Simulation and comparison of perturb and observe and incremental ...

Indian Academy of Sciences (India)

Perturb and Observe (P & O) algorithm and Incremental conductance algorithm. ... Keywords. Solar array; insolation; MPPT; modelling, P & O; incremental conductance. 1. .... voltage level. It is also ..... Int. J. Advances in Eng. Technol. 133–148.

A digital controlled negative high voltage power source for LINAC of HLS

International Nuclear Information System (INIS)

Gao Hui; Chen Jun; Hong Jun; Wang Weibing

2005-01-01

This paper introduces the working principle of a 10-80 kV negative high voltage power source for the electronic gun of the 200 MeV LINAC of NSRL, especially how to realize the switch power, voltage/current sampling, feedback control and microcontroller module. The firmware design for the SOC microcontroller of ADuC8xx and the application software design for PC are also presented. (authors)

Flash Memory Reliability: Read, Program, and Erase Latency Versus Endurance Cycling

Science.gov (United States)

Heidecker, Jason

2010-01-01

This report documents the efforts and results of the fiscal year (FY) 2010 NASA Electronic Parts and Packaging Program (NEPP) task for nonvolatile memory (NVM) reliability. This year's focus was to measure latency (read, program, and erase) of NAND Flash memories and determine how these parameters drift with erase/program/read endurance cycling.

Negative-feedback control system of the high voltage power supply for ECRH

International Nuclear Information System (INIS)

Ding Tonghai; Liu Baohua; Jiang Shufang

2001-01-01

A kind of high accuracy negative high voltage power supply (HVPS) was introduced. The serial feedback was regulated according to the character of the high power tetrode and a new kind of integrator with preset value, which solved the key technological problem of the HVPS that the ECRH system required a voltage of -80 kV, a pulse width of 10 - 100 ms and a precision of 99.7%. The result using a PSPICE code simulation has shown that the method is practical

A novel immunohistochemical sequential multi-labelling and erasing technique enables epitope characterization of bone marrow pericytes in primary myelofibrosis

DEFF Research Database (Denmark)

Madelung, Ann; Bzorek, Michael; Bondo, Henrik

2012-01-01

: In Philadelphia (Ph)-negative chronic myeloproliferative neoplasms, increased microvascular density, bizarre vessel architecture and increased number of pericytes are among the distinct histopathological features. The aim of this study was to characterize bone marrow pericytes in primary myelofibrosis (PMF) using...... a novel multi-labelling immunohistochemical technique. Methods and results: Bone marrow biopsies from a normal donor (n = 1) and patients with PMF (n = 3) were subjected to an immunohistochemical sequential multi-labelling and erasing technique (SE-technique). Antigens of interest in the first and....../or second layer were detected with an immunoperoxidase system and visualized with aminoethylcarbazole. After imaging, erasing and blocking of immunoreagents, the slides were stained with a traditional double immunolabelling procedure. In addition, we applied a Photoshop(®) colour palette, creating a single...

Quantum eraser for three-slit interference

Indian Academy of Sciences (India)

Naveed Ahmad Shah

2017-11-09

Nov 9, 2017 ... Abstract. It is well known that in a two-slit interference experiment, if the information, on which of the two paths the particle followed, is stored in a quantum path detector, the interference is destroyed. However, in a set-up where this path information is 'erased', the interference can reappear. Such a set-up is ...

A new repeatable, optical writing and electrical erasing device based on photochromism and electrochromism of viologen

International Nuclear Information System (INIS)

Gao, Li-ping; Wei, Jian; Wang, Yue-chuan; Ding, Guo-jing; Yang, Yu-lin

2012-01-01

New optical writing and electrical erasing devices have been successfully fabricated that exploit the photochromism and electrochromism of viologen. In a preliminary study, both the structures of viologen and device were investigated in detail by UV–vis spectra in order to confirm their effects on the optical writing and electrical erasing performances of corresponding devices. For sandwiched, single and complementary devices based on benzyl viologen (BV 2+ ), only optical writing can be performed, not electrical erasing operations, which indicated these devices cannot realize optical information rewriting. For single and complementary devices based on styrene-functional viologen (V BV 2+ ) and acrylic-functional viologen (ACV 2+ ), optical writing and electrical erasing operations can be reversibly performed and optical information rewriting realized. It is clear that single devices based on V BV 2+ and ACV 2+ possess better performance accompanied with contrast without significant degradation and bleaching times and without significant deterioration over 10 repeated writing/erasing cycles. Furthermore, we put forward possible mechanisms for sandwiched, single and complementary devices based on V BV 2+ and ACV 2+ for the optical writing and electrical erasing operations. This study provides a new strategy to design optical writing and electrical erasing devices to realize optical information rewriting. (paper)

Perovskite oxides: an atomic force pencil and eraser

NARCIS (Netherlands)

Rijnders, Augustinus J.H.M.; Blank, David H.A.

A method of writing and erasing conducting nanostructures at the interface between the wide-bandgap insulators LaAlO3 and SrTiO3 is presented. New developments for ltrahigh-density information storage look feasible

Effect of negative bias voltage on CrN films deposited by arc ion plating. I. Macroparticles filtration and film-growth characteristics

International Nuclear Information System (INIS)

Wang Qimin; Kim, Kwang Ho

2008-01-01

Chromium nitride (CrN) films were deposited on Si wafers by arc ion plating (AIP) at various negative bias voltages and several groups of N 2 /Ar gas flux ratios and chamber gas pressures. The authors systematically investigated the influence of negative bias voltage on the synthesis, composition, microstructure, and properties of the AIP CrN films. In this part (Part I), the investigations were mainly focused on the macroparticle distributions and film-growth characteristics. The results showed that macroparticle densities on the film surfaces decreased greatly by applying negative bias voltage, which can be affected by partial pressure of N 2 and Ar gases. From the statistical analysis of the experimental results, they proposed a new hybrid mechanism of ion bombardment and electrical repulsion. Also, the growth of the AIP CrN films was greatly altered by applying negative bias voltage. By increasing the bias voltage, the film surfaces became much smoother and the films evolved from apparent columnar microstructures to an equiaxed microstructure. The impinging high-energy Cr ions accelerated by negative bias voltages were deemed the inherent reason for the evolution of growth characteristics

Device and methods for writing and erasing analog information in small memory units via voltage pulses

Science.gov (United States)

El Gabaly Marquez, Farid; Talin, Albert Alec

2018-04-17

Devices and methods for non-volatile analog data storage are described herein. In an exemplary embodiment, an analog memory device comprises a potential-carrier source layer, a barrier layer deposited on the source layer, and at least two storage layers deposited on the barrier layer. The memory device can be prepared to write and read data via application of a biasing voltage between the source layer and the storage layers, wherein the biasing voltage causes potential-carriers to migrate into the storage layers. After initialization, data can be written to the memory device by application of a voltage pulse between two storage layers that causes potential-carriers to migrate from one storage layer to another. A difference in concentration of potential carriers caused by migration of potential-carriers between the storage layers results in a voltage that can be measured in order to read the written data.

High voltage generator circuit with low power and high efficiency applied in EEPROM

International Nuclear Information System (INIS)

Liu Yan; Zhang Shilin; Zhao Yiqiang

2012-01-01

This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

Management of High-Voltage Burns of the Hand and Wrist with Negative Pressure Dressing

Directory of Open Access Journals (Sweden)

Nazım Gümüş

2017-12-01

Full Text Available Objective: Negative pressure dressing stimulates wound healing by promoting cellular proliferation and regeneration. It also removes interstitial edema and increases local blood flow, resulting in rapid growth of the granulation tissue. We used the dressing method in deep hand and wrist burns caused by high-voltage electrical current, which leads to progressive tissue necrosis, elevated compartment pressure, and deep tissue edema, to reveal if subatmospheric pressure could limit the zone of injury or ongoing tissue necrosis after electrical burn. Material and Methods: Six hands of five patients, who came in contact with high-voltage electrical wire carrying more than 1000 volts, are presented in this study. Hands and wrists were seriously injured and contracted. After the initial treatment involving fluid resuscitation, fasciotomy, carpal tunnel release, and debridement, a negative pressure dressing was applied to the wounds of hand, wrist, and forearm with 125 mm Hg continuous pressure, and maintained for 20 days. Results: When negative pressure dressing was stopped on the 20th day, significant granulation tissue developed over the hand and forearm wounds. However, wrist wounds needed more debridement and repeated dressings because of the presence of necrosis. Edema of the hands subsided significantly during the use of negative pressure dressing. Time to closure for hand and forearm wounds decreased considerably. Moreover, in one wrist, spontaneous closure was achieved at about one month. All hands except one treated with negative pressure dressing could be saved from amputation; however, significant tissue loss developed, needing complex reconstruction procedures. One hand was amputated because of the permanent loss of blood perfusion. Conclusion: The management of high-voltage burns of hand and wrist with subatmospheric pressure appears to be capable of reducing hand edema and accelerating closure of the wounds. It seems that negative

Quantum eraser and the decoherence time of a local measurement process

International Nuclear Information System (INIS)

Abranyos, Y.; Jakob, M.; Bergou, J.

1998-01-01

We propose an implementation of the quantum eraser, based on a recent experimental scheme by Eichmann et al. involving two four-level atoms. In our version a continuous broad band excitation field drives the two trapped atoms and information about which atom scattered the light is stored in the internal degrees of freedom of the atoms. Entanglement of the two atoms after the detection of the photon is intimately connected to the availability of this 'which path' information. We also show that the quantum eraser can be used to measure the decoherence time of a local measurement process. (author)

Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT

Science.gov (United States)

Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar

2018-04-01

This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.

Optically erasable and rewritable solid-state holograms.

Science.gov (United States)

Gaylord, T. K.; Rabson, T. A.; Tittel, F. K.

1972-01-01

Optical holographic storage in single-crystal LiNbO3 is described which can be optically erased at room temperature and then rewritten with no degradation in efficiency or writing rate. The diffraction efficiencies associated with the process are about 0.0001. Some variations from previously obtained results include a lack of threshold power density for writing, very-long-term persistence of the stored hologram, and a lack of a dependence of the diffracted intensity on the polarization of the readout beam.

Different types of inks having certain medicolegal importance: Deciphering the faded and physically erased handwriting

Directory of Open Access Journals (Sweden)

Manal Abd-ElAziz Abd-ElZaher

2014-06-01

Full Text Available Disappearing ink is a type of ink which could be used to forge documents as it will fade away without any trace within 40–65 h. Erasable ink is another type of ink easily removed by certain rubbers incorporated in each pen. Both types of inks were applied separately on different types of papers (checks, standard white foolscap, and plain white A4 paper. For vanishing ink, it was observed visually in the first 6 h and then every 6 h. It was found that the vanishing ink disappeared completely within 2 h on checks, 36 h on standard white foolscap paper, and 40 h on plain white A4 paper. For erasable ink, the written strokes were manipulated manually using the incorporated eraser. Deciphering the faded writing failed by the conventional methods, but oblique light can reveal the indentation marks. The faded writing became visible when treated with weak alkaline (NaOH solutions. Erasable ink was deciphered with the aid of infra-red radiation combined with VSC-6000 as clear white traces against red fluorescence. It was concluded that the use of a weak (NaOH solution is an effective method for revealing the faded writing, and the infra-red illumination is also effective.

