorter linearizes and compensates for PVT variation of the cascode modulated PA. The empirical model is placed in the negative feedback of an operational...... transconductance amplifier. The predistorted varying envelope signal is applied to the cascode gate of the PA. It is shown that the proposed PVT compensation technique significantly reduces the PVT spread of the PA linearity indicators and improves the PA linearity. Simulations were performed in a 0.13 μm CMOS...

  5. Mitigation of the voltage fluctuations using an efficient disturbance extraction technique

    Energy Technology Data Exchange (ETDEWEB)

    Elnady, Amr; Salama, M.M.A. [University of Waterloo, Electrical and Computer Engineering, 200 University Ave. West, Waterloo, Ont. (Canada N2L3G1)

    2007-03-15

    This paper introduces an efficient technique for extracting the disturbance signal of the voltage flicker. The proposed technique depends on the supervised state estimation that is controlled by the Widrow-Hoff delta rule. The extracted disturbance signal is employed for mitigating the cyclic voltage flicker by using series and parallel mitigating devices. The speed and accuracy of the proposed technique are verified by simulation results with EMTDC/PSCAD. In addition, experimental results are presented to prove the validity of the proposed algorithm. (author)

  6. A Survey on Voltage Boosting Techniques for Step-Up DC-DC Converters

    DEFF Research Database (Denmark)

    Forouzesh, Mojtaba; Siwakoti, Yam Prasad; Gorji, Saman Asghari

    2016-01-01

    boosting techniques and topologies are large, which at times may be confusing and difficult to follow/adapt for different applications. Considering these aspects and in order to make a clear sketch of the general law and framework of various voltage boosting techniques, this paper comprehensively reviews...

  7. Application in low level counting of corona counters operating in voltage or current pulse recording modes

    International Nuclear Information System (INIS)

    Oravec, J.; Usacev, S.; Duka-Zojomi, A.; Sitar, B.; Benovic, D.; Holy, K.

    1977-01-01

    The advantages of current or voltage modes of recording are discussed. It appears that the current mode is more advantageous in measurements of rare events caused by highly ionizing particles on a high background of weakly ionizing particles. A 2.3 litre multiwire corona counter was used for the determination of 226 Ra content in drinking water. The 226 Ra content was estimated by measuring 222 Rn activity. The minimum measurable activity of the system was 0.07 pCi/l of water. (author)

  8. IMPROVING BANDWIDTH OF FLIPPED VOLTAGE FOLLOWER USING GATE-BODY DRIVEN TECHNIQUE

    Directory of Open Access Journals (Sweden)

    VANDANA NIRANJAN

    2017-01-01

    Full Text Available In this paper, a new approach to enhance the bandwidth of flipped voltage follower is explored. The proposed approach is based on gate-body driven technique. This technique boosts the transconductance in a MOS transistor as both gate and body/bulk terminals are tied together and used as signal input. This novel technique appears as a good solution to merge the advantages of gate-driven and bulk-driven techniques and suppress their disadvantages. The gate-body driven technique utilizes body effect to enable low voltage low power operation and improves the overall performance of flipped voltage follower, providing it with low output impedance, high input impedance and bandwidth extension ratio of 2.614. The most attractive feature is that bandwidth enhancement has been achieved without use of any passive component or extra circuitry. Simulations in PSpice environment for 180 nm CMOS technology verified the predicted theoretical results. The improved flipped voltage follower is particularly interesting for high frequency low noise signal processing applications.

  9. Modulation Technique for Four-Leg Voltage Source Inverter without a Look-Up Table

    DEFF Research Database (Denmark)

    Ebrahimzadeh, Esmaeil; Farhangi, Shahrokh; Iman-Eini, Hossein

    2016-01-01

    Three-dimensional space-vector modulation (3D SVM) has more popularity among the other modulation techniques of the four-leg inverter due to higher DC-link voltage utilisation. Sequencing schemes of the switching vectors in the 3D SVM are divided into Class I and II categories. Each of these clas...

  10. Authenticity techniques for PACS images and records

    Science.gov (United States)

    Wong, Stephen T. C.; Abundo, Marco; Huang, H. K.

    1995-05-01

    Along with the digital radiology environment supported by picture archiving and communication systems (PACS) comes a new problem: How to establish trust in multimedia medical data that exist only in the easily altered memory of a computer. Trust is characterized in terms of integrity and privacy of digital data. Two major self-enforcing techniques can be used to assure the authenticity of electronic images and text -- key-based cryptography and digital time stamping. Key-based cryptography associates the content of an image with the originator using one or two distinct keys and prevents alteration of the document by anyone other than the originator. A digital time stamping algorithm generates a characteristic `digital fingerprint' for the original document using a mathematical hash function, and checks that it has not been modified. This paper discusses these cryptographic algorithms and their appropriateness for a PACS environment. It also presents experimental results of cryptographic algorithms on several imaging modalities.

  11. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers

    Directory of Open Access Journals (Sweden)

    Francesco Dell’ Anna

    2018-04-01

    Full Text Available This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  12. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers.

    Science.gov (United States)

    Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar

    2018-04-17

    This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  13. An improved direct feedback linearization technique for transient stability enhancement and voltage regulation of power generators

    Energy Technology Data Exchange (ETDEWEB)

    Kenne, Godpromesse [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun, Cameroun; Goma, Raphael; Lamnabhi-Lagarrigue, Francoise [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere [Departement GEII, Universite Paris XIII, IUT Villetaneuse, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Arzande, Amir; Vannier, Jean Claude [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)

    2010-09-15

    In this paper, a simple improved direct feedback linearization design method for transient stability and voltage regulation of power systems is discussed. Starting with the classical direct feedback linearization technique currently applied to power systems, an adaptive nonlinear excitation control of synchronous generators is proposed, which is new and effective for engineering. The power angle and mechanical power input are not assumed to be available. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of angular speed, active electric power and generator terminal voltage. Experimental results of a practical power system show that fast response, robustness, damping, steady-state and transient stability as well as voltage regulation are all achieved satisfactorily. (author)

  14. Voltage switching technique for detecting nuclear spin polarization in a quantum dot

    International Nuclear Information System (INIS)

    Takahashi, Ryo; Kono, Kimitoshi; Tarucha, Seigo; Ono, Keiji

    2010-01-01

    We have introduced a source-drain voltage switching technique for studying nuclear spins in a vertical double quantum dot. Switching the source-drain voltage between the spin-blockade state and the zero-bias Coulomb blockade state can tune the energy difference between the spin singlet and triplet, and effectively turn on/off the hyperfine interaction. Since the change in the nuclear spin state affects the source-drain current, nuclear spin properties can only be detected by transport measurement. Using this technique, we have succeeded in measuring the timescale of nuclear spin depolarization. Furthermore, combining this technique and an RF ac magnetic field, we successfully detected continuous-wave NMR signals of 75 As, 69 Ga, and 71 Ga, which are contained in a quantum dot. (author)

  15. Comparative Study of Modulation Techniques for Two-Level Voltage Source Inverters

    Directory of Open Access Journals (Sweden)

    Barry W. Williams

    2016-06-01

    Full Text Available A detailed comparative study of modulation techniques for single and three phase dc-ac inverters is presented.  Sinusoidal Pulse Width Modulation, Triplen Sinusoidal Pulse Width Modulation, Space Vector Modulation, Selective Harmonic Elimination and Wavelet Modulation are assessed and compared in terms of maximum fundamental output, harmonic performance, switching losses and operational mode.  The presented modulation techniques are applied to single and three phase voltage source inverters and are simulated using SIMULINK.  The simulation results clarify the inverter performance achieved using the different modulations techniques.

  16. Efficiency Optimization by Considering the High Voltage Flyback Transformer Parasitics using an Automatic Winding Layout Technique

    DEFF Research Database (Denmark)

    Thummala, Prasanth; Schneider, Henrik; Zhang, Zhe

    2015-01-01

    .The energy efficiency is optimized using a proposed new automatic winding layout (AWL) technique and a comprehensive loss model.The AWL technique generates a large number of transformer winding layouts.The transformer parasitics such as dc resistance, leakage inductance and self-capacitance are calculated...... for each winding layout.An optimization technique is formulated to minimize the sum of energy losses during charge and discharge operations.The efficiency and energy loss distribution results from the optimization routine provide a deep insight into the high voltage transformer designand its impact...

  17. Performance improvement of a slip energy recovery drive system by a voltage-controlled technique

    Energy Technology Data Exchange (ETDEWEB)

    Tunyasrirut, Satean [Department of Instrumentation Engineering, Faculty of Engineering, Pathumwan Institute of Technology, 833 Rama1 Road, Pathumwan, Bangkok 10330 (Thailand); Kinnares, Vijit [Department of Electrical Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Ngamwiwit, Jongkol [Department of Control Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)

    2010-10-15

    This paper introduces the performance improvement of a slip energy recovery drive system for the speed control of a wound rotor induction motor by a voltage-controlled technique. The slip energy occurred in the rotor circuit is transferred back to ac mains supply through a reactor instead of a step up transformer. The objective of the voltage-controlled technique is to increase power factor of the system and to reduce low order harmonics of the input line current. The drive system is designed and implemented using a voltage source inverter in conjunction with a boost chopper for DC link voltage, instead of a conventional drive using a 6 pulse converter or a Scherbius system. The slip power is recovered by the help of a voltage source inverter (VSI) based on a space vector pulse width modulation (SVPWM) technique. In order to keep the speed of the wound rotor induction motor constant over a certain range of operating conditions, the servo state feedback controller designed by a linear quadratic regulator (LQR) is also introduced in this paper. The overall control system is implemented on DSP, DS1104'TMS320F240 controller board. The performance improvement of the proposed system is tested in comparison with the conventional Scherbius system and the modified conventional Scherbius system by a 12 pulse converter in conjunction with a chopper at steady state and at dynamic conditions. A 220 W wound motor is employed for testing. It is found that the motor speed can be controlled to be constant in the operating range of 450-1200 rpm at no load and full load. It is also found that the efficiency of the proposed system is remarkably increased since the harmonics of the input ac line current is reduced while the ac line input power factor is increased. (author)

  18. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  19. A CMOS frontend chip for implantable neural recording with wide voltage supply range

    International Nuclear Information System (INIS)

    Liu Jialin; Zhang Xu; Hu Xiaohui; Li Peng; Liu Ming; Chen Hongda; Guo Yatao; Li Bin

    2015-01-01

    A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a −3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μV rms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm 2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. (paper)

  20. A CMOS frontend chip for implantable neural recording with wide voltage supply range

    Science.gov (United States)

    Jialin, Liu; Xu, Zhang; Xiaohui, Hu; Yatao, Guo; Peng, Li; Ming, Liu; Bin, Li; Hongda, Chen

    2015-10-01

    A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a -3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μVrms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. Project supported by the National Natural Science Foundation of China (Nos. 61474107, 61372060, 61335010, 61275200, 61178051) and the Key Program of the Chinese Academy of Sciences (No. KJZD-EW-L11-01).

  1. Profiling of barrier capacitance and spreading resistance using a transient linearly increasing voltage technique.

    Science.gov (United States)

    Gaubas, E; Ceponis, T; Kusakovskij, J

    2011-08-01

    A technique for the combined measurement of barrier capacitance and spreading resistance profiles using a linearly increasing voltage pulse is presented. The technique is based on the measurement and analysis of current transients, due to the barrier and diffusion capacitance, and the spreading resistance, between a needle probe and sample. To control the impact of deep traps in the barrier capacitance, a steady state bias illumination with infrared light was employed. Measurements of the spreading resistance and barrier capacitance profiles using a stepwise positioned probe on cross sectioned silicon pin diodes and pnp structures are presented.

  2. Evaluation of diagnostic technique for degradation of low-voltage electric cables with silicone rubber insulator

    International Nuclear Information System (INIS)

    Mikami, Masao

    2005-01-01

    As a part of countermeasures against ageing problems of nuclear power plants, it is requested to establish non-destructive diagnostic technique for their degradation of low voltage electric cables and assessment standard of their life. Having aimed at investigating the degradation of low-voltage electric cable with silicone rubber insulator, change of its surface hardness at elevated temperature were measured by indenter modules. Moreover, we also measured the elongation at break, which is regarded as general degradation index of electric cables, and the surface hardness with a micro hardness meter. Consequently, it is seen that the indenter modulus measurement is (1) capable to obtain general feature of the thermal degradation of silicone rubber insulator, (2) applicable to diagnose the degree of degradation of the electric cable by converting the result to elongation at break, (3) well correlated with the hardness measurement of the electric cable with the micro hardness meter. (author)

  3. Dragon-I injector based on the induction voltage adder technique

    Directory of Open Access Journals (Sweden)

    Zhang Kaizhi

    2006-08-01

    Full Text Available The Dragon-I injector based on the induction voltage adder technique is introduced. Twelve ferrite loaded induction cells are connected in a series through central conducting stalks to achieve a pulsed voltage higher than 3.5 MV across the diode. Electrons are extracted from the velvet emitter and guided through the anode pipe by the magnets placed inside the cathode and anode shrouds. Measurements at the exit of injector show that, with an electric field of 200  kV/cm near the velvet surface and suitable magnetic field distribution, an electron beam up to 2.8 kA can be obtained with a normalized emittance of 1040π   mm mrad, and energy spread of 2.1% (3σ around the central energy of 3.5 MeV.

  4. Digital Control Techniques Based on Voltage Source Inverters in Renewable Energy Applications: A Review

    Directory of Open Access Journals (Sweden)

    Sohaib Tahir

    2018-02-01

    Full Text Available In the modern era, distributed generation is considered as an alternative source for power generation. Especially, need of the time is to provide the three-phase loads with smooth sinusoidal voltages having fixed frequency and amplitude. A common solution is the integration of power electronics converters in the systems for connecting distributed generation systems to the stand-alone loads. Thus, the presence of suitable control techniques, in the power electronic converters, for robust stability, abrupt response, optimal tracking ability and error eradication are inevitable. A comprehensive review based on design, analysis, validation of the most suitable digital control techniques and the options available for the researchers for improving the power quality is presented in this paper with their pros and cons. Comparisons based on the cost, schemes, performance, modulation techniques and coordinates system are also presented. Finally, the paper describes the performance evaluation of the control schemes on a voltage source inverter (VSI and proposes the different aspects to be considered for selecting a power electronics inverter topology, reference frames, filters, as well as control strategy.

  5. Sizing of SRAM Cell with Voltage Biasing Techniques for Reliability Enhancement of Memory and PUF Functions

    Directory of Open Access Journals (Sweden)

    Chip-Hong Chang

    2016-08-01

    Full Text Available Static Random Access Memory (SRAM has recently been developed into a physical unclonable function (PUF for generating chip-unique signatures for hardware cryptography. The most compelling issue in designing a good SRAM-based PUF (SPUF is that while maximizing the mismatches between the transistors in the cross-coupled inverters improves the quality of the SPUF, this ironically also gives rise to increased memory read/write failures. For this reason, the memory cells of existing SPUFs cannot be reused as storage elements, which increases the overheads of cryptographic system where long signatures and high-density storage are both required. This paper presents a novel design methodology for dual-mode SRAM cell optimization. The design conflicts are resolved by using word-line voltage modulation, dynamic voltage scaling, negative bit-line and adaptive body bias techniques to compensate for reliability degradation due to transistor downsizing. The augmented circuit-level techniques expand the design space to achieve a good solution to fulfill several otherwise contradicting key design qualities for both modes of operation, as evinced by our statistical analysis and simulation results based on complementary metal–oxide–semiconductor (CMOS 45 nm bulk Predictive Technology Model.

  6. A CMOS Micro-power, Class-AB “Flipped” Voltage Follower using the quasi floating-gate technique

    Directory of Open Access Journals (Sweden)

    Juan Jesus Ocampo-Hidalgo

    2017-05-01

    Full Text Available This paper presents the design and characterization of a new analog voltage follower for low-voltage applications. The main idea is based on the “Flipped” Voltage Follower and the use of the quasi-floating gate technique for achieving class AB operation. A test cell was simulated and fabricated using a 0,5 μm CMOS technology. When the proposed circuit is supplied with VDD = 1,5 V, it presents a power consumption of only 413 μW. Measurement and experimental results show a gain bandwidth product of 10 MHz and a total harmonic distortion of 1,12 % at 1 MHz.

  7. Study on condition monitoring techniques for low voltage electrical cables in nuclear power plants

    International Nuclear Information System (INIS)

    Hirao, Hideo; Sakai, Takeshi; Kajimura, Yuusaku

    2017-01-01

    Low voltage electrical cables installed in nuclear power plants are required to maintain its function in a design basis accident environment and they are qualified to that environment. The cables degrade also in normal operating conditions due to ageing and they must maintain integrity until the end of their qualified life. Demands for the condition monitoring technique for low voltage electrical cables have therefore been increasing as nuclear power plants operate longer. A single perfect method for this purpose is not available yet, but the possibility to use two different types of methods which can complement with each other has been examined. The combination of Fourier Transform Infrared Spectroscopy (FT-IR) and Indenter Modulus (IM) method was found highly effective. FT-IR is a method that determines chemical properties (changes in molecular bindings) of cables by using infrared rays, while IM is a method that determines mechanical properties (changes in hardness) of cables by indenters. Both methods are non-destructive and can be applied in-situ to the same material. Reliability of the evaluation can be assured by applying two different types of measurement principles that complement with each other. In this study, various cable samples with different kinds of insulation material (cross-linked polyethylene, ethylene propylene rubber, silicone rubber etc.) were aged with a special accelerated ageing technique which applies simultaneous thermal and radiation ageing to simulate ageing phenomena in a more realistic manner, and the degree of ageing was evaluated with FT-IR and IM. The evaluation result shows good correlation with ageing time and other ageing properties for most material types and the effectiveness of these methods were demonstrated. (author)

  8. Statistical identification of stimulus-activated network nodes in multi-neuron voltage-sensitive dye optical recordings.

    Science.gov (United States)

    Fathiazar, Elham; Anemuller, Jorn; Kretzberg, Jutta

    2016-08-01

    Voltage-Sensitive Dye (VSD) imaging is an optical imaging method that allows measuring the graded voltage changes of multiple neurons simultaneously. In neuroscience, this method is used to reveal networks of neurons involved in certain tasks. However, the recorded relative dye fluorescence changes are usually low and signals are superimposed by noise and artifacts. Therefore, establishing a reliable method to identify which cells are activated by specific stimulus conditions is the first step to identify functional networks. In this paper, we present a statistical method to identify stimulus-activated network nodes as cells, whose activities during sensory network stimulation differ significantly from the un-stimulated control condition. This method is demonstrated based on voltage-sensitive dye recordings from up to 100 neurons in a ganglion of the medicinal leech responding to tactile skin stimulation. Without relying on any prior physiological knowledge, the network nodes identified by our statistical analysis were found to match well with published cell types involved in tactile stimulus processing and to be consistent across stimulus conditions and preparations.

  9. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    OpenAIRE

    Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk

    2005-01-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

  10. A comparison of four streamflow record extension techniques

    Science.gov (United States)

    Hirsch, Robert M.

    1982-01-01

    One approach to developing time series of streamflow, which may be used for simulation and optimization studies of water resources development activities, is to extend an existing gage record in time by exploiting the interstation correlation between the station of interest and some nearby (long-term) base station. Four methods of extension are described, and their properties are explored. The methods are regression (REG), regression plus noise (RPN), and two new methods, maintenance of variance extension types 1 and 2 (MOVE.l, MOVE.2). MOVE.l is equivalent to a method which is widely used in psychology, biometrics, and geomorphology and which has been called by various names, e.g., ‘line of organic correlation,’ ‘reduced major axis,’ ‘unique solution,’ and ‘equivalence line.’ The methods are examined for bias and standard error of estimate of moments and order statistics, and an empirical examination is made of the preservation of historic low-flow characteristics using 50-year-long monthly records from seven streams. The REG and RPN methods are shown to have serious deficiencies as record extension techniques. MOVE.2 is shown to be marginally better than MOVE.l, according to the various comparisons of bias and accuracy.

  11. Some questions of the technique of high-voltage testing of accele-- rating tube space in electrostatic accelerators

    International Nuclear Information System (INIS)

    Romanov, V.A.; Ivanov, V.V.; Mukhametshin, V.I.; Dmitriev, E.P.; Kidalov, A.I.

    1983-01-01

    In the course of high-voltage testing of accelerating spaces a wide spread of experimental values of electric strength is observed. This circumstance is determined by a number of factors one of which is the technique used for high-voltage testing. For the purpose of obtaining more reliable experimental data on electric strength of accelerating spaces it is suggested to take for a criterion of electric strength of an accelerating space in long accelerating tubes a long-time withstood voltage which is equal approximately to a doubled working space voltage obtained as a result of a smooth voltage rise at dark current density not exceeding (1...5)x10 -2 A/cm 2 . In the course of testing of accelerating spaces of 25 mm height with total working area of electrodes approximately 360 cm 2 and insulator area onto vacuum approximately 150 cm 2 a long-time 70 kV voltage with dark current less than 1.10 -8 A is obtained

  12. Some problems in the technique of high-voltage testing of the accelerating tube gaps in electrostatic accelerators

    International Nuclear Information System (INIS)

    Romanov, V.A.; Ivanov, V.V.; Mukhametshin, V.I.; Dmitriev, E.P.; Kidalov, A.I.

    1983-01-01

    Problems arising during high-voltage testing and training of accelerating taubes of electrostatic accelrators are discussed. A rig and technique of the accelerating tube testing and program designed for the processing of the data obtained and sorting out of the samples investigated are described

  13. Applying Metrological Techniques to Satellite Fundamental Climate Data Records

    Science.gov (United States)

    Woolliams, Emma R.; Mittaz, Jonathan PD; Merchant, Christopher J.; Hunt, Samuel E.; Harris, Peter M.

    2018-02-01

    Quantifying long-term environmental variability, including climatic trends, requires decadal-scale time series of observations. The reliability of such trend analysis depends on the long-term stability of the data record, and understanding the sources of uncertainty in historic, current and future sensors. We give a brief overview on how metrological techniques can be applied to historical satellite data sets. In particular we discuss the implications of error correlation at different spatial and temporal scales and the forms of such correlation and consider how uncertainty is propagated with partial correlation. We give a form of the Law of Propagation of Uncertainties that considers the propagation of uncertainties associated with common errors to give the covariance associated with Earth observations in different spectral channels.

  14. A research technique for the effect of higher harmonic voltages on the operating parameters of a permanent magnet synchronous generator

    Directory of Open Access Journals (Sweden)

    Hasanova L. H.

    2017-12-01

    Full Text Available Nowadays permanent magnet synchronous machines those frequency-controlled from stator side with frequency inverters made on the basis of power transistors or fully controlled thyristors, are widely used as motors and generators. In future they are also promising a good application in transport, including marine. Modern frequency inverters are equipped with a control system based on sine-shaped pulse width modulation. While shaping the voltage in the output of the inverter, in addition to the fundamental harmonic, higher harmonic components are also included in the voltage shape, which certainly affect the operating parameters of the generator (electromagnetic torque, power, currents. To determine this effect the modeling and investigation technique of higher harmonic voltages in the "electric network – frequency converter – synchronous machine with permanent magnets" system has been developed. The proposed equations of a frequency-controlled permanent magnet synchronous machine allow relatively simply reproduce the harmonic composition of the voltage in the output of a frequency inverter equipped with the control system based on a sinusoidal pulse width modulation. The developed research technique can be used for inverters with any number and composition of voltage harmonic components feeding a stator winding of a permanent magnet synchronous machine. On a particular case, the efficiency of the research technique of the higher harmonics influence on the operating parameters of the generator has been demonstrated. At the same time, the study has been carried out taking into account the shape of the voltage curve feeding the windings of the synchronous machine containing in addition to the fundamental harmonic the 8, 10, 11, 13, 14 and 16-th harmonic components, and the rated active power of the synchronous machine has been equal to 1 500 kW.

  15. Technique eliminates high voltage arcing at electrode-insulator contact area

    Science.gov (United States)

    Mealy, G.

    1967-01-01

    Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.

  16. Simple Moving Voltage Average Incremental Conductance MPPT Technique with Direct Control Method under Nonuniform Solar Irradiance Conditions

    Directory of Open Access Journals (Sweden)

    Amjad Ali

    2015-01-01

    Full Text Available A new simple moving voltage average (SMVA technique with fixed step direct control incremental conductance method is introduced to reduce solar photovoltaic voltage (VPV oscillation under nonuniform solar irradiation conditions. To evaluate and validate the performance of the proposed SMVA method in comparison with the conventional fixed step direct control incremental conductance method under extreme conditions, different scenarios were simulated. Simulation results show that in most cases SMVA gives better results with more stability as compared to traditional fixed step direct control INC with faster tracking system along with reduction in sustained oscillations and possesses fast steady state response and robustness. The steady state oscillations are almost eliminated because of extremely small dP/dV around maximum power (MP, which verify that the proposed method is suitable for standalone PV system under extreme weather conditions not only in terms of bus voltage stability but also in overall system efficiency.

  17. Comparative Study of Online Open Circuit Voltage Estimation Techniques for State of Charge Estimation of Lithium-Ion Batteries

    Directory of Open Access Journals (Sweden)

    Hicham Chaoui

    2017-04-01

    Full Text Available Online estimation techniques are extensively used to determine the parameters of various uncertain dynamic systems. In this paper, online estimation of the open-circuit voltage (OCV of lithium-ion batteries is proposed by two different adaptive filtering methods (i.e., recursive least square, RLS, and least mean square, LMS, along with an adaptive observer. The proposed techniques use the battery’s terminal voltage and current to estimate the OCV, which is correlated to the state of charge (SOC. Experimental results highlight the effectiveness of the proposed methods in online estimation at different charge/discharge conditions and temperatures. The comparative study illustrates the advantages and limitations of each online estimation method.

  18. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    Science.gov (United States)

    Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.

    2005-03-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

  19. Improvement of diagnostic techniques and electrical circuit in azo dye degradation by high voltage electrical discharge

    International Nuclear Information System (INIS)

    Shen Yongjun; Lei Lecheng; Zhang Xingwang; Zhou Minghua; Zhang Yi

    2008-01-01

    Fast electrical diagnostics and improvement of electrical circuits for methyl orange (MO) degradation by high voltage pulsed electrical discharge were investigated. To eliminate electromagnetic radiation, several effective methods were employed. RG 218 coaxial cable was substituted for the common transmission lines to transmit high voltage pulses, and multi-lines in parallel were earthed to avoid electromagnetic interference and, additionally, to reduce the stray inductance of the electrical circuit and increase the pulse rise rate to reduce the energy losses in the transmission system. The problem of the differences in the bandwidths of voltage and current probes causing an error in the calculation of energy dissipation was avoided by reducing the bandwidths of voltage and current measurements to the same value. The real discharge current was obtained by subtracting the capacitive current from the total current. The energy per pulse obtained in the reactor before and after improvement of the diagnostics and electrical circuit were 15.5 mJ and 26.8 mJ, respectively, and the energy efficiencies of MO degradation were 1.34 x 10 -9 mol/J and 1.95 x 10 -9 mol/J, respectively

  20. Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques

    Science.gov (United States)

    Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron

    2016-01-26

    A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.

  1. FPGA Techniques Based New Hybrid Modulation Strategies for Voltage Source Inverters

    Science.gov (United States)

    Sudha, L. U.; Baskaran, J.; Elankurisil, S. A.

    2015-01-01

    This paper corroborates three different hybrid modulation strategies suitable for single-phase voltage source inverter. The proposed method is formulated using fundamental switching and carrier based pulse width modulation methods. The main tale of this proposed method is to optimize a specific performance criterion, such as minimization of the total harmonic distortion (THD), lower order harmonics, switching losses, and heat losses. The proposed method is articulated using fundamental switching and carrier based pulse width modulation methods. Thus, the harmonic pollution in the power system will be reduced and the power quality will be augmented with better harmonic profile for a target fundamental output voltage. The proposed modulation strategies are simulated in MATLAB r2010a and implemented in a Xilinx spartan 3E-500 FG 320 FPGA processor. The feasibility of these modulation strategies is authenticated through simulation and experimental results. PMID:25821852

  2. Forward voltage short-pulse technique for measuring high power laser array junction temperature

    Science.gov (United States)

    Meadows, Byron L. (Inventor); Amzajerdian, Frazin (Inventor); Barnes, Bruce W. (Inventor); Baker, Nathaniel R. (Inventor)

    2012-01-01

    The present invention relates to a method of measuring the temperature of the P-N junction within the light-emitting region of a quasi-continuous-wave or pulsed semiconductor laser diode device. A series of relatively short and low current monitor pulses are applied to the laser diode in the period between the main drive current pulses necessary to cause the semiconductor to lase. At the sufficiently low current level of the monitor pulses, the laser diode device does not lase and behaves similar to an electronic diode. The voltage across the laser diode resulting from each of these low current monitor pulses is measured with a high degree of precision. The junction temperature is then determined from the measured junction voltage using their known linear relationship.

  3. PV Power-Generation System with a Phase-Shift PWM Technique for High Step-Up Voltage Applications

    Directory of Open Access Journals (Sweden)

    Cheng-Tao Tsai

    2012-01-01

    Full Text Available A PV power-generation system with a phase-shift pulse-width modulation (PWM technique for high step-up voltage applications is proposed. The proposed power-generation system consists of two stages. In the input stage, all power switches of the full-bridge converter with phase-shift technique can be operated with zero-current switching (ZCS at turn-on or turn-off transition. Hence, the switching losses of the power switches can be reduced. Then, in the DC output stage, a voltage-doubler circuit is used to boost a high dc-link bus voltage. To supply a utility power, a dc/ac inverter is connected to induce a sinusoidal source. In order to draw a maximum power from PV arrays source, a microcontroller is incorporated with the perturbation and observation method to implement maximum power point tracking (MPPT algorithm and power regulating scheme. In this study, a full load power of 300 W prototype has been built. Experimental results are presented to verify the performance and feasibility of the proposed PV power-generation system.

  4. Mobile medium-voltage switching system. Temporary standby power supply in record time; Mobile Mittelspannungsschaltanlage. Vorlaeufige Wiederversorgung in Rekordzeit

    Energy Technology Data Exchange (ETDEWEB)

    Thiery, Matthias; Schwarz, Stefan [Siemens AG, Mannheim (Germany); Wingerter, Dieter [BASF SE, Ludwigshafen (Germany); Doering, Holger [B. Goebel und Sohn GmbH, Asschaffenburg (Germany). Fahrzeugbau

    2011-02-28

    BASF SE Ludwigshafen operates more than 100 medium-voltage switching stations for power supply to its plants. The complexity of the production plants and production method make it necessary to have immediate standby power supply in case of interruption of a medium-voltage switching station. For this purpose, a transportable emergency container was acquired that contains a medium-voltage switching system. Power can be supplied at very short notice, simply by plugging the necessary cable connections. No cranes or other tools are required for installation. The emergency container is designed for use at varying voltage levels and can be transported by road to other BASF sites in Europe. The switching station is a gas-insulated medium-voltage switching station 8DA10 by Siemens, designed for operating voltages of 6, 10, 20, and 35 kW.

  5. Beaming teaching application: recording techniques for spatial xylophone sound rendering

    DEFF Research Database (Denmark)

    Markovic, Milos; Madsen, Esben; Olesen, Søren Krarup

    2012-01-01

    BEAMING is a telepresence research project aiming at providing a multimodal interaction between two or more participants located at distant locations. One of the BEAMING applications allows a distant teacher to give a xylophone playing lecture to the students. Therefore, rendering of the xylophon...... to spatial improvements mainly in terms of the Apparent Source Width (ASW). Rendered examples are subjectively evaluated in listening tests by comparing them with binaural recording....

  6. Comparison of cardiopulmonary resuscitation techniques using video camera recordings.

    OpenAIRE

    Mann, C J; Heyworth, J

    1996-01-01

    OBJECTIVE--To use video recordings to compare the performance of resuscitation teams in relation to their previous training in cardiac resuscitation. METHODS--Over a 10 month period all cardiopulmonary resuscitations carried out in an accident and emergency (A&E) resuscitation room were videotaped. The following variables were monitored: (1) time to perform three defibrillatory shocks; (2) time to give intravenous adrenaline (centrally or peripherally); (3) the numbers and grade of medical an...

  7. Automatic Bowel Motility Evaluation Technique for Noncontact Sound Recordings

    Directory of Open Access Journals (Sweden)

    Ryunosuke Sato

    2018-06-01

    Full Text Available Information on bowel motility can be obtained via magnetic resonance imaging (MRIs and X-ray imaging. However, these approaches require expensive medical instruments and are unsuitable for frequent monitoring. Bowel sounds (BS can be conveniently obtained using electronic stethoscopes and have recently been employed for the evaluation of bowel motility. More recently, our group proposed a novel method to evaluate bowel motility on the basis of BS acquired using a noncontact microphone. However, the method required manually detecting BS in the sound recordings, and manual segmentation is inconvenient and time consuming. To address this issue, herein, we propose a new method to automatically evaluate bowel motility for noncontact sound recordings. Using simulations for the sound recordings obtained from 20 human participants, we showed that the proposed method achieves an accuracy of approximately 90% in automatic bowel sound detection when acoustic feature power-normalized cepstral coefficients are used as inputs to artificial neural networks. Furthermore, we showed that bowel motility can be evaluated based on the three acoustic features in the time domain extracted by our method: BS per minute, signal-to-noise ratio, and sound-to-sound interval. The proposed method has the potential to contribute towards the development of noncontact evaluation methods for bowel motility.