Improvement of voltage holding capability in the 500 keV negative ion source for JT-60SA.

Science.gov (United States)

Tanaka, Y; Hanada, M; Kojima, A; Akino, N; Shimizu, T; Ohshima, K; Inoue, T; Watanabe, K; Taniguchi, M; Kashiwagi, M; Umeda, N; Tobari, H; Grisham, L R

2010-02-01

Voltage holding capability of JT-60 negative ion source that has a large electrostatic negative ion accelerator with 45 cm x 1.1 m acceleration grids was experimentally examined and improved to realize 500 keV, 22 A, and 100 s D- ion beams for JT-60 Super Advanced. The gap lengths in the acceleration stages were extended to reduce electric fields in a gap between the large grids and at the corner of the support flanges from the original 4-5 to 3-4 kV/mm. As a result, the voltage holding capability without beam acceleration has been successfully improved from 400 to 500 kV. The pulse duration to hold 500 kV reached 40 s of the power supply limitation.

Low-Voltage Ride-Through Operation of Power Converters in Grid-Interactive Microgrids by Using Negative-Sequence Droop Control

DEFF Research Database (Denmark)

Zhao, Xin; Guerrero, Josep M.; Savaghebi, Mehdi

2017-01-01

of the utility grid during grid faults. In this paper, a LVRT control strategy based on positive/negative sequence droop control is proposed for grid-interactive MGs to ride-through voltage sags with not only inductive/resistive, but also complex line impedance. By using the proposed control strategy, MGs can......Due to the increasing penetration level of microgrids (MGs), it becomes a critical issue for MGs to help sustaining power system stability. Therefore, ancillary services, such as the low-voltage ride-through (LVRT) capability should be incorporated in MGs in order to guarantee stable operation...... support the grid voltage, make profits, and also ride-through the voltage dip during the whole fault period. A two layer hierarchical control strategy is proposed in this paper. The primary controller consists of voltage and current inner loops, a conventional droop control and a virtual impedance loop...

Laser induced Erasable Patterns in a N* Liquid Crystal on an Iron Doped Lithium Niobate (Postprint)

Science.gov (United States)

2017-10-12

4685; Clearance Date: 22 Sep 2017. This document contains color . Journal article published in Optics Express, Vol. 25, No. 21, 22 Sep 2017. © 2017...be applied selectively to erase these patterns. Thus, a promising method is reported to generate reconfigurable patterns, photonic motives , and...erase these patterns. Thus, a promising method is reported to generate reconfigurable patterns, photonic motives , and touch sensitive devices in a

Effective Dosage of Midazolam to Erase the Memory of Vascular Pain During Propofol Administration.

Science.gov (United States)

Boku, Aiji; Inoue, Mika; Hanamoto, Hiroshi; Oyamaguchi, Aiko; Kudo, Chiho; Sugimura, Mitsutaka; Niwa, Hitoshi

Intravenous sedation with propofol is often administered to anxious patients in dental practice. Pain on injection of propofol is a common adverse effect. This study aimed to determine the age-adjusted doses of midazolam required to erase memory of vascular pain of propofol administration and assess whether the Ramsay Sedation Scale (RSS) after the pretreatment of midazolam was useful to predict amnesia of the vascular pain of propofol administration. A total of 246 patients with dental phobia requiring dental treatment under intravenous sedation were included. Patients were classified according to their age: 30s, 40s, 50s, and 60s. Three minutes after administration of a predetermined dose of midazolam, propofol was infused continuously. After completion of the dental procedure, patients were interviewed about the memory of any pain or discomfort in the injection site or forearm. The dosage of midazolam was determined using the Dixon up-down method. The first patient was administered 0.03 mg/kg, and if memory of vascular pain remained, the dosage was increased by 0.01 mg/kg for the next patient, and then if the memory was erased, the dosage was decreased by 0.01 mg/kg. The effective dosage of midazolam in 95% of each age group for erasing the memory of propofol vascular pain (ED95) was determined using logistic analysis. The accuracy of RSS to predict the amnesia of injection pain was assessed by receiver operating characteristic (ROC) analysis. The ED95 of midazolam to erase the memory of propofol vascular pain was 0.061 mg/kg in patients in their 30s, 0.049 mg/kg in patients in their 40s, 0.033 mg/kg in patients in their 50s, and 0.033 mg/kg in patients in their 60s. The area under the ROC curve was 0.31. The ED95 of midazolam required to erase the memory of propofol vascular pain demonstrated a downward trend with age. On the other hand, it was impossible to predict the amnesia of propofol vascular pain using the RSS.

A school-based, teacher-mediated prevention program (ERASE-Stress) for reducing terror-related traumatic reactions in Israeli youth: a quasi-randomized controlled trial.

Science.gov (United States)

Gelkopf, Marc; Berger, Rony

2009-08-01

Since September 2000 Israeli children have been exposed to a large number of terrorist attacks. A universal, school-based intervention for dealing with the threat of terrorism as well as with terror-related symptoms, ERASE-Stress (ES), was evaluated in a male religious middle school in southern Israel. The program was administered by the homeroom teachers as part of the school curriculum. It consists of 12 classroom sessions each lasting 90 minutes, and included psycho-educational material, skill training and resiliency strategies delivered to the students by homeroom teachers. One hundred and fourteen 7th and 8th grade students were randomly assigned to the ES intervention or were part of a waiting list (WL). They were assessed on measures of posttraumatic symptomatology, depression, somatic symptoms and functional problems before and 3 months after the intervention or the WL period. Three months after the program ended, students in the experimental group showed significant reduction in all measures compared to the waiting-list control group. The ERASE-Stress program may help students suffering from terror-related posttraumatic symptoms and mitigate the negative effects of future traumatic experiences. Furthermore, a school-based universal program such as the ERASE-Stress may potentially serve as an important and effective component of a community mental health policy for communities affected by terrorism.

Light-erasable embedded charge-trapping memory based on MoS2 for system-on-panel applications

Science.gov (United States)

He, Long-Fei; Zhu, Hao; Xu, Jing; Liu, Hao; Nie, Xin-Ran; Chen, Lin; Sun, Qing-Qing; Xia, Yang; Wei Zhang, David

2017-11-01

The continuous scaling and challenges in device integrations in modern portable electronic products have aroused many scientific interests, and a great deal of effort has been made in seeking solutions towards a more microminiaturized package assembled with smaller and more powerful components. In this study, an embedded light-erasable charge-trapping memory with a high-k dielectric stack (Al2O3/HfO2/Al2O3) and an atomically thin MoS2 channel has been fabricated and fully characterized. The memory exhibits a sufficient memory window, fast programming and erasing (P/E) speed, and high On/Off current ratio up to 107. Less than 25% memory window degradation is observed after projected 10-year retention, and the device functions perfectly after 8000 P/E operation cycles. Furthermore, the programmed device can be fully erased by incident light without electrical assistance. Such excellent memory performance originates from the intrinsic properties of two-dimensional (2D) MoS2 and the engineered back-gate dielectric stack. Our integration of 2D semiconductors in the infrastructure of light-erasable charge-trapping memory is very promising for future system-on-panel applications like storage of metadata and flexible imaging arrays.

Eraser-based eco-friendly fabrication of a skin-like large-area matrix of flexible carbon nanotube strain and pressure sensors.

Science.gov (United States)

Sahatiya, Parikshit; Badhulika, Sushmee

2017-03-03

This paper reports a new type of electronic, recoverable skin-like pressure and strain sensor, produced on a flexible, biodegradable pencil-eraser substrate and fabricated using a solvent-free, low-cost and energy efficient process. Multi-walled carbon nanotube (MWCNT) film, the strain sensing element, was patterned on pencil eraser with a rolling pin and a pre-compaction mechanical press. This induces high interfacial bonding between the MWCNTs and the eraser substrate, which enables the sensor to achieve recoverability under ambient conditions. The eraser serves as a substrate for strain sensing, as well as acting as a dielectric for capacitive pressure sensing, thereby eliminating the dielectric deposition step, which is crucial in capacitive-based pressure sensors. The strain sensing transduction mechanism is attributed to the tunneling effect, caused by the elastic behavior of the MWCNTs and the strong mechanical interlock between MWCNTs and the eraser substrate, which restricts slippage of MWCNTs on the eraser thereby minimizing hysteresis. The gauge factor of the strain sensor was calculated to be 2.4, which is comparable to and even better than most of the strain and pressure sensors fabricated with more complex designs and architectures. The sensitivity of the capacitive pressure sensor was found to be 0.135 MPa -1 .To demonstrate the applicability of the sensor as artificial electronic skin, the sensor was assembled on various parts of the human body and corresponding movements and touch sensation were monitored. The entire fabrication process is scalable and can be integrated into large areas to map spatial pressure distributions. This low-cost, easily scalable MWCNT pin-rolled eraser-based pressure and strain sensor has huge potential in applications such as artificial e-skin in flexible electronics and medical diagnostics, in particular in surgery as it provides high spatial resolution without a complex nanostructure architecture.

Color Image Secret Watermarking Erase and Write Algorithm Based on SIFT

Science.gov (United States)

Qu, Jubao

The use of adaptive characteristics of SIFT, image features, the implementation of the write, erase operations on Extraction and color image hidden watermarking. From the experimental results, this algorithm has better imperceptibility and at the same time, is robust against geometric attacks and common signal processing.

Quality Assessment of the Physico-Mechanical and Elemental Composition of Three Pencil Grades and Eraser Types Produced in Nigeria

Directory of Open Access Journals (Sweden)

K. I. Omoniyi

2014-06-01

Full Text Available The quality assessment of the physical (pH, electrical conductivity, density, writeability, eraseability, mechanical (compression test and break strength and elemental composition of the pencil grades HB, 2B and 3B and eraser types of brand names Ben 10, Tiky 20 and the commonest White eraser in Nigerian primary school (Gummes Co. China was carried out. The diameter of the graphite part increased in the order HB Cr > Cd. Though, the levels of the trace metals and essential elements detected in the school items are below the recommended limits, regulatory measures should be directed towards maintaining the standards of school items.

Hysteresis and negative differential resistance of the current-voltage characteristic of a water bridge

Science.gov (United States)

Oshurko, V. B.; Fedorov, A. N.; Ropyanoi, A. A.; Fedosov, M. V.

2014-06-01

It is found experimentally that the properties of nanoporous ion-exchange membranes (hysteresis of the current-voltage characteristic in the solution and negative differential resistance), which have been discussed in recent years, are not associated with the properties of the membrane. It is shown that these effects are also observed in a floating water bridge and in water-filled tubes and are apparently determined by the geometrical shape of the liquid conductor. The observed effects are explained qualitatively.

Beyond extinction: erasing human fear responses and preventing the return of fear

NARCIS (Netherlands)

Kindt, M.; Soeter, M.; Vervliet, B.

2009-01-01

Animal studies have shown that fear memories can change when recalled, a process referred to as reconsolidation. We found that oral administration of the beta-adrenergic receptor antagonist propranolol before memory reactivation in humans erased the behavioral expression of the fear memory 24 h

Generalized Bohm’s criterion and negative anode voltage fall in electric discharges

Energy Technology Data Exchange (ETDEWEB)

Londer, Ya. I.; Ul’yanov, K. N., E-mail: kulyanov@vei.ru [Lenin All-Russian Electrotechnical Institute (Russian Federation)

2013-10-15

The value of the voltage fall across the anode sheath is found as a function of the current density. Analytic solutions are obtained in a wide range of the ratio of the directed velocity of plasma electrons v{sub 0} to their thermal velocity v{sub T}. It is shown that the voltage fall in a one-dimensional collisionless anode sheath is always negative. At the small values of v{sub 0}/v{sub T}, the obtained expression asymptotically transforms into the Langmuir formula. Generalized Bohm’s criterion for an electric discharge with allowance for the space charge density ρ(0), electric field E(0), ion velocity v{sub i}(0), and ratio v{sub 0}/v{sub T} at the plasma-sheath interface is formulated. It is shown that the minimum value of the ion velocity v{sub i}{sup *}(0) corresponds to the vanishing of the electric field at one point inside the sheath. The dependence of v{sub i}{sup *} (0) on ρ(0), E(0), and v{sub 0}/v{sub T} determines the boundary of the existence domain of stationary solutions in the sheath. Using this criterion, the maximum possible degree of contraction of the electron current at the anode is determined for a short high-current vacuum arc discharge.

Generalized Bohm’s criterion and negative anode voltage fall in electric discharges

International Nuclear Information System (INIS)

Londer, Ya. I.; Ul’yanov, K. N.

2013-01-01

The value of the voltage fall across the anode sheath is found as a function of the current density. Analytic solutions are obtained in a wide range of the ratio of the directed velocity of plasma electrons v 0 to their thermal velocity v T . It is shown that the voltage fall in a one-dimensional collisionless anode sheath is always negative. At the small values of v 0 /v T , the obtained expression asymptotically transforms into the Langmuir formula. Generalized Bohm’s criterion for an electric discharge with allowance for the space charge density ρ(0), electric field E(0), ion velocity v i (0), and ratio v 0 /v T at the plasma-sheath interface is formulated. It is shown that the minimum value of the ion velocity v i * (0) corresponds to the vanishing of the electric field at one point inside the sheath. The dependence of v i * (0) on ρ(0), E(0), and v 0 /v T determines the boundary of the existence domain of stationary solutions in the sheath. Using this criterion, the maximum possible degree of contraction of the electron current at the anode is determined for a short high-current vacuum arc discharge

Doubly tagged delayed-choice tunable quantum eraser: coherence, information and measurement

Science.gov (United States)

Imran, Muhammad; Tariq, Hinna; Rameez-ul-Islam; Ikram, Manzoor

2018-01-01

We present an idea for the doubly tagged delayed-choice tunable quantum eraser in a cavity QED setup, based on fully controlled resonant as well as dispersive atom-field interactions. Two cavity fields, bound initially in the Bell state, are coupled to a three-level atom. Such an atom is initially prepared in the coherent superposition of the lower two levels and is quite capable of exhibiting Ramsey fringes if taken independently. It is shown that the coherence lost due to tagging can not only be retrieved but that the fringe visibility/path distinguishability can also be conditionally tuned in a delayed manner through local manipulation of the entangled cavity fields. The stringent condition here is the retainment of the system’s coherence during successive manipulations of the individual cavity fields. Such a quantum eraser, therefore, prominently highlights the links among all the counterintuitive features of quantum theory including the conception of time, measurement, state vector reduction, coherence and information in an unambiguous manner. The schematics can be straightforwardly extended to a multipartite scenario and employed to explore multi-player quantum games with the payoff being strangely decided through delayed choice setups.

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

Action Movie in Election Day: Eraser (1996, Arnold Chwarzenegger and Other Politics Medias

Directory of Open Access Journals (Sweden)

Fabro Boaz Steibel

2008-08-01

Full Text Available This article aims to explore methodological frontiers between movie theory and political ommunication studies. When identifying traces of how politics, art and entertainment interact, it is possible to understand how movie celebrities can act as politicians, and vice versa. Arnold Schwarzenegger is a world famous actor who has twice won the Californian gubernatorial election. The principal purpose of this article is not to discuss political spectacle or analyse Schwarzenegger’s approach to government. The idea is to understand how a film in which Schwarzenegger starred over a decade ago (Eraser, 1996 has influenced his campaign image construction. The article’s methodological basis is a collective text by the Editors of Cahiers du Cinéma, based on John Ford’s Young Mr. Lincoln (1939. Its methodology allows us to observe important characteristics of Schwarzenegger’s role in the Eraser movie, which are then compared to the 2002 election scenario.

Atmospheric response to Saharan dust deduced from ECMWF reanalysis increments

Science.gov (United States)

Kishcha, P.; Alpert, P.; Barkan, J.; Kirchner, I.; Machenhauer, B.

2003-04-01

This study focuses on the atmospheric temperature response to dust deduced from a new source of data - the European Reanalysis (ERA) increments. These increments are the systematic errors of global climate models, generated in reanalysis procedure. The model errors result not only from the lack of desert dust but also from a complex combination of many kinds of model errors. Over the Sahara desert the dust radiative effect is believed to be a predominant model defect which should significantly affect the increments. This dust effect was examined by considering correlation between the increments and remotely-sensed dust. Comparisons were made between April temporal variations of the ERA analysis increments and the variations of the Total Ozone Mapping Spectrometer aerosol index (AI) between 1979 and 1993. The distinctive structure was identified in the distribution of correlation composed of three nested areas with high positive correlation (> 0.5), low correlation, and high negative correlation (Forecast(ECMWF) suggests that the PCA (NCA) corresponds mainly to anticyclonic (cyclonic) flow, negative (positive) vorticity, and downward (upward) airflow. These facts indicate an interaction between dust-forced heating /cooling and atmospheric circulation. The April correlation results are supported by the analysis of vertical distribution of dust concentration, derived from the 24-hour dust prediction system at Tel Aviv University (website: http://earth.nasa.proj.ac.il/dust/current/). For other months the analysis is more complicated because of the essential increasing of humidity along with the northward progress of the ITCZ and the significant impact on the increments.

Adaptive control strategy for ECRH negative high-voltage power supply based on CMAC neural network

International Nuclear Information System (INIS)

Luo Xiaoping; Du Pengying; Du Shaowu

2011-01-01

In order to solve the problem that the negative high-voltage power supply in an electron cyclotron resonance heating (ECRH) system can not satisfy the requirements because of the nonlinearity and sensitivity, the direct inverse model control strategy was proposed by using cerebellar model articulation controller(CMAC) for better control, and experiments were carried out to study the system performances with CMAC tracing dynamic signals. The results show that this strategy is strong in self-learning and self-adaptation and easy to be realized. (authors)

Evaluation of indices for voltage stability monitoring using PMU measurements

Directory of Open Access Journals (Sweden)

Sindy Lorena Ramirez Perdomo

2014-09-01

Full Text Available Large disturbances such as voltage collapse and its consequences represent a large challenge to the operational safety of power systems. Therefore, it is important to have indicators of the presence of voltage stability problems in real time. Using phasor measure-ments of voltage and current that are presented in Phasor Measurement Units (PMU, indices for voltage stability monitoring can be calculated in real time. This paper presents some indices for voltage stability monitoring using PMU measurements. Evaluation of such indices on a simplified system was carried out, and the indices were classified according to their method of calculation. Finally, one of these indices was used with the New England 39-bus system under different operating scenarios, including load increments, line output and generator output, to check the indices’ behavior for voltage stability monitoring based on synchronized local measurements.

Threshold-voltage modulated phase change heterojunction for application of high density memory

International Nuclear Information System (INIS)

Yan, Baihan; Tong, Hao; Qian, Hang; Miao, Xiangshui

2015-01-01

Phase change random access memory is one of the most important candidates for the next generation non-volatile memory technology. However, the ability to reduce its memory size is compromised by the fundamental limitations inherent in the CMOS technology. While 0T1R configuration without any additional access transistor shows great advantages in improving the storage density, the leakage current and small operation window limit its application in large-scale arrays. In this work, phase change heterojunction based on GeTe and n-Si is fabricated to address those problems. The relationship between threshold voltage and doping concentration is investigated, and energy band diagrams and X-ray photoelectron spectroscopy measurements are provided to explain the results. The threshold voltage is modulated to provide a large operational window based on this relationship. The switching performance of the heterojunction is also tested, showing a good reverse characteristic, which could effectively decrease the leakage current. Furthermore, a reliable read-write-erase function is achieved during the tests. Phase change heterojunction is proposed for high-density memory, showing some notable advantages, such as modulated threshold voltage, large operational window, and low leakage current

Threshold-voltage modulated phase change heterojunction for application of high density memory

Science.gov (United States)

Yan, Baihan; Tong, Hao; Qian, Hang; Miao, Xiangshui

2015-09-01

Phase change random access memory is one of the most important candidates for the next generation non-volatile memory technology. However, the ability to reduce its memory size is compromised by the fundamental limitations inherent in the CMOS technology. While 0T1R configuration without any additional access transistor shows great advantages in improving the storage density, the leakage current and small operation window limit its application in large-scale arrays. In this work, phase change heterojunction based on GeTe and n-Si is fabricated to address those problems. The relationship between threshold voltage and doping concentration is investigated, and energy band diagrams and X-ray photoelectron spectroscopy measurements are provided to explain the results. The threshold voltage is modulated to provide a large operational window based on this relationship. The switching performance of the heterojunction is also tested, showing a good reverse characteristic, which could effectively decrease the leakage current. Furthermore, a reliable read-write-erase function is achieved during the tests. Phase change heterojunction is proposed for high-density memory, showing some notable advantages, such as modulated threshold voltage, large operational window, and low leakage current.