  8. Practical recording techniques the step-by-step approach to professional audio recording

    CERN Document Server

    Bartlett, Bruce

    2013-01-01

    Hands-on practical guide covering all aspects of recording, ideal for beginning and intermediate recording engineers, producers, musicians and audio enthusiasts. Filled with tips and shortcuts, this book offers advice on equipping a home studio (both low-budget and advanced), suggestions for set-up, acoustics, choosing monitor speakers, and preventing hum. This best-selling guide also tells how to judge recordings and improve them to produce maximum results. New material covered in the 5th edition to include: * complete revision and update of dig

  9. AN EVALUATION OF CONDITION MONITORING TECHNIQUES FOR LOW-VOLTAGE ELECTRIC CABLES

    International Nuclear Information System (INIS)

    LOFARO, R.J.; GROVE, E.; SOO, P.

    2000-01-01

    Aging of systems and components in nuclear power plants is a well known occurrence that must be managed to ensure the continued safe operation of these plants. Much of the degradation due to aging is controlled through periodic maintenance and/or component replacement. However, there are components that do not receive periodic maintenance or monitoring once they are installed; electric cables are such a component. To provide a means of monitoring the condition of electric cables, research is ongoing to evaluate promising condition monitoring (CM) techniques that can be used in situ to monitor cable condition and predict remaining life. While several techniques are promising, each has limitations that must be considered in its application. This paper discusses the theory behind several of the promising cable CM techniques being studied, along with their effectiveness for monitoring aging degradation in typical cable insulation materials, such as cross-linked polyethylene and ethylene propylene rubber. Successes and limitations of each technique are also presented

  10. An efficient diagnostic technique for distribution systems based on under fault voltages and currents

    Energy Technology Data Exchange (ETDEWEB)

    Campoccia, A.; Di Silvestre, M.L.; Incontrera, I.; Riva Sanseverino, E. [Dipartimento di Ingegneria Elettrica elettronica e delle Telecomunicazioni, Universita degli Studi di Palermo, viale delle Scienze, 90128 Palermo (Italy); Spoto, G. [Centro per la Ricerca Elettronica in Sicilia, Monreale, Via Regione Siciliana 49, 90046 Palermo (Italy)

    2010-10-15

    Service continuity is one of the major aspects in the definition of the quality of the electrical energy, for this reason the research in the field of faults diagnostic for distribution systems is spreading ever more. Moreover the increasing interest around modern distribution systems automation for management purposes gives faults diagnostics more tools to detect outages precisely and in short times. In this paper, the applicability of an efficient fault location and characterization methodology within a centralized monitoring system is discussed. The methodology, appropriate for any kind of fault, is based on the use of the analytical model of the network lines and uses the fundamental components rms values taken from the transient measures of line currents and voltages at the MV/LV substations. The fault location and identification algorithm, proposed by the authors and suitably restated, has been implemented on a microprocessor-based device that can be installed at each MV/LV substation. The speed and precision of the algorithm have been tested against the errors deriving from the fundamental extraction within the prescribed fault clearing times and against the inherent precision of the electronic device used for computation. The tests have been carried out using Matlab Simulink for simulating the faulted system. (author)

  11. Current-voltage analysis of the record-efficiency CuGaSe2 solar cell: Application of the current separation method and the interface recombination model

    International Nuclear Information System (INIS)

    Saad, M.; Kasis, A.

    2011-01-01

    Current-voltage (j-V) characteristics of the record-efficiency CuGaSe 2 solar cell measured under several illumination levels are analyzed using a two-diode equation for a more accurate description of cell behavior. The contribution of each diode to the total cell j-V characteristic under illumination was estimated using the current separation method presented recently. This is performed in an effort to identify the distinctive features of this record-efficiency cell which have led to the up-to-date highest open circuit voltage of V o c = 946 mV and fill factor of FF = 66.5% for CuGaSe 2 solar cells. Furthermore, the interface recombination component of the cell current under illumination is quantitatively discussed applying the interface recombination model presented earlier. (author)

  12. Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

    Science.gov (United States)

    Xu, Kaili

    Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also

  13. Robust Sequential Circuits Design Technique for Low Voltage and High Noise Scenarios

    Directory of Open Access Journals (Sweden)

    Garcia-Leyva Lancelot

    2016-01-01

    In this paper we introduce an innovative input and output data redundancy principle for sequential block circuits, the responsible to keep the state of the system, showing its efficiency in front of other robust technique approaches. The methodology is totally different from the Von Neumann approaches, because element are not replicated N times, but instead, they check the coherence of redundant input data no allowing data propagation in case of discrepancy. This mechanism does not require voting devices.

  14. Current transport and capacitance-voltage characteristics of an n-PbTe/p-GaP heterojunction prepared using the electron beam deposition technique

    Science.gov (United States)

    Nasr, Mahmoud; El Radaf, I. M.; Mansour, A. M.

    2018-04-01

    In this study, a crystalline n-PbTe/p-GaP heterojunction was fabricated using the electron beam deposition technique. The structural properties of the prepared heterojunction were examined by X-ray diffraction and scanning electron microscopy. The dark current-voltage characteristics of the heterojunction were investigated at different temperatures ranging from 298 to 398 K. The rectification factor, series resistance, shunt resistance, diode ideality factor, and effective barrier height (ϕb) were determined. The photovoltaic parameters were identified based on the current density-voltage characteristics under illumination. The capacitance-voltage characteristics showed that the junction was abrupt in nature.

  15. Calibration technique and study on metrological characteristics of a high-voltage inverse square-law function generator

    International Nuclear Information System (INIS)

    Popov, V.P.; Semenov, A.L.

    1987-01-01

    The calibration technique is described, and the metrological characteristics of a high-voltage generator of the inverse-quadratic function (HGF), being a functional unit of the diagnostic system of an electrodynamic analyser of a ionic component of a laser plasma, is analysed. The results of HGF testing in the range of time constants of the τ=(5-25)μs function are given. Analysis of metrologic and experimental characteristics shows, that HGF with automatic calibration has quite high accurate parameters. The high accuracy of function generation is provided with the possibility of calibration and adjustment conduction under experimental working conditions. Increase of the generated pulse amplitude to several tens of kilovelts is possible. Besides, the possibility of timely function adjustment to the necessary parameter (τ) increases essentially the HGF functional possibilities

  16. A Smoothing Technique for the Multifractal Analysis of a Medium Voltage Feeders Electric Current

    Science.gov (United States)

    de Santis, Enrico; Sadeghian, Alireza; Rizzi, Antonello

    2017-12-01

    The current paper presents a data-driven detrending technique allowing to smooth complex sinusoidal trends from a real-world electric load time series before applying the Detrended Multifractal Fluctuation Analysis (MFDFA). The algorithm we call Smoothed Sort and Cut Fourier Detrending (SSC-FD) is based on a suitable smoothing of high power periodicities operating directly in the Fourier spectrum through a polynomial fitting technique of the DFT. The main aim consists of disambiguating the characteristic slow varying periodicities, that can impair the MFDFA analysis, from the residual signal in order to study its correlation properties. The algorithm performances are evaluated on a simple benchmark test consisting of a persistent series where the Hurst exponent is known, with superimposed ten sinusoidal harmonics. Moreover, the behavior of the algorithm parameters is assessed computing the MFDFA on the well-known sunspot data, whose correlation characteristics are reported in literature. In both cases, the SSC-FD method eliminates the apparent crossover induced by the synthetic and natural periodicities. Results are compared with some existing detrending methods within the MFDFA paradigm. Finally, a study of the multifractal characteristics of the electric load time series detrendended by the SSC-FD algorithm is provided, showing a strong persistent behavior and an appreciable amplitude of the multifractal spectrum that allows to conclude that the series at hand has multifractal characteristics.

  17. Development techniques and electron optical studies of high voltage, high current electron guns

    International Nuclear Information System (INIS)

    Rangarajan, L.M.; Mahadevan, S.; Ramamurthi, S.S.

    1992-01-01

    The progress of the electron gun design, limiting to axially symmetric geometries is discussed here with a view to utilise such guns for electron accelerators. The mechanical design features leading to the physical configuration of the gun with stringent tolerances are outlined. Vacuum processing is done at pressures of 1.3x10 -5 Pa. The gun employs W-filament emitter or a cathode pellet with bombarder service. A water cooled compact faraday cup is used to measure the electron current. Electron gun geometries have been studied using the computer programme. The preveance of the gun is 0.7x10 -7 A/Vsup(1.5) at 80 kV. Developmental techniques of such pulsed electron guns are described. (author). 7 refs., 5 figs

  18. ­The Geospatial Metadata Manager’s Toolbox: Three Techniques for Maintaining Records

    Directory of Open Access Journals (Sweden)

    Bruce Godfrey

    2015-07-01

    Full Text Available Managing geospatial metadata records requires a range of techniques. At the University of Idaho Library, we have tens of thousands of records which need to be maintained as well as the addition of new records which need to be normalized and added to the collections. We show a graphical user interface (GUI tool that was developed to make simple modifications, a simple XSLT that operates on complex metadata, and a Python script with enables parallel processing to make maintenance tasks more efficient. Throughout, we compare these techniques and discuss when they may be useful.

  19. Assessment of annoyance, loudness and unpleasantness with different recording and playback techniques

    DEFF Research Database (Denmark)

    Celik, Emine; Persson Waye, Kerstin; Møller, Henrik

    2005-01-01

    if there is a difference in perception related to annoyance, loudness and unpleasantness between monophonic recordings played back through a loudspeaker and binaural recordings played back via headphones and to evaluate whether a possible difference depends on temporal and frequency characteristics as well as spatial...... through a loudspeaker and the binaural recordings were presented through both closed (circum-aural) and completely open (free of the ear) headphones. The results show that for all judgments (annoyance, loudness and unpleasantness), there was no significant main effect of recording and playback techniques...

  20. The importance of recording and playback technique for assessment of annoyance

    DEFF Research Database (Denmark)

    Celik, Emine; Persson Waye, Kerstin; Møller, Henrik

    2005-01-01

    in perception related to annoyance, loudness and unpleasantness between monophonic recordings played back through a loudspeaker and binaural recordings played back via headphones and to evaluate whether a possible difference depends on temporal and frequency characteristics as well as spatial characteristics...... a loudspeaker and the binaural recordings were presented through both closed (circum-aural) and completely open (free of the ear) headphones. The results show that for all judgments (annoyance, loudness and unpleasantness), there was no significant main effect of recording and playback techniques; however...

  1. Comparison of non-invasive electrohysterographic recording techniques for monitoring uterine dynamics.

    Science.gov (United States)

    Alberola-Rubio, J; Prats-Boluda, G; Ye-Lin, Y; Valero, J; Perales, A; Garcia-Casado, J

    2013-12-01

    Non-invasive recording of uterine myoelectric activity (electrohysterogram, EHG) could provide an alternative to monitoring uterine dynamics by systems based on tocodynamometers (TOCO). Laplacian recording of bioelectric signals has been shown to give better spatial resolution and less interference than mono- and bipolar surface recordings. The aim of this work was to study the signal quality obtained from monopolar, bipolar and Laplacian techniques in EHG recordings, as well as to assess their ability to detect uterine contractions. Twenty-two recording sessions were carried out on singleton pregnant women during the active phase of labour. In each session the following simultaneous recordings were obtained: internal uterine pressure (IUP), external tension of abdominal wall (TOCO) and EHG signals (5 monopolar and 4 bipolar recordings, 1 discrete approximation to the Laplacian of the potential and 2 estimates of the Laplacian from two active annular electrodes). The results obtained show that EHG is able to detect a higher number of uterine contractions than TOCO. Laplacian recordings give improved signal quality over monopolar and bipolar techniques, reduce maternal cardiac interference and improve the signal-to-noise ratio. The optimal position for recording EHG was found to be the uterine median axis and the lower centre-right umbilical zone. Copyright © 2013 IPEM. Published by Elsevier Ltd. All rights reserved.

  2. A look-up-table digital predistortion technique for high-voltage power amplifiers in ultrasonic applications.

    Science.gov (United States)

    Gao, Zheng; Gui, Ping

    2012-07-01

    In this paper, we present a digital predistortion technique to improve the linearity and power efficiency of a high-voltage class-AB power amplifier (PA) for ultrasound transmitters. The system is composed of a digital-to-analog converter (DAC), an analog-to-digital converter (ADC), and a field-programmable gate array (FPGA) in which the digital predistortion (DPD) algorithm is implemented. The DPD algorithm updates the error, which is the difference between the ideal signal and the attenuated distorted output signal, in the look-up table (LUT) memory during each cycle of a sinusoidal signal using the least-mean-square (LMS) algorithm. On the next signal cycle, the error data are used to equalize the signal with negative harmonic components to cancel the amplifier's nonlinear response. The algorithm also includes a linear interpolation method applied to the windowed sinusoidal signals for the B-mode and Doppler modes. The measurement test bench uses an arbitrary function generator as the DAC to generate the input signal, an oscilloscope as the ADC to capture the output waveform, and software to implement the DPD algorithm. The measurement results show that the proposed system is able to reduce the second-order harmonic distortion (HD2) by 20 dB and the third-order harmonic distortion (HD3) by 14.5 dB, while at the same time improving the power efficiency by 18%.

  3. A Low-Voltage Ride-Through Technique for Grid-Connected Converters with Reduced Power Transistors Stress

    DEFF Research Database (Denmark)

    Chen, Hsin-Chih; Lee, Chia-Tse; Cheng, Po-Tai

    2016-01-01

    With more and more distributed energy resources being installed in the utility grid, grid operators start imposing the low-voltage ride-through requirement on such systems to remain grid-connected and inject reactive and/or active current to support grid voltage during fault conditions. This pape...

  4. Melodic pattern extraction in large collections of music recordings using time series mining techniques

    OpenAIRE

    Gulati, Sankalp; Serrà, Joan; Ishwar, Vignesh; Serra, Xavier

    2014-01-01

    We demonstrate a data-driven unsupervised approach for the discovery of melodic patterns in large collections of Indian art music recordings. The approach first works on single recordings and subsequently searches in the entire music collection. Melodic similarity is based on dynamic time warping. The task being computationally intensive, lower bounding and early abandoning techniques are applied during distance computation. Our dataset comprises 365 hours of music, containing 1,764 audio rec...

  5. Simplified Technique for Incorporating a Metal Mesh into Record Bases for Mandibular Implant Overdentures.

    Science.gov (United States)

    Godoy, Antonio; Siegel, Sharon C

    2015-12-01

    Mandibular implant-retained overdentures have become the standard of care for patients with mandibular complete edentulism. As part of the treatment, the mandibular implant-retained overdenture may require a metal mesh framework to be incorporated to strengthen the denture and avoid fracture of the prosthesis. Integrating the metal mesh framework as part of the acrylic record base and wax occlusion rim before the jaw relation procedure will avoid the distortion of the record base and will minimize the chances of processing errors. A simplified method to incorporate the mesh into the record base and occlusion rim is presented in this technique article. © 2015 by the American College of Prosthodontists.

  6. Reduction technique of drop voltage and power losses to improve power quality using ETAP Power Station simulation model

    Science.gov (United States)

    Satrio, Reza Indra; Subiyanto

    2018-03-01

    The effect of electric loads growth emerged direct impact in power systems distribution. Drop voltage and power losses one of the important things in power systems distribution. This paper presents modelling approach used to restructrure electrical network configuration, reduce drop voltage, reduce power losses and add new distribution transformer to enhance reliability of power systems distribution. Restructrure electrical network was aimed to analyse and investigate electric loads of a distribution transformer. Measurement of real voltage and real current were finished two times for each consumer, that were morning period and night period or when peak load. Design and simulation were conduct by using ETAP Power Station Software. Based on result of simulation and real measurement precentage of drop voltage and total power losses were mismatch with SPLN (Standard PLN) 72:1987. After added a new distribution transformer and restructrured electricity network configuration, the result of simulation could reduce drop voltage from 1.3 % - 31.3 % to 8.1 % - 9.6 % and power losses from 646.7 watt to 233.29 watt. Result showed, restructrure electricity network configuration and added new distribution transformer can be applied as an effective method to reduce drop voltage and reduce power losses.

  7. The Technique of the Sound Studio: Radio, Record Production, Television, and Film. Revised Edition.

    Science.gov (United States)

    Nisbett, Alec

    Detailed explanations of the studio techniques used in radio, record, television, and film sound production are presented in as non-technical language as possible. An introductory chapter discusses the physics and physiology of sound. Subsequent chapters detail standards for sound control in the studio; explain the planning and routine of a sound…

  8. Techniques for extracting single-trial activity patterns from large-scale neural recordings

    Science.gov (United States)

    Churchland, Mark M; Yu, Byron M; Sahani, Maneesh; Shenoy, Krishna V

    2008-01-01

    Summary Large, chronically-implanted arrays of microelectrodes are an increasingly common tool for recording from primate cortex, and can provide extracellular recordings from many (order of 100) neurons. While the desire for cortically-based motor prostheses has helped drive their development, such arrays also offer great potential to advance basic neuroscience research. Here we discuss the utility of array recording for the study of neural dynamics. Neural activity often has dynamics beyond that driven directly by the stimulus. While governed by those dynamics, neural responses may nevertheless unfold differently for nominally identical trials, rendering many traditional analysis methods ineffective. We review recent studies – some employing simultaneous recording, some not – indicating that such variability is indeed present both during movement generation, and during the preceding premotor computations. In such cases, large-scale simultaneous recordings have the potential to provide an unprecedented view of neural dynamics at the level of single trials. However, this enterprise will depend not only on techniques for simultaneous recording, but also on the use and further development of analysis techniques that can appropriately reduce the dimensionality of the data, and allow visualization of single-trial neural behavior. PMID:18093826

  9. Predictable Technique to Register Retruded Contact Position (RCP) Using a Disposable Jaw Relation Recording Device.

    Science.gov (United States)

    Daher, Tony; Lobel, William A; Massad, Joseph; Ahuja, Swati; Danilov, Zarko Jack

    2015-05-01

    The dental literature presents various definitions and techniques to describe and register centric relation (CR) or centric occlusion (CO). Briefly reviewing the literature in relation to CR, this article proposes the use of the term retruded contact position (RCP), clinically defined as retruded, unstrained, repeatable position and where the mandibular movements start when a Gothic arch tracing is used. With this clinical definition, a technique can be easily selected that meets all the requirements of such position. The article discusses the use of a jaw recorder that is an intraorally graphic recording device that results in a tracing of mandibular movements in one plane, with the apex of the tracing indicating the retruded, unstrained, and repeatable relationship. The intersection of the arcs produced by the right and left working movement form the apex of the Gothic arch tracing. Several clinical situations using the jaw recorder are described. Clinicians can now quickly and accurately record RCP, balance complete, partial, or implant dentures, and orthopedically reposition the mandible. The technique achieves highly reliable and reproducible results.

  10. Techniques for Handling Channeling in High Resolution Fourier Transform Spectra Recorded with Synchrotron Sources

    International Nuclear Information System (INIS)

    Ibrahim, Amr; PredoiCross, Adriana; Teillet, P. M.

    2010-01-01

    Seven different techniques in dealing the problem of channel spectra in Fourier transform Spectroscopy utilizing synchrotron source were examined and compared. Five of these techniques deal with the artifacts (spikes) in the recorded interferogram which in turn result in channel spectra within the spectral domain. Such interferogram editing method include replacing these spikes with zeros, straight line, fitted polynomial curve, rescaled spike and spike reduced with Gauss Function. Another two techniques try to target this issue in the spectral domain instead by either generating a synthetic background simulating the channels or measuring the channels parameters (amplitude, spacing and phase) to use in the spectral fitting program. Results showed spectral domain techniques produces higher quality results in terms of signal to noise and fitting residual. The effect of each method on the line parameters such as position, intensity are air broadening are also measured and discussed.

  11. The code system of record of technique-tactical actions of badminton players

    Directory of Open Access Journals (Sweden)

    Liubieva V.A.

    2010-03-01

    Full Text Available Software, used by the Russian specialists and International federation of badminton (IBF, are analysed. The results of semantic interpretation and classification of technique - tactical technique - tactical actions of badminton players are presented. On the basis of this classification the special system of record of game which allows operatively to fix all actions of players of single digit in the process of competition activity is worked out and approved. Systematization of technical actions as classification assists creation of the effective going near the estimation of competition activity of players and planning of training process.

  12. Using text-mining techniques in electronic patient records to identify ADRs from medicine use

    DEFF Research Database (Denmark)

    Warrer, Pernille; Hansen, Ebba Holme; Jensen, Lars Juhl

    2012-01-01

    This literature review included studies that use text-mining techniques in narrative documents stored in electronic patient records (EPRs) to investigate ADRs. We searched PubMed, Embase, Web of Science and International Pharmaceutical Abstracts without restrictions from origin until July 2011. We...... included empirically based studies on text mining of electronic patient records (EPRs) that focused on detecting ADRs, excluding those that investigated adverse events not related to medicine use. We extracted information on study populations, EPR data sources, frequencies and types of the identified ADRs......, medicines associated with ADRs, text-mining algorithms used and their performance. Seven studies, all from the United States, were eligible for inclusion in the review. Studies were published from 2001, the majority between 2009 and 2010. Text-mining techniques varied over time from simple free text...

  13. Ultrasonic recording and display techniques for the inspection of nuclear power plant

    International Nuclear Information System (INIS)

    Ely, R.W.; Hall, G.D.; Johnson, A.; Pascoe, P.T.

    1985-01-01

    This paper describes four systems: MDU, PURDIE, LAURA and DRUID, under development as ultrasonic recording and display techniques for the inspection of nuclear power plant. The MDU system plots either plan or sectional views of the component under test onto a bistable storage screen. PURDIE is a system based around a video cassette recorder which has been modified to record ultrasonic A-scan waveforms and probe positional information. MDU and PURDIE are portable systems, for use under difficult site conditions. They may be manufactured in quantity to satisfy the demanding inspection programmes of nuclear power stations. LAURA is a desk top replay system for the video cassette tapes produced on site by PURDIE. DRUID is a digital desk top replay/display system incorporating a high resolution colour graphics terminal and therefore offering more flexibility and improved display formats. The systems are compatible with each other and some component units are directly interchangeable between the various systems

  14. High-speed, random-access fluorescence microscopy: I. High-resolution optical recording with voltage-sensitive dyes and ion indicators.

    Science.gov (United States)

    Bullen, A; Patel, S S; Saggau, P

    1997-07-01

    The design and implementation of a high-speed, random-access, laser-scanning fluorescence microscope configured to record fast physiological signals from small neuronal structures with high spatiotemporal resolution is presented. The laser-scanning capability of this nonimaging microscope is provided by two orthogonal acousto-optic deflectors under computer control. Each scanning point can be randomly accessed and has a positioning time of 3-5 microseconds. Sampling time is also computer-controlled and can be varied to maximize the signal-to-noise ratio. Acquisition rates up to 200k samples/s at 16-bit digitizing resolution are possible. The spatial resolution of this instrument is determined by the minimal spot size at the level of the preparation (i.e., 2-7 microns). Scanning points are selected interactively from a reference image collected with differential interference contrast optics and a video camera. Frame rates up to 5 kHz are easily attainable. Intrinsic variations in laser light intensity and scanning spot brightness are overcome by an on-line signal-processing scheme. Representative records obtained with this instrument by using voltage-sensitive dyes and calcium indicators demonstrate the ability to make fast, high-fidelity measurements of membrane potential and intracellular calcium at high spatial resolution (2 microns) without any temporal averaging.

  15. Microstructure Investigation of 13Cr-2Mo ODS Steel Components Obtained by High Voltage Electric Discharge Compaction Technique

    Directory of Open Access Journals (Sweden)

    Igor Bogachev

    2015-11-01

    Full Text Available Refractory oxide dispersion strengthened 13Cr-2Mo steel powder was successfully consolidated to near theoretical density using high voltage electric discharge compaction. Cylindrical samples with relative density from 90% to 97% and dimensions of 10 mm in diameter and 10–15 mm in height were obtained. Consolidation conditions such as pressure and voltage were varied in some ranges to determine the optimal compaction regime. Three different concentrations of yttria were used to identify its effect on the properties of the samples. It is shown that the utilized ultra-rapid consolidation process in combination with high transmitted energy allows obtaining high density compacts, retaining the initial structure with minimal grain growth. The experimental results indicate some heterogeneity of the structure which may occur in the external layers of the tested samples due to various thermal and electromagnetic in-processing effects. The choice of the optimal parameters of the consolidation enables obtaining samples of acceptable quality.

  16. Microstructure Investigation of 13Cr-2Mo ODS Steel Components Obtained by High Voltage Electric Discharge Compaction Technique.

    Science.gov (United States)

    Bogachev, Igor; Yudin, Artem; Grigoryev, Evgeniy; Chernov, Ivan; Staltsov, Maxim; Khasanov, Oleg; Olevsky, Eugene

    2015-11-02

    Refractory oxide dispersion strengthened 13Cr-2Mo steel powder was successfully consolidated to near theoretical density using high voltage electric discharge compaction. Cylindrical samples with relative density from 90% to 97% and dimensions of 10 mm in diameter and 10-15 mm in height were obtained. Consolidation conditions such as pressure and voltage were varied in some ranges to determine the optimal compaction regime. Three different concentrations of yttria were used to identify its effect on the properties of the samples. It is shown that the utilized ultra-rapid consolidation process in combination with high transmitted energy allows obtaining high density compacts, retaining the initial structure with minimal grain growth. The experimental results indicate some heterogeneity of the structure which may occur in the external layers of the tested samples due to various thermal and electromagnetic in-processing effects. The choice of the optimal parameters of the consolidation enables obtaining samples of acceptable quality.

  17. Comparative Study of Modulation-Based Individual Inverter Techniques for Direct and Inverse by using Star-Connection Induction Motor in Extra Low Voltage Application

    Directory of Open Access Journals (Sweden)

    Ardhia Wishnuprakasa

    2016-12-01

    Full Text Available In this study, the IEEE 519 Standard as a basis benchmarking for voltage (THDV and current (THDI in draft performance. Comparative Study based onthree-techniques of 2-Level Converter (2LC by using a Star-Connection Induction Motor (Y-CIM in ExtraLow Voltage (ELV Configuration.For the detail explanation, a primary inverter as Direct-Inverterby PWMdirect (PWM degreesand asecondary inverter as Inverse-Inverterby PWMinverse(PWM + PI degrees. It tends a modified algorithm,for eachof SPWM in six rules, and FHIPWM in 5th harmonics Injectedin standard modulation as the purpose for the Open-Ends of Pre-Dual Inverter in Decoupled SPWM for twelve rules, and Decoupled FHIPWM in combination of 5th harmonics Injectedin combination of two-standard-modulation. Those techniques are the purpose of two-inverter combination, which namelythe Equal Direct-Inverse (EDI algorithmproduct of prototyping in similarities. The observation is restricted in voltage scope between Simulation by using Power Simulator (PSIMand Application by using Microcontroller ARM STM32F4 Discovery.

  18. Using text-mining techniques in electronic patient records to identify ADRs from medicine use.

    Science.gov (United States)

    Warrer, Pernille; Hansen, Ebba Holme; Juhl-Jensen, Lars; Aagaard, Lise

    2012-05-01

    This literature review included studies that use text-mining techniques in narrative documents stored in electronic patient records (EPRs) to investigate ADRs. We searched PubMed, Embase, Web of Science and International Pharmaceutical Abstracts without restrictions from origin until July 2011. We included empirically based studies on text mining of electronic patient records (EPRs) that focused on detecting ADRs, excluding those that investigated adverse events not related to medicine use. We extracted information on study populations, EPR data sources, frequencies and types of the identified ADRs, medicines associated with ADRs, text-mining algorithms used and their performance. Seven studies, all from the United States, were eligible for inclusion in the review. Studies were published from 2001, the majority between 2009 and 2010. Text-mining techniques varied over time from simple free text searching of outpatient visit notes and inpatient discharge summaries to more advanced techniques involving natural language processing (NLP) of inpatient discharge summaries. Performance appeared to increase with the use of NLP, although many ADRs were still missed. Due to differences in study design and populations, various types of ADRs were identified and thus we could not make comparisons across studies. The review underscores the feasibility and potential of text mining to investigate narrative documents in EPRs for ADRs. However, more empirical studies are needed to evaluate whether text mining of EPRs can be used systematically to collect new information about ADRs. © 2011 The Authors. British Journal of Clinical Pharmacology © 2011 The British Pharmacological Society.

  19. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  20. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  1. A Novel Technique for Fetal ECG Extraction Using Single-Channel Abdominal Recording

    Directory of Open Access Journals (Sweden)

    Nannan Zhang

    2017-02-01

    Full Text Available Non-invasive fetal electrocardiograms (FECGs are an alternative method to standard means of fetal monitoring which permit long-term continual monitoring. However, in abdominal recording, the FECG amplitude is weak in the temporal domain and overlaps with the maternal electrocardiogram (MECG in the spectral domain. Research in the area of non-invasive separations of FECG from abdominal electrocardiograms (AECGs is in its infancy and several studies are currently focusing on this area. An adaptive noise canceller (ANC is commonly used for cancelling interference in cases where the reference signal only correlates with an interference signal, and not with a signal of interest. However, results from some existing studies suggest that propagation of electrocardiogram (ECG signals from the maternal heart to the abdomen is nonlinear, hence the adaptive filter approach may fail if the thoracic and abdominal MECG lack strict waveform similarity. In this study, singular value decomposition (SVD and smooth window (SW techniques are combined to build a reference signal in an ANC. This is to avoid the limitation that thoracic MECGs recorded separately must be similar to abdominal MECGs in waveform. Validation of the proposed method with r01 and r07 signals from a public dataset, and a self-recorded private dataset showed that the proposed method achieved F1 scores of 99.61%, 99.28% and 98.58%, respectively for the detection of fetal QRS. Compared with four other single-channel methods, the proposed method also achieved higher accuracy values of 99.22%, 98.57% and 97.21%, respectively. The findings from this study suggest that the proposed method could potentially aid accurate extraction of FECG from MECG recordings in both clinical and commercial applications.

  2. Evaluation results on the effectiveness of the corrosion protection system for underground pipelines, using the DC-voltage gradient technique

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Antonio Carlos [Petroquimica Uniao S.A., Santo Andre, SP (Brazil)

    2003-07-01

    A pipeline of diameter 6'' with 17.694 km of extension was evaluated how much to the integrity of its external covering and the effectiveness of the system of cathodic protection, using the method DC-Voltage Gradient. The Cathodic Protection in this pipeline is made by seven rectifiers. The gotten data indicate that the potential pipe-ground registered in some check points to the long one of the pipeline is extremely negative, what has led to a super protection of the pipeline for the CP. This if explains for the great proximity between the anodes and the pipeline. For km had been identified 917 failures with a mean density of 50,1 per Km. Beyond the analysis of the data, this work includes conclusions and recommendations detailed for the repairs of the covering of the pipeline and for improvement of the effectiveness of the CP. One sends regards to a combination of repairs in the covering and reevaluation of the CP, in way to improve the protection level and to assure the reduction of the risk of external corrosion. (author)

  3. Evaluation results on the effectiveness of the corrosion protection system for underground pipelines, using the DC-voltage gradient technique

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Antonio Carlos [Petroquimica Uniao S.A., Santo Andre, SP (Brazil)

    2003-07-01

    A pipeline of diameter 6'' with 17.694 km of extension was evaluated how much to the integrity of its external covering and the effectiveness of the system of cathodic protection, using the method DC-Voltage Gradient. The Cathodic Protection in this pipeline is made by seven rectifiers. The gotten data indicate that the potential pipe-ground registered in some check points to the long one of the pipeline is extremely negative, what has led to a super protection of the pipeline for the CP. This if explains for the great proximity between the anodes and the pipeline. For km had been identified 917 failures with a mean density of 50,1 per Km. Beyond the analysis of the data, this work includes conclusions and recommendations detailed for the repairs of the covering of the pipeline and for improvement of the effectiveness of the CP. One sends regards to a combination of repairs in the covering and reevaluation of the CP, in way to improve the protection level and to assure the reduction of the risk of external corrosion. (author)

  4. Signal averaging technique for noninvasive recording of late potentials in patients with coronary artery disease

    Science.gov (United States)

    Abboud, S.; Blatt, C. M.; Lown, B.; Graboys, T. B.; Sadeh, D.; Cohen, R. J.

    1987-01-01

    An advanced non invasive signal averaging technique was used to detect late potentials in two groups of patients: Group A (24 patients) with coronary artery disease (CAD) and without sustained ventricular tachycardia (VT) and Group B (8 patients) with CAD and sustained VT. Recorded analog data were digitized and aligned using a cross correlation function with fast Fourier transform schema, averaged and band pass filtered between 60 and 200 Hz with a non-recursive digital filter. Averaged filtered waveforms were analyzed by computer program for 3 parameters: (1) filtered QRS (fQRS) duration (2) interval between the peak of the R wave peak and the end of fQRS (R-LP) (3) RMS value of last 40 msec of fQRS (RMS). Significant change was found between Groups A and B in fQRS (101 -/+ 13 msec vs 123 -/+ 15 msec; p < .0005) and in R-LP vs 52 -/+ 11 msec vs 71-/+18 msec, p <.002). We conclude that (1) the use of a cross correlation triggering method and non-recursive digital filter enables a reliable recording of late potentials from the body surface; (2) fQRS and R-LP durations are sensitive indicators of CAD patients susceptible to VT.

  5. Experimental Technique for Producing and Recording Precise Particle Impacts on Transparent Window Materials

    Science.gov (United States)

    Gray, Perry; Guven, Ibrahim

    2016-01-01

    A new facility for making small particle impacts is being developed at NASA. Current sand/particle impact facilities are an erosion test and do not precisely measure and document the size and velocity of each of the impacting particles. In addition, evidence of individual impacts is often obscured by subsequent impacts. This facility will allow the number, size, and velocity of each particle to be measured and adjusted. It will also be possible to determine which particle produced damage at a given location on the target. The particle size and velocity will be measured by high speed imaging techniques. Information as to the extent of damage and debris from impacts will also be recorded. It will be possible to track these secondary particles, measuring size and velocity. It is anticipated that this additional degree of detail will provide input for erosion models and also help determine the impact physics of the erosion process. Particle impacts will be recorded at 90 degrees to the particle flight path and also from the top looking through the target window material.

  6. The study of insect blood-feeding behaviour: 2. Recording techniques and the use of flow charts

    Directory of Open Access Journals (Sweden)

    J. J. B. Smith

    1987-01-01

    Full Text Available This paper continues a discussion of approaches and methodologies we have used in our studies of feeding in haematophagous insects. Described are techniques for directly monitoring behaviour: electrical recording of feeding behaviour via resistance changes in the food canal, optical methods for monitoring mouthpart activity, and a computer technique for behavioural event recording. Also described is the use of "flow charts" or "decision diagrams" to model interrelated sequences of behaviours.

  7. A technique to stabilize record bases for Gothic arch tracings in patients with implant-retained complete dentures.

    Science.gov (United States)

    Raigrodski, A J; Sadan, A; Carruth, P L

    1998-12-01

    Clinicians have long expressed concern about the accuracy of the Gothic arch tracing for recording centric relation in edentulous patients. With the use of dental implants to assist in retaining complete dentures, the problem of inaccurate recordings, made for patients without natural teeth, can be significantly reduced. This article presents a technique that uses healing abutments to stabilize the record bases so that an accurate Gothic arch tracing can be made.

  8. Low concentration contrast medium for dual-source computed tomography coronary angiography by a combination of iterative reconstruction and low-tube-voltage technique: Feasibility study

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Minwen, E-mail: zhengmw2007@163.com; Liu, Ying, E-mail: yingyinglyly@126.com; Wei, Mengqi, E-mail: weimengqi2008@163.com; Wu, Yongjie, E-mail: wu18291988526@163.com; Zhao, Hongliang, E-mail: zhaohl1980@163.com; Li, Jian, E-mail: xjyylj@yeah.net

    2014-02-15

    Objectives: To assess the impact of low-concentration contrast medium on vascular enhancement, image quality and radiation dose of coronary CT angiography (cCTA) by using a combination of iterative reconstruction (IR) and low-tube-voltage technique. Materials and methods: One hundred patients were prospectively randomized to two types of contrast medium and underwent prospective electrocardiogram-triggering cCTA (Definition Flash, Siemens Healthcare; collimation: 128 mm × 0.6 mm; tube current: 300 mA s). Fifty patients received Iopromide 370 were scanned using the conventional tube setting (100 kVp or 120 kVp if BMI ≥ 25 kg/m{sup 2}) and reconstructed with filtered back projection (FBP). Fifty patients received Iodixanol 270 were scanned using the low-tube-voltage (80 kVp or 100 kVp if BMI ≥ 25 kg/m{sup 2}) technique and reconstructed with IR. CT attenuation was measured in coronary artery and other anatomical regions. Noise, image quality and radiation dose were compared. Results: Compared with two Iopromide 370 subgroups, Iomeprol 270 subgroups showed no significant difference in CT attenuation (576.63 ± 95.50 vs. 569.51 ± 118.93 for BMI < 25 kg/m{sup 2}, p = 0.647 and 394.19 ± 68.09 vs. 383.72 ± 63.11 for BMI ≥ 25 kg/m{sup 2}, p = 0.212), noise (in various anatomical regions of interest) and image quality (3.5 vs. 4.0, p = 0.13), but significantly (0.41 ± 0.17 vs. 0.94 ± 0.45 for BMI < 25 kg/m{sup 2}, p < 0.001 and 1.14 ± 0.24 vs. 2.37 ± 0.69 for BMI ≥ 25 kg/m{sup 2}, p < 0.001) lower radiation dose, which reflects dose saving of 56.4% and 51.9%, respectively. Conclusions: Combined IR with low-tube-voltage technique, a low-concentration contrast medium of 270 mg I/ml can still maintain the contrast enhancement without impairing image quality, as well as significantly lower the radiation dose.

  9. Low-voltage electrically-enhanced microextraction as a novel technique for simultaneous extraction of acidic and basic drugs from biological fluids.

    Science.gov (United States)

    Seidi, Shahram; Yamini, Yadollah; Rezazadeh, Maryam; Esrafili, Ali

    2012-06-22

    In the present work, for the first time a new set-up was presented for simultaneous extraction of acidic and basic drugs using a recent novel electrically-enhanced microextraction technique, termed electromembrane extraction at low voltages followed by high performance liquid chromatography with ultraviolet detection. Nalmefene (NAL) as a basic drug and diclofenac (DIC) as an acidic drug were extracted from 24 mL aqueous sample solutions at neutral pH into 10 μL of each acidified (HCl 50 mM) and basic (NaOH 50 mM) acceptor solution, respectively. Supported liquid membranes including 2-nitrophenyl octyl ether containing 5% di-(2-ethylhexyl) phosphate and 1-octanol were used to ensure efficient extraction of NAL and DIC, respectively. Low voltage of 40 V was applied over the SLMs during 14 min extraction time. The influences of fundamental parameters affecting the transport of target drugs were optimized using experimental design. Under optimal conditions, NAL and DIC were extracted with extraction recoveries of 12.5 and 14.6, respectively, which corresponded to preconcentration factors of 300 and 350, respectively. The proposed technique provided good linearity with correlation coefficient values higher than 0.9956 over a concentration range of 8-500 μg L⁻¹ and 12-500 μg L⁻¹ for NAL and DIC, respectively. Limits of detection and quantifications, and intra-day precisions (n=3) were less than 4 μg L⁻¹, 12 μg L⁻¹, and 10.1%, respectively. Extraction and determination of NAL and DIC in human urine samples were successfully performed. In light of the data obtained in the present work, this new set-up for EME with low voltages has a future potential as a simple, selective, and fast sample preparation technique for simultaneous extraction and determination of acidic and basic drugs in different complicated matrices. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  11. New Technique for Voltage Tracking Control of a Boost Converter Based on the PSO Algorithm and LTspice

    DEFF Research Database (Denmark)

    Farhang, Peyman; Drimus, Alin; Mátéfi-Tempfli, Stefan

    2015-01-01

    In this paper, a new technique is proposed to design a Modified PID (MPID) controller for a Boost converter. An interface between LTspice and MATLAB is carried out to implement the Particle Swarm Optimization (PSO) algorithm. The PSO algorithm which has the appropriate capability to find out...... the optimal solutions is run in MATLAB while it is interfaced with LTspice for simulation of the circuit using actual component models obtained from manufacturers. The PSO is utilized to solve the optimization problem in order to find the optimal parameters of MPID and PID controllers. The performances...

  12. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  13. Voltage stability evaluation facing small disturbances by means of the modal analysis technique; Evaluacion de la estabilidad de voltaje ante disturbios pequenos mediante la tecnica de analisis modal

    Energy Technology Data Exchange (ETDEWEB)

    Leon Rodriguez, Daniel

    2000-12-15

    The economic development of the countries has taken implicit a growing industrialization the one which, joined to those every time bigger resident's necessities, it has caused a constant and progressive increment in the electric power demand. However, in the last years the growth of the electric network of these systems has been more and more limited for diverse such factors as the ecology and the economy, as well as for the social and political costs that implies each new construction in the system. With the presence of these restrictions the electric systems in many cases, have been forced to satisfy the increments in the demand making a more exhaustive use of the infrastructure that they have available and the incorporation of only a few new system elements or constructions. These aspects have caused such systems to operate with more limited security margins and that their stability has to be analyzed in a reliable and precise way. Taking into account the previously mentioned aspects, as the electric systems have had the necessity of operating under forced conditions to satisfy the load demand, voltage stability problems have been presented with more frequency causing serious disturbances and in some cases, total blackouts. With these problems, the voltage stability analysis has taken bigger importance in the studies that the electric utilities carry out. This issue has caused that bigger resources are dedicated for the investigation of this phenomenon with the purpose of understanding and developing tools that allow studying it in a more complete and more truthful way. Modal analysis is one of the most recent and popular steady techniques the one that, from its appearance has had a great peak due to the valuable and quick information that provides, besides its implementation easiness and the little effort computational that it requires. In this work is carried out the voltage stability evaluation of a real electric system applying in a combined way the

  14. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  15. Validation of an Improved Computer-Assisted Technique for Mining Free-Text Electronic Medical Records.

    Science.gov (United States)

    Duz, Marco; Marshall, John F; Parkin, Tim

    2017-06-29

    The use of electronic medical records (EMRs) offers opportunity for clinical epidemiological research. With large EMR databases, automated analysis processes are necessary but require thorough validation before they can be routinely used. The aim of this study was to validate a computer-assisted technique using commercially available content analysis software (SimStat-WordStat v.6 (SS/WS), Provalis Research) for mining free-text EMRs. The dataset used for the validation process included life-long EMRs from 335 patients (17,563 rows of data), selected at random from a larger dataset (141,543 patients, ~2.6 million rows of data) and obtained from 10 equine veterinary practices in the United Kingdom. The ability of the computer-assisted technique to detect rows of data (cases) of colic, renal failure, right dorsal colitis, and non-steroidal anti-inflammatory drug (NSAID) use in the population was compared with manual classification. The first step of the computer-assisted analysis process was the definition of inclusion dictionaries to identify cases, including terms identifying a condition of interest. Words in inclusion dictionaries were selected from the list of all words in the dataset obtained in SS/WS. The second step consisted of defining an exclusion dictionary, including combinations of words to remove cases erroneously classified by the inclusion dictionary alone. The third step was the definition of a reinclusion dictionary to reinclude cases that had been erroneously classified by the exclusion dictionary. Finally, cases obtained by the exclusion dictionary were removed from cases obtained by the inclusion dictionary, and cases from the reinclusion dictionary were subsequently reincluded using Rv3.0.2 (R Foundation for Statistical Computing, Vienna, Austria). Manual analysis was performed as a separate process by a single experienced clinician reading through the dataset once and classifying each row of data based on the interpretation of the free

  16. Behaviour of total surface charge in SiO2-Si system under short-pulsed ultraviolet irradiation cycles characterised by surface photo voltage technique

    International Nuclear Information System (INIS)

    Kang, Ban-Hong; Lee, Wah-Pheng; Yow, Ho-Kwang; Tou, Teck-Yong

    2009-01-01

    Effects of time-accumulated ultraviolet (UV) irradiation and surface treatment on thermally oxidized p-type silicon wafers were investigated by using the surface photo voltage (SPV) technique via the direct measurement of the total surface charge, Q SC . The rise and fall times of Q sc curves, as a function of accumulated UV irradiation, depended on the thermal oxide thickness. A simple model was proposed to explain the time-varying characteristics of Q sc based on the UV-induced bond breaking of SiOH and SiH, and photoemission of bulk electrons to wafer surface where O 2 - charges were formed. While these mechanisms resulted in charge variations and hence in Q sc , these could be removed by rinsing the silicon wafers in de-ionized water followed by spin-dry or blow-dry by an ionizer fan. Empirical parameters were used in the model simulations and curve-fitting of Q SC . The simulated results suggested that initial changes in the characteristic behaviour of Q sc were mainly due to the net changes in the positive and negative charges, but subsequently were dominated by the accumulation of O 2 - during the UV irradiation.

  17. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  18. DOCUMENTING FOR POSTERITY: ADVOCATING THE USE OF ADVANCED RECORDING TECHNIQUES FOR DOCUMENTATION IN THE FIELD OF BUILDING ARCHAEOLOGY

    Directory of Open Access Journals (Sweden)

    P. J. De Vos

    2017-08-01

    Full Text Available Since the new millennium, living in historic cities has become extremely popular in the Netherlands. As a consequence, historic environments are being adapted to meet modern living standards. Houses are constantly subjected to development, restoration and renovation. Although most projects are carried out with great care and strive to preserve and respect as much historic material as possible, nevertheless a significant amount of historical fabric disappears. This puts enormous pressure on building archaeologists that struggle to rapidly and accurately capture in situ authentic material and historical evidence in the midst of construction works. In Leiden, a medieval city that flourished during the seventeenth century and that today counts over 3,000 listed monuments, a solution to the problem has been found with the implementation of advanced recording techniques. Since 2014, building archaeologists of the city council have experienced first-hand that new recording techniques, such as laser scanning and photogrammetry, have dramatically decreased time spent on site with documentation. Time they now use to uncover, analyse and interpret the recovered historical data. Nevertheless, within building archaeology education, a strong case is made for hand drawing as a method for understanding a building, emphasising the importance of close observation and physical contact with the subject. In this paper, the use of advanced recording techniques in building archaeology is being advocated, confronting traditional educational theory with practise, and research tradition with the rapid rise of new recording technologies.

  19. Documenting for Posterity: Advocating the Use of Advanced Recording Techniques for Documentation in the Field of Building Archaeology

    Science.gov (United States)

    De Vos, P. J.

    2017-08-01

    Since the new millennium, living in historic cities has become extremely popular in the Netherlands. As a consequence, historic environments are being adapted to meet modern living standards. Houses are constantly subjected to development, restoration and renovation. Although most projects are carried out with great care and strive to preserve and respect as much historic material as possible, nevertheless a significant amount of historical fabric disappears. This puts enormous pressure on building archaeologists that struggle to rapidly and accurately capture in situ authentic material and historical evidence in the midst of construction works. In Leiden, a medieval city that flourished during the seventeenth century and that today counts over 3,000 listed monuments, a solution to the problem has been found with the implementation of advanced recording techniques. Since 2014, building archaeologists of the city council have experienced first-hand that new recording techniques, such as laser scanning and photogrammetry, have dramatically decreased time spent on site with documentation. Time they now use to uncover, analyse and interpret the recovered historical data. Nevertheless, within building archaeology education, a strong case is made for hand drawing as a method for understanding a building, emphasising the importance of close observation and physical contact with the subject. In this paper, the use of advanced recording techniques in building archaeology is being advocated, confronting traditional educational theory with practise, and research tradition with the rapid rise of new recording technologies.

  20. Urethral pressure reflectometry; a novel technique for simultaneous recording of pressure and cross-sectional area

    DEFF Research Database (Denmark)

    Aagaard, Mikael; Klarskov, Niels; Sønksen, Jens

    2012-01-01

    Study Type - Diagnostic (case series) Level of Evidence 4 What's known on the subject? and What does the study add? In the 1980s and 1990s, a method for direct measurement of pressure and cross-sectional area in women and men was developed. It was successful in terms of obtaining meaningful results...... reproducible than conventional urethral pressure profilometry, when measuring incontinence in women. In 2010 it was also introduced as a new measuring technique in the anal canal. This study, adds a new and interesting technique to the field of male urodynamics. For the first time, sound waves have been used...... in several studies. But the technique, which was based on the field gradient principle, was never implemented in the clinical setting because of technical limitations. In 2005, urethral pressure reflectometry was introduced as a new technique in female urodynamics. The technique has been shown to be more...

  1. Data Matching Concepts and Techniques for Record Linkage, Entity Resolution, and Duplicate Detection

    CERN Document Server

    Christen, Peter

    2012-01-01

    Data matching (also known as record or data linkage, entity resolution, object identification, or field matching) is the task of identifying, matching and merging records that correspond to the same entities from several databases or even within one database. Based on research in various domains including applied statistics, health informatics, data mining, machine learning, artificial intelligence, database management, and digital libraries, significant advances have been achieved over the last decade in all aspects of the data matching process, especially on how to improve the accuracy of da

  2. Interferenceless coded aperture correlation holography-a new technique for recording incoherent digital holograms without two-wave interference.

    Science.gov (United States)

    Vijayakumar, A; Rosen, Joseph

    2017-06-12

    Recording digital holograms without wave interference simplifies the optical systems, increases their power efficiency and avoids complicated aligning procedures. We propose and demonstrate a new technique of digital hologram acquisition without two-wave interference. Incoherent light emitted from an object propagates through a random-like coded phase mask and recorded directly without interference by a digital camera. In the training stage of the system, a point spread hologram (PSH) is first recorded by modulating the light diffracted from a point object by the coded phase masks. At least two different masks should be used to record two different intensity distributions at all possible axial locations. The various recorded patterns at every axial location are superposed in the computer to obtain a complex valued PSH library cataloged to its axial location. Following the training stage, an object is placed within the axial boundaries of the PSH library and the light diffracted from the object is once again modulated by the same phase masks. The intensity patterns are recorded and superposed exactly as the PSH to yield a complex hologram of the object. The object information at any particular plane is reconstructed by a cross-correlation between the complex valued hologram and the appropriate element of the PSH library. The characteristics and the performance of the proposed system were compared with an equivalent regular imaging system.

  3. Statistical evaluation of recorded knowledge in nuclear and other instrumental analytical techniques

    International Nuclear Information System (INIS)

    Braun, T.

    1987-01-01

    The main points addressed in this study are the following: Statistical distribution patterns of published literature on instrumental analytical techniques 1981-1984; structure of scientific literature and heuristics for identifying active specialities and emerging hot spot research areas in instrumental analytical techniques; growth and growth rates of the literature in some of the identified hot research areas; quality and quantity in instrumental analytical research output. (orig.)

  4. Measuring a Pig's Preference for Suspended Toys by Using an Automated Recording Technique

    NARCIS (Netherlands)

    Zonderland, J.J.; Vermeer, H.M.; Vereijken, P.F.G.; Spoolder, H.A.M.

    2003-01-01

    Not all suspended materials for finishing pigs are equally suited to meet the natural behavior of the animal, but the required physical properties of the toys have yet to be identified. The present study aimed to develop a labor saving electronic recording device for animal-material interactions.

  5. Scanning laser techniques for dynamic thermo-magnetic recording onto stationary media

    Energy Technology Data Exchange (ETDEWEB)

    Clegg, Warwick; Jenkins, David; Helian, Na; Windmill, James; Windmill, Robert; Atkinson, Ron; Hendren, Bill; Wright, C. David

    2002-09-01

    Scanning laser microscopes (SLMs) have been used to characterise the magnetic properties of materials for some time (J. Magn. Magn. Mater. 95(1) (1991); IEEE Trans. Magn. 31(6 Pt. 1) (1995)). An SLM has been designed to facilitate a number of operating modes: both for writing and reading magneto-optical data. The current SLM is capable of thermo-magnetically recording bits onto magneto-optical thin films. Unlike previous SLMs, the current instrument has been designed to write bits both statically and dynamically onto stationary media. It will be used to write to magneto-optic (MO) disk material thermo-magnetically prior to imaging. Images may be derived from the longitudinal and polar magneto-optic Kerr effects, which are wavelength dependent, using the appropriate laser wavelength. In this paper the two configurations for dynamic recording are described.

  6. Scanning laser techniques for dynamic thermo-magnetic recording onto stationary media

    International Nuclear Information System (INIS)

    Clegg, Warwick; Jenkins, David; Helian, Na; Windmill, James; Windmill, Robert; Atkinson, Ron; Hendren, Bill; Wright, C. David

    2002-01-01

    Scanning laser microscopes (SLMs) have been used to characterise the magnetic properties of materials for some time (J. Magn. Magn. Mater. 95(1) (1991); IEEE Trans. Magn. 31(6 Pt. 1) (1995)). An SLM has been designed to facilitate a number of operating modes: both for writing and reading magneto-optical data. The current SLM is capable of thermo-magnetically recording bits onto magneto-optical thin films. Unlike previous SLMs, the current instrument has been designed to write bits both statically and dynamically onto stationary media. It will be used to write to magneto-optic (MO) disk material thermo-magnetically prior to imaging. Images may be derived from the longitudinal and polar magneto-optic Kerr effects, which are wavelength dependent, using the appropriate laser wavelength. In this paper the two configurations for dynamic recording are described

  7. Object-orientated DBMS techniques for time-oriented medical record.

    Science.gov (United States)

    Pinciroli, F; Combi, C; Pozzi, G

    1992-01-01

    In implementing time-orientated medical record (TOMR) management systems, use of a relational model played a big role. Many applications have been developed to extend query and data manipulation languages to temporal aspects of information. Our experience in developing TOMR revealed some deficiencies inside the relational model, such as: (a) abstract data type definition; (b) unified view of data, at a programming level; (c) management of temporal data; (d) management of signals and images. We identified some first topics to face by an object-orientated approach to database design. This paper describes the first steps in designing and implementing a TOMR by an object-orientated DBMS.

  8. The use of an improved technique to reduce the variability of output voltage in real-time Fibre Bragg Grating based monitoring system

    Science.gov (United States)

    Vorathin, E.; Hafizi, Z. M.; Che Ghani, S. A.; Lim, K. S.; Aizzuddin, A. M.

    2017-10-01

    Fibre Bragg Grating (FBG) sensors have been widely utilized in the structural health monitoring (SHM) of structures. However, one of the main challenges of FBGs is the existence of inconsistency in output voltage during wavelength intensity demodulation utilizing photodetector (PD) to convert the light signal into digital voltage readings. Thus, the designation of this experimental work is to develop a robust FBG real-time monitoring system with the benefit of MATLAB graphical user interface (GUI) and voltage normalization algorithm to scale down the voltage inconsistency. Low-cost edge filter interrogation system has been practiced in the experimentation and splitter optical component is make use to reduce the intensity of the high power light source that leads to the formation of noise due to unwanted reflected wavelengths. The results revealed that with the advancement of the proposed monitoring system, the sensitivity of the FBG has been increased from 2.4 mV/N to 3.8 mV/N across the range of 50 N. The redundancy in output voltage variation data points has been reduced from 26 data/minute to 17 data/minute. The accuracy of the FBG in detecting the load induced falls in the acceptable range of total average error which is 1.38 %.

  9. Single-intensity-recording optical encryption technique based on phase retrieval algorithm and QR code

    Science.gov (United States)

    Wang, Zhi-peng; Zhang, Shuai; Liu, Hong-zhao; Qin, Yi

    2014-12-01

    Based on phase retrieval algorithm and QR code, a new optical encryption technology that only needs to record one intensity distribution is proposed. In this encryption process, firstly, the QR code is generated from the information to be encrypted; and then the generated QR code is placed in the input plane of 4-f system to have a double random phase encryption. For only one intensity distribution in the output plane is recorded as the ciphertext, the encryption process is greatly simplified. In the decryption process, the corresponding QR code is retrieved using phase retrieval algorithm. A priori information about QR code is used as support constraint in the input plane, which helps solve the stagnation problem. The original information can be recovered without distortion by scanning the QR code. The encryption process can be implemented either optically or digitally, and the decryption process uses digital method. In addition, the security of the proposed optical encryption technology is analyzed. Theoretical analysis and computer simulations show that this optical encryption system is invulnerable to various attacks, and suitable for harsh transmission conditions.

  10. Yeast and mammalian metabolism continuous monitoring by using pressure recording as an assessment technique for xenobiotic agent effects

    Science.gov (United States)

    Milani, Marziale; Ballerini, Monica; Ferraro, Lorenzo; Marelli, E.; Mazza, Francesca; Zabeo, Matteo

    2002-06-01

    Our work is devoted to the study of Saccharomyces cerevisiae and human lymphocytes cellular metabolism in order to develop a reference model to assess biological systems responses to chemical or physical agents exposure. CO2 variations inside test-tubes are measured by differential pressure sensors; pressure values are subsequently converted in voltage. The system allows to test up to 16 samples at the same time. Sampling manages up to 100 acquisitions per second. Values are recorded by a data acquisition card connected to a computer. This procedure leads to a standard curve (pressure variation versus time), typical of the cellular line, that describe cellular metabolism. The longest time lapse used is of 170 h. Different phases appear in this curve: an initial growth up to a maximum, followed by a decrement that leads to a typical depression (pressure value inside the test-tubes is lower than the initial one) after about 35 h from the beginning of yeast cells. The curve is reproducible within an experimental error of 4%. The analysis of many samples and the low cost of the devices allow a good statistical significance of the data. In particular as a test we will compare two sterilizing agents effects: UV radiation and amuchina.

  11. The use of holographic techniques for recording high-speed events

    International Nuclear Information System (INIS)

    Stepanov, B.M.; Filenko, Yu.I.

    The metods resulting from studies carried out using the commercial holographic device UIG-I are described. The device is intended for recording and investigating moving scenes and high-speed events by a holographic method. It consists of a quantum generator with a two-stage amplifier whose radiation energy in a single-mode operation is 0.7 J, and pulse width for passive Q-switching is 40nsec. Hologram portrait making was one of the experiments which illustrate the possible applications of the device. Hologram portraits such as group portraits and those that can be reconstructed in white light, were obtained on Micrat BP-2 and Agfa Gevaert plates

  12. A comparative study of surface waves inversion techniques at strong motion recording sites in Greece

    Science.gov (United States)

    Panagiotis C. Pelekis,; Savvaidis, Alexandros; Kayen, Robert E.; Vlachakis, Vasileios S.; Athanasopoulos, George A.

    2015-01-01

    Surface wave method was used for the estimation of Vs vs depth profile at 10 strong motion stations in Greece. The dispersion data were obtained by SASW method, utilizing a pair of electromechanical harmonic-wave source (shakers) or a random source (drop weight). In this study, three inversion techniques were used a) a recently proposed Simplified Inversion Method (SIM), b) an inversion technique based on a neighborhood algorithm (NA) which allows the incorporation of a priori information regarding the subsurface structure parameters, and c) Occam's inversion algorithm. For each site constant value of Poisson's ratio was assumed (ν=0.4) since the objective of the current study is the comparison of the three inversion schemes regardless the uncertainties resulting due to the lack of geotechnical data. A penalty function was introduced to quantify the deviations of the derived Vs profiles. The Vs models are compared as of Vs(z), Vs30 and EC8 soil category, in order to show the insignificance of the existing variations. The comparison results showed that the average variation of SIM profiles is 9% and 4.9% comparing with NA and Occam's profiles respectively whilst the average difference of Vs30 values obtained from SIM is 7.4% and 5.0% compared with NA and Occam's.

  13. Evaluation of the reproducibility of two techniques used to determine and record centric relation in angle's class I patients

    Directory of Open Access Journals (Sweden)

    Fernanda Paixão

    2007-08-01

    Full Text Available The centric relation is a mandibular position that determines a balance relation among the temporomandibular joints, the chew muscles and the occlusion. This position makes possible to the dentist to plan and to execute oral rehabilitation respecting the physiological principles of the stomatognathic system. The aim of this study was to investigate the reproducibility of centric relation records obtained using two techniques: Dawson's Bilateral Manipulation and Gysi's Gothic Arch Tracing. Twenty volunteers (14 females and 6 males with no dental loss, presenting occlusal contacts according to those described in Angle's I classification and without signs and symptoms of temporomandibular disorders were selected. All volunteers were submitted five times with a 1-week interval, always in the same schedule, to the Dawson's Bilateral Manipulation and to the Gysi's Gothic Arch Tracing with aid of an intraoral apparatus. The average standard error of each technique was calculated (Bilateral Manipulation 0.94 and Gothic Arch Tracing 0.27. Shapiro-Wilk test was applied and the results allowed application of Student's t-test (sampling error of 5%. The techniques showed different degrees of variability. The Gysi's Gothic Arch Tracing was found to be more accurate than the Bilateral Manipulation in reproducing the centric relation records.

  14. An easy-to-use semiquantitative food record validated for energy intake by using doubly labelled water technique.

    Science.gov (United States)

    Koebnick, C; Wagner, K; Thielecke, F; Dieter, G; Höhne, A; Franke, A; Garcia, A L; Meyer, H; Hoffmann, I; Leitzmann, P; Trippo, U; Zunft, H J F

    2005-09-01

    Estimating dietary intake is important for both epidemiological and clinical studies, but often lacks accuracy. To investigate the accuracy and validity of energy intake estimated by an easy-to-use semiquantitative food record (EI(SQFR)) compared to total energy expenditure (TEE) estimated by doubly labelled water technique (EE(DLW)). TEE was measured in 29 nonobese subjects using the doubly labelled water method over a period of 14 days. Within this period, subjects reported their food consumption by a newly developed semiquantitative food record for 4 consecutive days. Energy intake was calculated using the German Food Code and Nutrition Data Base BLS II.3. A good correlation was observed between EI(SQFR) and EE(DLW) (r = 0.685, P 20% in nine subjects (31%). In five subjects (17%), an overestimation of EI(SQFR) was observed. The easy-to-use semiquantitative food record provided good estimates of EI in free-living and nonobese adults without prior detailed verbal instructions. The presented food record has limitations regarding accuracy at the individual level.

  15. Determination of the uranium concentration in water samples by the technique of fission track recording

    International Nuclear Information System (INIS)

    Geraldo, L.P.

    1979-01-01

    The technique of fission track register was developed for the determination of micrograms of uranium. The Makrofol KG, a synthetic plastic made by Bayer, was used as the detector and the wet method was utilized. The detector calibration curve allows the determination of the uranium concentration in a sample within an interval from 8.0 to 0.4μgU/L, the total error ranging from 3.3% to 29.0% respectively. The method was used in the determination of the uranium content in various water samples, obtained from various sources like rivers, sea etc. in the state of Sao Paulo, Brazil. Results were compared with those obtained by other authors using different methods. The average concentration found in sea waters (3.27 +- 9.12μgU/l) by this method is compatible with the international average accepted value of 3.3μgU/l, irrespective of site and depth. The determination of the uranium content by fission track counting has proved to be very convenient. (Author) [pt

  16. Comparison of energy expenditure by the doubly labeled water technique with energy intake, heart rate, and activity recording in man

    International Nuclear Information System (INIS)

    Schulz, S.; Westerterp, K.R.; Brueck, K.

    1989-01-01

    Average daily energy expenditure determined by the doubly labeled water technique (dlwEE) was compared in six subjects (aged 20-30 y) over 2 wk under usual living conditions; average food energy intake and energy expenditure estimated from individual diary records of physical activity. In addition, energy expenditure was estimated from 24-h heart rate recordings carried out on two randomly chosen days of the 2-wk period. The group means of the dlwEE were 1.94 +/- 0.24 (means +/- SD) times larger than resting metabolic rate (= 1.94 met) and nearly identical to the average daily energy intake (1.93 +/- 0.23 met). Energy expenditure estimated from the diaries of activity and from the 24-h heart rate recording varied between 1.67 and 2.24 met depending on the calculation procedure. The dlwEE (1.94 +/- 0.24 met) is much higher than that recently determined for sedentary people (1.25 met) and thus explains that young students may achieve body weight balance with a relatively high daily food energy intake

  17. The role of bulk and interface states on performance of a-Si: H p-i-n solar cells using reverse current-voltage technique

    International Nuclear Information System (INIS)

    Mahmood, S A; Kabir, M Z; Murthy, R V R; Dutta, V

    2009-01-01

    The defect state densities in the bulk of the i-layer and at the p/i interface have been studied in hydrogenated amorphous silicon (a-Si : H) solar cells using reverse current-voltage (J-V) measurements. In this work the cells have been soaked with blue and red lights prior to measurements. The voltage-dependent reverse current has been analysed on the basis of thermal generation of the carriers from midgap states in the i-layer and the carrier injection through the p/i interface. Based on the reverse current behaviour, it has been analysed that at lower reverse bias (reverse voltage, V r r ∼ 25 V) the defect states at the p/i interface are contributing to the reverse currents. The applied reverse bias annealing (RBA) treatment on these cells shows more significant annihilation of defect states at the p/i interface as compared with the bulk of the i-layer. An analytical model is developed to explain the observed behaviour. There is good agreement between the theory and the experimental observations. The fitted defect state densities are 9.1 x 10 15 cm -3 and 8 x 10 18 cm -3 in the bulk of the i-layer and near the p/i interface, respectively. These values decrease to 2.5 x 10 15 cm -3 and 6 x 10 17 cm -3 , respectively, in the samples annealed under reverse bias at 2 V.

  18. Beyond the neuropsychology of dreaming: Insights into the neural basis of dreaming with new techniques of sleep recording and analysis.

    Science.gov (United States)

    Cipolli, Carlo; Ferrara, Michele; De Gennaro, Luigi; Plazzi, Giuseppe

    2017-10-01

    Recent advances in electrophysiological [e.g., surface high-density electroencephalographic (hd-EEG) and intracranial recordings], video-polysomnography (video-PSG), transcranial stimulation and neuroimaging techniques allow more in-depth and more accurate investigation of the neural correlates of dreaming in healthy individuals and in patients with brain-damage, neurodegenerative diseases, sleep disorders or parasomnias. Convergent evidence provided by studies using these techniques in healthy subjects has led to a reformulation of several unresolved issues of dream generation and recall [such as the inter- and intra-individual differences in dream recall and the predictivity of specific EEG rhythms, such as theta in rapid eye movement (REM) sleep, for dream recall] within more comprehensive models of human consciousness and its variations across sleep/wake states than the traditional models, which were largely based on the neurophysiology of REM sleep in animals. These studies are casting new light on the neural bases (in particular, the activity of dorsal medial prefrontal cortex regions and hippocampus and amygdala areas) of the inter- and intra-individual differences in dream recall, the temporal location of specific contents or properties (e.g., lucidity) of dream experience and the processing of memories accessed during sleep and incorporated into dream content. Hd-EEG techniques, used on their own or in combination with neuroimaging, appear able to provide further important insights into how the brain generates not only dreaming during sleep but also some dreamlike experiences in waking. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  20. Comparison of infrared spectroscopy techniques: developing an efficient method for high resolution analysis of sediment properties from long records

    Science.gov (United States)

    Hahn, Annette; Rosén, Peter; Kliem, Pierre; Ohlendorf, Christian; Persson, Per; Zolitschka, Bernd; Pasado Science Team

    2010-05-01

    The analysis of sediment samples in visible to mid-infrared spectra is ideal for high-resolution records. It requires only small amounts (0.01-0.1g dry weight) of sample material and facilitates rapid and cost efficient analysis of a wide variety of biogeochemical properties on minerogenic and organic substances (Kellner et al. 1998). One of these techniques, the Diffuse Reflectance Fourier Transform Infrared Spectrometry (DRIFTS), has already been successfully applied to lake sediment from very different settings and has shown to be a promising technique for high resolution analyses of long sedimentary records on glacial-interglacial timescales (Rosén et al. 2009). However, the DRIFTS technique includes a time-consuming step where sediment samples are mixed with KBr. To assess if alternative and more rapid infrared (IR) techniques can be used, four different IR spectroscopy techniques are compared for core catcher sediment samples from Laguna Potrok Aike - an ICDP site located in southernmost South America. Partial least square (PLS) calibration models were developed using the DRIFTS technique. The correlation coefficients (R) for correlations between DRIFTS-inferred and conventionally measured biogeochemical properties show values of 0.80 for biogenic silica (BSi), 0.95 for total organic carbon (TOC), 0.91 for total nitrogen (TN), and 0.92 for total inorganic carbon (TIC). Good statistical performance was also obtained by using the Attenuated Total Reflectance Fourier Transform Infrared Spectroscopy ATR-FTIRS technique which requires less sample preparation. Two devices were used, the full-sized Bruker Equinox 252 and the smaller and less expensive Bruker Alpha. R for ATR-FTIRS-inferred and conventionally measured biogeochemical properties were 0.87 (BSi), 0.93 (TOC), 0.90 (TN), and 0.91 (TIC) for the Alpha, and 0.78 (TOC), 0.85 (TN), 0.79 (TIC) for the Equinox 252 device. As the penetration depth of the IR beam is frequency dependent, a firm surface contact of

  1. Urethrotonography - a radiological and manometrical combination technique to diagnose urinary stress incontinance in comparison with urethral pressure profile recording

    International Nuclear Information System (INIS)

    Wess, H.