Memory characteristics of Au nanocrystals embedded in metal-oxide-semiconductor structure by using atomic-layer-deposited Al2O3 as control oxide

International Nuclear Information System (INIS)

Wang, C.-C.; Chiou, Y.-K.; Chang, C.-H.; Tseng, J.-Y.; Wu, L.-J.; Chen, C.-Y.; Wu, T.-B.

2007-01-01

The nonvolatile memory characteristics of metal-oxide-semiconductor (MOS) structures containing Au nanocrystals in the Al 2 O 3 /SiO 2 matrix were studied. In this work, we have demonstrated that the use of Al 2 O 3 as control oxide prepared by atomic-layer-deposition enhances the erase speed of the MOS capacitors. A giant capacitance-voltage hysteresis loop and a very short erase time which is lower than 1 ms can be obtained. Compared with the conventional floating-gate electrically erasable programmable read-only memories, the erase speed was promoted drastically. In addition, very low leakage current and large turn-around voltage resulting from electrons or holes stored in the Au nanocrystals were found in the current-voltage relation of the MOS capacitors

A non-erasable magnetic memory based on the magnetic permeability

International Nuclear Information System (INIS)

Petrie, J.R.; Wieland, K.A.; Burke, R.A.; Newburgh, G.A.; Burnette, J.E.; Fischer, G.A.; Edelstein, A.S.

2014-01-01

A non-erasable memory based on using differences in the magnetic permeability is demonstrated. The method can potentially store information indefinitely. Initially the high permeability bits were 10–50 μm wide lines of sputtered permalloy (Ni 81 Fe 19 ) on a glass substrate. In a second writing technique a continuous film of amorphous, high permeability ferromagnetic Metglas (Fe 78 Si 13 B 9 ) was sputtered onto a similar glass substrate. Low permeability, crystalline 50 μm wide lines were then written in the film by laser heating. Both types of written media were read by applying an external probe field that is locally modified by the permeability of each bit. The modifications in the probe field were read by a nearby set of 10 micron wide magnetic tunnel junctions with a signal-to-noise ratio of up to 45 dB. This large response to changes in bit permeability is not altered after the media has been exposed to a 6400 Oe field. While being immediately applicable for data archiving and secure information storage, higher densities are possible with smaller read and write heads. - Highlights: • We demonstrate a non-erasable memory based on changes in the magnetic permeability. • Large change in permeability occur when Metglas changes from amorphous to crystalline. • Micron size regions of Metglas can be crystallized using a laser. • Permeability changes read by observing deviations of a probe field with an MTJ

Atmospheric response to Saharan dust deduced from ECMWF reanalysis (ERA) temperature increments

Science.gov (United States)

Kishcha, P.; Alpert, P.; Barkan, J.; Kirchner, I.; Machenhauer, B.

2003-09-01

This study focuses on the atmospheric temperature response to dust deduced from a new source of data the European Reanalysis (ERA) increments. These increments are the systematic errors of global climate models, generated in the reanalysis procedure. The model errors result not only from the lack of desert dust but also from a complex combination of many kinds of model errors. Over the Sahara desert the lack of dust radiative effect is believed to be a predominant model defect which should significantly affect the increments. This dust effect was examined by considering correlation between the increments and remotely sensed dust. Comparisons were made between April temporal variations of the ERA analysis increments and the variations of the Total Ozone Mapping Spectrometer aerosol index (AI) between 1979 and 1993. The distinctive structure was identified in the distribution of correlation composed of three nested areas with high positive correlation (>0.5), low correlation and high negative correlation (Forecast (ECMWF) suggest that the PCA (NCA) corresponds mainly to anticyclonic (cyclonic) flow, negative (positive) vorticity and downward (upward) airflow. These findings are associated with the interaction between dust-forced heating/cooling and atmospheric circulation. This paper contributes to a better understanding of dust radiative processes missed in the model.

DC-Voltage Fluctuation Elimination Through a DC-Capacitor Current Control for DFIG Converters Under Unbalanced Grid Voltage Conditions

DEFF Research Database (Denmark)

Liu, Changjin; Xu, Dehong; Zhu, Nan

2013-01-01

Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...

Decoherence in a double-slit quantum eraser

International Nuclear Information System (INIS)

Torres-Ruiz, F. A.; Lima, G.; Delgado, A.; Saavedra, C.; Padua, S.

2010-01-01

We study and experimentally implement a double-slit quantum eraser in the presence of a controlled decoherence mechanism. A two-photon state, produced in a spontaneous parametric down-conversion process, is prepared in a maximally entangled polarization state. A birefringent double slit is illuminated by one of the down-converted photons, and it acts as a single-photon two-qubits controlled-not gate that couples the polarization with the transversal momentum of these photons. The other photon, which acts as a which-path marker, is sent through a Mach-Zehnder-like interferometer. When the interferometer is partially unbalanced, it behaves as a controlled source of decoherence for polarization states of down-converted photons. We show the transition from wavelike to particle-like behavior of the signal photons crossing the double slit as a function of the decoherence parameter, which depends on the length path difference at the interferometer.

High-voltage pulse generator synchronous with LINAC

International Nuclear Information System (INIS)

Muto, M.; Hiratsuka, Yoshio; Niimura, Nobuo

1974-01-01

High-voltage pulse generator (H.V. Flip-Flop) No.2, an improved type of No.1, is described, which is used in the structural analysis of transient phenomena in materials through the neutron TOF with a Linac. The method of producing positive and negative high-voltage pulses synchronous with the Linac is identical with that in No.1. However, No.2 has outstanding features as follows: (1) The rise time of output pulses is reduced to 0.3 msec, due to the improvement of switching circuit and the winding of a step-up transformer; (2) The widths of positive and negative pulses are variable up to maximum 8 and 16 frames, respectively (One frame = 10 msec); (3) The distribution of TOF signals from a BF 3 counter to a time analyzer is possible even in the negative voltage duration. The panel is provided with the switches for choosing pulse width and the frame for analysis, as well as the dials for setting positive/negative pulse voltage values and the respective indicating meters. (Mori, K)

Analysis of writing and erasing behaviours in phase change materials

Energy Technology Data Exchange (ETDEWEB)

Hyot, B. E-mail: bhyot@cea.fr; Poupinet, L.; Gehanno, V.; Desre, P.J

2002-09-01

An understanding of the process involved in writing and erasing of phase-change optical recording media is vital to the development of new, and the improvement of existing, products. The present work investigates both experimental and theoretical laser-induced fast structural transformations of GeSbTe thin films. Optical and microstructural changes are correlated using both a static tester and transmission electron microscopy. In the second part of this paper we try to elucidate the physics underlying the amorphous-to-crystalline phase transformation under short-pulse laser excitation. Both thermal and thermodynamical behaviours must be taken into account to illustrate real processes.

Analysis of writing and erasing behaviours in phase change materials

International Nuclear Information System (INIS)

Hyot, B.; Poupinet, L.; Gehanno, V.; Desre, P.J.

2002-01-01

An understanding of the process involved in writing and erasing of phase-change optical recording media is vital to the development of new, and the improvement of existing, products. The present work investigates both experimental and theoretical laser-induced fast structural transformations of GeSbTe thin films. Optical and microstructural changes are correlated using both a static tester and transmission electron microscopy. In the second part of this paper we try to elucidate the physics underlying the amorphous-to-crystalline phase transformation under short-pulse laser excitation. Both thermal and thermodynamical behaviours must be taken into account to illustrate real processes

The Effects of Cells Temperature Increment and Variations of Irradiation for Monocrystalline Photovoltaic

Science.gov (United States)

Fuad Rahman Soeharto, Faishal; Hermawan

2017-04-01

Photovoltaic cell technology has been developed to meet the target of 17% Renewable Energy in 2025 accordance with Indonesia Government Regulation No. 5 2006. Photovoltaic cells are made of semiconductor materials, namely silicon or germanium (p-n junction). These cells need the light that comes from solar irradiation which brings energy photons to convert light energy into electrical energy. It is different from the solar heater that requires heat energy or thermal of sunlight that is normally used for drying or heating water. Photovoltaic cells requires energy photons to perform the energy conversion process, the photon energy can be derived from sunlight. Energy photon is taken from the sun light along with the advent of heat due to black-body radiation, which can lead to temperature increments of photovoltaic cells. Increment of 1°C can decreased photovoltaic cell voltage of up to 2.3 mV per cell. In this research, it will be discuss the analysis of the effect of rising temperatures and variations of irradiation on the type monocrystalline photovoltaic. Those variation are analyzed, simulated and experiment by using a module of experiment. The test results show that increment temperature from 25° C to 80° C at cell of photovoltaic decrease the output voltage of the photovoltaic cell at 4.21 V, and it also affect the power output of the cell which decreases up to 0.7523 Watt. In addition, the bigger the value of irradiation received by cell at amount of 1000 W / m2, produce more output power cells at the same temperature.

Implementing Kernel Methods Incrementally by Incremental Nonlinear Projection Trick.

Science.gov (United States)

Kwak, Nojun

2016-05-20

Recently, the nonlinear projection trick (NPT) was introduced enabling direct computation of coordinates of samples in a reproducing kernel Hilbert space. With NPT, any machine learning algorithm can be extended to a kernel version without relying on the so called kernel trick. However, NPT is inherently difficult to be implemented incrementally because an ever increasing kernel matrix should be treated as additional training samples are introduced. In this paper, an incremental version of the NPT (INPT) is proposed based on the observation that the centerization step in NPT is unnecessary. Because the proposed INPT does not change the coordinates of the old data, the coordinates obtained by INPT can directly be used in any incremental methods to implement a kernel version of the incremental methods. The effectiveness of the INPT is shown by applying it to implement incremental versions of kernel methods such as, kernel singular value decomposition, kernel principal component analysis, and kernel discriminant analysis which are utilized for problems of kernel matrix reconstruction, letter classification, and face image retrieval, respectively.

Performance Improvement of DFIG Wind Turbine Using Series Grid-Side Converter under Unbalanced Grid Voltage and Voltage Sag Conditions

DEFF Research Database (Denmark)

Shokri, Yunes; Ebrahimzadeh, Esmaeil; Lesani, Hamid

2014-01-01

under unbalanced grid voltage and small voltage sag conditions without needing additional DC link capacitor or energy storage unlike other methods. The control system includes negative and positive sequence controllers which make the stator voltage balanced and keep it constant at the nominal value...

Transferring the Incremental Capacity Analysis to Lithium-Sulfur Batteries

DEFF Research Database (Denmark)

Knap, Vaclav; Kalogiannis, Theodoros; Purkayastha, Rajlakshmi

2017-01-01

In order to investigate the battery degradation and to estimate their health, various techniques can be applied. One of them, which is widely used for Lithium-ion batteries, is the incremental capacity analysis (ICA). In this work, we apply the ICA to Lithium-Sulfur batteries, which differ in many...... aspects from Lithium-ion batteries and possess unique behavior. One of the challenges of applying the ICA to Lithium-Sulfur batteries is the representation of the IC curves, as their voltage profiles are often non-monotonic, resulting in more complex IC curves. The ICA is at first applied to charge...