    1982-01-01

    The study described here was carried out in order to gain more insight into the pathogenesis of urinary stress incontinance and the related urethrovesical functions. The pathophysiological changes in the urogenital tract that are associated with urinary stress incontinance are described just as well as the clinical symptoms and signs differentiating the individual forms of incontinance from each other. Account is further taken of the various manometrical and radiological techniques used in the diagnosis of urinary stress incontinance. In this study, which included a total of 100 patients, comparative evaluations were made of the pressure behaviour of the bladder during the filling-up phase and the closing mechanism of the urethra both at rest and under stress using the following procedures: - Method developed by Brown and Wickham for urethral pressure profile recording; visualisation of the bladder and urethra with the aid of X-rays and a balloon catheter especially developed by us. The latter technique may help to solve the problems usually arising when given morphological factors are to be connected with certain medical views or theories concerning the vesical and urethral functions as well as the pathogenesis of urinary stress incontinance. It may thus enable more straightforward diagnosis to be made. (TRV) [de

  2. [Multi-channel in vivo recording techniques: analysis of phase coupling between spikes and rhythmic oscillations of local field potentials].

    Science.gov (United States)

    Wang, Ce-Qun; Chen, Qiang; Zhang, Lu; Xu, Jia-Min; Lin, Long-Nian

    2014-12-25

    The purpose of this article is to introduce the measurements of phase coupling between spikes and rhythmic oscillations of local field potentials (LFPs). Multi-channel in vivo recording techniques allow us to record ensemble neuronal activity and LFPs simultaneously from the same sites in the brain. Neuronal activity is generally characterized by temporal spike sequences, while LFPs contain oscillatory rhythms in different frequency ranges. Phase coupling analysis can reveal the temporal relationships between neuronal firing and LFP rhythms. As the first step, the instantaneous phase of LFP rhythms can be calculated using Hilbert transform, and then for each time-stamped spike occurred during an oscillatory epoch, we marked instantaneous phase of the LFP at that time stamp. Finally, the phase relationships between the neuronal firing and LFP rhythms were determined by examining the distribution of the firing phase. Phase-locked spikes are revealed by the non-random distribution of spike phase. Theta phase precession is a unique phase relationship between neuronal firing and LFPs, which is one of the basic features of hippocampal place cells. Place cells show rhythmic burst firing following theta oscillation within a place field. And phase precession refers to that rhythmic burst firing shifted in a systematic way during traversal of the field, moving progressively forward on each theta cycle. This relation between phase and position can be described by a linear model, and phase precession is commonly quantified with a circular-linear coefficient. Phase coupling analysis helps us to better understand the temporal information coding between neuronal firing and LFPs.

  3. Reconstruction of Cell Surface Densities of Ion Pumps, Exchangers, and Channels from mRNA Expression, Conductance Kinetics, Whole-Cell Calcium, and Current-Clamp Voltage Recordings, with an Application to Human Uterine Smooth Muscle Cells.

    Directory of Open Access Journals (Sweden)

    Jolene Atia

    2016-04-01

    Full Text Available Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the 'conductance repertoire' being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations.

  4. Hiding Electronic Patient Record (EPR) in medical images: A high capacity and computationally efficient technique for e-healthcare applications.

    Science.gov (United States)

    Loan, Nazir A; Parah, Shabir A; Sheikh, Javaid A; Akhoon, Jahangir A; Bhat, Ghulam M

    2017-09-01

    A high capacity and semi-reversible data hiding scheme based on Pixel Repetition Method (PRM) and hybrid edge detection for scalable medical images has been proposed in this paper. PRM has been used to scale up the small sized image (seed image) and hybrid edge detection ensures that no important edge information is missed. The scaled up version of seed image has been divided into 2×2 non overlapping blocks. In each block there is one seed pixel whose status decides the number of bits to be embedded in the remaining three pixels of that block. The Electronic Patient Record (EPR)/data have been embedded by using Least Significant and Intermediate Significant Bit Substitution (ISBS). The RC4 encryption has been used to add an additional security layer for embedded EPR/data. The proposed scheme has been tested for various medical and general images and compared with some state of art techniques in the field. The experimental results reveal that the proposed scheme besides being semi-reversible and computationally efficient is capable of handling high payload and as such can be used effectively for electronic healthcare applications. Copyright © 2017. Published by Elsevier Inc.

  5. Analysis of NSTX TF Joint Voltage Measurements

    International Nuclear Information System (INIS)

    Woolley R

    2005-01-01

    This report presents findings of analyses of recorded current and voltage data associated with 72 electrical joints operating at high current and high mechanical stress. The analysis goal was to characterize the mechanical behavior of each joint and thus evaluate its mechanical supports. The joints are part of the toroidal field (TF) magnet system of the National Spherical Torus Experiment (NSTX) pulsed plasma device operating at the Princeton Plasma Physics Laboratory (PPPL). Since there is not sufficient space near the joints for much traditional mechanical instrumentation, small voltage probes were installed on each joint and their voltage monitoring waveforms have been recorded on sampling digitizers during each NSTX ''shot''

  6. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  7. Benchmark Analysis for Condition Monitoring Test Techniques of Aged Low Voltage Cables in Nuclear Power Plants. Final Results of a Coordinated Research Project

    International Nuclear Information System (INIS)

    2017-10-01

    This publication provides information and guidelines on how to monitor the performance of insulation and jacket materials of existing cables and establish a programme of cable degradation monitoring and ageing management for operating reactors and the next generation of nuclear facilities. This research was done through a coordinated research project (CRP) with participants from 17 Member States. This group of experts compiled the current knowledge in a report together with areas of future research and development to cover aging mechanisms and means to identify and manage the consequences of aging. They established a benchmarking programme using cable samples aged under thermal and/or radiation conditions, and tested before and after ageing by various methods and organizations. In particular, 12 types of cable insulation or jacket material were tested, each using 14 different condition monitoring techniques. Condition monitoring techniques yield usable and traceable results. Techniques such as elongation at break, indenter modulus, oxidation induction time and oxidation induction temperature were found to work reasonably well for degradation trending of all materials. However, other condition monitoring techniques, such as insulation resistance, were only partially successful on some cables and other methods like ultrasonic or Tan δ were either unsuccessful or failed to provide reliable information to qualify the method for degradation trending or ageing assessment of cables. The electrical in situ tests did not show great promise for cable degradation trending or ageing assessment, although these methods are known to be very effective for finding and locating faults in cable insulation material. In particular, electrical methods such as insulation resistance and reflectometry techniques are known to be rather effective for locating insulation damage, hot spots or other faults in essentially all cable types. The advantage of electrical methods is that they can be

  8. A technique for simultaneously improving the product of cutoff frequency-breakdown voltage and thermal stability of SOI SiGe HBT

    Science.gov (United States)

    Fu, Qiang; Zhang, Wan-Rong; Jin, Dong-Yue; Zhao, Yan-Xiao; Wang, Xiao

    2016-12-01

    The product of the cutoff frequency and breakdown voltage (fT×BVCEO) is an important figure of merit (FOM) to characterize overall performance of heterojunction bipolar transistor (HBT). In this paper, an approach to introducing a thin N+-buried layer into N collector region in silicon-on-insulator (SOI) SiGe HBT to simultaneously improve the FOM of fT×BVCEO and thermal stability is presented by using two-dimensional (2D) numerical simulation through SILVACO device simulator. Firstly, in order to show some disadvantages of the introduction of SOI structure, the effects of SOI insulation layer thickness (TBOX) on fT, BVCEO, and the FOM of fT×BVCEO are presented. The introduction of SOI structure remarkably reduces the electron concentration in collector region near SOI substrate insulation layer, obviously reduces fT, slightly increases BVCEO to some extent, but ultimately degrades the FOM of fT×BVCEO. Although the fT, BVCEO, and the FOM of fT×BVCEO can be improved by increasing SOI insulator SiO2 layer thickness TBOX in SOI structure, the device temperature and collector current are increased due to lower thermal conductivity of SiO2 layer, as a result, the self-heating effect of the device is enhanced, and the thermal stability of the device is degraded. Secondly, in order to alleviate the foregoing problem of low electron concentration in collector region near SOI insulation layer and the thermal stability resulting from thick TBOX, a thin N+-buried layer is introduced into collector region to not only improve the FOM of fT×BVCEO, but also weaken the self-heating effect of the device, thus improving the thermal stability of the device. Furthermore, the effect of the location of the thin N+-buried layer in collector region is investigated in detail. The result show that the FOM of fT×BVCEO is improved and the device temperature decreases as the N+-buried layer shifts toward SOI substrate insulation layer. The approach to introducing a thin N+-buried layer

  9. A technique for simultaneously improving the product of cutoff frequency–breakdown voltage and thermal stability of SOI SiGe HBT

    International Nuclear Information System (INIS)

    Fu Qiang; Zhang Wan-Rong; Jin Dong-Yue; Zhao Yan-Xiao; Wang Xiao

    2016-01-01

    The product of the cutoff frequency and breakdown voltage ( f T ×BV CEO ) is an important figure of merit (FOM) to characterize overall performance of heterojunction bipolar transistor (HBT). In this paper, an approach to introducing a thin N + -buried layer into N collector region in silicon-on-insulator (SOI) SiGe HBT to simultaneously improve the FOM of f T ×BV CEO and thermal stability is presented by using two-dimensional (2D) numerical simulation through SILVACO device simulator. Firstly, in order to show some disadvantages of the introduction of SOI structure, the effects of SOI insulation layer thickness ( T BOX ) on f T , BV CEO , and the FOM of f T ×BV CEO are presented. The introduction of SOI structure remarkably reduces the electron concentration in collector region near SOI substrate insulation layer, obviously reduces f T , slightly increases BV CEO to some extent, but ultimately degrades the FOM of f T ×BV CEO . Although the f T , BV CEO , and the FOM of f T ×BV CEO can be improved by increasing SOI insulator SiO 2 layer thickness T BOX in SOI structure, the device temperature and collector current are increased due to lower thermal conductivity of SiO 2 layer, as a result, the self-heating effect of the device is enhanced, and the thermal stability of the device is degraded. Secondly, in order to alleviate the foregoing problem of low electron concentration in collector region near SOI insulation layer and the thermal stability resulting from thick T BOX , a thin N + -buried layer is introduced into collector region to not only improve the FOM of f T ×BV CEO , but also weaken the self-heating effect of the device, thus improving the thermal stability of the device. Furthermore, the effect of the location of the thin N + -buried layer in collector region is investigated in detail. The result show that the FOM of f T ×BV CEO is improved and the device temperature decreases as the N + -buried layer shifts toward SOI substrate insulation layer

  10. Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2014-01-01

    Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.

  11. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  12. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  13. Effect of state feedback coupling on the transient performance of voltage source inverters with LC filter

    DEFF Research Database (Denmark)

    Federico, de Bosio; Pastorelli, Michele; Antonio DeSouza Ribeiro, Luiz

    2016-01-01

    State feedback coupling between the capacitor voltage and inductor current deteriorates notably the performance during transients of voltage and current regulators in stand-alone systems based on voltage source inverters. A decoupling technique is proposed, considering the limitations introduced...

  14. Practical considerations in voltage stability assessment

    Energy Technology Data Exchange (ETDEWEB)

    Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)

    1994-12-31

    This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.

  15. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  16. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  17. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  18. Reduced Voltage Scaling in Clock Distribution Networks

    Directory of Open Access Journals (Sweden)

    Khader Mohammad

    2009-01-01

    Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.

  19. Voltage clamp methods for the study of membrane currents and SR Ca2+ release in adult skeletal muscle fibres

    Science.gov (United States)

    Hernández-Ochoa, Erick O.; Schneider, Martin F.

    2012-01-01

    Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655

  20. A Comparison between Electrochemical Impedance Spectroscopy and Incremental Capacity-Differential Voltage as Li-ion Diagnostic Techniques to Identify and Quantify the Effects of Degradation Modes within Battery Management Systems

    Science.gov (United States)

    Pastor-Fernández, Carlos; Uddin, Kotub; Chouchelamane, Gael H.; Widanage, W. Dhammika; Marco, James

    2017-08-01

    Degradation of Lithium-ion batteries is a complex process that is caused by a variety of mechanisms. For simplicity, ageing mechanisms are often grouped into three degradation modes (DMs): conductivity loss (CL), loss of active material (LAM) and loss of lithium inventory (LLI). State of Health (SoH) is typically the parameter used by the Battery Management System (BMS) to quantify battery degradation based on the decrease in capacity and the increase in resistance. However, the definition of SoH within a BMS does not currently include an indication of the underlying DMs causing the degradation. Previous studies have analysed the effects of the DMs using incremental capacity and differential voltage (IC-DV) and electrochemical impedance spectroscopy (EIS). The aim of this study is to compare IC-DV and EIS on the same data set to evaluate if both techniques provide similar insights into the causes of battery degradation. For an experimental case of parallelized cells aged differently, the effects due to LAM and LLI were found to be the most pertinent, outlining that both techniques are correlated. This approach can be further implemented within a BMS to quantify the causes of battery ageing which would support battery lifetime control strategies and future battery designs.

  1. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  2. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  3. Voltage-assisted polymer wafer bonding

    International Nuclear Information System (INIS)

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  4. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  5. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  6. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  7. An enhanced security solution for electronic medical records based on AES hybrid technique with SOAP/XML and SHA-1.

    Science.gov (United States)

    Kiah, M L Mat; Nabi, Mohamed S; Zaidan, B B; Zaidan, A A

    2013-10-01

    This study aims to provide security solutions for implementing electronic medical records (EMRs). E-Health organizations could utilize the proposed method and implement recommended solutions in medical/health systems. Majority of the required security features of EMRs were noted. The methods used were tested against each of these security features. In implementing the system, the combination that satisfied all of the security features of EMRs was selected. Secure implementation and management of EMRs facilitate the safeguarding of the confidentiality, integrity, and availability of e-health organization systems. Health practitioners, patients, and visitors can use the information system facilities safely and with confidence anytime and anywhere. After critically reviewing security and data transmission methods, a new hybrid method was proposed to be implemented on EMR systems. This method will enhance the robustness, security, and integration of EMR systems. The hybrid of simple object access protocol/extensible markup language (XML) with advanced encryption standard and secure hash algorithm version 1 has achieved the security requirements of an EMR system with the capability of integrating with other systems through the design of XML messages.

  8. Simultaneous recordings of human microsaccades and drifts with a contemporary video eye tracker and the search coil technique.

    Directory of Open Access Journals (Sweden)

    Michael B McCamy

    Full Text Available Human eyes move continuously, even during visual fixation. These "fixational eye movements" (FEMs include microsaccades, intersaccadic drift and oculomotor tremor. Research in human FEMs has grown considerably in the last decade, facilitated by the manufacture of noninvasive, high-resolution/speed video-oculography eye trackers. Due to the small magnitude of FEMs, obtaining reliable data can be challenging, however, and depends critically on the sensitivity and precision of the eye tracking system. Yet, no study has conducted an in-depth comparison of human FEM recordings obtained with the search coil (considered the gold standard for measuring microsaccades and drift and with contemporary, state-of-the art video trackers. Here we measured human microsaccades and drift simultaneously with the search coil and a popular state-of-the-art video tracker. We found that 95% of microsaccades detected with the search coil were also detected with the video tracker, and 95% of microsaccades detected with video tracking were also detected with the search coil, indicating substantial agreement between the two systems. Peak/mean velocities and main sequence slopes of microsaccades detected with video tracking were significantly higher than those of the same microsaccades detected with the search coil, however. Ocular drift was significantly correlated between the two systems, but drift speeds were higher with video tracking than with the search coil. Overall, our combined results suggest that contemporary video tracking now approaches the search coil for measuring FEMs.

  9. Gastrointestinal passage of [125I]Na and blood clearance of 125I-labelled bacteria recorded with a simple non-invasive technique

    International Nuclear Information System (INIS)

    Sundqvist, T.; Skogh, T.

    1982-01-01

    To measure blood concentrations of radiolabelled particles or substances, blood sampling is generally required. The kinetics of radioactivity variations in the blood can be studied by blood sampling from each individual or experimental animal. Alternatively blood samples can be taken from different individuals at different time points. With either of these methods it is difficult to predict the optimal time points for blood sampling, and important information can easily be missed, especially in rapid processes. In this study a simple non-invasive technique for continuous recording of blood radioactivity concentrations in mice is presented. (Auth.)

  10. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  11. Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

    Science.gov (United States)

    Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

    2014-03-17

    Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

  12. A High Voltage Swing 1.9 GHz PA in Standard CMOS

    NARCIS (Netherlands)

    Aartsen, W.A.J.; Annema, Anne J.; Nauta, Bram

    2002-01-01

    A circuit technique for RF power amplifiers that reliably handle voltage peaks well above the nominal supply voltage is presented. To achieve this high-voltage tolerance the circuit implements switched-cascode transistors that yield reliable operation for voltages up to 7V at RF frequencies in a

  13. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  14. Modeling and simulation of dynamic voltage restorer in power system

    International Nuclear Information System (INIS)

    Abdel Aziz, M.A.A.M.

    2012-01-01

    There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.

  15. Observability of Low Voltage grids

    DEFF Research Database (Denmark)

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  16. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  17. The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma

    International Nuclear Information System (INIS)

    Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.

    2006-01-01

    The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)

  18. Voltage measurements at the vacuum post-hole convolute of the Z pulsed-power accelerator

    Directory of Open Access Journals (Sweden)

    E. M. Waisman

    2014-12-01

    Full Text Available Presented are voltage measurements taken near the load region on the Z pulsed-power accelerator using an inductive voltage monitor (IVM. Specifically, the IVM was connected to, and thus monitored the voltage at, the bottom level of the accelerator’s vacuum double post-hole convolute. Additional voltage and current measurements were taken at the accelerator’s vacuum-insulator stack (at a radius of 1.6 m by using standard D-dot and B-dot probes, respectively. During postprocessing, the measurements taken at the stack were translated to the location of the IVM measurements by using a lossless propagation model of the Z accelerator’s magnetically insulated transmission lines (MITLs and a lumped inductor model of the vacuum post-hole convolute. Across a wide variety of experiments conducted on the Z accelerator, the voltage histories obtained from the IVM and the lossless propagation technique agree well in overall shape and magnitude. However, large-amplitude, high-frequency oscillations are more pronounced in the IVM records. It is unclear whether these larger oscillations represent true voltage oscillations at the convolute or if they are due to noise pickup and/or transit-time effects and other resonant modes in the IVM. Results using a transit-time-correction technique and Fourier analysis support the latter. Regardless of which interpretation is correct, both true voltage oscillations and the excitement of resonant modes could be the result of transient electrical breakdowns in the post-hole convolute, though more information is required to determine definitively if such breakdowns occurred. Despite the larger oscillations in the IVM records, the general agreement found between the lossless propagation results and the results of the IVM shows that large voltages are transmitted efficiently through the MITLs on Z. These results are complementary to previous studies [R. D. McBride et al., Phys. Rev. ST Accel. Beams 13, 120401 (2010

  19. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  20. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  1. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  2. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  3. A new technique for continuous measurement and recording of gastric potential difference in the rat: evaluation of NSAID-induced gastric mucosal damage.

    Science.gov (United States)

    Scarpignato, C; Corradi, C; Gandolfi, M A; Galmiche, J P

    1995-10-01

    Disruption of the gastric mucosal barrier by the so-called "barrier breakers" such as ethanol, aspirin, and bile is associated with an increase in gastric potential difference (GPD), that is, a decrease in its negativity. Because a good correlation between the degree of histological damage and changes in GPD has been observed, this parameter has been used increasingly as an index of mucosal integrity. However, the current methodology for measuring GPD is laborious due to the preparation and checking of KCl-agarose bridges prior to each experiment, and calculations--usually handmade--are time-consuming and inaccurate. In this paper, a new method allowing simultaneous measurement and recording of GPD in the rat is described. The method allows a simultaneous recording of intragastric pH and an automatic data analysis. The new technique has been validated by studying mucosal damage induced by aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs) (namely indomethacin and droxicam) as well as the mucosal protective activity of an antacid and sucralfate. The similarity between the results obtained in this rat model and those derived from human experiments clearly show that the developed methodology yields results that are predictive for human pharmacology.

  4. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  5. Ceramic capacitor insulation resistance failures accelerated by low voltage

    Science.gov (United States)

    Brennan, T. F.

    1978-01-01

    Ceramic capacitors failed insulation resistance testing at less than one-tenth their rated voltage. Many failures recovered as the voltage was increased. Comprehensive failure analysis techniques, some of which are unprecedented, were used to examine these failures. It was determined that there was more than one failure mechanism, and the results indicate a need for special additional screening.

  6. Inductive voltage compensation in superconducting magnet systems

    International Nuclear Information System (INIS)

    Yeh, H.T.; Goddard, J.S.; Shen, S.S.

    1979-01-01

    This paper details several techniques of inductive voltage compensation developed for quench detection in superconducting magnet systems with multiple coils and power supplies, with particular application for the Large Coil Test Facility (LCTF). Sources of noise, their magnitudes, and the sensitivity required for normal zone detection to avoid damage to the magnets are discussed. Two passive compensation schemes (second difference and central difference) are introduced and illustrated by parameters of LCTF; these take advantage of coil symmetries and other system characteristics. An active compensation scheme based on current rate input fom pickup coils and utilizing theory on ac loss voltage for calibration was tested, and the experimental setup and test results are discussed

  7. Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

    DEFF Research Database (Denmark)

    Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

    2004-01-01

    power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

  8. Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

    Science.gov (United States)

    Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

    2017-11-01

    Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

  9. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  10. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  11. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  12. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  13. Technique and Calculation Results of Currents and Voltages in the Circuits of the Measuring Element of the Protection Device of the Transmission Line Based on the Control of Transient Processes

    Science.gov (United States)

    Lachugin, V. F.; Kulikov, A. L.; Platonov, P. S.; Vucolov, V. Yu.

    2017-12-01

    The specifics of generation of the signals of current and voltage in the circuits of a directional element of wave relay protection during short circuit (SC) in overhead power transmission lines are considered. The computing method of transient processes in the protection circuits, including frequency filters, that attenuate the parameters of currents and voltages of the mode taking into account the higher harmonic components and probable deviations of the frequency of transmission line from the rated value is presented. It is revealed that it is advisable to implement the measuring circuits of the directional elements of wave relay protection with the three-section filter attenuating the frequencies from 45 to 55 Hz and the low pass filter with cutoff frequency that does not exceed 1 kHz.

  14. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  15. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  16. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  17. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  18. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  19. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  20. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    International Nuclear Information System (INIS)

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  1. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  2. Digital Recording and Non-Destructive Techniques for the Understanding of Structural Performance for Rehabilitating Historic Structures at the Kathmandu Valley after Gorkha Earthquake 2015

    Science.gov (United States)

    Shrestha, S.; Reina Ortiz, M.; Gutland, M.; Napolitano, R.; Morris, I. M.; Santana Quintero, M.; Erochko, J.; Kawan, S.; Shrestha, R. G.; Awal, P.; Suwal, S.; Duwal, S.; Maharjan, D. K.

    2017-08-01

    On 25 April 2015, the Gorkha earthquake of magnitude 7.8, severely damaged the cultural heritage sites of Nepal. In particular, the seven monument zones of the Kathmandu Valley World Heritage Site suffered extensive damage. Out of 195 surveyed monuments, 38 have completely collapsed and 157 partially damaged (DoA, 2015). In particular, the world historic city of Bhaktapur was heavily affected by the earthquake. There is, in general, a lack of knowledge regarding the traditional construction technology used in many of the most important temple monuments in Bhaktapur. To address this limitation and to assist in reconstruction and rehabilitation of the area, this study documents the existing condition of different historic structures in the Kathmandu Valley. In particular, the Nyatapola Temple is studied in detail. To record and document the condition of this temple, a combination of laser scanning and terrestrial and aerial photogrammetry are used. By also including evaluation of the temple and its supporting plinth structure using non-destructive evaluation techniques like geo-radar and micro-tremor dynamic analysis, this study will form the basis of a structural analysis study to assess the anticipated future seismic performance of the Nyatapola Temple.

  3. Improved detection of electrical activity with a voltage probe based on a voltage-sensing phosphatase.

    Science.gov (United States)

    Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi

    2013-09-15

      One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.

  4. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  5. Exploring dark current voltage characteristics of micromorph silicon tandem cells with computer simulations

    NARCIS (Netherlands)

    Sturiale, A.; Li, H. B. T.; Rath, J.K.; Schropp, R.E.I.; Rubinelli, F.A.

    2009-01-01

    The transport mechanisms controlling the forward dark current-voltage characteristic of the silicon micromorph tandem solar cell were investigated with numerical modeling techniques. The dark current-voltage characteristics of the micromorph tandem structure at forward voltages show three regions:

  6. Low cost photomultiplier high-voltage readout system

    International Nuclear Information System (INIS)

    Oxoby, G.J.; Kunz, P.F.

    1976-10-01

    The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers

  7. UNA TECNICA ESTADISTICA PARA MEDIR LA CONFLICTIVIDAD SOCIAL A TRAVES DEL REGISTRO ARQUEOLOGICO (A Statistical Technique to Measure Social Conflict through the Archaeological Record

    Directory of Open Access Journals (Sweden)

    Pascual Izquierdo-Egea

    2015-03-01

    Full Text Available Se presenta aqui una tecnica estadistica para medir la conflictividad social a traves del registro mortuorio. Nace al amparo del metodo de valoracion contextual empleado en el analisis de los ajuares funerarios desde 1993. Se trata de una herramienta fundamental para el desarrollo de la arqueologia de los fenomenos sociales, cuyos relevantes resultados empiricos avalan su trascendencia teorica. Tras proceder a su conceptualizacion en funcion de la desigualdad social y la riqueza relativa, se explican las dos clases de conflictividad social definidas: estructural o estatica y coyuntural o dinamica. Finalmente, se incluyen sus conexiones con la ley demografica de Malthus a traves de sus dos parametros: poblacion y recursos. Todo este entramado teorico se ilustra con algunas aplicaciones referidas a las civilizaciones antiguas, abarcando la protohistoria iberica, la Mesoamerica prehispanica o la Roma altoimperial. ENGLISH: A statistical technique to measure social conflict through the mortuary record is presented here. It is born under the contextual valuation method used in the analysis of grave goods since 1993. This is a fundamental tool for the development of the archaeology of social phenomena, whose relevant empirical results support its theoretical significance. After conveying its conceptualization in terms of social inequality and relative wealth, the two classes of social conflict are explained: static or structural and dynamic or conjunctural. Finally, connections with the Malthusian demographic law through its two parameters—population and resources—are included. The synthesis of these theoretical frameworks is illustrated with applications to ancient civilizations, including Iberian protohistory, prehispanic Mesoamerica, and early imperial Rome.

  8. Quality assurance records and records' system

    International Nuclear Information System (INIS)

    Link, M.; Martinek, J.

    1980-01-01

    For nuclear power plants extensive proof of quality is required which has to be documented reliably by quality records. With respect to the paper volume it is the most comprehensive 'curriculum vitae' of the technique. Traditional methods of information and recording are unsatisfactory for meeting regulatory requirements for maintaining the QA-aspects of status reporting, completeness, traceability and retrieval. Therefore KWU has established a record (documentation) subsystem within the overall component qualification system. Examples of the general documentation requirements, the procedure and handling in accordance with this subsystem for mechanical equipment are to be described examplarily. Topics are: - National and international requirements - Definition of QA records - Modular and product orientated KWU-record subsystem - Criteria for developing records - Record control, distribution, collection, storage - New documentation techniques (microfilm, data processing) - Education and training of personnel. (orig./RW)

  9. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  10. The effect of activation rate on left atrial bipolar voltage in patients with paroxysmal atrial fibrillation.

    Science.gov (United States)

    Williams, Steven E; Linton, Nick; O'Neill, Louisa; Harrison, James; Whitaker, John; Mukherjee, Rahul; Rinaldi, Christopher A; Gill, Jaswinder; Niederer, Steven; Wright, Matthew; O'Neill, Mark

    2017-09-01

    Bipolar voltage is used during electroanatomic mapping to define abnormal myocardium, but the effect of activation rate on bipolar voltage is not known. We hypothesized that bipolar voltage may change in response to activation rate. By examining corresponding unipolar signals we sought to determine the mechanisms of such changes. LA extrastimulus mapping was performed during CS pacing in 10 patients undergoing first time paroxysmal atrial fibrillation ablation. Bipolar and unipolar electrograms were recorded using a PentaRay catheter (4-4-4 spacing) and indifferent IVC electrode, respectively. An S1S2 pacing protocol was delivered with extrastimulus coupling interval reducing from 350 to 200 milliseconds. At each recording site (119 ± 37 per LA), bipolar peak-to-peak voltage, unipolar peak to peak voltage and activation delay between unipole pairs was measured. Four patterns of bipolar voltage/extrastimulus coupling interval curves were seen: voltage attenuation with plateau voltage >1 mV (48 ± 15%) or voltage unaffected by coupling interval with plateau voltage >1 mV (17 ± 10%) or voltage attenuation were associated with significantly greater unipolar voltage attenuation at low (25 ± 28 mV/s vs. 9 ± 11 mV/s) and high (23 ± 29 mV/s vs. 6 ± 12 mV/s) plateau voltage sites (P voltage attenuation (P = 0.026). Bipolar electrogram voltage is dependent on activation rate at a significant proportion of sites. Changes in unipolar voltage and timing underlie these effects. These observations have important implications for use of voltage mapping to delineate abnormal atrial substrate. © 2017 The Authors. Journal of Cardiovascular Electrophysiology published by Wiley Periodicals, Inc.

  11. Filtration influence in a constant potential X-ray machine peak voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Santos, L.R.; Vivolo, V.; Xavier, M.; Potiens, M.P.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Navarro, M.V.T., E-mail: dossantos.lucasrodrigues@gmail.com [Instituto Federal de Educacao, Ciencia e Tecnologia da Bahia (IFBA), Salvador (Brazil)

    2017-09-01

    This work shows the peak voltage measurements for several beam filtrations used in diagnostic radiology, using two types of non-invasive detectors; a voltage meter and a high-resolution spectrometer. The technique chosen for the voltage peak measurements with the spectrometer was the endpoint. The results were compared to the measured ones and showed good similarity to the nominal values. However the voltage meter detector used in this work presented errors for heavier filtrations. (author)

  12. Development of a fast voltage control method for electrostatic accelerators

    International Nuclear Information System (INIS)

    Lobanov, Nikolai R.; Linardakis, Peter; Tsifakis, Dimitrios

    2014-01-01

    The concept of a novel fast voltage control loop for tandem electrostatic accelerators is described. This control loop utilises high-frequency components of the ion beam current intercepted by the image slits to generate a correction voltage that is applied to the first few gaps of the low- and high-energy acceleration tubes adjoining the high voltage terminal. New techniques for the direct measurement of the transfer function of an ultra-high impedance structure, such as an electrostatic accelerator, have been developed. For the first time, the transfer function for the fast feedback loop has been measured directly. Slow voltage variations are stabilised with common corona control loop and the relationship between transfer functions for the slow and new fast control loops required for optimum operation is discussed. The main source of terminal voltage instabilities, which are due to variation of the charging current caused by mechanical oscillations of charging chains, has been analysed

  13. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  14. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  15. Methods, systems and apparatus for controlling third harmonic voltage when operating a multi-space machine in an overmodulation region

    Science.gov (United States)

    Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel

    2014-06-03

    Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.

  16. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  17. A comprehensive analysis and hardware implementation of control strategies for high output voltage DC-DC boost power converter

    OpenAIRE

    Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel

    2017-01-01

    Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...

  18. Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

    Science.gov (United States)

    Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

    2017-09-20

    Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

  19. Mechanism of electromechanical coupling in voltage-gated potassium channels

    Directory of Open Access Journals (Sweden)

    Rikard eBlunck

    2012-09-01

    Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

  20. A novel fiber-free technique for brain activity imaging in multiple freely behaving mice

    Science.gov (United States)

    Inagaki, Shigenori; Agetsuma, Masakazu; Nagai, Takeharu

    2018-02-01

    Brain functions and related psychiatric disorders have been investigated by recording electrophysiological field potential. When recording it, a conventional method requires fiber-based apparatus connected to the brain, which however hampers the simultaneous measurement in multiple animals (e.g. by a tangle of fibers). Here, we propose a fiber-free recording technique in conjunction with a ratiometric bioluminescent voltage indicator. Our method allows investigation of electrophysiological filed potential dynamics in multiple freely behaving animals simultaneously over a long time period. Therefore, this fiber-free technique opens up the way to investigate a new mechanism of brain function that governs social behaviors and animal-to-animal interaction.

  1. Evaluation of variation of voltage (kV) absorbed dose in chest CT scans

    International Nuclear Information System (INIS)

    Mendonca, Bruna G.A.; Mourao, Arnaldo P.

    2013-01-01

    Computed tomography (CT) is one of the most important diagnostic techniques images today. The increasing utilization of CT implies a significant increase of population exposure to ionizing radiation. Optimization of practice aims to reduce doses to patients because the image quality is directly related to the diagnosis. You can decrease the amount of dose to the patient, and maintain the quality of the image. There are several parameters that can be manipulated in a CT scan and these parameters can be used to reduce the energy deposited in the patient. Based on this, we analyzed the variation of dose deposited in the lungs, breasts and thyroid, by varying the supply voltage of the tube. Scans of the thorax were performed following the protocol of routine chest with constant and variable current for the same applied voltage. Moreover, a female phantom was used and thermoluminescent dosimeters (TLD-100), model bat, were used to record the specific organ doses. Scans were performed on a GE CT scanner, model 64 Discovery channels. Higher doses were recorded for the voltage of 120 kV with 200 mAs in the lungs (22.46 mGy) and thyroid (32.22 mGy). For scans with automatic mAs, variable between 100 and 440, this same tension contributed to the higher doses. The best examination in terms of the dose that was used with automatic 80 kV mAs, whose lungs and thyroid received lower dose. For the best breast exam was 100 kV. Since the increase in the 80 kV to 100 kV no impact so much the dose deposited in the lungs, it can be concluded that lowering the applied voltage to 100 kV resulted in a reduction in the dose absorbed by the patient. These results can contribute to optimizing scans of the chest computed tomography

  2. Contribution to high voltage matrix switches reliability

    International Nuclear Information System (INIS)

    Lausenaz, Yvan

    2000-01-01

    Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr

  3. System and carrier for optical images and holographic information recording

    International Nuclear Information System (INIS)

    Andries, A.; Bivol, V.; Iovu, M

    2002-01-01

    The invention relates to the semiconducting silverless photography, in particular to the technique for optical information recording and may be used in microphotography for manifacture of microfiches, microfilms, storage disks, i the multiplication and copying technique, in holography, in micro- and optoelectronics, cinematography etc. The system for optical images and holographic information recording includes an optical exposure system, an information carrier , containing a dielectric substrate with the first electrode, a photosensitive element and the second electrode, arranged in consecutive order, a constant and impulse voltage source, a means for climbing and movement of the information carrier, a control unit for connection of the voltage source to the electroconducting strate, a personal computer, connected to the control unit of the recording modes ,to the exposure system and the information carrier, an electrooptical transparency, connected to the computer by means of the matching unit. The carrier for optical images and holographic information recording contains a dielectric substrate, a photosensitive element formed of a layer of the vitreous chalcogenic semiconductor and a layer of the crystalline or amorphous semiconductor, forming a heterojunction, the photosensitive element is arranged between two electrodes , one of which is made transparent , in such case rge layer of the vitreous chalcogenic semiconductor comes into contact with the superior transparent electrode, subjected to exposure

  4. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  5. CMOS voltage references an analytical and practical perspective

    CERN Document Server

    Kok, Chi-Wah

    2013-01-01

    A practical overview of CMOS circuit design, this book covers the technology, analysis, and design techniques of voltage reference circuits.  The design requirements covered follow modern CMOS processes, with an emphasis on low power, low voltage, and low temperature coefficient voltage reference design. Dedicating a chapter to each stage of the design process, the authors have organized the content to give readers the tools they need to implement the technologies themselves. Readers will gain an understanding of device characteristics, the practical considerations behind circuit topology,

  6. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  7. A new approach to voltage sag detection based on wavelet transform

    Energy Technology Data Exchange (ETDEWEB)

    Gencer, Oezguer; Oeztuerk, Semra; Erfidan, Tarik [Kocaeli University, Faculty of Engineering, Department of Electrical Engineering, Veziroglu Kampuesue, Eski Goelcuek Yolu, Kocaeli (Turkey)

    2010-02-15

    In this work, a new voltage sag detection method based on wavelet transform is developed. Voltage sag detection algorithms, so far have proved their efficiency and computational ability. Using several windowing techniques take long computational times for disturbance detection. Also researchers have been working on separating voltage sags from other voltage disturbances for the last decade. Due to increasing power quality standards new high performance disturbance detection algorithms are necessary to obtain high power quality standards. For this purpose, the wavelet technique is used for detecting voltage sag duration and magnitude. The developed voltage sag detection algorithm is implemented with high speed microcontroller. Test results show that, the new approach provides very accurate and satisfactory voltage sag detection. (author)

  8. PLATEAUING COSMIC RAY DETECTORS TO ACHIEVE OPTIMUM OPERATING VOLTAGE

    Energy Technology Data Exchange (ETDEWEB)

    Knoff, E.N.; Peterson, R.S.

    2008-01-01

    Through QuarkNet, students across the country have access to cosmic ray detectors in their high school classrooms. These detectors operate using a scintillator material and a photomultiplier tube (PMT). A data acquisition (DAQ) board counts cosmic ray hits from the counters. Through an online e-Lab, students can analyze and share their data. In order to collect viable data, the PMTs should operate at their plateau voltages. In these plateau ranges, the number of counts per minute remains relatively constant with small changes in PMT voltage. We sought to plateau the counters in the test array and to clarify the plateauing procedure itself. In order to most effectively plateau the counters, the counters should be stacked and programmed to record the number of coincident hits as well as their singles rates. We also changed the threshold value that a signal must exceed in order to record a hit and replateaued the counters. For counter 1, counter 2, and counter 3, we found plateau voltages around 1V. The singles rate plateau was very small, while the coincidence plateau was very long. The plateau voltages corresponded to a singles rate of 700–850 counts per minute. We found very little effect of changing the threshold voltages. Our chosen plateau voltages produced good performance studies on the e-Lab. Keeping in mind the nature of the experiments conducted by the high school students, we recommend a streamlined plateauing process. Because changing the threshold did not drastically affect the plateau voltage or the performance study, students should choose a threshold value, construct plateau graphs, and analyze their data using a performance study. Even if the counters operate slightly off their plateau voltage, they should deliver good performance studies and return reliable results.

  9. Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

    Science.gov (United States)

    Cai, Yuanji; Guan, Yonggang; Liu, Weidong

    2017-06-01

    Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

  10. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  11. Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

    DEFF Research Database (Denmark)

    Micallef, A.; Apap, M.; Spitero-Stanies, C.

    2012-01-01

    This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

  12. High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter

    International Nuclear Information System (INIS)

    Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.

    1987-01-01

    The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V

  13. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  14. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  15. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  16. Power converters for medium voltage networks

    CERN Document Server

    Islam, Md Rabiul; Zhu, Jianguo

    2014-01-01

    This book examines a number of topics, mainly in connection with advances in semiconductor devices and magnetic materials and developments in medium and large-scale renewable power plant technologies, grid integration techniques and new converter topologies, including advanced digital control systems for medium-voltage networks. The book's individual chapters provide an extensive compilation of fundamental theories and in-depth information on current research and development trends, while also exploring new approaches to overcoming some critical limitations of conventional grid integration te

  17. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  18. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  19. Diode-Assisted Buck-Boost Voltage-Source Inverters

    DEFF Research Database (Denmark)

    Gao, Feng; Loh, Poh Chiang; Teodorescu, Remus

    2009-01-01

    , a number of diode-assisted inverter variants can be designed with each having its own operational principle and voltage gain expression. For controlling them, a generic modulation scheme that can be used for controlling all diode-assisted variants with minimized harmonic distortion and component stress......This paper proposes a number of diode-assisted buck-boost voltage-source inverters with a unique X-shaped diode-capacitor network inserted between the inverter circuitry and dc source for producing a voltage gain that is comparatively higher than those of other buck-boost conversion techniques....... Using the diode-assisted network, the proposed inverters can naturally configure themselves to perform capacitive charging in parallel and discharging in series to give a higher voltage multiplication factor without compromising waveform quality. In addition, by adopting different front-end circuitries...

  20. Performance Evaluation of Three Different Inverter Configurations of DVR for Mitigation of Voltage Events

    Directory of Open Access Journals (Sweden)

    Miska Prasad

    2016-12-01

    Full Text Available The voltage events namely voltage sags and voltage swells represent the most common, frequent and important power quality events in today’s power system. Dynamic voltage restorer (DVR is one of the key components used to mitigate the supply voltage quality disturbances in terms of voltage sags and swells in the distribution system. It consists of an energy storage unit, a voltage source inverter, a filter, a coupling transformer and the control system. This paper presents three different inverter configurations of dynamic voltage restorer (DVR for mitigation of voltage events such as voltage sags and swells with sudden addition or removal of the nonlinear load. These three configurations are voltage source inverter based DVR (VSI-DVR, current source inverter based DVR (CSI-DVR and impedance or Z-source inverter based DVR (ZSI-DVR. The d-q control technique is used to control the operation of the DVR. The response of ZSI-DVR for mitigation of voltage sags and swells are investigated and compared with VSI-DVR and CSI-DVR using MATLAB/SIMULINK environment.

  1. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  2. Charge Gain, Voltage Gain, and Node Capacitance of the SAPHIRA Detector Pixel by Pixel

    Science.gov (United States)

    Pastrana, Izabella M.; Hall, Donald N. B.; Baker, Ian M.; Jacobson, Shane M.; Goebel, Sean B.

    2018-01-01

    The University of Hawai`i Institute for Astronomy has partnered with Leonardo (formerly Selex) in the development of HgCdTe linear mode avalanche photodiode (L-APD) SAPHIRA detectors. The SAPHIRA (Selex Avalanche Photodiode High-speed Infra-Red Array) is ideally suited for photon-starved astronomical observations, particularly near infrared (NIR) adaptive optics (AO) wave-front sensing. I have measured the stability, and linearity with current, of a 1.7-um (10% spectral bandpass) infrared light emitting diode (IR LED) used to illuminate the SAPHIRA and have then utilized this source to determine the charge gain (in e-/ADU), voltage gain (in uV/ADU), and node capacitance (in fF) for each pixel of the 320x256@24um SAPHIRA. These have previously only been averages over some sub-array. Determined from the ratio of the temporal averaged signal level to variance under constant 1.7-um LED illumination, I present the charge gain pixel-by-pixel in a 64x64 sub-array at the center of the active area of the SAPHIRA (analyzed separately as four 32x32 sub-arrays) to be about 1.6 e-/ADU (σ=0.5 e-/ADU). Additionally, the standard technique of varying the pixel reset voltage (PRV) in 10 mV increments and recording output frames for the same 64x64 subarray found the voltage gain per pixel to be about 11.7 uV/ADU (σ=0.2 uV/ADU). Finally, node capacitance was found to be approximately 23 fF (σ=6 fF) utilizing the aforementioned charge and voltage gain measurements. I further discuss the linearity measurements of the 1.7-um LED used in the charge gain characterization procedure.

  3. Determining the mode of high voltage breakdowns in vacuum devices

    International Nuclear Information System (INIS)

    Miller, H.C.; Furno, E.J.; Sturtz, J.P.

    1980-01-01

    High voltage breakdowns (HVBs) occur in many vacuum devices. It frequently is of great practical interest to know the type (or mode) of such HVB's, since this can indicate weak points in the device. Post-mortems can sometimes be helpful, but it would be quite desirable to have a technique which would allow the HVB mode to be determined in an operating device. Photography can be quite helpful, but unfortunately many devices do not permit optical access to the region of interest. However, the idea of using photography in conjunction with other diagnostic techniques to establish the validity of these techniques seemed promising, since these techniques could then be used to determine the mode of HVBs in opaque devices. A literature search indicates that promising techniques are to measure the voltage applied to the device (or the current through the device) and also to look for x-rays generated by the device during an HVB

  4. A 50–60 GHz mm-wave rectifier with bulk voltage bias in 65-nm CMOS

    NARCIS (Netherlands)

    Gao, H.; Matters-Kammerer, M.; Harpe, P.; Baltus, P.

    2016-01-01

    This letter presents a 50∼60 GHz fully integrated 3-stage rectifier with bulk voltage bias for threshold voltage modulation in a 65-nm CMOS technology, which can be integrated in a mm-wave hybrid rectifier structure as the main rectifier. In this letter, the new technique of bulk voltage bias is

  5. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  6. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  7. Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages

    Energy Technology Data Exchange (ETDEWEB)

    An, Seok Chan; Kim, Jin Sub [Yonsei University, Seoul (Korea, Republic of); Chu, Yong [National Fusion Research Institute(NFRI), Daejeon (Korea, Republic of)

    2016-03-15

    Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals.

  8. Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages

    International Nuclear Information System (INIS)

    An, Seok Chan; Kim, Jin Sub; Chu, Yong

    2016-01-01

    Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals

  9. A technique for recording polycrystalline structure and orientation during in situ deformation cycles of rock analogues using an automated fabric analyser.

    Science.gov (United States)

    Peternell, M; Russell-Head, D S; Wilson, C J L

    2011-05-01

    Two in situ plane-strain deformation experiments on norcamphor and natural ice using synchronous recording of crystal c-axis orientations have been performed with an automated fabric analyser and a newly developed sample press and deformation stage. Without interrupting the deformation experiment, c-axis orientations are determined for each pixel in a 5 × 5 mm sample area at a spatial resolution of 5 μm/pixel. In the case of norcamphor, changes in microstructures and associated crystallographic information, at a strain rate of ∼2 × 10(-5) s(-1), were recorded for the first time during a complete in situ deformation-cycle experiment that consisted of an annealing, deformation and post-deformation annealing path. In the case of natural ice, slower external strain rates (∼1 × 10(-6) s(-1)) enabled the investigation of small changes in the polycrystal aggregate's crystallography and microstructure for small amounts of strain. The technical setup and first results from the experiments are presented. © 2010 The Authors Journal of Microscopy © 2010 Royal Microscopical Society.

  10. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  11. Measurement of magnetically insulated line voltage using a Thomson Parabola Charged Particle Analyser

    International Nuclear Information System (INIS)

    Stanley, T.D.; Stinnett, R.W.

    1981-01-01

    The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed

  12. Voltage imaging in vivo with a new class of rhodopsin-based indicators

    Science.gov (United States)

    Douglass, Adam

    2013-03-01

    Reliable, optical detection of single action potentials in an intact brain is one of the longest-standing challenges in neuroscience. We have recently shown that a number of microbial rhodopsins exhibit intrinsic fluorescence that is sensitive to transmembrane potential. One class of indicator, derived from Archaerhodopsin-3 (Arch), responds to voltage transients with a speed and sensitivity that enable near-perfect identification of single action potentials in cultured neurons [Nat Methods. (2011). 9:90-5]. We have extended the use of these indicators to an in vivo context through the application of advanced imaging techniques to the larval zebrafish. Using planar-illumination, spinning-disk confocal, and epifluorescence imaging modalities, we have successfully recorded electrical activity in a variety of fish structures, including the brain and heart, in a completely noninvasive manner. Transgenic lines expressing Arch variants in defined cells enable comprehensive measurements to be made from specific target populations. In parallel, we have also extended the capabilities of our indicators by improving their multiphoton excitability and overall brightness. Microbial rhodopsin-based voltage indicators now enable optical interrogation of complex neural circuits, and electrophysiology in systems for which electrode-based techniques are challenging.

  13. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  14. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  15. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  16. A Transformerless Medium Voltage Multiphase Motor Drive System

    Directory of Open Access Journals (Sweden)

    Dan Wang

    2016-04-01

    Full Text Available A multiphase motor has several major advantages, such as high reliability, fault tolerance, and high power density. It is a critical issue to develop a reliable and efficient multiphase motor drive system. In this paper, a transformerless voltage source converter-based drive system for a medium-voltage (MV multiphase motor is proposed. This drive converter employs cascaded H-bridge rectifiers loaded by H-bridge inverters as the interface between the grid and multiphase motor. The cascaded H-bridge rectifier technique makes the drive system able to be directly connected to the MV grid without the phase-shifting transformer because it can offset the voltage level gap between the MV grid and the semiconductor devices, provide near-sinusoidal AC terminal voltages without filters, and draw sinusoidal line current from the grid. Based on a digital signal processor (DSP, a complete improved Phase Disposition Pulse Width Modulation (PD-PWM method is developed to ensure the individual DC-link capacitor voltage balancing for enhancing the controllability and limiting the voltage and power stress on the H-bridge cells. A downscaled prototype is designed and developed based on a nine-phase motor. The experimental results verify the excellent performances of the proposed drive system and control strategy in steady-state and variant-frequency startup operations.

  17. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  18. Exploring the clinical decision-making used by experienced cardiorespiratory physiotherapists: A mixed method qualitative design of simulation, video recording and think aloud techniques.

    Science.gov (United States)

    Thackray, Debbie; Roberts, Lisa

    2017-02-01

    The ability of physiotherapists to make clinical decisions is a vital component of being an autonomous practitioner, yet this complex phenomenon has been under-researched in cardiorespiratory physiotherapy. The purpose of this study was to explore clinical decision-making (CDM) by experienced physiotherapists in a scenario of a simulated patient experiencing acute deterioration of their respiratory function. The main objective of this observational study was to identify the actions, thoughts, and behaviours used by experienced cardiorespiratory physiotherapists in their clinical decision-making processes. A mixed-methods (qualitative) design employing observation and think-aloud, was adopted using a computerised manikin in a simulated environment. The participants clinically assessed the manikin programmed with the same clinical signs, under standardised conditions in the clinical skills practice suite, which was set up as a ward environment. Experienced cardiorespiratory physiotherapists, recruited from clinical practice within a 50-mile radius of the University(*). Participants were video-recorded throughout the assessment and treatment and asked to verbalise their thought processes using the 'think-aloud' method. The recordings were transcribed verbatim and managed using a Framework approach. Eight cardiorespiratory physiotherapists participated (mean 7years clinical experience, range 3.5-16years. CDM was similar to the collaborative hypothetico-deductive model, five-rights nursing model, reasoning strategies, inductive reasoning and pattern recognition. However, the CDM demonstrated by the physiotherapists was complex, interactive and iterative. Information processing occurred continuously throughout the whole interaction with the patient, and the specific cognitive skills of recognition, matching, discriminating, relating, inferring, synthesising and prediction were identified as being used sequentially. The findings from this study were used to develop a new

  19. Mitigation of Flicker using STATCOM with Three-Level 12-pulse Voltage Source Inverter

    OpenAIRE

    Ali Z a'fari

    2011-01-01

    Voltage flicker is a disturbance in electrical power systems. The reason for this disturbance is mainly the large nonlinear loads such as electric arc furnaces. Synchronous static compensator (STATCOM) is considered as a proper technique to mitigate the voltage flicker. Application of more suitable and precise power electronic converter leads to a more precise performance of the compensator. In this paper a three-level 12-pulse voltage source inverter (VSI) with a 12-term...

  20. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  1. Doubly-Fed Induction Generator Control Under Voltage Sags

    DEFF Research Database (Denmark)

    Teodorescu, Remus; Blaabjerg, Frede; Lima, K.

    2008-01-01

    This paper proposes a new control technique to improve the fault-ride through capability of doubly fed induction generators (DFIG). In such generators the appearance of severe voltage sags at the coupling point make rise to high over currents at the rotor/stator windings, something that makes...

  2. Accurate determination of the voltage of a transmission electron ...

    Indian Academy of Sciences (India)

    The techniques established are found to be suitable for TEMs operating at a setting voltage of about 250 kV. For the TEM studies, a regular double-tilt specimen holder is required in order to be able to get to the desired zone axes. When the experiments were repeated using a cryogenic double-tilt holder, an improvement in ...

  3. Medium and high voltage power cables market in Europe

    International Nuclear Information System (INIS)

    Kupiec, M.

    1992-06-01

    This note gives an overview of the European market for medium and high voltage power cables. In this text, emphasis is placed on suppliers and important European clients; there is also a brief review of the different techniques for cable laying and utilization in Europe. This not has mainly been drafted from informations supplied by EUROPACABLE

  4. High voltage diagnostics on electrical insulation of supersonducting magnets

    International Nuclear Information System (INIS)

    Irmisch, M.

    1995-12-01

    The high voltage (HV) performance of superconducting magnets of large dimensions, e.g. as needed in fusion reactors, is a challange in the field of high voltage technology, i.e. especially in the field of cryogenic high voltage components and with respect to questions of HV insulation diagnostics at low temperature. By using the development of POLO - a superconducting prototype coil of a tokamak poloidal field coil - as an example, this work deals with special problems of how to get use of conventional HV test techniques for diagnostics under special cryogenic boundary conditions. As a first approach to gain experience in the field of phase resolved partial discharge (PRPD) measurements during operation of a superconductive coil, the POLO coil was subject to several high voltage tests. Compared with DC insulation resistance measurements and capacitive impulse voltage discharges to the coil, the AC PD measurements have been the only way to observe special characteristics of the electrical insulation with respect to the cooling down of the coil from 300 K to 4.2 K. The PRPD measurement technique thereby has proofed as a suitable diagnostic tool. This work can serve as basic data to be comparable within further projects of electrical insulation diagnostics at cryogenic temperatures. (orig.)

  5. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  6. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  7. High voltage power network construction

    CERN Document Server

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  8. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  9. Energy reduction through voltage scaling and lightweight checking

    Science.gov (United States)

    Kadric, Edin

    As the semiconductor roadmap reaches smaller feature sizes and the end of Dennard Scaling, design goals change, and managing the power envelope often dominates delay minimization. Voltage scaling remains a powerful tool to reduce energy. We find that it results in about 60% geomean energy reduction on top of other common low-energy optimizations with 22nm CMOS technology. However, when voltage is reduced, it becomes easier for noise and particle strikes to upset a node, potentially causing Silent Data Corruption (SDC). The 60% energy reduction, therefore, comes with a significant drop in reliability. Duplication with checking and triple-modular redundancy are traditional approaches used to combat transient errors, but spending 2--3x the energy for redundant computation can diminish or reverse the benefits of voltage scaling. As an alternative, we explore the opportunity to use checking operations that are cheaper than the base computation they are guarding. We devise a classification system for applications and their lightweight checking characteristics. In particular, we identify and evaluate the effectiveness of lightweight checks in a broad set of common tasks in scientific computing and signal processing. We find that the lightweight checks cost only a fraction of the base computation (0-25%) and allow us to recover the reliability losses from voltage scaling. Overall, we show about 50% net energy reduction without compromising reliability compared to operation at the nominal voltage. We use FPGAs (Field-Programmable Gate Arrays) in our work, although the same ideas can be applied to different systems. On top of voltage scaling, we explore other common low-energy techniques for FPGAs: transmission gates, gate boosting, power gating, low-leakage (high-Vth) processes, and dual-V dd architectures. We do not scale voltage for memories, so lower voltages help us reduce logic and interconnect energy, but not memory energy. At lower voltages, memories become dominant

  10. Voltage linear transformation circuit design

    Science.gov (United States)

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  11. A Demonstration of an Improved Filtering Technique for Analyzing Climate Records via Comparisons of Satellite MSU/AMSU Instrument Temperature Products from Three Research Groups

    Science.gov (United States)

    Swanson, R. E.

    2017-12-01

    Climate data records typically exhibit considerable variation over short time scales both from natural variability and from instrumentation issues. The use of linear least squares regression can provide overall trend information from noisy data, however assessing intermediate time periods can also provide useful information unavailable from basic trend calculations. Extracting the short term information in these data for assessing changes to climate or for comparison of data series from different sources requires the application of filters to separate short period variations from longer period trends. A common method used to smooth data is the moving average, which is a simple digital filter that can distort the resulting series due to the aliasing of the sampling period into the output series. We utilized Hamming filters to compare MSU/AMSU satellite time series developed by three research groups (UAH, RSS and NOAA STAR), the results published in January 2017 [http://journals.ametsoc.org/doi/abs/10.1175/JTECH-D-16-0121.1]. Since the last release date (July 2016) for the data analyzed in that paper, some of these groups have updated their analytical procedures and additional months of data are available to extend the series. An updated analysis of these data using the latest data releases available from each group is to be presented. Improved graphics will be employed to provide a clearer visualization of the differences between each group's results. As in the previous paper, the greatest difference between the UAH TMT series and those from the RSS and NOAA data appears during the early period of data from the MSU instruments before about 2003, as shown in the attached figure, and preliminary results indicate this pattern continues. Also to be presented are other findings regarding seasonal changes which were not included in the previous study.

  12. Initial progress in the recording of crime scene simulations using 3D laser structured light imagery techniques for law enforcement and forensic applications

    Science.gov (United States)

    Altschuler, Bruce R.; Monson, Keith L.

    1998-03-01

    Representation of crime scenes as virtual reality 3D computer displays promises to become a useful and important tool for law enforcement evaluation and analysis, forensic identification and pathological study and archival presentation during court proceedings. Use of these methods for assessment of evidentiary materials demands complete accuracy of reproduction of the original scene, both in data collection and in its eventual virtual reality representation. The recording of spatially accurate information as soon as possible after first arrival of law enforcement personnel is advantageous for unstable or hazardous crime scenes and reduces the possibility that either inadvertent measurement error or deliberate falsification may occur or be alleged concerning processing of a scene. Detailed measurements and multimedia archiving of critical surface topographical details in a calibrated, uniform, consistent and standardized quantitative 3D coordinate method are needed. These methods would afford professional personnel in initial contact with a crime scene the means for remote, non-contacting, immediate, thorough and unequivocal documentation of the contents of the scene. Measurements of the relative and absolute global positions of object sand victims, and their dispositions within the scene before their relocation and detailed examination, could be made. Resolution must be sufficient to map both small and large objects. Equipment must be able to map regions at varied resolution as collected from different perspectives. Progress is presented in devising methods for collecting and archiving 3D spatial numerical data from crime scenes, sufficient for law enforcement needs, by remote laser structured light and video imagery. Two types of simulation studies were done. One study evaluated the potential of 3D topographic mapping and 3D telepresence using a robotic platform for explosive ordnance disassembly. The second study involved using the laser mapping system on a

  13. A new technique for obtaining high-resolution pore pressure records in thick claystone aquitards and its use to determine in situ compressibility

    Science.gov (United States)

    Smith, Laura A.; van der Kamp, Garth; Jim Hendry, M.

    2013-02-01

    Laboratory tests are commonly used to determine properties (vertical compressibility, α; specific storage, SS; and vertical hydraulic conductivity, Kv) of claystone aquitards; however, whether data representative of in situ conditions can be obtained from disturbed samples is questionable. Here, we present a method to determine the in situ α and SS of a thick sequence of Cretaceous aged claystone by estimating the loading efficiency (γ) of a formation from pore pressure responses to barometric pressure fluctuations. We installed 10 vibrating wire pressure transducers at different depths (25-325 m below ground) in a thick claystone aquitard by placing them directly within the cement-bentonite grout. Two years of continuous transducer records using this method appeared to provide pore pressure data with a resolution of better than one part in 105, equivalent to millimeter of hydraulic head change. Pore pressure responses to barometric pressure changes, earth tides, and precipitation events can be clearly identified, and the barometric responses can be easily analyzed. The resulting values of γ (0.6-0.93), α (2.5 × 10-7 to 2.2 × 10-6 kPa-1), and SS (2.6 × 10-5 to 4.5 × 10-6 m-1) all decrease with depth. The results are comparable with the limited existing data for in situ estimates of SS and are as much as an order of magnitude smaller than laboratory estimates of SS for similar aquitard deposits. Our findings suggest that the fully grouted transducer method can provide an accurate and reliable means to monitor pore pressure changes and to determine in situ parameters for bedrock aquitard systems.

  14. Neutral-point voltage dynamic model of three-level NPC inverter for reactive load

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2012-01-01

    A three-level neutral-point-clamped inverter needs a controller for the neutral-point voltage. Typically, the controller design is based on a dynamic model. The dynamic model of the neutral-point voltage depends on the pulse width modulation technique used for the inverter. A pulse width modulati...

  15. Optimal Cooperative Management of Energy Storage Systems to Deal with Over- and Under-Voltages

    DEFF Research Database (Denmark)

    Mokhtari, Ghassem; Nourbakhsh, Ghavameddin; Anvari-Moghaddam, Amjad

    2017-01-01

    This paper presents an optimal cooperative voltage control approach, which coordinates storage units in a distribution network. This technique is developed for storage systems’ active power management with a local strategy to provide robust voltage control and a distributed strategy to deliver op...

  16. Mass impregnation plant speeds high voltage cable production

    Energy Technology Data Exchange (ETDEWEB)

    1965-05-07

    A mass impregnation and continuous sheath extrusion plant that will eliminate the long period of vacuum treatment usually required for high voltage oil-filled cables is among the latest techniques included in the new factory at Pirelli General's Eastleigh works. The new factory is said to be the first in Europe designed solely for the manufacture of the full range of oil-filled cables. Possible future increases of system voltages to about 750-kV ac or 1000-kV dc have been taken into account in the design of the works, so that only a small amount of modification and new plant will be involved.

  17. Buck supplies output voltage ripple reduction using fuzzy control

    Directory of Open Access Journals (Sweden)

    Nicu BIZON

    2007-12-01

    Full Text Available Using the PWM control for switching power supplies the peaks EMI noise appear at the switching frequency and its harmonics. Using randomize or chaotic PWM control techniques in these systems the power spectrum is spread out in all frequencies band spectral emissions, but with a bigger ripple in the output voltage. The proposed nonlinear feedback control method, which induces chaos, is based by fuzzy rules that minimize the output voltage ripple. The feasibility and effectiveness of this relative simple method is shown by simulation. A comparison with the previous control method is included, too.

  18. A SQUID gradiometer module with wire-wound pickup antenna and integrated voltage feedback circuit

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Guofeng [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology (SIMIT), Chinese Academy of Sciences (CAS), Shanghai 200050 (China); Peter Gruenberg Institute (PGI-8), Forschungszentrum Juelich (FZJ), D-52425 Juelich (Germany); Joint Research Laboratory on Superconductivity and Bioelectronics, Collaboration between CAS-Shanghai and FZJ, Shanghai 200050 (China); Graduate University of the Chinese Academy of Sciences, Beijing 100049 (China); Zhang, Yi, E-mail: y.zhang@fz-juelich.de [Peter Gruenberg Institute (PGI-8), Forschungszentrum Juelich (FZJ), D-52425 Juelich (Germany); Joint Research Laboratory on Superconductivity and Bioelectronics, Collaboration between CAS-Shanghai and FZJ, Shanghai 200050 (China); Zhang Shulin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology (SIMIT), Chinese Academy of Sciences (CAS), Shanghai 200050 (China); Joint Research Laboratory on Superconductivity and Bioelectronics, Collaboration between CAS-Shanghai and FZJ, Shanghai 200050 (China); Krause, Hans-Joachim [Peter Gruenberg Institute (PGI-8), Forschungszentrum Juelich (FZJ), D-52425 Juelich (Germany); Joint Research Laboratory on Superconductivity and Bioelectronics, Collaboration between CAS-Shanghai and FZJ, Shanghai 200050 (China); and others

    2012-10-15

    The performance of the direct readout schemes for dc SQUID, Additional Positive Feedback (APF), noise cancellation (NC) and SQUID bootstrap circuit (SBC), have been studied in conjunction with planar SQUID magnetometers. In this paper, we examine the NC technique applied to a niobium SQUID gradiometer module with an Nb wire-wound antenna connecting to a dual-loop SQUID chip with an integrated voltage feedback circuit for suppression of the preamplifier noise contribution. The sensitivity of the SQUID gradiometer module is measured to be about 1 fT/(cm {radical}Hz) in the white noise range in a magnetically shielded room. Using such gradiometer, both MCG and MEG signals are recorded.

  19. In search of a consensus model of the resting state of a voltage-sensing domain.

    Science.gov (United States)

    Vargas, Ernesto; Bezanilla, Francisco; Roux, Benoît

    2011-12-08

    Voltage-sensing domains (VSDs) undergo conformational changes in response to the membrane potential and are the critical structural modules responsible for the activation of voltage-gated channels. Structural information about the key conformational states underlying voltage activation is currently incomplete. Through the use of experimentally determined residue-residue interactions as structural constraints, we determine and refine a model of the Kv channel VSD in the resting conformation. The resulting structural model is in broad agreement with results that originate from various labs using different techniques, indicating the emergence of a consensus for the structural basis of voltage sensing. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Common-mode Voltage Reduction in a Motor Drive System with a Power Factor Correction

    DEFF Research Database (Denmark)

    Adabi, J.; Boora, A.A.; Zare, F.

    2012-01-01

    Common-mode voltage generated by a power converter in combination with parasitic capacitive couplings is a potential source of shaft voltage in an AC motor drive system. In this study, a three-phase motor drive system supplied with a single-phase AC-DC diode rectifier is investigated in order...... to reduce shaft voltage in a three-phase AC motor drive system. In this topology, the AC-DC diode rectifier influences the common-mode voltage generated by the inverter because the placement of the neutral point is changing in different rectifier circuit states. A pulse width modulation technique...

  1. Analyzing randomly occurring voltage breakdowns

    International Nuclear Information System (INIS)

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  2. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  3. Unequal Input Voltages Distribution Between the Serial Connected Halfbridges

    Directory of Open Access Journals (Sweden)

    Radovan Ovcarcik

    2006-01-01

    Full Text Available This paper describes a topology of DC-DC converter consisting in two serial connected half-bridges. Secondary circuit is realized like a conventional full-wave rectifier. The main advantage of this topology is the possibility of dividing the input voltage between the half-bridges. The converter is controlled using the phase-shift modulation, which allows a ZVSoperation mode. The voltage unbalance between the inputs causes an important problem of the presented topology. It is necessary to avoid it by the control algorithm, which is described in the text. The practical results show a zero voltage switching technique and the limits of the chosen topology and of the control.