Voltage-Induced Nonlinear Conduction Properties of Epoxy Resin/Micron-Silver Particles Composites

Science.gov (United States)

Qu, Zhaoming; Lu, Pin; Yuan, Yang; Wang, Qingguo

2018-01-01

The nonlinear conduction properties of epoxy resin (ER)/micron-silver particles (MP) composites were investigated. Under sufficient high intensity applied constant voltage, the obvious nonlinear conduction properties of the samples with volume fraction 25% were found. With increments in the voltage, the conductive switching effect was observed. The nonlinear conduction mechanism of the ER/MP composites under high applied voltages could be attributed to the electrical current conducted via discrete paths of conductive particles induced by the electric field. The test results show that the ER/MP composites with nonlinear conduction properties are of great potential application in electromagnetic protection of electron devices and systems.

10,000 optical write, read, and erase cycles in an azobenzene sidechain liquid-crystalline polyester

DEFF Research Database (Denmark)

Holme, NCR; Ramanujam, P.S.; Hvilsted, Søren

1996-01-01

We show far what is believed to he the first time that it is possible tu generate 10,000 rapid write, read, and erase cycles optically in an azobenzene sidechain liquid-crystalline polyester. We do this by exposing the film alternately to visible light from an argon laser at 488 nm and ultraviolet...

Analysis of single-degree-of-freedom piezoelectric energy harvester with stopper by incremental harmonic balance method

Science.gov (United States)

Zhao, Dan; Wang, Xiaoman; Cheng, Yuan; Liu, Shaogang; Wu, Yanhong; Chai, Liqin; Liu, Yang; Cheng, Qianju

2018-05-01

Piecewise-linear structure can effectively broaden the working frequency band of the piezoelectric energy harvester, and improvement of its research can promote the practical process of energy collection device to meet the requirements for powering microelectronic components. In this paper, the incremental harmonic balance (IHB) method is introduced for the complicated and difficult analysis process of the piezoelectric energy harvester to solve these problems. After obtaining the nonlinear dynamic equation of the single-degree-of-freedom piecewise-linear energy harvester by mathematical modeling and the equation is solved based on the IHB method, the theoretical amplitude-frequency curve of open-circuit voltage is achieved. Under 0.2 g harmonic excitation, a piecewise-linear energy harvester is experimentally tested by unidirectional frequency-increasing scanning. The results demonstrate that the theoretical and experimental amplitudes have the same trend, and the width of the working band with high voltage output are 4.9 Hz and 4.7 Hz, respectively, and the relative error is 4.08%. The open-output peak voltage are 21.53 V and 18.25 V, respectively, and the relative error is 15.23%. Since the theoretical value is consistent with the experimental results, the theoretical model and the incremental harmonic balance method used in this paper are suitable for solving single-degree-of-freedom piecewise-linear piezoelectric energy harvester and can be applied to further parameter optimized design.

POWER STABILITY MONITORING BASED ON VOLTAGE INSTABILITY PREDICTION APPROACH THROUGH WIDE AREA SYSTEM

OpenAIRE

H. H. Goh; Q. S. Chua; S. W. Lee; B. C. Kok; K. C. Goh; K. T.K. Teo

2014-01-01

Nowadays, power systems are being forced to operate closer to its security limit due to current economic growth and the difficulties to upgrade the existing grid infrastructure. With the sudden increment of power demand, voltage instability problem has become a main concern to the power system operator because voltage instability has led or crucially contributed to some major blackouts throughout the world. Hence, methods for early warning and early prevention are required to prevent the powe...

Modelling of the negative discharge in long air gaps under impulse voltages

International Nuclear Information System (INIS)

Rakotonandrasana, J H; Beroual, A; Fofana, I

2008-01-01

This paper presents a self-consistent model enabling the description of the whole negative discharge sequence, initiated in long air gaps under impulse voltage waves. This sequence includes the different phases of the propagation such as the initiation of the first corona, the pilot leader, the electrode and space leaders, and their junction. The model consists of using a RLC equivalent electrical network, the parameters of which vary with time according to the discharge characteristics and geometry (R, L and C being, respectively, the resistance, the inductance and the capacitance). This model provides the spatial and temporal evolution of the entire discharge, the current and the corresponding electrical charge, the power and energy injected into the gap and the velocity. It also allows us to simulate an image converter working in streak or frame mode and the leader propagation velocities as well as the trajectory of the discharge obtained from a probabilistic distribution. The computed results are compared with experimental data. Good agreement between computed and experimental results was obtained for various test configurations

Grid Voltage Modulated Control of Grid-Connected Voltage Source Inverters under Unbalanced Grid Conditions

DEFF Research Database (Denmark)

Li, Mingshen; Gui, Yonghao; Quintero, Juan Carlos Vasquez

2017-01-01

In this paper, an improved grid voltage modulated control (GVM) with power compensation is proposed for grid-connected voltage inverters when the grid voltage is unbalanced. The objective of the proposed control is to remove the power ripple and to improve current quality. Three power compensation...... objectives are selected to eliminate the negative sequence components of currents. The modified GVM method is designed to obtain two separate second-order systems for not only the fast convergence rate of the instantaneous active and reactive powers but also the robust performance. In addition, this method...

Quasi-unipolar pentacene films embedded with fullerene for non-volatile organic transistor memories

Energy Technology Data Exchange (ETDEWEB)

Lee, Juhee; Lee, Sungpyo; Lee, Moo Hyung; Kang, Moon Sung, E-mail: mskang@ssu.ac.kr [Department of Chemical Engineering, Soongsil University, Seoul 156-743 (Korea, Republic of)

2015-02-09

Quasi-unipolar non-volatile organic transistor memory (NOTM) can combine the best characteristics of conventional unipolar and ambipolar NOTMs and, as a result, exhibit improved device performance. Unipolar NOTMs typically exhibit a large signal ratio between the programmed and erased current signals but also require a large voltage to program and erase the memory cells. Meanwhile, an ambipolar NOTM can be programmed and erased at lower voltages, but the resulting signal ratio is small. By embedding a discontinuous n-type fullerene layer within a p-type pentacene film, quasi-unipolar NOTMs are fabricated, of which the signal storage utilizes both electrons and holes while the electrical signal relies on only hole conduction. These devices exhibit superior memory performance relative to both pristine unipolar pentacene devices and ambipolar fullerene/pentacene bilayer devices. The quasi-unipolar NOTM exhibited a larger signal ratio between the programmed and erased states while also reducing the voltage required to program and erase a memory cell. This simple approach should be readily applicable for various combinations of advanced organic semiconductors that have been recently developed and thereby should make a significant impact on organic memory research.

A thermalization energy analysis of the threshold voltage shift in amorphous indium gallium zinc oxide thin film transistors under simultaneous negative gate bias and illumination

Energy Technology Data Exchange (ETDEWEB)

Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk [Electrical Engineering Division, Cambridge University, J J Thomson Avenue, Cambridge CB3 0FA (United Kingdom); Powell, M. J. [252, Valley Drive, Kendal LA9 7SL (United Kingdom)

2014-04-07

It has been previously observed that thin film transistors (TFTs) utilizing an amorphous indium gallium zinc oxide (a-IGZO) semiconducting channel suffer from a threshold voltage shift when subjected to a negative gate bias and light illumination simultaneously. In this work, a thermalization energy analysis has been applied to previously published data on negative bias under illumination stress (NBIS) in a-IGZO TFTs. A barrier to defect conversion of 0.65–0.75 eV is extracted, which is consistent with reported energies of oxygen vacancy migration. The attempt-to-escape frequency is extracted to be 10{sup 6}−10{sup 7} s{sup −1}, which suggests a weak localization of carriers in band tail states over a 20–40 nm distance. Models for the NBIS mechanism based on charge trapping are reviewed and a defect pool model is proposed in which two distinct distributions of defect states exist in the a-IGZO band gap: these are associated with states that are formed as neutrally charged and 2+ charged oxygen vacancies at the time of film formation. In this model, threshold voltage shift is not due to a defect creation process, but to a change in the energy distribution of states in the band gap upon defect migration as this allows a state formed as a neutrally charged vacancy to be converted into one formed as a 2+ charged vacancy and vice versa. Carrier localization close to the defect migration site is necessary for the conversion process to take place, and such defect migration sites are associated with conduction and valence band tail states. Under negative gate bias stressing, the conduction band tail is depleted of carriers, but the bias is insufficient to accumulate holes in the valence band tail states, and so no threshold voltage shift results. It is only under illumination that the quasi Fermi level for holes is sufficiently lowered to allow occupation of valence band tail states. The resulting charge localization then allows a negative threshold voltage

Unbalanced voltage control of virtual synchronous generator in isolated micro-grid

Science.gov (United States)

Cao, Y. Z.; Wang, H. N.; Chen, B.

2017-06-01

Virtual synchronous generator (VSG) control is recommended to stabilize the voltage and frequency in isolated micro-grid. However, common VSG control is challenged by widely used unbalance loads, and the linked unbalance voltage problem worsens the power quality of the micro-grid. In this paper, the mathematical model of VSG was presented. Based on the analysis of positive- and negative-sequence equivalent circuit of VSG, an approach was proposed to eliminate the negative-sequence voltage of VSG with unbalance loads. Delay cancellation method and PI controller were utilized to identify and suppress the negative-sequence voltages. Simulation results verify the feasibility of proposed control strategy.

Optical pumping of electron and nuclear spin in a negatively-charged quantum dot

Science.gov (United States)

Bracker, Allan; Gershoni, David; Korenev, Vladimir

2005-03-01

We report optical pumping of electron and nuclear spins in an individual negatively-charged quantum dot. With a bias-controlled heterostructure, we inject one electron into the quantum dot. Intense laser excitation produces negative photoluminescence polarization, which is easily erased by the Hanle effect, demonstrating optical pumping of a long-lived resident electron. The electron spin lifetime is consistent with the influence of nuclear spin fluctuations. Measuring the Overhauser effect in high magnetic fields, we observe a high degree of nuclear spin polarization, which is closely correlated to electron spin pumping.

Intelligent voltage control in a DC micro-grid containing PV generation and energy storage

OpenAIRE

Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro

2014-01-01

This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

Science.gov (United States)

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

Science.gov (United States)

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Magnetoresistance and negative differential resistance in Ni/graphene/Ni vertical heterostructures driven by finite bias voltage: a first-principles study

DEFF Research Database (Denmark)

Saha, Kamal K.; Blom, Anders; Thygesen, Kristian S.