  4. Genetic algorithm based reactive power dispatch for voltage stability improvement

    Energy Technology Data Exchange (ETDEWEB)

    Devaraj, D. [Department of Electrical and Electronics, Kalasalingam University, Krishnankoil 626 190 (India); Roselyn, J. Preetha [Department of Electrical and Electronics, SRM University, Kattankulathur 603 203, Chennai (India)

    2010-12-15

    Voltage stability assessment and control form the core function in a modern energy control centre. This paper presents an improved Genetic algorithm (GA) approach for voltage stability enhancement. The proposed technique is based on the minimization of the maximum of L-indices of load buses. Generator voltages, switchable VAR sources and transformer tap changers are used as optimization variables of this problem. The proposed approach permits the optimization variables to be represented in their natural form in the genetic population. For effective genetic processing, the crossover and mutation operators which can directly deal with the floating point numbers and integers are used. The proposed algorithm has been tested on IEEE 30-bus and IEEE 57-bus test systems and successful results have been obtained. (author)

  5. Low Power/Low Voltage Interface Circuitry for Capacitive Sensors

    DEFF Research Database (Denmark)

    Furst, Claus Efdmann

    This thesis focuses mainly on low power/low voltage interface circuits, implemented in CMOS, for capacitive sensors. A brief discussion of demands and possibilities for analog signal processing in the future is presented. Techniques for low power design is presented. This is done by analyzing power...... power consumption. It is shown that the Sigma-Delta modulator is advantageous when embedded in a feedback loop with a mechanical sensor. Here a micro mechanical capacitive microphone. Feedback and detection circuitry for a capacitive microphone is presented. Practical implementations of low power....../low voltage interface circuitry is presented. It is demonstrated that an amplifier optimized for a capacitive microphone implemented in a standard 0.7 micron CMOS technology competes well with a traditional JFET amplifier. Furthermore a low power/low voltage 3rd order Sigma-Delta modulator is presented...

  6. High-voltage CMOS detectors

    International Nuclear Information System (INIS)

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  7. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  8. High-voltage CMOS detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  9. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  10. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  11. Uv laser triggering of high-voltage gas switches

    International Nuclear Information System (INIS)

    Woodworth, J.R.; Frost, C.A.; Green, T.A.

    1982-01-01

    Two different techniques are discussed for uv laser triggering of high-voltage gas switches using a KrF laser (248 nm) to create an ionized channel through the dielectric gas in a spark gap. One technique uses an uv laser to induce breakdown in SF 6 . For this technique, we present data that demonstrate a 1-sigma jitter of +- 150 ps for a 0.5-MV switch at 80% of its self-breakdown voltage using a low-divergence KrF laser. The other scheme uses additives to the normal dielectric gas, such as tripropylamine, which are selected to undergo resonant two-step ionization in the uv laser field

  12. Piezoelectric self sensing actuators for high voltage excitation

    International Nuclear Information System (INIS)

    Grasso, E; Totaro, N; Janocha, H; Naso, D

    2013-01-01

    Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)

  13. Research on uncertainty evaluation measure and method of voltage sag severity

    Science.gov (United States)

    Liu, X. N.; Wei, J.; Ye, S. Y.; Chen, B.; Long, C.

    2018-01-01

    Voltage sag is an inevitable serious problem of power quality in power system. This paper focuses on a general summarization and reviews on the concepts, indices and evaluation methods about voltage sag severity. Considering the complexity and uncertainty of influencing factors, damage degree, the characteristics and requirements of voltage sag severity in the power source-network-load sides, the measure concepts and their existing conditions, evaluation indices and methods of voltage sag severity have been analyzed. Current evaluation techniques, such as stochastic theory, fuzzy logic, as well as their fusion, are reviewed in detail. An index system about voltage sag severity is provided for comprehensive study. The main aim of this paper is to propose thought and method of severity research based on advanced uncertainty theory and uncertainty measure. This study may be considered as a valuable guide for researchers who are interested in the domain of voltage sag severity.

  14. [Development of residual voltage testing equipment].

    Science.gov (United States)

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  15. A voltage to frequency converter for astronomical photometry

    Science.gov (United States)

    Dunham, E.; Elliot, J. L.

    1978-01-01

    A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.

  16. Symmetric voltage-controlled variable resistance

    Science.gov (United States)

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  17. Ultra Low-Voltage Energy Harvesting

    Science.gov (United States)

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  18. S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Yoni Haitin

    Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.

  19. Voltage Quality of Grid Connected Wind Turbines

    DEFF Research Database (Denmark)

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  20. Manufacturing technology for practical Josephson voltage normals

    International Nuclear Information System (INIS)

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  1. 49 CFR 234.221 - Lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  2. Bootstrapped Low-Voltage Analog Switches

    DEFF Research Database (Denmark)

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  3. Voltage generators of high voltage high power accelerators

    International Nuclear Information System (INIS)

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  4. On-chip high-voltage generator design design methodology for charge pumps

    CERN Document Server

    Tanzawa, Toru

    2016-01-01

    This book provides various design techniques for switched-capacitor on-chip high-voltage generators, including charge pump circuits, regulators, level shifters, references, and oscillators.  Readers will see these techniques applied to system design in order to address the challenge of how the on-chip high-voltage generator is designed for Flash memories, LCD drivers, and other semiconductor devices to optimize the entire circuit area and power efficiency with a low voltage supply, while minimizing the cost.  This new edition includes a variety of useful updates, including coverage of power efficiency and comprehensive optimization methodologies for DC-DC voltage multipliers, modeling of extremely low voltage Dickson charge pumps, and modeling and optimum design of AC-DC switched-capacitor multipliers for energy harvesting and power transfer for RFID.

  5. Optimal power and performance trade-offs for dynamic voltage scaling in power management based wireless sensor node

    Directory of Open Access Journals (Sweden)

    Anuradha Pughat

    2016-09-01

    Full Text Available Dynamic voltage scaling contributes to a significant amount of power saving, especially in the energy constrained wireless sensor networks (WSNs. Existing dynamic voltage scaling techniques make the system slower and ignore the event miss rate. This results in degradation of the system performance when there is non-stationary workload at input. The overhead due to transition between voltage level and discrete voltage levels are also the limitations of available dynamic voltage scaling (DVS techniques at sensor node (SN. This paper proposes a workload dependent DVS based MSP430 controller model used for SN. An online gradient estimation technique has been used to optimize power and performance trade-offs. The analytical results are validated with the simulation results obtained using simulation tool “SimEvents” and compared with the available AT9OS8535 controller. Based on the stochastic workload, the controller's input voltage, operational frequency, utilization, and average wait time of events are obtained.

  6. Analysis of Voltage Signals from Superconducting Accelerator Magnets

    Energy Technology Data Exchange (ETDEWEB)

    Lizarazo, J.; Caspi, S.; Ferracin, P.; Joseph, J.; Lietzke, A. F.; Sabbi, G. L.; Wang, X.

    2009-10-30

    We present two techniques used in the analysis of voltage tap data collected during recent tests of superconducting magnets developed by the Superconducting Magnet Program at Lawrence Berkeley National Laboratory. The first technique was used on a quadrupole to provide information about quench origins that could not be obtained using the time-of-flight method. The second technique illustrates the use of data from transient flux imbalances occurring during magnet ramping to diagnose changes in the current-temperature margin of a superconducting cable. In both cases, the results of this analysis contributed to make improvements on subsequent magnets.

  7. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    DEFF Research Database (Denmark)

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  8. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    Science.gov (United States)

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  9. Piezo Voltage Controlled Planar Hall Effect Devices.

    Science.gov (United States)

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  10. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    DEFF Research Database (Denmark)

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  11. Stargate: Energy Management Techniques

    OpenAIRE

    Vijay Raghunathan; Mani Srivastava; Trevor Pering; Roy Want

    2004-01-01

    This poster presents techniques for energy efficient operation of the Stargate wireless platform. In addition to conventional power management techniques such as dynamic voltage and scaling and processor shutdown, the Stargate features several mechanisms for energy efficient operation of the communication subsystem, such as support for hierarchical radios, Bluetooth based remote wakeup, mote based wakeup, etc. Finally, design optimizations including the use of power gating, and provision for ...

  12. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  13. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  14. Topologically protected loop flows in high voltage AC power grids

    International Nuclear Information System (INIS)

    Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I

    2016-01-01

    Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)

  15. Voltage imaging to understand connections and functions of neuronal circuits

    Science.gov (United States)

    Antic, Srdjan D.; Empson, Ruth M.

    2016-01-01

    Understanding of the cellular mechanisms underlying brain functions such as cognition and emotions requires monitoring of membrane voltage at the cellular, circuit, and system levels. Seminal voltage-sensitive dye and calcium-sensitive dye imaging studies have demonstrated parallel detection of electrical activity across populations of interconnected neurons in a variety of preparations. A game-changing advance made in recent years has been the conceptualization and development of optogenetic tools, including genetically encoded indicators of voltage (GEVIs) or calcium (GECIs) and genetically encoded light-gated ion channels (actuators, e.g., channelrhodopsin2). Compared with low-molecular-weight calcium and voltage indicators (dyes), the optogenetic imaging approaches are 1) cell type specific, 2) less invasive, 3) able to relate activity and anatomy, and 4) facilitate long-term recordings of individual cells' activities over weeks, thereby allowing direct monitoring of the emergence of learned behaviors and underlying circuit mechanisms. We highlight the potential of novel approaches based on GEVIs and compare those to calcium imaging approaches. We also discuss how novel approaches based on GEVIs (and GECIs) coupled with genetically encoded actuators will promote progress in our knowledge of brain circuits and systems. PMID:27075539

  16. Particle swarm optimization for determining shortest distance to voltage collapse

    Energy Technology Data Exchange (ETDEWEB)

    Arya, L.D.; Choube, S.C. [Electrical Engineering Department, S.G.S.I.T.S. Indore, MP 452 003 (India); Shrivastava, M. [Electrical Engineering Department, Government Engineering College Ujjain, MP 456 010 (India); Kothari, D.P. [Centre for Energy Studies, Indian Institute of Technology, Delhi (India)

    2007-12-15

    This paper describes an algorithm for computing shortest distance to voltage collapse or determination of CSNBP using PSO technique. A direction along CSNBP gives conservative results from voltage security view point. This information is useful to the operator to steer the system away from this point by taking corrective actions. The distance to a closest bifurcation is a minimum of the loadability given a slack bus or participation factors for increasing generation as the load increases. CSNBP determination has been formulated as an optimization problem to be used in PSO technique. PSO is a new evolutionary algorithm (EA) which is population based inspired by the social behavior of animals such as fish schooling and birds flocking. It can handle optimization problems with any complexity since mechanization is simple with few parameters to be tuned. The developed algorithm has been implemented on two standard test systems. (author)

  17. The effect of providing feedback on inhaler technique and adherence from an electronic audio recording device, INCA®, in a community pharmacy setting: study protocol for a randomised controlled trial.

    Science.gov (United States)

    O'Dwyer, Susan Mary; MacHale, Elaine; Sulaiman, Imran; Holmes, Martin; Hughes, Cian; D'Arcy, Shona; Rapcan, Viliam; Taylor, Terence; Boland, Fiona; Bosnic-Anticevich, Sinthia; Reilly, Richard B; Ryder, Sheila A; Costello, Richard W

    2016-05-04

    Poor adherence to inhaled medication may lead to inadequate symptom control in patients with respiratory disease. In practice it can be difficult to identify poor adherence. We designed an acoustic recording device, the INCA® (INhaler Compliance Assessment) device, which, when attached to an inhaler, identifies and records the time and technique of inhaler use, thereby providing objective longitudinal data on an individual's adherence to inhaled medication. This study will test the hypothesis that providing objective, personalised, visual feedback on adherence to patients in combination with a tailored educational intervention in a community pharmacy setting, improves adherence more effectively than education alone. The study is a prospective, cluster randomised, parallel-group, multi-site study conducted over 6 months. The study is designed to compare current best practice in care (i.e. routine inhaler technique training) with the use of the INCA® device for respiratory patients in a community pharmacy setting. Pharmacies are the unit of randomisation and on enrolment to the study they will be allocated by the lead researcher to one of the three study groups (intervention, comparator or control groups) using a computer-generated list of random numbers. Given the nature of the intervention neither pharmacists nor participants can be blinded. The intervention group will receive feedback from the acoustic recording device on inhaler technique and adherence three times over a 6-month period along with inhaler technique training at each of these times. The comparator group will also receive training in inhaler use three times over the 6-month study period but no feedback on their habitual performance. The control group will receive usual care (i.e. the safe supply of medicines and advice on their use). The primary outcome is the rate of participant adherence to their inhaled medication, defined as the proportion of correctly taken doses of medication at the correct

  18. A pragmatic approach to voltage stability analysis of large power systems

    Energy Technology Data Exchange (ETDEWEB)

    Sarmiento, H.G.; Pampin, G. [Inst. de Investigaciones Electricas, Morelos (Mexico); Diaz de Leon, J.A. [American Superconductor, Middleton, WI (United States)

    2008-07-01

    A methodology for performing voltage stability analyses for large power systems was presented. Modal and time-domain analyses were used for selection and siting solutions for potential voltage instability and collapse. Steady state systems were used to compute the smallest eigenvalues and associated eigenvalues of a reduced Jacobean matrix. The eigenvalues were used to provide a relative measure of proximity to voltage instability. The analysis was applied to provide an indication of a network's proximity to voltage collapse. Negative eigenvalues were representative of voltage instability conditions, while small positive values indicated proximity to voltage instability. The analysis technique was used to identify buses, lines, and generators prone to voltage instabilities for a 10-node network. A comparative analysis of results obtained from modal and time domain analyses were used to identify areas vulnerable to voltage instability conditions. Pre-fault, fault, and post-fault conditions were analyzed statically and dynamically. Results of the study showed that the combined method can be used to identify and place reactive power compensation solutions for voltage collapses in electric networks. 20 refs., 5 tabs., 7 figs.

  19. Phenological Records

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Phenology is the scientific study of periodic biological phenomena, such as flowering, breeding, and migration, in relation to climatic conditions. The few records...

  20. Modelling and application of modern control techniques to governor and voltage regulator systems of synchronous machines of small hydroelectric power plants; Modelagem e aplicacao de tecnicas de controle moderno a sistemas reguladores de velocidade e tensao de maquinas sincronas de pequenas centrais hidreletricas

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Claudio Homero Ferreira da

    2002-07-01

    In small hydroelectric plants the control system is quite simplified. It is sometimes mounted in a primitive and archaic way although it is functional. Performance of this system determines the final quality of the energy, stability and physical integrity of the apparatus as well as the whole electric system. Based on the present situation of the electric system, it is noticed a tendency in building and modernizing early small hydroelectric plants in order to increase energy supply very fast with low cost and satisfying environmental constraints. The development of mathematical tools and digital computer facilities have made possible the use of advanced automatic control structures that take into account the process stability even in presence of noise measurement and plant/model mismatch. Physical modifications in the plant are proposed in order to provide significant improvement in closed loop behaviour of the turbine speed and terminal voltage control. The decision ability and flexibility of the computer package to be developed are the major aspects that support this research. It will be intended to incorporate this control computer package into programmable logical controller. Experimental data from CEMIG's Martins Hydro Plant (4 x 2750 KVA), located in Uberlandia, Brazil, were used to identify and validate the system model. Pole placement, optimal control and model predictive control techniques were used to controller design. Perfect modeling and plant/model mismatch were considered in both presence and absence of state observers (full order and reduced order) in order to become accessible unmeasured states. Simulation results show developed controllers are promising for the system regulating. The proposed approaches offer a larger control flexibility taking into account plant/model mismatch and stability questions. These results contribute to a quality energy improvement associated to a cost reduction in energy generation process. (author)

  1. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    OpenAIRE

    Wilders, R.; Jongsma, H.J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  2. A seismic recording device

    Energy Technology Data Exchange (ETDEWEB)

    Dixon, R; Kind, A G; Thompson, S R

    1983-06-08

    A method and a device for noting the moment of an explosion on a seismic recording is proposed, in which the moment of the explosion is recorded as a result of a break in an electrical circuit under the effects of the explosive charge used to excite the seismic waves. The electrical circuit being broken is connected to the same energy source as the electric detonator which initiates the explosion, which is attached to a high frequency, alternating current source, where the circuit being broken is either the primary or the secondary winding of a transformer, through which the electric detonator is switched in to the source. The moment the circuit is broken is determined from the ceasation of current in the circuit or by the sharp rise in voltage in the broken sector. The method makes it possible to more precisely fix the moment of the break than the existing methods. When insulated copper wires are used the recording of the time occurs 100 microseconds after the explosion.

  3. Phase-lock loop of Grid-connected Voltage Source Converter under non-ideal grid condition

    DEFF Research Database (Denmark)

    Wang, Haojie; Sun, Hai; Han, Minxiao

    2015-01-01

    It is a normal practice that the DC micro-grid is connected to AC main grid through Grid-connected Voltage Source Converter (G-VSC) for voltage support. Accurate control of DC micro-grid voltage is difficult for G-VSC under unbalanced grid condition as the fundamental positive-sequence component...... and distorted system voltage the proposed PLL can accurately detect the fundamental positive-sequence component of grid voltage thus accurate control of DC micro-grid voltage can be realized....... phase information cannot be accurately tracked. Based on analysis of the cause of double-frequency ripple when unbalance exists in main grid, a phase-locked loop (PLL) detection technique is proposed. Under the conditions of unsymmetrical system voltage, varying system frequency, single-phase system...

  4. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  5. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium

    Directory of Open Access Journals (Sweden)

    Adela Banciu

    2018-05-01

    Full Text Available Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1, estrogen receptors (ESR1, ESR2, GPR30, and nuclear receptor coactivator 3 (NCOA3. Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM antagonized the effect of BAY K8644 (2.5 or 5 µM in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant

  6. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium.

    Science.gov (United States)

    Banciu, Adela; Banciu, Daniel Dumitru; Mustaciosu, Cosmin Catalin; Radu, Mihai; Cretoiu, Dragos; Xiao, Junjie; Cretoiu, Sanda Maria; Suciu, Nicolae; Radu, Beatrice Mihaela

    2018-05-09

    Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs) contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1), estrogen receptors (ESR1, ESR2, GPR30), and nuclear receptor coactivator 3 (NCOA3). Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM) downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM) antagonized the effect of BAY K8644 (2.5 or 5 µM) in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant human uterine

  7. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  8. Theoretical analysis of magnetic sensor output voltage

    International Nuclear Information System (INIS)

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  9. Voltage-Controlled Floating Resistor Using DDCC

    Directory of Open Access Journals (Sweden)

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  10. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  11. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    OpenAIRE

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  12. High voltage investigations for ITER coils

    International Nuclear Information System (INIS)

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  13. A high open-circuit voltage gallium nitride betavoltaic microbattery

    International Nuclear Information System (INIS)

    Cheng, Zaijun; Chen, Xuyuan; San, Haisheng; Feng, Zhihong; Liu, Bo

    2012-01-01

    A high open-circuit voltage betavoltaic microbattery based on a gallium nitride (GaN) p–i–n homojunction is demonstrated. As a beta-absorbing layer, the low electron concentration of the n-type GaN layer is achieved by the process of Fe compensation doping. Under the irradiation of a planar solid 63 Ni source with activity of 0.5 mCi, the open-circuit voltage of the fabricated microbattery with 2 × 2 mm 2 area reaches as much as 1.64 V, which is the record value reported for betavoltaic batteries with 63 Ni source, the short-circuit current was measured as 568 pA and the conversion effective of 0.98% was obtained. The experimental results suggest that GaN is a high-potential candidate for developing the betavoltaic microbattery. (paper)

  14. High voltage generator circuit with low power and high efficiency applied in EEPROM

    International Nuclear Information System (INIS)

    Liu Yan; Zhang Shilin; Zhao Yiqiang

    2012-01-01

    This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

  15. Non-contact current and voltage sensing method using a clamshell housing and a ferrite cylinder

    Science.gov (United States)

    Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael

    2016-04-26

    A method of measurement using a detachable current and voltage sensor provides an isolated and convenient technique for to measuring current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  16. Maximum permissible voltage of YBCO coated conductors

    Energy Technology Data Exchange (ETDEWEB)

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  17. Microprocessor-controlled, programmable ramp voltage generator

    International Nuclear Information System (INIS)

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  18. Low-Voltage Switched-Capacitor Circuits

    DEFF Research Database (Denmark)

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  19. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  20. Identification of voltage collapse point in self excited induction generator

    Directory of Open Access Journals (Sweden)

    Kalyanasundaram Rajambal

    2009-10-01

    Full Text Available This paper presents a direct equilibrium tracing method for identifying the voltage collapse point of a self-excitedinduction generator (SEIG without many trials. The technique solves differential and algebraic equations simultaneously toobtain the variables in a single step. The load parameter is also automatically varied during equilibrium tracing and thisreduces the computational time significantly. Comparing the simulation results obtained through conventional iterative procedure shows the effectiveness of the technique. An experimental verification on a 1.5KW induction machine validates the simulation results.

  1. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  2. Accurate measurement of junctional conductance between electrically coupled cells with dual whole-cell voltage-clamp under conditions of high series resistance.

    Science.gov (United States)

    Hartveit, Espen; Veruki, Margaret Lin

    2010-03-15

    Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.

  3. Electric characterization of GaAs deposited on porous silicon by electrodeposition technique

    International Nuclear Information System (INIS)

    Lajnef, M.; Chtourou, R.; Ezzaouia, H.

    2010-01-01

    GaAs thin films were synthesized on porous Si substrate by the electrodeposition technique. The X-ray diffraction studies showed that the as-grown films were crystallised in mixed phase nature orthorhombic and cubic of GaAs. The GaAs film was then electrically characterized using current-voltage (I-V) and capacitance-voltage (C-V) techniques by the way of Al/GaAs Schottky junctions. The electric analysis allowed us to determine the n factor and the barrier height φ b0 parameters of Al/GaAs Schottky junctions. The (C-V) characteristics were recorded at frequency signal 1 MHz in order to identify the effect of the surface states on the behaviour of the capacitance of the device.

  4. Electric characterization of GaAs deposited on porous silicon by electrodeposition technique

    Energy Technology Data Exchange (ETDEWEB)

    Lajnef, M., E-mail: Mohamed.lajnef@yahoo.fr [Laboratoire de Photovoltaique et de Semi-conducteurs, Centre de Recherche et des Technologies de l' Energie, BP. 95, Hammam-Lif 2050 (Tunisia); Chtourou, R.; Ezzaouia, H. [Laboratoire de Photovoltaique et de Semi-conducteurs, Centre de Recherche et des Technologies de l' Energie, BP. 95, Hammam-Lif 2050 (Tunisia)

    2010-03-01

    GaAs thin films were synthesized on porous Si substrate by the electrodeposition technique. The X-ray diffraction studies showed that the as-grown films were crystallised in mixed phase nature orthorhombic and cubic of GaAs. The GaAs film was then electrically characterized using current-voltage (I-V) and capacitance-voltage (C-V) techniques by the way of Al/GaAs Schottky junctions. The electric analysis allowed us to determine the n factor and the barrier height {phi}{sub b0} parameters of Al/GaAs Schottky junctions. The (C-V) characteristics were recorded at frequency signal 1 MHz in order to identify the effect of the surface states on the behaviour of the capacitance of the device.

  5. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  6. Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

    Science.gov (United States)

    Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

    2012-02-14

    Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

  7. RECORDS REACHING RECORDING DATA TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    G. W. L. Gresik

    2013-07-01

    Full Text Available The goal of RECORDS (Reaching Recording Data Technologies is the digital capturing of buildings and cultural heritage objects in hard-to-reach areas and the combination of data. It is achieved by using a modified crane from film industry, which is able to carry different measuring systems. The low-vibration measurement should be guaranteed by a gyroscopic controlled advice that has been , developed for the project. The data were achieved by using digital photography, UV-fluorescence photography, infrared reflectography, infrared thermography and shearography. Also a terrestrial 3D laser scanner and a light stripe topography scanner have been used The combination of the recorded data should ensure a complementary analysis of monuments and buildings.

  8. Records Reaching Recording Data Technologies

    Science.gov (United States)

    Gresik, G. W. L.; Siebe, S.; Drewello, R.

    2013-07-01

    The goal of RECORDS (Reaching Recording Data Technologies) is the digital capturing of buildings and cultural heritage objects in hard-to-reach areas and the combination of data. It is achieved by using a modified crane from film industry, which is able to carry different measuring systems. The low-vibration measurement should be guaranteed by a gyroscopic controlled advice that has been , developed for the project. The data were achieved by using digital photography, UV-fluorescence photography, infrared reflectography, infrared thermography and shearography. Also a terrestrial 3D laser scanner and a light stripe topography scanner have been used The combination of the recorded data should ensure a complementary analysis of monuments and buildings.

  9. Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

    Science.gov (United States)

    Teverovsky, Alexander A.

    2016-01-01

    Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

  10. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  11. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  12. Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

    DEFF Research Database (Denmark)

    Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

    2014-01-01

    This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

  13. On-site voltage measurement with capacitive sensors on high voltage systems

    NARCIS (Netherlands)

    Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

    2011-01-01

    In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

  14. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    Science.gov (United States)

    2011-11-22

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

  15. Modeling and Simulation of Low Voltage Arcs

    NARCIS (Netherlands)

    Ghezzi, L.; Balestrero, A.

    2010-01-01

    Modeling and Simulation of Low Voltage Arcs is an attempt to improve the physical understanding, mathematical modeling and numerical simulation of the electric arcs that are found during current interruptions in low voltage circuit breakers. An empirical description is gained by refined electrical

  16. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  17. Time isolation high-voltage impulse generator

    International Nuclear Information System (INIS)

    Chodorow, A.M.

    1975-01-01

    Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation

  18. High-voltage engineering and testing

    CERN Document Server

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  19. Improving transition voltage spectroscopy of molecular junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...

  20. Reducing Ripple In A Switching Voltage Regulator

    Science.gov (United States)

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  1. Digital Realization of Capacitor-Voltage Feedback Active Damping for LCL-Filtered Grid Converters

    DEFF Research Database (Denmark)

    Xin, Zhen; Wang, Xiongfei; Loh, Poh Chiang

    2015-01-01

    The capacitor voltage of an LCL-filter can also be used for active damping, if it is fed back for synchronization. By this way, an extra current sensor can be avoided. Compared with the existing active damping techniques designed with capacitor current feedback, the capacitor voltage feedback....... To overcome their drawbacks, a new derivative method is then proposed, based on the non-ideal generalized integrator. The performance of the proposed derivative has been found to match the ideal “s” function closely. Active damping based on capacitor voltage feedback can therefore be realized accurately...

  2. Highly Accurate Derivatives for LCL-Filtered Grid Converter with Capacitor Voltage Active Damping

    DEFF Research Database (Denmark)

    Xin, Zhen; Loh, Poh Chiang; Wang, Xiongfei

    2016-01-01

    The middle capacitor voltage of an LCL-filter, if fed back for synchronization, can be used for active damping. An extra sensor for measuring the capacitor current is then avoided. Relating the capacitor voltage to existing popular damping techniques designed with capacitor current feedback would...... are then proposed, based on either second-order or non-ideal generalized integrator. Performances of these derivatives have been found to match the ideal “s” function closely. Active damping based on capacitor voltage feedback can therefore be realized accurately. Experimental results presented have verified...

  3. Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

    DEFF Research Database (Denmark)

    Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

    2010-01-01

    introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

  4. Wide-range voltage modulation

    International Nuclear Information System (INIS)

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  5. Scheduling and Voltage Scaling for Energy/Reliability Trade-offs in Fault-Tolerant Time-Triggered Embedded Systems

    DEFF Research Database (Denmark)

    Pop, Paul; Poulsen, Kåre Harbo; Izosimov, Viacheslav

    2007-01-01

    -execution and dynamic voltage scaling-based low-power techniques are competing for the slack in the schedules. Our approach decides the voltage levels and start times of processes and the transmission times of messages, such that the transient faults are tolerated, the timing constraints of the application...

  6. Non-contact current and voltage sensor

    Science.gov (United States)

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  7. Coordinated Voltage Control of Active Distribution Network

    Directory of Open Access Journals (Sweden)

    Xie Jiang

    2016-01-01

    Full Text Available This paper presents a centralized coordinated voltage control method for active distribution network to solve off-limit problem of voltage after incorporation of distributed generation (DG. The proposed method consists of two parts, it coordinated primal-dual interior point method-based voltage regulation schemes of DG reactive powers and capacitors with centralized on-load tap changer (OLTC controlling method which utilizes system’s maximum and minimum voltages, to improve the qualified rate of voltage and reduce the operation numbers of OLTC. The proposed coordination has considered the cost of capacitors. The method is tested using a radial edited IEEE-33 nodes distribution network which is modelled using MATLAB.

  8. High voltage processing of the SLC polarized electron gun

    International Nuclear Information System (INIS)

    Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

    1993-04-01

    The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. High voltage wide range marx generator design and construction

    International Nuclear Information System (INIS)

    Thompson, J.E.

    1976-01-01

    A wide range, long pulse, Marx generator has been designed and constructed for the purpose of exciting a thermionic electron gun utilized for quasi-cw gas laser medium ionization. The Marx generator has been specifically designed to operate over a voltage range variable from 100 kV to 200 kV into a resistive load of between 83 kΩ and open circuit. This wide operating range, both in voltage and load impedance, was obtained using interstage coupling capacitors to assure overvoltage and subsequent breakdown of the three element spark gap switches used. This paper will discuss the motivation and specific application for the Marx generator and will present the relevant design procedure with particular emphasis on the interstage coupling and triggering techniques employed. Experimental data regarding the measured Marx generator performance will also be presented

  11. A high-voltage triggered pseudospark discharge experiment

    International Nuclear Information System (INIS)

    Ramaswamy, K.; Destler, W.W.; Rodgers, J.

    1996-01-01

    The design and execution of a pulsed high-voltage (350 endash 400 keV) triggered pseudospark discharge experiment is reported. Experimental studies were carried out to obtain an optimal design for stable and reliable pseudospark operation in a high-voltage regime (approx-gt 350 kV). Experiments were performed to determine the most suitable fill gas for electron-beam formation. The pseudospark discharge is initiated by a trigger mechanism involving a flashover between the trigger electrode and hollow cathode housing. Experimental results characterizing the electron-beam energy using the range-energy method are reported. Source size imaging was carried out using an x-ray pinhole camera and a novel technique using Mylar as a witness plate. It was experimentally determined that strong pinching occurred later in time and was associated with the lower-energy electrons. copyright 1996 American Institute of Physics

  12. Child-Langmuir flow with periodically varying anode voltage

    International Nuclear Information System (INIS)

    Rokhlenko, A.

    2015-01-01

    Using the Lagrangian technique, we study settled Child-Langmuir flows in a one dimensional planar diodes whose anode voltages periodically vary around given positive values. Our goal is to find analytically if the average currents in these systems can exceed the famous Child-Langmuir limit found for the stationary current a long time ago. The main result of our study is that in a periodic quasi-stationary regime the average current can be larger than the Child-Langmuir maximum even by 50% compared with its adiabatic average value. The cathode current in this case has the form of rectangular pulses which are formed by a very special triangular voltage modulation. This regime, i.e., periodicity, shape of pulses, and their amplitude, needs to be carefully chosen for the best performance

  13. Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

    Directory of Open Access Journals (Sweden)

    Perić Dragoslav M.

    2015-01-01

    Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

  14. Quantitative analysis of dual whole-cell voltage-clamp determination of gap junctional conductance

    NARCIS (Netherlands)

    van Rijen, H. V.; Wilders, R.; van Ginneken, A. C.; Jongsma, H. J.

    1998-01-01

    The dual whole-cell voltage-clamp technique is used widely for determination of kinetics and conductance of gap junctions. The use of this technique may, however, occasion to considerable errors. We have analysed the errors in steady state junctional conductance measurements under different

  15. Consciousness can reduce the voltage of the output signal of solar cell

    Science.gov (United States)

    Cao, Dayong

    2010-10-01

    When the sun's light radiate on the solar cell, the solar cell can produce the output signal as the photocurrent. We use the Data Acquisition Modules to record the voltage of the output signals. The v1 is voltage of the output signal of solar cell1; The v2 is the one of solar cell2. And these two solar cells stay side by side. When we record the voltage of the output signal from the morning to the noon, the voltage of the output signals will go up, and the v1 is bigger than the v2 during this time. But when the experimenter use consciousness to reduce the voltage of the output signals. That is to say: not only natural light ratiade on two solar cells, but also consciousness act on two solar cells. Not only I can use consciousness to reduce the growth voltage of the output signals, but also can change the v1 to be littler than the v2. The experiment was conducted on Sep. 2010. There is the physical system of the mass, energy, space and time-MEST; There is the spirited system of the mind, consciousness, emotion and desire-MECD; the information system is the code system. We can use them to develop photoelectric principle, life technology and Nanotech of semiconductor for consciousness effect.

  16. Feasibility of Stochastic Voltage/VAr Optimization Considering Renewable Energy Resources for Smart Grid

    Science.gov (United States)

    Momoh, James A.; Salkuti, Surender Reddy

    2016-06-01

    This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.