2012-01-01

Using the nonequilibrium Green's function formalism combined with density functional theory, we study finite bias quantum transport in Ni/Grn/Ni vertical heterostructures where n graphene layers are sandwiched between two semi-infinite Ni(111) electrodes. We find that the recently predicted “pess...... differential resistance as the bias voltage is increased from Vb=0 V to Vb≃0.5 V. We confirm that both of these nonequilibrium transport effects hold for different types of bonding of Gr on the Ni(111) surface while maintaining Bernal stacking between individual Gr layers....... “pessimistic” magnetoresistance of 100% for n≥5 junctions at zero bias voltage Vb→0 persists up to Vb≃0.4 V, which makes such devices promising for spin-torque-based device applications. In addition, for parallel orientations of the Ni magnetizations, the n=5 junction exhibits a pronounced negative...

Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.

Science.gov (United States)

Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V

2015-05-01

A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

Voltage Unbalance Compensation with Smart Three-phase Loads

DEFF Research Database (Denmark)

Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

2016-01-01

unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

Nonlinear Robust Control for Low Voltage Direct-Current Residential Microgrids with Constant Power Loads

Directory of Open Access Journals (Sweden)

Martín-Antonio Rodríguez-Licea

2018-05-01

Full Text Available A Direct Current (DC microgrid is a concept derived from a smart grid integrating DC renewable sources. The DC microgrids have three particularities: (1 integration of different power sources and local loads through a DC link; (2 on-site power source generation; and (3 alternating loads (on-off state. This kind of arrangement achieves high efficiency, reliability and versatility characteristics. The key device in the development of the DC microgrid is the power electronic converter (PEC, since it allows an efficient energy conversion between power sources and loads. However, alternating loads with strictly-controlled PECs can provide negative impedance behavior to the microgrid, acting as constant power loads (CPLs, such that the overall closed-loop system becomes unstable. Traditional CPL compensation techniques rely on a damping increment by the adaptation of the source or load voltage level, adding external circuitry or by using some advanced control technique. However, none of them provide a simple and general solution for the CPL problem when abrupt changes in parameters and/or in alternating loads/sources occur. This paper proposes a mathematical modeling and a robust control for the basic PECs dealing with CPLs in continuous conduction mode. In particular, the case of the low voltage residential DC microgrid with CPLs is taken as a benchmark. The proposed controller can be easily tuned for the desired response even by the non-expert. Basic converters with voltage mode control are taken as a basis to show the feasibility of this analysis, and experimental tests on a 100-W testbed include abrupt parameter changes such as input voltage.

Method and apparatus for bistable optical information storage for erasable optical disks

Science.gov (United States)

Land, Cecil E.; McKinney, Ira D.

1990-01-01

A method and an optical device for bistable storage of optical information, together with reading and erasure of the optical information, using a photoactivated shift in a field dependent phase transition between a metastable or a bias-stabilized ferroelectric (FE) phase and a stable antiferroelectric (AFE) phase in an lead lanthanum zirconate titanate (PLZT). An optical disk contains the PLZT. Writing and erasing of optical information can be accomplished by a light beam normal to the disk. Reading of optical information can be accomplished by a light beam at an incidence angle of 15 to 60 degrees to the normal of the disk.

Negative voltage modulated multi-level resistive switching by using a Cr/BaTiOx/TiN structure and quantum conductance through evidence of H2O2 sensing mechanism.

Science.gov (United States)

Chakrabarti, Somsubhra; Ginnaram, Sreekanth; Jana, Surajit; Wu, Zong-Yi; Singh, Kanishk; Roy, Anisha; Kumar, Pankaj; Maikap, Siddheswar; Qiu, Jian-Tai; Cheng, Hsin-Ming; Tsai, Ling-Na; Chang, Ya-Ling; Mahapatra, Rajat; Yang, Jer-Ren

2017-07-05

Negative voltage modulated multi-level resistive switching with quantum conductance during staircase-type RESET and its transport characteristics in Cr/BaTiO x /TiN structure have been investigated for the first time. The as-deposited amorphous BaTiO x film has been confirmed by high-resolution transmission electron microscopy. X-ray photo-electron spectroscopy shows different oxidation states of Ba in the switching material, which is responsible for tunable more than 10 resistance states by varying negative stop voltage owing to slow decay value of RESET slope (217.39 mV/decade). Quantum conductance phenomenon has been observed in staircase RESET cycle of the memory devices. By inspecting the oxidation states of Ba + and Ba 2+ through measuring H 2 O 2 with a low concentration of 1 nM in electrolyte/BaTiO x /SiO 2 /p-Si structure, the switching mechanism of each HRS level as well as the multi-level phenomenon has been explained by gradual dissolution of oxygen vacancy filament. Along with negative stop voltage modulated multi-level, current compliance dependent multi-level has also been demonstrated and resistance ratio up to 2000 has been achieved even for a thin (voltage switching curve has been simulated as well. Hence, multi-level resistive switching of Cr/BaTiO x /TiN structure implies the promising applications in high dense, multistate non-volatile memories in near future.

Guidance system operations plan for manned CSM earth orbital and lunar missions using program COLOSSUS 3. Section 7: Erasable memory programs

Science.gov (United States)

Hamilton, M. H.

1972-01-01

Erasable-memory programs designed for guidance computers used in command and lunar modules are presented. The purpose, functional description, assumptions, restrictions, and imitations are given for each program.

Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

International Nuclear Information System (INIS)

Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

2010-01-01

This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

Voltage-carrying states in superconducting microstrips

International Nuclear Information System (INIS)

Stuivinga, M.E.C.

1983-01-01

When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

Reducing primary and secondary traumatic stress symptoms among educators by training them to deliver a resiliency program (ERASE-Stress) following the Christchurch earthquake in New Zealand.

Science.gov (United States)

Berger, Rony; Abu-Raiya, Hisham; Benatov, Joy

2016-03-01

The current investigation evaluated the impact of a universal school-based resiliency intervention (ERASE-Stress) on educators who were working with elementary schoolchildren exposed to the Canterbury earthquake in New Zealand. In the context of major disasters, educators may suffer from "dual trauma"; they can experience symptoms of both primary trauma (as a result of the disaster itself) and secondary trauma (as a result of working with traumatized students). Sixty-three educators were randomly assigned to either the ERASE-Stress intervention or an alternative Managing Emergencies and Traumatic Incidents (METI) program which served as a control group. Efficacy of the program was evaluated at the end of the training as well as at 8 months follow-up. Compared with educators in the control group, those in the ERASE-Stress intervention significantly reduced their posttraumatic distress and secondary traumatization symptoms, improved their perceived level of professional self-efficacy as a helper of earthquake survivors, developed an optimistic outlook regarding their personal future and enhanced their sense of hope, and honed some of their positive coping strategies and reduced the utilization of some maladaptive coping methods. These beneficial consequences of the ERASE-Stress training make it a potentially useful tool for educators working with traumatized students in the context of major disasters. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Negative capacitance in a ferroelectric capacitor.

Science.gov (United States)

Khan, Asif Islam; Chatterjee, Korok; Wang, Brian; Drapcho, Steven; You, Long; Serrao, Claudy; Bakaul, Saidur Rahman; Ramesh, Ramamoorthy; Salahuddin, Sayeef

2015-02-01

The Boltzmann distribution of electrons poses a fundamental barrier to lowering energy dissipation in conventional electronics, often termed as Boltzmann Tyranny. Negative capacitance in ferroelectric materials, which stems from the stored energy of a phase transition, could provide a solution, but a direct measurement of negative capacitance has so far been elusive. Here, we report the observation of negative capacitance in a thin, epitaxial ferroelectric film. When a voltage pulse is applied, the voltage across the ferroelectric capacitor is found to be decreasing with time--in exactly the opposite direction to which voltage for a regular capacitor should change. Analysis of this 'inductance'-like behaviour from a capacitor presents an unprecedented insight into the intrinsic energy profile of the ferroelectric material and could pave the way for completely new applications.

Multiagent-based Distributed Control for Operation Cost Minimization of Droop Controlled DC Microgrid Using Incremental Cost Consensus

DEFF Research Database (Denmark)

Li, Chendan; Quintero, Juan Carlos Vasquez; Guerrero, Josep M.

2015-01-01

In this paper, a multiagent based distributed control is proposed for DC microgrid to minimize the operation cost. The power of each distributed generator (DG) is dispatched in a distributed manner in a multiagent system by means of voltage scheduling. Every DG unit is taken as an agent......, and they share the load corresponding to the operation cost of all the units in the system with only communication with direct neighbors through incremental cost consensus. The power regulation according to the power reference generated by consensus is implemented through voltage scheduling in local primary...... controllers. Simulation verification shows that total operation cost of the DC microgrid is successfully reduced though the proposed method....

Memory Erasing Drugs Now in Earliest Stages%美科学家正研制遗忘痛苦药

Institute of Scientific and Technical Information of China (English)

2011-01-01

Painful memories of people could be erased from their mind by a new medical technology, a research made by Johns Hopkins University suggests. The Johns Hopkins researchers say they are working on ways to remove the pro teins from the brain＇s fear center,

Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

Science.gov (United States)

Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

2017-06-01

The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity

KAUST Repository

Savagatrup, Suchol; Schroeder, Vera; He, Xin; Lin, Sibo; He, Maggie; Yassine, Omar; Salama, Khaled N.; Zhang, Xixiang; Swager, Timothy M.

2017-01-01

voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV

Differences between signal currents for both polarities of applied voltages on cavity ionization chambers

International Nuclear Information System (INIS)

Takata, N.

2000-01-01

It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the

Low-voltage operating flexible ferroelectric organic field-effect transistor nonvolatile memory with a vertical phase separation P(VDF-TrFE-CTFE)/PS dielectric

Science.gov (United States)

Xu, Meili; Xiang, Lanyi; Xu, Ting; Wang, Wei; Xie, Wenfa; Zhou, Dayu

2017-10-01

Future flexible electronic systems require memory devices combining low-power operation and mechanical bendability. However, high programming/erasing voltages, which are universally needed to switch the storage states in previously reported ferroelectric organic field-effect transistor (Fe-OFET) nonvolatile memories (NVMs), severely prevent their practical applications. In this work, we develop a route to achieve a low-voltage operating flexible Fe-OFET NVM. Utilizing vertical phase separation, an ultrathin self-organized poly(styrene) (PS) buffering layer covers the surface of the ferroelectric polymer layer by one-step spin-coating from their blending solution. The ferroelectric polymer with a low coercive field contributes to low-voltage operation in the Fe-OFET NVM. The polymer PS contributes to the improvement of mobility, attributing to screening the charge scattering and decreasing the surface roughness. As a result, a high performance flexible Fe-OFET NVM is achieved at the low P/E voltages of ±10 V, with a mobility larger than 0.2 cm2 V-1 s-1, a reliable P/E endurance over 150 cycles, stable data storage retention capability over 104 s, and excellent mechanical bending durability with a slight performance degradation after 1000 repetitive tensile bending cycles at a curvature radius of 5.5 mm.