  17. Electrical Tree Initiation and Growth in Silicone Rubber under Combined DC-Pulse Voltage

    Directory of Open Access Journals (Sweden)

    Tao Han

    2018-03-01

    Full Text Available Electrical tree is a serious threat to silicone rubber (SIR insulation and can even cause breakdown. Electrical trees under alternating current (AC and direct current (DC voltage have been widely researched. While there are pulses in high-voltage direct current (HVDC cables under operating conditions caused by lightning and operating overvoltage in the power system, little research has been reported about trees under combined DC-pulse voltage. Their inception and growth mechanism is still not clear. In this paper, electrical trees are studied under several types of combined DC-pulse voltage. The initiation and growth process was recorded by a digital microscope system. The experimental results indicate that the inception pulse voltage is different under each voltage type and is influenced by the combined DC. The initial tree has two structures, determined by the pulse polarity. With increased DC prestressing time, tree inception pulse voltage with the same polarity is clearly decreased. Moreover, a special initial bubble tree was observed after the prestressing DC.

  18. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  19. Ion channel recordings on an injection-molded polymer chip.

    Science.gov (United States)

    Tanzi, Simone; Matteucci, Marco; Christiansen, Thomas Lehrmann; Friis, Søren; Christensen, Mette Thylstrup; Garnaes, Joergen; Wilson, Sandra; Kutchinsky, Jonatan; Taboryski, Rafael

    2013-12-21

    In this paper, we demonstrate recordings of the ion channel activity across the cell membrane in a biological cell by employing the so-called patch clamping technique on an injection-molded polymer microfluidic device. The findings will allow direct recordings of ion channel activity to be made using the cheapest materials and production platform to date and with the potential for very high throughput. The employment of cornered apertures for cell capture allowed the fabrication of devices without through holes and via a scheme comprising master origination by dry etching in a silicon substrate, electroplating in nickel and injection molding of the final part. The most critical device parameters were identified as the length of the patching capillary and the very low surface roughness on the inside of the capillary. The cross-sectional shape of the orifice was found to be less critical, as both rectangular and semicircular profiles seemed to have almost the same ability to form tight seals with cells with negligible leak currents. The devices were functionally tested using human embryonic kidney cells expressing voltage-gated sodium channels (Nav1.7) and benchmarked against a commercial state-of-the-art system for automated ion channel recordings. These experiments considered current-voltage (IV) relationships for activation and inactivation of the Nav1.7 channels and their sensitivity to a local anesthetic, lidocaine. Both IVs and lidocaine dose-response curves obtained from the injection-molded polymer device were in good agreement with data obtained from the commercial system.

  20. Vinyl Record

    DEFF Research Database (Denmark)

    Bartmanski, Dominik; Woodward, Ian

    2018-01-01

    . This relational process means that both the material affordances and entanglements of vinyl allow us to feel, handle, experience, project, and share its iconicity. The materially mediated meanings of vinyl enabled it to retain currency in independent and collector’s markets and thus resist the planned......In this paper, we use the case of the vinyl record to show that iconic objects become meaningful via a dual process. First, they offer immersive engagements which structure user interpretations through various material experiences of handling, use, and extension. Second, they always work via...

  1. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    International Nuclear Information System (INIS)

    Smallwood, Jeremy; Swenson, David E

    2011-01-01

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest 'peaks' and 'valleys' of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  2. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    Science.gov (United States)

    Smallwood, Jeremy; Swenson, David E.

    2011-06-01

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest "peaks" and "valleys" of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  3. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    Energy Technology Data Exchange (ETDEWEB)

    Smallwood, Jeremy [Electrostatic Solutions Ltd (United Kingdom); Swenson, David E, E-mail: jeremys@static-sol.com [Affinity Static Control Consulting LLC (United States)

    2011-06-23

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest 'peaks' and 'valleys' of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  4. Novel Voltage limiting concept for avalance breakdown protection

    NARCIS (Netherlands)

    Ruijs, L.C.H.; Bezooijen, van A.; Mahmoudi, R.; Roermund, van A.H.M.

    2006-01-01

    Destructive over-voltage breakdown of cellular phone power transistors is prevented by using a new voltage-limiting concept. The output voltage is detected by an avalanche-based detector, and limited by decreasing the output power when needed. The voltage detector contains a low voltage bipolar NPN

  5. Time-Domain Voltage Sag State Estimation Based on the Unscented Kalman Filter for Power Systems with Nonlinear Components

    Directory of Open Access Journals (Sweden)

    Rafael Cisneros-Magaña

    2018-06-01

    Full Text Available This paper proposes a time-domain methodology based on the unscented Kalman filter to estimate voltage sags and their characteristics, such as magnitude and duration in power systems represented by nonlinear models. Partial and noisy measurements from the electrical network with nonlinear loads, used as data, are assumed. The characteristics of voltage sags can be calculated in a discrete form with the unscented Kalman filter to estimate all the busbar voltages; being possible to determine the rms voltage magnitude and the voltage sag starting and ending time, respectively. Voltage sag state estimation results can be used to obtain the power quality indices for monitored and unmonitored busbars in the power grid and to design adequate mitigating techniques. The proposed methodology is successfully validated against the results obtained with the time-domain system simulation for the power system with nonlinear components, being the normalized root mean square error less than 3%.

  6. PI and Fuzzy Control Strategies for High Voltage Output DC-DC Boost Power Converter - Hardware Implementation and Analysis

    DEFF Research Database (Denmark)

    Padmanaban, Sanjeevi Kumar; Blaabjerg, Frede; Siano, Pierluigi

    2016-01-01

    This paper presents the control strategies by Proportional-Integral (P-I) and Fuzzy Logic (FL) for a DC-DC boost power converter for high output voltage configuration. Standard DC-DC converters are traditionally used for high voltage direct current (HVDC) power transmission systems. But, lack its...... converter with inbuilt voltage-lift technique and overcome the aforementioned deficiencies. Further, the control strategy is adapted based on proportional-integral (P-I) and fuzzy logic, closed-loop controller to regulate the outputs and ensure the performances. Complete hardware prototype of EHV converter...... performances in terms of efficiency, reduced transfer gain and increased cost with sensor units. Moreover, the internal self-parasitic components reduce the output voltage and efficiency of classical high voltage converters (HVC). This investigation focused on extra high-voltage (EHV) DC-DC boost power...

  7. Fuel Cell/Electrochemical Cell Voltage Monitor

    Science.gov (United States)

    Vasquez, Arturo

    2012-01-01

    A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

  8. Record Club

    CERN Multimedia

    Record Club

    2011-01-01

    http://cern.ch/Record.Club November  Selections Just in time for the holiday season, we have added a number of new CDs and DVDs into the Club. You will find the full lists at http://cern.ch/record.club; select the "Discs of the Month" button on the left side on the left panel of the web page and then Nov 2011. New films include the all 5 episodes of Fast and Furious, many of the most famous films starring Jean-Paul Belmondo and those of Louis de Funes and some more recent films such as The Lincoln Lawyer and, according to some critics, Woody Allen’s best film for years – Midnight in Paris. For the younger generation there is Cars 2 and Kung Fu Panda 2. New CDs include the latest releases by Adele, Coldplay and the Red Hot Chili Peppers. We have also added the new Duets II CD featuring Tony Bennett singing with some of today’s pop stars including Lady Gaga, Amy Winehouse and Willy Nelson. The Club is now open every Monday, Wednesday and Friday ...

  9. Record Club

    CERN Multimedia

    Record Club

    2011-01-01

    http://cern.ch/Record.Club June Selections We have put a significant number of new CDs and DVDs into the Club You will find the full lists at http://cern.ch/record.club and select the «Discs of the Month» button on the left side on the left panel of the web page and then June 2011. New films include the latest Action, Suspense and Science Fiction film hits, general drama movies including the Oscar-winning The King’s Speech, comedies including both chapter of Bridget Jones’s Diary, seven films for children and a musical. Other highlights include the latest Harry Potter release and some movies from the past you may have missed including the first in the Terminator series. New CDs include the latest releases by Michel Sardou, Mylene Farmer, Jennifer Lopez, Zucchero and Britney Spears. There is also a hits collection from NRJ. Don’t forget that the Club is now open every Monday, Wednesday and Friday lunchtimes from 12h30 to 13h00 in Restaurant 2, Building 504. (C...

  10. Record club

    CERN Document Server

    Record club

    2010-01-01

      Bonjour a tous, Voici les 24 nouveaux DVD de Juillet disponibles depuis quelques jours, sans oublier les 5 CD Pop musique. Découvrez la saga du terroriste Carlos, la vie de Gainsbourg et les aventures de Lucky Luke; angoissez avec Paranormal Activity et évadez vous sur Pandora dans la peau d’Avatar. Toutes les nouveautés sont à découvrir directement au club. Pour en connaître la liste complète ainsi que le reste de la collection du Record Club, nous vous invitons sur notre site web: http://cern.ch/crc. Toutes les dernières nouveautés sont dans la rubrique « Discs of the Month ». Rappel : le club est ouvert les Lundis, Mercredis, Vendredis de 12h30 à 13h00 au restaurant n°2, bâtiment 504. A bientôt chers Record Clubbers.  

  11. Record Club

    CERN Multimedia

    Record Club

    2011-01-01

    http://cern.ch/Record.Club Nouveautés été 2011 Le club de location de CDs et de DVDs vient d’ajouter un grand nombre de disques pour l’été 2011. Parmi eux, Le Discours d’un Roi, oscar 2011 du meilleur film et Harry Potter les reliques de la mort (1re partie). Ce n’est pas moins de 48 DVDs et 10 CDs nouveaux qui vous sont proposés à la location. Il y en a pour tous les genres. Alors n’hésitez pas à consulter notre site http://cern.ch/record.club, voir Disc Catalogue, Discs of the month pour avoir la liste complète. Le club est ouvert tous les Lundi, Mercredi, Vendredi de 12h30 à 13h dans le bâtiment du restaurent N°2 (Cf. URL: http://www.cern.ch/map/building?bno=504) A très bientôt.  

  12. High voltage electricity installations a planning perspective

    CERN Document Server

    Jay, Stephen Andrew

    2006-01-01

    The presence of high voltage power lines has provoked widespread concern for many years. High Voltage Electricity Installations presents an in-depth study of policy surrounding the planning of high voltage installations, discussing the manner in which they are percieved by the public, and the associated environmental issues. An analysis of these concerns, along with the geographical, environmental and political influences that shape their expression, is presented. Investigates local planning policy in an area of the energy sector that is of highly topical environmental and public concern Cover

  13. Investigation of voltage swell mitigation using STATCOM

    International Nuclear Information System (INIS)

    Razak, N A Abdul; Jaafar, S; Hussain, I S

    2013-01-01

    STATCOM is one of the best applications of a self commutated FACTS device to control power quality problems in the distribution system. This project proposed a STATCOM model with voltage control mechanism. DQ transformation was implemented in the controller system to achieve better estimation. Then, the model was used to investigate and analyse voltage swell problem in distribution system. The simulation results show that voltage swell could contaminate distribution network with unwanted harmonic frequencies. Negative sequence frequencies give harmful effects to the network. System connected with proposed STATCOM model illustrates that it could mitigate this problems efficiently.

  14. Digital SLIFER Recorder, Model A

    International Nuclear Information System (INIS)

    Breding, D.R.; Fogel, D.; Loukota, J.J.; Worthen, G.S.; Watterberg, J.P.

    1977-11-01

    The Digital SLIFER Recorder (DSR) is an instrument that records a time-varying frequency signal in the range from 700 kHz to 1500 kHz with an amplitude greater than 200 mV. This signal is referenced to an input fiducial marker, and recording is initiated by an increase in the frequency of the signal. The primary purpose of this instrument is to record data from the SLIFER system. The DSR records 512 samples after the record trigger signal, with a sample interval of 50 μs (for a total recording time of 25.55 ms). The measurement essentially uses a 20-cycle period-averaging counter technique

  15. Comparison of a web-based food record tool and a food-frequency questionnaire and objective validation using the doubly labelled water technique in a Swedish middle-aged population.

    Science.gov (United States)

    Nybacka, Sanna; Bertéus Forslund, Heléne; Wirfält, Elisabet; Larsson, Ingrid; Ericson, Ulrika; Warensjö Lemming, Eva; Bergström, Göran; Hedblad, Bo; Winkvist, Anna; Lindroos, Anna Karin

    2016-01-01

    Two web-based dietary assessment tools have been developed for use in large-scale studies: the Riksmaten method (4-d food record) and MiniMeal-Q (food-frequency method). The aim of the present study was to examine the ability of these methods to capture energy intake against objectively measured total energy expenditure (TEE) with the doubly labelled water technique (TEE DLW ), and to compare reported energy and macronutrient intake. This study was conducted within the pilot study of the Swedish CArdioPulmonary bioImage Study (SCAPIS), which included 1111 randomly selected men and women aged 50-64 years from the Gothenburg general population. Of these, 200 were enrolled in the SCAPIS diet substudy. TEE DLW was measured in a subsample ( n 40). Compared with TEE DLW , both methods underestimated energy intake: -2·5 (sd  2·9) MJ with the Riksmaten method; -2·3 (sd 3·6) MJ with MiniMeal-Q. Mean reporting accuracy was 80 and 82 %, respectively. The correlation between reported energy intake and TEE DLW was r 0·4 for the Riksmaten method ( P  < 0·05) and r 0·28 (non-significant) for MiniMeal-Q. Women reported similar average intake of energy and macronutrients in both methods whereas men reported higher intakes with the Riksmaten method. Energy-adjusted correlations ranged from 0·14 (polyunsaturated fat) to 0·77 (alcohol). Bland-Altman plots showed acceptable agreement for energy and energy-adjusted protein and carbohydrate intake, whereas the agreement for fat intake was poorer. According to energy intake data, both methods displayed similar precision on energy intake reporting. However, MiniMeal-Q was less successful in ranking individuals than the Riksmaten method. The development of methods to achieve limited under-reporting is a major challenge for future research.

  16. RECORD CLUB

    CERN Multimedia

    Record Club

    2010-01-01

    DVD James Bond – Series Complete To all Record Club Members, to start the new year, we have taken advantage of a special offer to add copies of all the James Bond movies to date, from the very first - Dr. No - to the latest - Quantum of Solace. No matter which of the successive 007s you prefer (Sean Connery, George Lazenby, Roger Moore, Timothy Dalton, Pierce Brosnan or Daniel Craig), they are all there. Or perhaps you have a favourite Bond Girl, or even perhaps a favourite villain. Take your pick. You can find the full selection listed on the club web site http://cern.ch/crc; use the panel on the left of the page “Discs of the Month” and select Jan 2010. We remind you that we are open on Mondays, Wednesdays and Fridays from 12:30 to 13:00 in Restaurant 2 (Bldg 504).

  17. Record dynamics

    DEFF Research Database (Denmark)

    Robe, Dominic M.; Boettcher, Stefan; Sibani, Paolo

    2016-01-01

    When quenched rapidly beyond their glass transition, colloidal suspensions fall out of equilibrium. The pace of their dynamics then slows down with the system age, i.e., with the time elapsed after the quench. This breaking of time translational invariance is associated with dynamical observables...... which depend on two time-arguments. The phenomenology is shared by a broad class of aging systems and calls for an equally broad theoretical description. The key idea is that, independent of microscopic details, aging systems progress through rare intermittent structural relaxations that are de......-facto irreversible and become increasingly harder to achieve. Thus, a progression of record-sized dynamical barriers are traversed in the approach to equilibration. Accordingly, the statistics of the events is closely described by a log-Poisson process. Originally developed for relaxation in spin glasses...

  18. Record breakers

    CERN Multimedia

    Antonella Del Rosso

    2012-01-01

    In the sixties, CERN’s Fellows were but a handful of about 50 young experimentalists present on site to complete their training. Today, their number has increased to a record-breaking 500. They come from many different fields and are spread across CERN’s different activity areas.   “Diversifying the Fellowship programme has been the key theme in recent years,” comments James Purvis, Head of the Recruitment, Programmes and Monitoring group in the HR Department. “In particular, the 2005 five-yearly review introduced the notion of ‘senior’ and ‘junior’ Fellowships, broadening the target audience to include those with Bachelor-level qualifications.” Diversification made CERN’s Fellowship programme attractive to a wider audience but the number of Fellows on site could not have increased so much without the support of EU-funded projects, which were instrumental in the growth of the programme. ...

  19. Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations.

    Science.gov (United States)

    Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

    2017-09-15

    The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

  20. High performance Si nanowire field-effect-transistors based on a CMOS inverter with tunable threshold voltage.

    Science.gov (United States)

    Van, Ngoc Huynh; Lee, Jae-Hyun; Sohn, Jung Inn; Cha, Seung Nam; Whang, Dongmok; Kim, Jong Min; Kang, Dae Joon

    2014-05-21

    We successfully fabricated nanowire-based complementary metal-oxide semiconductor (NWCMOS) inverter devices by utilizing n- and p-type Si nanowire field-effect-transistors (NWFETs) via a low-temperature fabrication processing technique. We demonstrate that NWCMOS inverter devices can be operated at less than 1 V, a significantly lower voltage than that of typical thin-film based complementary metal-oxide semiconductor (CMOS) inverter devices. This low-voltage operation was accomplished by controlling the threshold voltage of the n-type Si NWFETs through effective management of the nanowire (NW) doping concentration, while realizing high voltage gain (>10) and ultra-low static power dissipation (≤3 pW) for high-performance digital inverter devices. This result offers a viable means of fabricating high-performance, low-operation voltage, and high-density digital logic circuits using a low-temperature fabrication processing technique suitable for next-generation flexible electronics.

  1. Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations

    Science.gov (United States)

    Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

    2017-09-01

    The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

  2. A review on power reducing methods of neural recording amplifiers

    Directory of Open Access Journals (Sweden)

    samira mehdipour

    2016-10-01

    Full Text Available Implantable multi-channel neural recording Microsystems comprise a large number of neural amplifiers, that can affect the overall power consumption and chip area of the analog part of the system.power, noise, size and dc offset are the main challenge faced by designers. Ideally the output of the opamp should be at zero volts when the inputs are grounded.In reality the input terminals are at slightly different dc potentials.The input offset voltage is defined as the voltage that must be applied between the two input terminals of the opamp to obtain zero volts at the output. Amplifier must have capability to reject this dc offset. First method that uses a capacitor feedback network with ac coupling of input devices to reject the offset is very popular in designs.very small low-cutoff frequency.The second method employs a closed-loop resistive feedback and electrode capacitance to form a highpass filter.Moreover,The third method adopts the symmetric floating resistor the feedback path of low noise amplifier to achieve low-frequency cutoff and rejects DC offset voltage. .In some application we can use folded cascade topology.The telescopic topology is a good candidate in terms of providing large gain and phase margin while dissipating small power. the cortical VLSI neuron model reducing power consumption of circuits.Power distribution is the best way to reduce power, noise and silicon area. The total power consumption of the amplifier array is reduced by applying the partial OTA sharing technique. The silicon area is reduced as a benefit of sharing the bulky capacitor.

  3. Design and Control of a Dynamic Voltage Restorer

    DEFF Research Database (Denmark)

    Nielsen, John Godsk

    voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...

  4. Fiber-optic voltage measuring system

    Science.gov (United States)

    Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

    1993-09-01

    A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

  5. Constant potential high-voltage generator

    International Nuclear Information System (INIS)

    Resnick, T.A.; Dupuis, W.A.; Palermo, T.

    1980-01-01

    An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)

  6. Nested high voltage generator/particle accelerator

    International Nuclear Information System (INIS)

    Adler, R.J.

    1992-01-01

    This patent describes a modular high voltage particle accelerator having an emission axis and an emission end, the accelerator. It comprises: a plurality of high voltage generators in nested adjacency to form a nested stack, each the generator comprising a cup-like housing having a base and a tubular sleeve extending from the base, a primary transformer winding encircling the nested stack; a secondary transformer winding between each adjacent pair of housings, magnetically linked to the primary transformer winding through the gaps; a power supply respective to each of the secondary windings converting alternating voltage from its respective secondary winding to d.c. voltage, the housings at the emission end forming a hollow throat for particle acceleration, a vacuum seal at the emission end of the throat which enables the throat to be evacuated; a particle source in the thrond power means to energize the primary transformer winding

  7. Low voltage arc formation in railguns

    Science.gov (United States)

    Hawke, R.S.

    1985-08-05

    A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.

  8. A new Zero-Voltage-Transition PWM switching cell

    Energy Technology Data Exchange (ETDEWEB)

    Grigore, V. [Electronics and Telecommunications Faculty `Politebuica` University Bucharest (Romania); Kyyrae, J. [Helsinki University of Technology, Otaniemi (Finland): Institute of Intelligent Power Electronics

    1997-12-31

    In this paper a new Zero-Voltage-Transition (ZVT) PWM switching cell is presented. The proposed switching cell is composed of the normal hard-switched PWM cell (consisting of one active switch and one passive switch), plus an auxiliary circuit (consisting of one active switch and some reactive components). The auxiliary circuit is inactive during the ON and OFF intervals of the switches in the normal PWM switch. However, the transitions between the two states are controlled by the auxiliary circuit. Prior to turn-on, the voltage across the active switch in the PWM cell is forced to zero, thus the turn-on losses of the active switch are practically eliminated. At turn-off the auxiliary circuit behaves like a non-dissipative passive snubber reducing the turn-off losses to a great extent. Zero-Voltage-Transition switching technique almost eliminates switching losses. The active switch operates under ZVT conditions, the passive switch (diode) has a controlled reverse recovery, and the switch in the auxiliary circuit operates under Zero-Current-Switching (ZCS) conditions. (orig.) 6 refs.

  9. Studies of radiation blistering effects on voltage holding

    International Nuclear Information System (INIS)

    Miley, G.H.

    1975-01-01

    The surfaces of niobium and tungsten wires were blistered by 300-keV helium-ion irradiation and then tested for voltage holding. A cylindrical projection-tube technique was employed so that regions of strong electron emission could be observed and later examined with a scanning electron microscope (SEM). Blistering was found to cause significant increases in pre-breakdown currents. However, these currents tend to saturate over a region corresponding to around 200-400 kV/cm surface field such that the ultimate voltage breakdown limit is not seriously reduced. Emission image observations and SEM photographs suggest that, in many cases, parts of the blistered surface are gradually erected by the strong surface fields, but this may not occur until after several arc breakdowns. SEM photographs also indicate that vapor from the anode may play an important part in the breakdown mechanism. Implications of these results to the design of devices important to fusion development, such as direct collectors and ion sources, are briefly discussed. The importance of future in situ irradiation-voltage experiments is also stressed. (U.S.)

  10. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  11. Investigating ion channel conformational changes using voltage clamp fluorometry.

    Science.gov (United States)

    Talwar, Sahil; Lynch, Joseph W

    2015-11-01

    Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Voltage, Temperature, Frequency Margin Test Report

    DEFF Research Database (Denmark)

    Denver, Troelz

    1999-01-01

    The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation......The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation...

  13. Detecting Faults In High-Voltage Transformers

    Science.gov (United States)

    Blow, Raymond K.

    1988-01-01

    Simple fixture quickly shows whether high-voltage transformer has excessive voids in dielectric materials and whether high-voltage lead wires too close to transformer case. Fixture is "go/no-go" indicator; corona appears if transformer contains such faults. Nests in wire mesh supported by cap of clear epoxy. If transformer has defects, blue glow of corona appears in mesh and is seen through cap.

  14. Design and development of digital seismic amplifier recorder

    Energy Technology Data Exchange (ETDEWEB)

    Samsidar, Siti Alaa; Afuar, Waldy; Handayani, Gunawan, E-mail: gunawanhandayani@gmail.com [Department of Physics, ITB (Indonesia)

    2015-04-16

    A digital seismic recording is a recording technique of seismic data in digital systems. This method is more convenient because it is more accurate than other methods of seismic recorders. To improve the quality of the results of seismic measurements, the signal needs to be amplified to obtain better subsurface images. The purpose of this study is to improve the accuracy of measurement by amplifying the input signal. We use seismic sensors/geophones with a frequency of 4.5 Hz. The signal is amplified by means of 12 units of non-inverting amplifier. The non-inverting amplifier using IC 741 with the resistor values 1KΩ and 1MΩ. The amplification results were 1,000 times. The results of signal amplification converted into digital by using the Analog Digital Converter (ADC). Quantitative analysis in this study was performed using the software Lab VIEW 8.6. The Lab VIEW 8.6 program was used to control the ADC. The results of qualitative analysis showed that the seismic conditioning can produce a large output, so that the data obtained is better than conventional data. This application can be used for geophysical methods that have low input voltage such as microtremor application.

  15. Modular high voltage power supply for chemical analysis

    Science.gov (United States)

    Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

    2008-07-15

    A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

  16. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  17. Experimental validation of prototype high voltage bushing

    Science.gov (United States)

    Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.

    2017-08-01

    Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.

  18. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  19. Beam induced rf cavity transient voltage

    International Nuclear Information System (INIS)

    Kramer, S.L.; Wang, J.M.

    1998-10-01

    The authors calculate the transient voltage induced in a radio frequency cavity by the injection of a relativistic bunched beam into a circular accelerator. A simplified model of the beam induced voltage, using a single tone current signal, is generated and compared with the voltage induced by a more realistic model of a point-like bunched beam. The high Q limit of the bunched beam model is shown to be related simply to the simplified model. Both models are shown to induce voltages at the resonant frequency ω r of the cavity and at an integer multiple of the bunch revolution frequency (i.e. the accelerating frequency for powered cavity operation) hω ο . The presence of two nearby frequencies in the cavity leads to a modulation of the carrier wave exp(hω ο t). A special emphasis is placed in this paper on studying the modulation function. These models prove useful for computing the transient voltage induced in superconducting rf cavities, which was the motivation behind this research. The modulation of the transient cavity voltage discussed in this paper is the physical basis of the recently observed and explained new kinds of longitudinal rigid dipole mode which differs from the conventional Robinson mode

  20. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  1. Prediction of breakdown voltages in novel gases for high voltage insulation

    International Nuclear Information System (INIS)

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  2. Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

    Directory of Open Access Journals (Sweden)

    Dung Vo Tien

    2018-01-01

    Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

  3. Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

    Directory of Open Access Journals (Sweden)

    Chaichana Amornchai

    2017-01-01

    Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

  4. High voltage transmission lines studies with the use of artificial intelligence

    Energy Technology Data Exchange (ETDEWEB)

    Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)

    2009-12-15

    The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)

  5. Detecting Power Voltage Dips using Tracking Filters - A Comparison against Kalman

    Directory of Open Access Journals (Sweden)

    STANCIU, I.-R.

    2012-11-01

    Full Text Available Due of its significant economical impact, Power-Quality (PQ analysis is an important domain today. Severe voltage distortions affect the consumers and disturb their activity. They may be caused by short circuits (in this case the voltage drops significantly or by varying loads (with a smaller drop. These two types are the PQ currently issues. Monitoring these phenomena (called dips or sags require powerful techniques. Digital Signal Processing (DSP algorithms are currently employed to fulfill this task. Discrete Wavelet Transforms, (and variants, Kalman filters, and S-Transform are currently proposed by researchers to detect voltage dips. This paper introduces and examines a new tool to detect voltage dips: the so-called tracking filters. Discovered and tested during the cold war, they can estimate a parameter of interest one-step-ahead based on the previously observed values. Two filters are implemented. Their performance is assessed by comparison against the Kalman filter?s results.

  6. Record Club

    CERN Document Server

    Record Club

    2012-01-01

      March  Selections By the time this appears, we will have added a number of new CDs and DVDs into the Club. You will find the full lists at http://cern.ch/record.club; select the "Discs of the Month" button on the left panel of the web page and then Mar 2012. New films include recent releases such as Johnny English 2, Bad Teacher, Cowboys vs Aliens, and Super 8. We are also starting to acquire some of the classic films we missed when we initiated the DVD section of the club, such as appeared in a recent Best 100 Films published by a leading UK magazine; this month we have added Spielberg’s Jaws and Scorsese’s Goodfellas. If you have your own ideas on what we are missing, let us know. For children we have no less than 8 Tin-Tin DVDs. And if you like fast moving pop music, try the Beyonce concert DVD. New CDs include the latest releases from Paul McCartney, Rihanna and Amy Winehouse. There is a best of Mylene Farmer, a compilation from the NRJ 201...

  7. Internal voltage control of hydrogen-oxygen fuel cells: Feasibility study

    Science.gov (United States)

    Prokopius, P. R.

    1975-01-01

    An experimental study was conducted to assess the feasibility of internal voltage regulation of fuel cell systems. Two methods were tested. In one, reactant partial pressure was used as the voltage control parameter and in the other reactant total pressure was used for control. Both techniques were breadboarded and tested on a single alkaline-electrolyte fuel cell. Both methods were found to be possible forms of regulation, however, of the two the total pressure technique would be more efficient, simpler to apply and would provide better transient characteristics.

  8. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  9. Voltage scheduling for low power/energy

    Science.gov (United States)

    Manzak, Ali

    2001-07-01

    Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

  10. Assessment of the operating conditions of coordinated Q-V controller within secondary voltage control system

    Directory of Open Access Journals (Sweden)

    Arnautović Dušan

    2014-01-01

    Full Text Available The paper, discusses the possibility to use coordinated Q-V controller (CQVC to perform secondary voltage control at the power plant level. The CQVC performs the coordination of the synchronous generators' (SG reactive power outputs in order to maintain the same total reactive power delivered by the steam power plant (SPP, while at the same time maintaining a constant voltage with programmed reactive droop characteristic at the SPP HV busbar. This busbar is the natural pilot node for secondary voltage control at HV level as the node with maximum power production and maximum power consumption. In addition to voltage control, the CQVC maintains the uniform allocation of reactive power reserves at all SGs in the power plant. This is accomplished by setting the reactive power of each SG at given operating point in accordance to the available reactive power of the same SG at that point. Different limitations imposed by unit's and plant equipment are superimposed on original SG operating chart (provided by the manufacturer in order to establish realistic limits of SG operation at given operating point. The CQVC facilitates: i practical implementation of secondary voltage control in power system, as it is capable of ensuring delivery of reactive power as requested by regional/voltage control while maintaining voltage at system pilot node, ii the full deployment of available reactive power of SGs which in turn contributes to system stability, iii assessment of the reactive power impact/contribution of each generator in providing voltage control as ancillary service. Furthermore, it is also possible to use CQVC to pricing reactive power production cost at each SG involved and to design reactive power bidding structure for transmission network devices by using recorded data. Practical exploitation experience acquired during CQVC continuous operation for over two years enabled implementation of the optimal setting of reference voltage and droop on daily

  11. CERN News: Selection of the type of superconducting coil for the Omega project; New intensity records at the proton synchrotron; Progress with the Spiral Reader film measuring equipment; New technique at transition energy on the proton synchrotron; CERN Courier 10th anniversary; Equipment travelling from and to Serpukhov

    CERN Multimedia

    1969-01-01

    CERN News: Selection of the type of superconducting coil for the Omega project; New intensity records at the proton synchrotron; Progress with the Spiral Reader film measuring equipment; New technique at transition energy on the proton synchrotron; CERN Courier 10th anniversary; Equipment travelling from and to Serpukhov

  12. Effective high voltage at X-ray tube in hard X-ray chest imaging

    International Nuclear Information System (INIS)

    Klein, J.

    1987-01-01

    The FRG standard TGL 36 661 (March 1980) for synoptical chest pictures of large size in adults specifies the 120 kV voltage at the X-ray tube together with maximal, 100% use of the capacity of the tube (hard picture, short exposure time). By means of circular recording and by measuring the high voltage at the X-ray tube it was quantitatively shown that the effective voltage during exposure is (according to the exposure time and the attenuation phase of the generator) always lower than the set-up voltage of 120 kV. This phenomenon is the more marked the shorter the actual exposure time in comparison with the attenuation phase of the generator. The typical characteristic of a hard X-ray chest picture is thus not given only by the setting-up of voltage. The impact of the reduction in voltage is thus quantitatively shown also from the aspect of the radiation burden for the patient. (author). 7 figs., 8 refs

  13. Investigation of phase-wise voltage regulator control logics for compensating voltage deviations in an experimental low voltage network

    DEFF Research Database (Denmark)

    Hu, Junjie; Zecchino, Antonio; Marinelli, Mattia

    2016-01-01

    This paper investigates the control logics of an on-load tap-changer (OLTC) transformer by means of an experimental system validation. The experimental low-voltage unbalanced system consists of a decoupled single-phase OLTC transformer, a 75-metre 16 mm2 cable, a controllable single-phase resistive...... load and an electric vehicle, which has the vehicle-to-grid function. Three control logics of the OLTC transformer are described in the study. The three control logics are classified based on their control objectives and control inputs, which include network currents and voltages, and can be measured...... either locally or remotely. To evaluate and compare the control performances of the three control logics, all the tests use the same loading profiles. The experimental results indicate that the modified line compensation control can regulate voltage in a safe band in the case of various load...

  14. High-voltage zones within the pulmonary vein antra: Major determinants of acute pulmonary vein reconnections after atrial fibrillation ablation.

    Science.gov (United States)

    Nagashima, Koichi; Watanabe, Ichiro; Okumura, Yasuo; Iso, Kazuki; Takahashi, Keiko; Watanabe, Ryuta; Arai, Masaru; Kurokawa, Sayaka; Nakai, Toshiko; Ohkubo, Kimie; Yoda, Shunichi; Hirayama, Atsushi

    2017-08-01

    Recurrence of atrial fibrillation (AF) after pulmonary vein isolation (PVI) is mainly due to PV reconnections. Patient-specific tissue characteristics that may contribute remain unidentified. This study aimed to assess the relationship between the bipolar electrogram voltage amplitudes recorded from the PV-left atrial (LA) junction and acute PV reconnection sites. Three-dimensional LA voltage maps created before an extensive encircling PVI in 47 AF patients (31 men; mean age 62 ± 11 years) were examined for an association between the EGM voltage amplitude recorded from the PV-LA junction and acute post-PVI PV reconnections (spontaneous PV reconnections and/or ATP-provoked dormant PV conduction). Acute PV reconnections were observed in 17 patients (36%) and in 24 (3%) of the 748 PV segments (16 segments per patient) and were associated with relatively high bipolar voltage amplitudes (3.26 ± 0.85 vs. 1.79 ± 1.15 mV, p voltage (137 [106, 166] vs. 295 [193, 498] gs/mV, p voltage and FTI/PV-LA bipolar voltage for acute PV reconnections (areas under the curve: 0.86 and 0.89, respectively); the best cutoff values were >2.12 mV and ≤183 gs/mV, respectively. The PV-LA voltage on the PV-encircling ablation line and FTI/PV-LA voltage were related to the acute post-PVI PV reconnections. A more durable ablation strategy is warranted for high-voltage zones.