Evaluation of the magnetic and mechanical properties of reactor pressure vessel steels by incremental permeability change curve measurements

International Nuclear Information System (INIS)

Ebine, N.; Suzuki, M.

2001-01-01

Incremental permeability measurement was performed for two types of structural steels along with the magnetization of their hysteresis minor-loop. The obtained incremental permeability change curve has two sharp peaks, and the width between the two peaks is correlated with the coercivity. Hence the existence of good correlation was verified. On the basis of this result, nondestructive measurement experiments were carried out with planar coils to evaluate changes in the material properties of ferromagnetic structural steel plates. Changes in output voltages from planar coils with different test plates were correlated with their mechanical and magnetic properties. The correlation is so good that the measurement method adopted in this work could be used for nondestructive evaluation of material degradation in ferromagnetic structural steels. (author)

Negative Differential Resistance and Astability of the Wigner Solid

OpenAIRE

Csathy, G. A.; Tsui, D. C.; Pfeiffer, L. N.; West, K. W.

2005-01-01

We report an unusual breakdown of the magnetically induced Wigner solid in an exceptional two-dimensional electron gas. The current-voltage characteristic is found to be hysteretic in the voltage biased setup and has a region of negative differential resistance in the current biased setup. When the sample is current biased in the region of negative differential resistance, the voltage on and the current through the sample develop spontaneous narrow band oscillations.

Weighting Function Integrated in Grid-interfacing Converters for Unbalanced Voltage Correction

NARCIS (Netherlands)

Wang, F.; Duarte, J.L.; Hendrix, M.A.M.

2008-01-01

In this paper a weighting function for voltage unbalance correction is proposed to be integrated into the control of distributed grid-interfacing systems. The correction action can help decrease the negative-sequence voltage at the point of connection with the grid. Based on the voltage unbalance

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Independent variations of applied voltage and injection current for controlling the quantum-confined Stark effect in an InGaN/GaN quantum-well light-emitting diode.

Science.gov (United States)

Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C

2014-04-07

A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.

Incremental Capacity Analysis of a Lithium-Ion Battery Pack for Different Charging Rates

DEFF Research Database (Denmark)

Kalogiannis, Theodoros; Stroe, Daniel-Ioan; Nyborg, Jonas

2017-01-01

-depth investigation of two battery packs composed of 14 Lithium-ion cells each; for the purpose of evaluating the applicability and the challenges of the ICA on a battery pack level by means of different charging current rates. Also, at a certain charging current, the influence of the temperature on the ICA curves......Incremental Capacity Analysis (ICA) is a method used to investigate the capacity state of health of batteries by tracking the electrochemical properties of the cell. It is based on the differentiation of the battery capacity over the battery voltage, for a full or a partial cycle regarding...

Deep Incremental Boosting

OpenAIRE

Mosca, Alan; Magoulas, George D

2017-01-01

This paper introduces Deep Incremental Boosting, a new technique derived from AdaBoost, specifically adapted to work with Deep Learning methods, that reduces the required training time and improves generalisation. We draw inspiration from Transfer of Learning approaches to reduce the start-up time to training each incremental Ensemble member. We show a set of experiments that outlines some preliminary results on some common Deep Learning datasets and discuss the potential improvements Deep In...

On excursion increments in heartbeat dynamics

International Nuclear Information System (INIS)

Guzmán-Vargas, L.; Reyes-Ramírez, I.; Hernández-Pérez, R.

2013-01-01

We study correlation properties of excursion increments of heartbeat time series from healthy subjects and heart failure patients. We construct the excursion time based on the original heartbeat time series, representing the time employed by the walker to return to the local mean value. Next, the detrended fluctuation analysis and the fractal dimension method are applied to the magnitude and sign of the increments in the time excursions between successive excursions for the mentioned groups. Our results show that for magnitude series of excursion increments both groups display long-range correlations with similar correlation exponents, indicating that large (small) increments (decrements) are more likely to be followed by large (small) increments (decrements). For sign sequences and for both groups, we find that increments are short-range anti-correlated, which is noticeable under heart failure conditions

Selective Harmonic Virtual Impedance for Voltage Source Inverters with LCL filter in Microgrids

DEFF Research Database (Denmark)

Savaghebi, Mehdi; Vasquez, Juan Carlos; Jalilian, Alireza Jalilian

2012-01-01

This paper presents a new control approach for voltage source inverters ended with LCL filters for microgrid applications. The control approach consists of voltage and current inner control loops in order to fix the filter capacitor voltage and a virtual impedance loop. The virtual impedance...... is added in order to mitigate the voltage distortion after the output inductor and improve the load sharing among parallel inverters. A general case with a combined voltage harmonic and unbalance distortion is considered. In such a case, voltage distortion is mitigated by inserting capacitive virtual...... impedance for negative sequence of fundamental component as well as positive and negative sequences of main harmonic components. Furthermore, resistive virtual impedances are added at these components in order to provide a proper load sharing and make the overall system more damped. Simulation results...

A Direct Voltage Unbalance Compensation Strategy for Islanded Microgrids

DEFF Research Database (Denmark)

Zhao, Xin; Wu, Xiaohua; Meng, Lexuan

2015-01-01

and nonlinear loads. Moreover, by adjusting voltage references according to the amplitude of the negative sequence voltage, the unbalance factor, which is mainly caused by single phase generators/loads, can be mitigated to an extremely low value. Finally, an AC microgrid which includes three three-phase three...

An Improved Incremental Learning Approach for KPI Prognosis of Dynamic Fuel Cell System.

Science.gov (United States)

Yin, Shen; Xie, Xiaochen; Lam, James; Cheung, Kie Chung; Gao, Huijun

2016-12-01

The key performance indicator (KPI) has an important practical value with respect to the product quality and economic benefits for modern industry. To cope with the KPI prognosis issue under nonlinear conditions, this paper presents an improved incremental learning approach based on available process measurements. The proposed approach takes advantage of the algorithm overlapping of locally weighted projection regression (LWPR) and partial least squares (PLS), implementing the PLS-based prognosis in each locally linear model produced by the incremental learning process of LWPR. The global prognosis results including KPI prediction and process monitoring are obtained from the corresponding normalized weighted means of all the local models. The statistical indicators for prognosis are enhanced as well by the design of novel KPI-related and KPI-unrelated statistics with suitable control limits for non-Gaussian data. For application-oriented purpose, the process measurements from real datasets of a proton exchange membrane fuel cell system are employed to demonstrate the effectiveness of KPI prognosis. The proposed approach is finally extended to a long-term voltage prediction for potential reference of further fuel cell applications.

Investigation of voltage swell mitigation using STATCOM

International Nuclear Information System (INIS)

Razak, N A Abdul; Jaafar, S; Hussain, I S

2013-01-01

STATCOM is one of the best applications of a self commutated FACTS device to control power quality problems in the distribution system. This project proposed a STATCOM model with voltage control mechanism. DQ transformation was implemented in the controller system to achieve better estimation. Then, the model was used to investigate and analyse voltage swell problem in distribution system. The simulation results show that voltage swell could contaminate distribution network with unwanted harmonic frequencies. Negative sequence frequencies give harmful effects to the network. System connected with proposed STATCOM model illustrates that it could mitigate this problems efficiently.

Legislative Bargaining and Incremental Budgeting

OpenAIRE

Dhammika Dharmapala

2002-01-01

The notion of 'incrementalism', formulated by Aaron Wildavsky in the 1960's, has been extremely influential in the public budgeting literature. In essence, it entails the claim that legislators engaged in budgetary policymaking accept past allocations, and decide only on the allocation of increments to revenue. Wildavsky explained incrementalism with reference to the cognitive limitations of lawmakers and their desire to reduce conflict. This paper uses a legislative bargaining framework to u...

Contributions of counter-charge in a potassium channel voltage-sensor domain

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

2011-01-01

Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

Design of a High Voltage Bidirectional DC-DC Converter for Driving Capacitive Incremental Actuators usable in Electric Vehicles (EVs)

DEFF Research Database (Denmark)

Thummala, Prasanth; Zhang, Zhe; Andersen, Michael A. E.

2014-01-01

the converter for efficiently charging and discharging the capacitive actuator from 0 V to 2.5 kV and vice versa, respectively. The converter is used to drive a dielectric electro active polymer (DEAP) based capacitive incremental actuator, which has the potential to be used in automotive (e.g., EVs), space...

Adaptive Virtual Impedance Scheme for Selective Compensation of Voltage Unbalance and Harmonics in Microgrids

DEFF Research Database (Denmark)

Savaghebi, Mehdi; Shafiee, Qobad; Vasquez, Juan Carlos

2015-01-01

and current inner control loops in order to fix the filter capacitor voltage and a virtual impedance loop mainly for voltage harmonics and unbalance compensation. The virtual impedance is set by the central secondary controller to mitigate the voltage distortion at sensitive load bus (SLB). Secondary...... controller is connected to a measurement unit to obtain the data of voltage harmonics and unbalance at microgrid SLB and broadcasts the commands for adjusting the virtual impedance of each unit. A general case with a combined voltage harmonic and unbalance distortion is considered. In such a case, voltage...... distortion is mitigated by selective insertion of capacitive virtual impedances for negative sequence of fundamental component as well as positive and negative sequences of main harmonics. The values of virtual capacitances are determined based on the required voltage quality at the load bus; thus...

Relating annual increments of the endangered Blanding's turtle plastron growth to climate.

Science.gov (United States)

Richard, Monik G; Laroque, Colin P; Herman, Thomas B

2014-05-01

This research is the first published study to report a relationship between climate variables and plastron growth increments of turtles, in this case the endangered Nova Scotia Blanding's turtle (Emydoidea blandingii). We used techniques and software common to the discipline of dendrochronology to successfully cross-date our growth increment data series, to detrend and average our series of 80 immature Blanding's turtles into one common chronology, and to seek correlations between the chronology and environmental temperature and precipitation variables. Our cross-dated chronology had a series intercorrelation of 0.441 (above 99% confidence interval), an average mean sensitivity of 0.293, and an average unfiltered autocorrelation of 0.377. Our master chronology represented increments from 1975 to 2007 (33 years), with index values ranging from a low of 0.688 in 2006 to a high of 1.303 in 1977. Univariate climate response function analysis on mean monthly air temperature and precipitation values revealed a positive correlation with the previous year's May temperature and current year's August temperature; a negative correlation with the previous year's October temperature; and no significant correlation with precipitation. These techniques for determining growth increment response to environmental variables should be applicable to other turtle species and merit further exploration.

Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

KAUST Repository

Useinov, Arthur

2011-10-22

In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Directory of Open Access Journals (Sweden)

R. N. Bhowmik

2015-06-01

Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Science.gov (United States)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Unmanned Maritime Systems Incremental Acquisition Approach

Science.gov (United States)

2016-12-01

REPORT TYPE AND DATES COVERED MBA professional report 4. TITLE AND SUBTITLE UNMANNED MARITIME SYSTEMS INCREMENTAL ACQUISITION APPROACH 5. FUNDING...Approved for public release. Distribution is unlimited. UNMANNED MARITIME SYSTEMS INCREMENTAL ACQUISITION APPROACH Thomas Driscoll, Lieutenant...UNMANNED MARITIME SYSTEMS INCREMENTAL ACQUISITION APPROACH ABSTRACT The purpose of this MBA report is to explore and understand the issues

Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

Science.gov (United States)

Petit, C.; Zander, D.

2007-10-01

It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

Erasing and blurring memories: The differential impact of interference on separate aspects of forgetting.

Science.gov (United States)

Sun, Sol Z; Fidalgo, Celia; Barense, Morgan D; Lee, Andy C H; Cant, Jonathan S; Ferber, Susanne

2017-11-01

Interference disrupts information processing across many timescales, from immediate perception to memory over short and long durations. The widely held similarity assumption states that as similarity between interfering information and memory contents increases, so too does the degree of impairment. However, information is lost from memory in different ways. For instance, studied content might be erased in an all-or-nothing manner. Alternatively, information may be retained but the precision might be degraded or blurred. Here, we asked whether the similarity of interfering information to memory contents might differentially impact these 2 aspects of forgetting. Observers studied colored images of real-world objects, each followed by a stream of interfering objects. Across 4 experiments, we manipulated the similarity between the studied object and the interfering objects in circular color space. After interference, memory for object color was tested continuously on a color wheel, which in combination with mixture modeling, allowed for estimation of how erasing and blurring differentially contribute to forgetting. In contrast to the similarity assumption, we show that highly dissimilar interfering items caused the greatest increase in random guess responses, suggesting a greater frequency of memory erasure (Experiments 1-3). Moreover, we found that observers were generally able to resist interference from highly similar items, perhaps through surround suppression (Experiments 1 and 4). Finally, we report that interference from items of intermediate similarity tended to blur or decrease memory precision (Experiments 3 and 4). These results reveal that the nature of visual similarity can differentially alter how information is lost from memory. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Origin of negative resistance in anion migration controlled resistive memory

Science.gov (United States)

Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

2018-03-01

Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

Erasing the methyl mark: histone demethylases at the center of cellular differentiation and disease

DEFF Research Database (Denmark)

Cloos, Paul A C; Christensen, Jesper; Agger, Karl

2008-01-01

The enzymes catalyzing lysine and arginine methylation of histones are essential for maintaining transcriptional programs and determining cell fate and identity. Until recently, histone methylation was regarded irreversible. However, within the last few years, several families of histone...... demethylases erasing methyl marks associated with gene repression or activation have been identified, underscoring the plasticity and dynamic nature of histone methylation. Recent discoveries have revealed that histone demethylases take part in large multiprotein complexes synergizing with histone deacetylases......, histone methyltransferases, and nuclear receptors to control developmental and transcriptional programs. Here we review the emerging biochemical and biological functions of the histone demethylases and discuss their potential involvement in human diseases, including cancer....

The Effect of Image Potential on the Current-Voltage Characteristics of a Ferritin-layer

Directory of Open Access Journals (Sweden)

Eunjung Bang

2010-11-01

Full Text Available Considering for the concept of power storage systems, such as those used to supply power to microelectronic devices, ferritins have aroused a lot of interests for applications in bioelectrochemical devices. And electron transfer rates from the proteins to electrode surface are key determinants of overall performance and efficiency of the ferritin-based devices. Here we have investigated the electron transport mechanism of ferritin layer which was immobilized on an Au electrode. The current-voltage (I-V curves are obtained by a conductive atomic force microscope (c-AFM as a function of contact area between AFM tip and the ferritin layer. In the low voltage region, I-V curves are affected by both Fowler-Nordheim tunneling and image force. On the other hand, the experimental results are consistent with a Simmons model in a high voltage region, indicating that, as the voltage increases, the image potential has a dominant effect on the electron transport mechanism. These results are attributed to the film-like character of the ferritin layer, which generates an image potential to lower the barrier height in proportion to the voltage increment.

FEM Simulation of Incremental Shear

International Nuclear Information System (INIS)

Rosochowski, Andrzej; Olejnik, Lech

2007-01-01

A popular way of producing ultrafine grained metals on a laboratory scale is severe plastic deformation. This paper introduces a new severe plastic deformation process of incremental shear. A finite element method simulation is carried out for various tool geometries and process kinematics. It has been established that for the successful realisation of the process the inner radius of the channel as well as the feeding increment should be approximately 30% of the billet thickness. The angle at which the reciprocating die works the material can be 30 deg. . When compared to equal channel angular pressing, incremental shear shows basic similarities in the mode of material flow and a few technological advantages which make it an attractive alternative to the known severe plastic deformation processes. The most promising characteristic of incremental shear is the possibility of processing very long billets in a continuous way which makes the process more industrially relevant

Characteristics of MAO coating obtained on ZK60 Mg alloy under two and three steps voltage-increasing modes in dual electrolyte

Science.gov (United States)

Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei

2017-03-01

The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.

Influence of different open circuit voltage tests on state of charge online estimation for lithium-ion batteries

International Nuclear Information System (INIS)

Zheng, Fangdan; Xing, Yinjiao; Jiang, Jiuchun; Sun, Bingxiang; Kim, Jonghoon; Pecht, Michael

2016-01-01

Highlights: • Two common tests for observing battery open circuit voltage performance are compared. • The temperature dependency of the OCV-SOC relationship is investigated. • Two estimators are evaluated in terms of accuracy and robustness for estimating battery SOC. • The incremental OCV test is better to predetermine the OCV-SOCs for SOC online estimation. - Abstract: Battery state of charge (SOC) estimation is a crucial function of battery management systems (BMSs), since accurate estimated SOC is critical to ensure the safety and reliability of electric vehicles. A widely used technique for SOC estimation is based on online inference of battery open circuit voltage (OCV). Low-current OCV and incremental OCV tests are two common methods to observe the OCV-SOC relationship, which is an important element of the SOC estimation technique. In this paper, two OCV tests are run at three different temperatures and based on which, two SOC estimators are compared and evaluated in terms of tracking accuracy, convergence time, and robustness for online estimating battery SOC. The temperature dependency of the OCV-SOC relationship is investigated and its influence on SOC estimation results is discussed. In addition, four dynamic tests are presented, one for estimator parameter identification and the other three for estimator performance evaluation. The comparison results show that estimator 2 (based on the incremental OCV test) has higher tracking accuracy and is more robust against varied loading conditions and different initial values of SOC than estimator 1 (based on the low-current OCV test) with regard to ambient temperature. Therefore, the incremental OCV test is recommended for predetermining the OCV-SOCs for battery SOC online estimation in BMSs.

The incremental role of trait emotional intelligence on perceived cervical screening barriers.

Science.gov (United States)

Costa, Sebastiano; Barberis, Nadia; Larcan, Rosalba; Cuzzocrea, Francesca

2018-02-13

Researchers have become increasingly interested in investigating the role of the psychological aspects related to the perception of cervical screening barriers. This study investigates the influence of trait EI on perceived cervical screening barriers. Furthermore, this study investigates the incremental validity of trait EI beyond the Big Five, as well as emotion regulation in the perceived barrier towards the Pap test as revealed in a sample of 206 Italian women that were undergoing cervical screening. Results have shown that trait EI is negatively related to cervical screening barriers. Furthermore, trait EI can be considered as a strong incremental predictor of a woman's perception of screening over and above the Big Five, emotion regulation, age, sexual intercourse experience and past Pap test. Detailed information on the study findings and future research directions are discussed.

Lessons learned from unintended consequences about erasing the stigma of mental illness.

Science.gov (United States)

Corrigan, Patrick W

2016-02-01

Advocates and scientists have partnered to develop and evaluate programs meant to erase the egregious effects of the different forms of stigma. Enough evidence has been collected to yield lessons about approaches to stigma change. Some of the most insightful of these lessons emerge from unintended consequences of good intentioned approaches, and are the focus of this paper. They include the limited benefits of education especially when compared to contact, beating stigma is more than changing words, beware pity as a message, understand the competing agendas of stigma change, replace ideas of normalcy with solidarity, and avoid framing self-stigma as the problem of people with mental illness and not of society. The paper ends with consideration of the back seat role that psychiatrists and other mental health providers should have in stigma change. © 2015 World Psychiatric Association.

Effect of anodizing voltage on the sorption of water molecules on porous alumina

Energy Technology Data Exchange (ETDEWEB)

Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)

2012-05-01

The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).

Computational Studies of Positive and Negative Streamers in Bubbles Suspended in Distilled Water

KAUST Repository

Sharma, Ashish

2017-01-05

We perform computational studies of nanosecond streamers generated in helium bubbles immersed in distilled water under high pressure conditions. The model takes into account the presence of water vapor in the gas bubble for an accurate description of the chemical kinetics of the discharge. We apply positive and negative trigger voltages much higher than the breakdown voltage and study the dynamic characteristics of the resulting discharge. We observe that, for high positive trigger voltages, the streamer moves along the surface of the gas bubble during the initial stages of the discharge. We also find a considerable difference in the evolution of the streamer discharge for positive and negative trigger voltages with more uniform volumetric distribution of species in the streamer channel for negative trigger voltages due to formation of multiple streamers. We also observe that the presence of water vapor does not influence the breakdown voltage of the discharge but greatly affects the composition of dominant species in the trail of the streamer channel.

Hysteresis analysis of graphene transistor under repeated test and gate voltage stress

International Nuclear Information System (INIS)

Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang

2014-01-01

The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)

Fuzzy Controller for a Voltage-Regulated Solar-Powered MPPT System for Hybrid Power System Applications

Directory of Open Access Journals (Sweden)

Jaw-Kuen Shiau

2015-04-01

Full Text Available This paper presents the design of a fuzzy-logic-based voltage-regulated solar power maximum power point tracking (MPPT system for applications involving hybrid power systems. The system contains a solar power system and battery as the primary and secondary power sources, respectively. The solar system alone supplies power to the electric motor and maintains the output voltage at a predetermined level when it has sufficient power. When the solar power is insufficient, the solar system is operated at its maximum power point (MPP and the battery is engaged to compensate for the insufficiency. First, a variant of the incremental conductance MPP condition was established. Under the MPP condition, the voltage-regulated MPPT system was formulated as a