  15. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  16. Transmission of power at high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Lane, F J

    1963-01-01

    High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.

  17. Induced Voltage in an Open Wire

    Science.gov (United States)

    Morawetz, K.; Gilbert, M.; Trupp, A.

    2017-07-01

    A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.

  18. Dispersion of breakdown voltage of liquid helium

    International Nuclear Information System (INIS)

    Ishii, Itaru; Noguchi, Takuya

    1978-01-01

    As for the electrical insulation characteristics of liquid helium, the discrepancy among the measured values by each person is very large even in the fundamental DC breakdown voltage in uniform electric field. The dispersion of experimental values obtained in the experiments by the same person is also large. Hereafter, the difference among the mean values obtained by each experimenter will be referred to as ''deviation of mean values'', and the dispersion of measured values around the mean value obtained by the same person as ''deviation around the man value''. The authors have mainly investigated on the latter experimentally. The cryostat was made of stainless steel, and the innermost helium chamber was of 500 mm I.D. and approximately 1200 mm deep. The high voltage electrode was of brass sphere of 25 mm diameter, and the low voltage electrode was of brass plate. The experiment was conducted for liquid helium boiling at 4.2 K and 1 atm, and the breakdown voltage and time lag were measured by applying the approximately square wave impulses of fast rise and long tail, ramp and DC voltages. The cause of the deviation of mean values may be the presence of impurity particles or the effect of electrode shape. As for the deviation around the mean value, the dispersion is large, and its standard deviation may amount to 10 to 20% of the man value. The dispersion is not due to the statistical time lag, but is due to parameters that vary with breakdown. (Wakatsuki, Y.)

  19. Voltage breakdown on niobium and copper surfaces

    International Nuclear Information System (INIS)

    Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.

    2003-01-01

    Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)

  20. Reactive power dispatch considering voltage stability with seeker optimization algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Chaohua; Chen, Weirong; Zhang, Xuexia [The School of Electrical Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Zhu, Yunfang [Department of Computer and Communication Engineering, E' mei Campus, Southwest Jiaotong University, E' mei 614202 (China)

    2009-10-15

    Optimal reactive power dispatch (ORPD) has a growing impact on secure and economical operation of power systems. This issue is well known as a non-linear, multi-modal and multi-objective optimization problem where global optimization techniques are required in order to avoid local minima. In the last decades, computation intelligence-based techniques such as genetic algorithms (GAs), differential evolution (DE) algorithms and particle swarm optimization (PSO) algorithms, etc., have often been used for this aim. In this work, a seeker optimization algorithm (SOA) based method is proposed for ORPD considering static voltage stability and voltage deviation. The SOA is based on the concept of simulating the act of human searching where search direction is based on the empirical gradient by evaluating the response to the position changes and step length is based on uncertainty reasoning by using a simple Fuzzy rule. The algorithm's performance is studied with comparisons of two versions of GAs, three versions of DE algorithms and four versions of PSO algorithms on the IEEE 57 and 118-bus power systems. The simulation results show that the proposed approach performed better than the other listed algorithms and can be efficiently used for the ORPD problem. (author)

  1. Modelling a single phase voltage controlled rectifier using Laplace transforms

    Science.gov (United States)

    Kraft, L. Alan; Kankam, M. David

    1992-01-01

    The development of a 20 kHz, AC power system by NASA for large space projects has spurred a need to develop models for the equipment which will be used on these single phase systems. To date, models for the AC source (i.e., inverters) have been developed. It is the intent of this paper to develop a method to model the single phase voltage controlled rectifiers which will be attached to the AC power grid as an interface for connected loads. A modified version of EPRI's HARMFLO program is used as the shell for these models. The results obtained from the model developed in this paper are quite adequate for the analysis of problems such as voltage resonance. The unique technique presented in this paper uses the Laplace transforms to determine the harmonic content of the load current of the rectifier rather than a curve fitting technique. Laplace transforms yield the coefficient of the differential equations which model the line current to the rectifier directly.

  2. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    International Nuclear Information System (INIS)

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  3. Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control

    DEFF Research Database (Denmark)

    Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal

    2014-01-01

    This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...

  4. Analysis of Voltage Support by Electric Vehicles and Photovoltaic in a Real Danish Low Voltage Network

    DEFF Research Database (Denmark)

    Knezovic, Katarina; Marinelli, Mattia; Juul Møller, René

    2014-01-01

    of incorporating electric vehicles (EVs) in a low voltage distribution network with high penetration of photovoltaic installations (PVs), and focuses on analysing potential voltage support functions from EVs and PVs. In addition, the paper evaluates the benefits that reactive power control may provide...

  5. Serially Connected Micro Amorphous Silicon Solar Cells for Compact High-Voltage Sources

    Directory of Open Access Journals (Sweden)

    Jiyoon Nam

    2016-01-01

    Full Text Available We demonstrate a compact amorphous silicon (a-Si solar module to be used as high-voltage power supply. In comparison with the organic solar module, the main advantages of the a-Si solar module are its compatibility with photolithography techniques and relatively high power conversion efficiency. The open circuit voltage of a-Si solar cells can be easily controlled by serially interconnecting a-Si solar cells. Moreover, the a-Si solar module can be easily patterned by photolithography in any desired shapes with high areal densities. Using the photolithographic technique, we fabricate a compact a-Si solar module with noticeable photovoltaic characteristics as compared with the reported values for high-voltage power supplies.

  6. Light emitting diode driver with differential voltage supply

    NARCIS (Netherlands)

    2015-01-01

    The current invention relates to a driver for driving one or a plurality of LEDs (D1, D2), comprising at least one driving unit (201, 202) adapted to be supplied with a differential voltage, between one first bias voltage (VB1) and one second bias voltage (VB2), the differential voltage being

  7. 30 CFR 75.804 - Underground high-voltage cables.

    Science.gov (United States)

    2010-07-01

    ... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution § 75.804 Underground high-voltage cables. (a) Underground high-voltage cables used in resistance... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Underground high-voltage cables. 75.804 Section...

  8. 30 CFR 75.813 - High-voltage longwalls; scope.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage longwalls; scope. 75.813 Section... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution High-Voltage Longwalls § 75.813 High-voltage longwalls; scope. Sections 75.814 through 75.822 of this...

  9. Voltage Support from Electric Vehicles in Distribution Grid

    DEFF Research Database (Denmark)

    Huang, Shaojun; Pillai, Jayakrishnan Radhakrishna; Bak-Jensen, Birgitte

    2013-01-01

    The paper evaluates the voltage support functions from electric vehicles (EVs) on a typical Danish distribution grid with high EV penetration. In addition to the popular voltage control modes, such as voltage droop charging (low voltage level leads to low charging power) and reactive power support...

  10. 47 CFR 17.54 - Rated lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Rated lamp voltage. 17.54 Section 17.54... voltage. To insure the necessary lumen output by obstruction lights, the rated voltage of incandescent lamps used shall correspond to be within 3 percent higher than the voltage across the lamp socket during...

  11. The Preceding Voltage Pulse and Separation Welding Mechanism of Electrical Contacts

    DEFF Research Database (Denmark)

    Yang, Xiao Cheng; Huang, Jiang; Li, Zhen Biao

    2016-01-01

    In order to obtain a better understanding of the welding mechanism in contact separation, electrical endurance tests were conducted with AgSnO2 and AgNi contacts on a simulation test device. Waveforms of contact displacement, contact voltage, and current were recorded with LabVIEW during the tests......, and changes in a contact gap and heights of pips with increases in operation cycles were observed through charge-coupled device cameras. The resultant test results show that welding in separation is accompanied with a preceding voltage pulse which represents arc rather than contact bounce arc....

  12. Observation of voltage fluctuations in a superconducting magnet during MHD power generation

    International Nuclear Information System (INIS)

    Smith, R.P.; Niemann, R.C.; Kraimer, M.R.; Zinneman, T.E.

    1978-01-01

    Fluctuating voltage signals on the potential taps of the ANL 5.0 T MHD Superconducting Dipole Magnet have been observed during MHD power generation at the U-25B Facility at the High Temperature Institute (IVTAN) Moscow, USSR. Various other thermodynamic and electrical parameters of the U-25B flow train have been recorded, and statistical analysis concerning correlations between the phenomena with a view of discerning causal interdependence is in progress. Voltage fluctuations observed at the magnet terminals are analyzed with special emphasis on magnet stability

  13. ICT Based HIL Validation of Voltage Control Coordination in Smart Grids Scenarios

    DEFF Research Database (Denmark)

    Shahid, Kamal; Petersen, Lennart; Olsen, Rasmus Løvenstein

    2018-01-01

    as the associated data traffic patterns obtained from a real network. Based on the sets of recordings, guidelines and recommendations for practical implementation of the developed control algorithms for targeted ancillary service are made. This provides a deep insight for stakeholders i.e. wind turbines and PV....... However, here, the results are validated through a real-time Hardware-In-The-Loop framework using an exemplary benchmark grid area in Denmark as a base case that includes flexible renewable power plants providing voltage control functionality. The provision of voltage control support from ReGen plants...

  14. Determination of the cathode fall voltage in fluorescent lamps by measurement of the operating voltage

    International Nuclear Information System (INIS)

    Hilscher, A.

    2002-01-01

    A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)

  15. A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level

    DEFF Research Database (Denmark)

    Newman, M.J.; Holmes, D.G.; Nielsen, J.G.

    2005-01-01

    Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... be advantageous if the series-connected inverter of a DVR could also be used to compensate for any steady-state load voltage harmonics, since this would increase the power quality "value-added" benefits to the grid system. However, before this can be done, consideration must be given to the control of steady......-state power through the DVR, the increased losses, and the low modulation depths at which the scheme must operate to achieve acceptable harmonic compensation performance. This paper presents a selective harmonic feedback control strategy that can be easily added to medium-voltage DVR systems to provide...

  16. Electrocardiogram voltage discordance: Interpretation of low QRS voltage only in the precordial leads.

    Science.gov (United States)

    Kim, Diana H; Verdino, Ralph J

    To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Voltage stability, bifurcation parameters and continuation methods

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, F L [Wisconsin Univ., Madison, WI (United States)

    1994-12-31

    This paper considers the importance of the choice of bifurcation parameter in the determination of the voltage stability limit and the maximum power load ability of a system. When the bifurcation parameter is power demand, the two limits are equivalent. However, when other types of load models and bifurcation parameters are considered, the two concepts differ. The continuation method is considered as a method for determination of voltage stability margins. Three variants of the continuation method are described: the continuation parameter is the bifurcation parameter the continuation parameter is initially the bifurcation parameter, but is free to change, and the continuation parameter is a new `arc length` parameter. Implementations of voltage stability software using continuation methods are described. (author) 23 refs., 9 figs.

  18. Critical voltage effects in electron channeling patterns

    International Nuclear Information System (INIS)

    Farrow, R.C.

    1984-01-01

    Electron channeling patterns were used to study critical voltage effects in the metals molybdenum and tungsten. The purpose was to characterize both theoretically and experimentally how a critical voltage will affect the channeling pattern line shapes. The study focused on the second order critical voltage that results from the degeneracy between the Bloch wave states of the (110) and (220) reflections. Theoretical (110) series electron channeling pattern line profiles were calculated using the dynamical theory of Hirsch and Humphreys (1970). A 10 beam dynamical electron diffraction calculation was performed (using complex Fourier lattice potentials) to generate Bloch wave coefficients, excitation amplitudes, and absorption coefficients needed for determining backscattering coefficients and subsequent backscattered electron intensities. The theoretical model is applicable to electron diffraction at all energies since no high energy approximation or perturbation method was used

  19. Intermediate state trapping of a voltage sensor

    DEFF Research Database (Denmark)

    Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

    2012-01-01

    Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

  20. A thermoelectric voltage effect in polyethylene oxide

    CERN Document Server

    Martin, B; Kliem, H

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

  1. Microwave integrated circuit for Josephson voltage standards

    Science.gov (United States)

    Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)

    1980-01-01

    A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.

  2. Coplanar strips for Josephson voltage standard circuits

    International Nuclear Information System (INIS)

    Schubert, M.; May, T.; Wende, G.; Fritzsch, L.; Meyer, H.-G.

    2001-01-01

    We present a microwave circuit for Josephson voltage standards. Here, the Josephson junctions are integrated in a microwave transmission line designed as coplanar strips (CPS). The new layout offers the possibility of achieving a higher scale of integration and to considerably simplify the fabrication technology. The characteristic impedance of the CPS is about 50 Ω, and this should be of interest for programmable Josephson voltage standard circuits with SNS or SINIS junctions. To demonstrate the function of the microwave circuit design, conventional 10 V Josephson voltage standard circuits with 17000 Nb/AlO x /Nb junctions were prepared and tested. Stable Shapiro steps at the 10 V level were generated. Furthermore, arrays of 1400 SINIS junctions in this microwave layout exhibited first-order Shapiro steps. Copyright 2001 American Institute of Physics

  3. Voltage control of cavity magnon polariton

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, S., E-mail: kaurs3@myumanitoba.ca; Rao, J. W.; Gui, Y. S.; Hu, C.-M., E-mail: hu@physics.umanitoba.ca [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); Yao, B. M. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); National Laboratory for Infrared Physics, Chinese Academy of Sciences, Shanghai 200083 (China)

    2016-07-18

    We have experimentally investigated the microwave transmission of the cavity-magnon-polariton (CMP) generated by integrating a low damping magnetic insulator onto a 2D microwave cavity. The high tunability of our planar cavity allows the cavity resonance frequency to be precisely controlled using a DC voltage. By appropriately tuning the voltage and magnetic bias, we can observe the cavity photon magnon coupling and the magnetic coupling between a magnetostatic mode and the generated CMP. The dispersion of the generated CMP was measured by either tuning the magnetic field or the applied voltage. This electrical control of CMP may open up avenues for designing advanced on-chip microwave devices that utilize light-matter interaction.

  4. Sensorless Control of IPMSM by Voltage Injection

    DEFF Research Database (Denmark)

    Matzen, Torben N.; Bech, Michael Møller

    2006-01-01

    In this paper a sensorless discrete current control of an Interior Permanent Magnet Synchrouns Motor (IPMSM) by voltage injection is designed and tested. The whole controller is operating in the dq-frame and for this reason the rotor position is essential to know, to transform between the station......In this paper a sensorless discrete current control of an Interior Permanent Magnet Synchrouns Motor (IPMSM) by voltage injection is designed and tested. The whole controller is operating in the dq-frame and for this reason the rotor position is essential to know, to transform between...... the stationary frame and the rotor xed dq-frame. To obtain the position even at standstill a sensorless scheme using voltage injection is added to the current controller....

  5. Semisupervised Community Detection by Voltage Drops

    Directory of Open Access Journals (Sweden)

    Min Ji

    2016-01-01

    Full Text Available Many applications show that semisupervised community detection is one of the important topics and has attracted considerable attention in the study of complex network. In this paper, based on notion of voltage drops and discrete potential theory, a simple and fast semisupervised community detection algorithm is proposed. The label propagation through discrete potential transmission is accomplished by using voltage drops. The complexity of the proposal is OV+E for the sparse network with V vertices and E edges. The obtained voltage value of a vertex can be reflected clearly in the relationship between the vertex and community. The experimental results on four real networks and three benchmarks indicate that the proposed algorithm is effective and flexible. Furthermore, this algorithm is easily applied to graph-based machine learning methods.

  6. Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

    Science.gov (United States)

    Fernandez, Fernando R.; Malerba, Paola; White, John A.

    2015-01-01

    The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

  7. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  8. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  9. Voltage Quench Dynamics of a Kondo System.

    Science.gov (United States)

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  10. Technical feasibility study of Voltage Optimization Unit

    DEFF Research Database (Denmark)

    Hu, Junjie; Marinelli, Mattia; Coppo, Massimiliano

    This report provides an analysis on the benefits of a transformer with on load tap chang-ers on each phase that can be applied in the distribution system to accommodate more renewable generations such as photovoltaic power. The main purpose of this research is to verify whether power distribution...... are used as load basics for the analysis. In term of PV genera-tion profiles, a realistic PV output power is assumed. Four relevant indicies such as phase neutral voltage, netural potential voltage, unbalanced factor (VUF), and power losses are evaluated in the present study. The simulation tests include...

  11. Voltage-pulse generator for electron gun

    International Nuclear Information System (INIS)

    Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.

    1987-01-01

    A voltage-pulse generator with combined capacitive and inductive storage devices of an electron gun is described. The current interrupter is a hydrogen thyratron (TGI1-100/8, TGI1-500/16, or TGI1-1000/25) installed in a short magnetic lens. The current interruption time of the thyratrons is 100-300 nsec. When the capacitive storage device is charged to 1 kV, a voltage pulse with an amplitude of 25 kV is obtained at the load

  12. Influence of tube voltage on CT attenuation, radiation dose, and image quality: phantom study

    International Nuclear Information System (INIS)

    Li Fengtan; Li Dong; Zhang Yunting

    2013-01-01

    Objective: To assess the influence of tube current and tube voltage on the CT attenuation, radiation dose, and image quality. Methods: A total of 113 saline solutions with decreasing dilution of contrast medium (370 mg I/ml) was produced. MDCT scan was performed with 15 series of different settings of tube current and tube voltage. CT attenuations with 15 series of different settings were all measured, and influence of tube current and tube voltage on CT attenuations was analyzed. CT dose index (CTDIvol) was recorded. The CT attenuations with different tube voltage and current were compared with one-way ANOVA and Kruskal-Wallis rank sum test. The correlation of CT attenuation with different tube voltage and the influence of tube voltage and current on radiation dose and image quality were tested by correlation analysis. Results: Tube current (250, 200, 150, 100, and 50 mA) had no significant effect on CT attenuation (F = 0.001, 0.008, 0.075, P > 0.05), while tube voltage (120, 100, and 80 kV) had significant effect (H = 17.906, 17.906, 13.527, 20.124, 23.563, P < 0.05). The correlation between CT attenuation and tube voltage was determined with equation: CT attenuatio N_1_0_0 _k_V = 1.561 × CT attenuatio N_1_2_0 _k_v + 4.0818, CT attenuatio N_8_0 _k_v = 1.2131 × CT attenuatio N_1_2_0 _k_v + 0.9283. The influence of tube voltage on radiation dose and image quality was also analyzed, and equations were also obtained: N_1_2_0 -k_v = -5.9771 Ln (D_1_2_0 kv) + 25.412, N_1_0_0 _k_v = -10.544 Ln (D_1_0_0 _k_v) + 36.262, N_8_0 _k_v = -25.326 Ln (D_8_0 _k_v) + 62.816. According to the results of relationship among CT attenuation, radiation dose, and image quality, lower tube voltage with higher tube current can reduce the radiation dose. Conclusions: Lower tube voltage can reduce the radiation dose. However, CT attenuation was influenced, and correction should be done with the equations. (authors)

  13. State reference design and saturated control of doubly-fed induction generators under voltage dips

    Science.gov (United States)

    Tilli, Andrea; Conficoni, Christian; Hashemi, Ahmad

    2017-04-01

    In this paper, the stator/rotor currents control problem of doubly-fed induction generator under faulty line voltage is carried out. Common grid faults cause a steep decline in the line voltage profile, commonly denoted as voltage dip. This point is critical for such kind of machines, having their stator windings directly connected to the grid. In this respect, solid methodological nonlinear control theory arguments are exploited and applied to design a novel controller, whose main goal is to improve the system behaviour during voltage dips, endowing it with low voltage ride through capability, a fundamental feature required by modern Grid Codes. The proposed solution exploits both feedforward and feedback actions. The feedforward part relies on suitable reference trajectories for the system internal dynamics, which are designed to prevent large oscillations in the rotor currents and command voltages, excited by line perturbations. The feedback part uses state measurements and is designed according to Linear Matrix Inequalities (LMI) based saturated control techniques to further reduce oscillations, while explicitly accounting for the system constraints. Numerical simulations verify the benefits of the internal dynamics trajectory planning, and the saturated state feedback action, in crucially improving the Doubly-Fed Induction Machine response under severe grid faults.

  14. An Optimal Control Strategy for DC Bus Voltage Regulation in Photovoltaic System with Battery Energy Storage

    Directory of Open Access Journals (Sweden)

    Muhamad Zalani Daud

    2014-01-01

    Full Text Available This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV system with battery energy storage (BES. The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC. For the grid side VSC (G-VSC, two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods.

  15. An optimal control strategy for DC bus voltage regulation in photovoltaic system with battery energy storage.

    Science.gov (United States)

    Daud, Muhamad Zalani; Mohamed, Azah; Hannan, M A

    2014-01-01

    This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV) system with battery energy storage (BES). The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC). For the grid side VSC (G-VSC), two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods.

  16. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  17. Summary record

    International Nuclear Information System (INIS)

    2007-01-01

    encouragement to developing novel next-generation approaches that focus on more microscopic processes. Thus, the benchmark problem includes both macroscopic and microscopic measurement data. In this context, the sub-channel grade void fraction data are regarded as the macroscopic data and the digitized computer graphic images are the microscopic data. The meeting was organized around the discussion of the Benchmark Specifications, as well as the presentation and discussion of modelling issues and preliminary results for Exercises 1 and 2 of Phase 1, and Exercise 1 of Phase 2. At the first workshop of the OECD/NRC BFBT Benchmark BFBT-1 - a schedule for benchmark activities was accepted by the participants (see NEA/NSC/DOC (2004)15). According to this schedule the participants were requested to submit their results for Exercises 1 of Phase 1 and Phase 2 by April 30, 2005, which was postponed because of the delay in issuing the BFBT Benchmark Specifications. The Version 2 of the Specifications was distributed in May 2005 and the participants were requested to review the Specifications and were encouraged to start modelling of Exercises 1 of Phase 1 and Phase 2 as well as Exercise 2 of Phase 2. This was beneficial for the discussions at the 2. Workshop where the participants were requested to present any available preliminary results, for the exercises of both phases. Presentations on related experience in BWR sub-channel modelling as well as on CFD modelling were also encouraged. The technical topics, which were presented and discussed at the BFBT-2 workshop, are as follows: Review of the benchmark activities after the first Workshop; Detailed discussion of test facility, test conditions and measurement techniques; Discussion of the complete test data provided on the CD-ROM to the participants' key for using the data and format of the data; Discussion of the Benchmark Specifications and how the benchmark cases have been selected; Presentation and discussion of modelling issues and

  18. Coordinated Voltage Control in Distribution Network with the Presence of DGs and Variable Loads Using Pareto and Fuzzy Logic

    Directory of Open Access Journals (Sweden)

    José Raúl Castro

    2016-02-01

    Full Text Available This paper presents an efficient algorithm to solve the multi-objective (MO voltage control problem in distribution networks. The proposed algorithm minimizes the following three objectives: voltage variation on pilot buses, reactive power production ratio deviation, and generator voltage deviation. This work leverages two optimization techniques: fuzzy logic to find the optimum value of the reactive power of the distributed generation (DG and Pareto optimization to find the optimal value of the pilot bus voltage so that this produces lower losses under the constraints that the voltage remains within established limits. Variable loads and DGs are taken into account in this paper. The algorithm is tested on an IEEE 13-node test feeder and the results show the effectiveness of the proposed model.

  19. Charge-sharing SAR ADCs for low-voltage low-power applications

    CERN Document Server

    Rabuske, Taimur

    2017-01-01

    This book introduces readers to the potential of charge-sharing (CS) successive approximation register (SAR) analog-to-digital converters (ADCs), while providing extensive analysis of the factors that limit the performance of the CS topology. The authors present guidelines and useful techniques for mitigating the limitations of the architecture, while focusing on the implementation under restricted power budgets and voltage supplies.

  20. Records Management Directive

    Data.gov (United States)

    Office of Personnel Management — The Office of Personnel Management (OPM) Records Management Directive provides guidelines for the management of OPM records, and identifies the records management...

  1. Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks

    Science.gov (United States)

    Pace, D. C.; Austin, M. E.; Bardoczi, L.; Collins, C. S.; Crowley, B.; Davis, E.; Du, X.; Ferron, J.; Grierson, B. A.; Heidbrink, W. W.; Holcomb, C. T.; McKee, G. R.; Pawley, C.; Petty, C. C.; Podestà, M.; Rauch, J.; Scoville, J. T.; Spong, D. A.; Thome, K. E.; Van Zeeland, M. A.; Varela, J.; Victor, B.

    2018-05-01

    An engineering upgrade to the neutral beam system at the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)] enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic ( E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2 MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities and results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.

  2. High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

    Science.gov (United States)

    Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

    2017-09-01

    The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

  3. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

    Directory of Open Access Journals (Sweden)

    Yukiko eMishina

    2014-09-01

    Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  4. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

    Science.gov (United States)

    Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

    2014-01-01

    Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  5. Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

    KAUST Repository

    Kim, Younggy

    2011-01-01

    Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

  6. Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching

    Science.gov (United States)

    Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest

    2017-09-01

    A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k  =  2) at 1 MHz and 0.5 part in 106 (k  =  2) at 100 kHz is within reach.

  7. An Efficient Approach for Fast and Accurate Voltage Stability Margin Computation in Large Power Grids

    Directory of Open Access Journals (Sweden)

    Heng-Yi Su

    2016-11-01

    Full Text Available This paper proposes an efficient approach for the computation of voltage stability margin (VSM in a large-scale power grid. The objective is to accurately and rapidly determine the load power margin which corresponds to voltage collapse phenomena. The proposed approach is based on the impedance match-based technique and the model-based technique. It combines the Thevenin equivalent (TE network method with cubic spline extrapolation technique and the continuation technique to achieve fast and accurate VSM computation for a bulk power grid. Moreover, the generator Q limits are taken into account for practical applications. Extensive case studies carried out on Institute of Electrical and Electronics Engineers (IEEE benchmark systems and the Taiwan Power Company (Taipower, Taipei, Taiwan system are used to demonstrate the effectiveness of the proposed approach.

  8. Voltage control on a train system

    Science.gov (United States)

    Gordon, Susanna P.; Evans, John A.

    2004-01-20

    The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.

  9. Voltage control of DC islanded microgrids

    DEFF Research Database (Denmark)

    Tucci, Michele; Riverso, Stefano; Quintero, Juan Carlos Vasquez

    2015-01-01

    We propose a new decentralized control scheme for DC Islanded microGrids (ImGs) composed by several Distributed Generation Units (DGUs) with a general interconnection topology. Each local controller regulates to a reference value the voltage of the Point of Common Coupling (PCC...

  10. High voltage pulse generator. [Patent application

    Science.gov (United States)

    Fasching, G.E.

    1975-06-12

    An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

  11. Dual voltage power supply with 48 volt

    Energy Technology Data Exchange (ETDEWEB)

    Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)

    2012-11-01

    Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)

  12. Microparticles in high-voltage accelerator tubes

    International Nuclear Information System (INIS)

    Griffith, G.L.; Eastham, D.A.

    1979-01-01

    Microparticles with radii greater than 2 μm have been observed in a high voltage vacuum accelerator tube. The charge acquired by most of the particles is similar to the contact charging of a conducting sphere on a plane. (author)

  13. An Inexpensive Source of High Voltage

    Science.gov (United States)

    Saraiva, Carlos

    2012-01-01

    As a physics teacher I like recycling old apparatus and using them for demonstrations in my classes. In physics laboratories in schools, sources of high voltage include induction coils or electronic systems that can be bought from companies that sell lab equipment. But these sources can be very expensive. In this article, I will explain how you…

  14. Determination of the working voltage of the RP-0 and RP-10 nuclear reactors starting chains

    International Nuclear Information System (INIS)

    Zuniga, Agustin; Veramendi, Emilio; Salazar, Alberto

    2014-01-01

    This report presents the determination of the voltage curve of the RP-0 and RP-10 nuclear reactor starting chains, as an approach for determining the working voltages. The method consisted in changing the voltage and recording the corresponding counts. Then, the area of the best response was determined according to the detector characteristics, and also was found that for the RP-0, the response was in the proportional region, meanwhile for the RP-10, the response was in the region of ionization chambers. The values obtained were: BF3-A3 (RP-0) and 1150 V for RP-10, CF-A1 = 400 V, CF-A2 = 400 V, CF-A3 = 400 V. (authors).

  15. Discriminator based on voltage comparator for nuclear physics research

    International Nuclear Information System (INIS)

    Vorob'ev, V.A.; Kiselev, A.A.; Kuz'min, R.N.

    1985-01-01

    This paper describes a simple discriminator of low-level pulses with integral discrimination based on a K521SA3 comparator. The discriminator can be used to record pulses with durations of ≥ 0.1 usec and amplitudes of ≥ 1 mV. the input-pulse amplitude must not exceed the supply-voltage amplitude. A schematic diagram of the discriminator is given. For operation of the NGR spectrometer in the constant-velocity mode, the comparator was gated by the bipolar vibrator-velocity signal. The described circuit is reliable under laboratory conditions and its use is promising in multi-input systems such as those with multisection coordinate detectors

  16. TAURINE REGULATION OF VOLTAGE-GATED CHANNELS IN RETINAL NEURONS

    Science.gov (United States)

    Rowan, Matthew JM; Bulley, Simon; Purpura, Lauren; Ripps, Harris; Shen, Wen

    2017-01-01

    Taurine activates not only Cl−-permeable ionotropic receptors, but also receptors that mediate metabotropic responses. The metabotropic property of taurine was revealed in electrophysiological recordings obtained after fully blocking Cl−-permeable receptors with an inhibitory “cocktail” consisting of picrotoxin, SR95531, and strychnine. We found that taurine’s metabotropic effects regulate voltage-gated channels in retinal neurons. After applying the inhibitory cocktail, taurine enhanced delayed outward rectifier K+ channels preferentially in Off-bipolar cells, and the effect was completely blocked by the specific PKC inhibitor, GF109203X. Additionally, taurine also acted through a metabotropic pathway to suppress both L- and N-type Ca2+ channels in retinal neurons, which were insensitive to the potent GABAB receptor inhibitor, CGP55845. This study reinforces our previous finding that taurine in physiological concentrations produces a multiplicity of metabotropic effects that precisely govern the integration of signals being transmitted from the retina to the brain. PMID:23392926

  17. Metering error quantification under voltage and current waveform distortion

    Science.gov (United States)

    Wang, Tao; Wang, Jia; Xie, Zhi; Zhang, Ran

    2017-09-01

    With integration of more and more renewable energies and distortion loads into power grid, the voltage and current waveform distortion results in metering error in the smart meters. Because of the negative effects on the metering accuracy and fairness, it is an important subject to study energy metering combined error. In this paper, after the comparing between metering theoretical value and real recorded value under different meter modes for linear and nonlinear loads, a quantification method of metering mode error is proposed under waveform distortion. Based on the metering and time-division multiplier principles, a quantification method of metering accuracy error is proposed also. Analyzing the mode error and accuracy error, a comprehensive error analysis method is presented which is suitable for new energy and nonlinear loads. The proposed method has been proved by simulation.

  18. Grid Voltage Modulated Control of Grid-Connected Voltage Source Inverters under Unbalanced Grid Conditions

    DEFF Research Database (Denmark)

    Li, Mingshen; Gui, Yonghao; Quintero, Juan Carlos Vasquez

    2017-01-01

    In this paper, an improved grid voltage modulated control (GVM) with power compensation is proposed for grid-connected voltage inverters when the grid voltage is unbalanced. The objective of the proposed control is to remove the power ripple and to improve current quality. Three power compensation...... objectives are selected to eliminate the negative sequence components of currents. The modified GVM method is designed to obtain two separate second-order systems for not only the fast convergence rate of the instantaneous active and reactive powers but also the robust performance. In addition, this method...

  19. Enzyme domain affects the movement of the voltage sensor in ascidian and zebrafish voltage-sensing phosphatases.

    Science.gov (United States)

    Hossain, Md Israil; Iwasaki, Hirohide; Okochi, Yoshifumi; Chahine, Mohamed; Higashijima, Shinichi; Nagayama, Kuniaki; Okamura, Yasushi

    2008-06-27

    The ascidian voltage-sensing phosphatase (Ci-VSP) consists of the voltage sensor domain (VSD) and a cytoplasmic phosphatase region that has significant homology to the phosphatase and tensin homolog deleted on chromosome TEN (PTEN). The phosphatase activity of Ci-VSP is modified by the conformational change of the VSD. In many proteins, two protein modules are bidirectionally coupled, but it is unknown whether the phosphatase domain could affect the movement of the VSD in VSP. We addressed this issue by whole-cell patch recording of gating currents from a teleost VSP (Dr-VSP) cloned from Danio rerio expressed in tsA201 cells. Replacement of a critical cysteine residue, in the phosphatase active center of Dr-VSP, by serine sharpened both ON- and OFF-gating currents. Similar changes were produced by treatment with phosphatase inhibitors, pervanadate and orthovanadate, that constitutively bind to cysteine in the active catalytic center of phosphatases. The distinct kinetics of gating currents dependent on enzyme activity were not because of altered phosphatidylinositol 4,5-bisphosphate levels, because the kinetics of gating current did not change by depletion of phosphatidylinositol 4,5-bisphosphate, as reported by coexpressed KCNQ2/3 channels. These results indicate that the movement of the VSD is influenced by the enzymatic state of the cytoplasmic domain, providing an important clue for understanding mechanisms of coupling between the VSD and its effector.

  20. Hybrid AC-High Voltage DC Grid Stability and Controls

    Science.gov (United States)

    Yu, Jicheng

    The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient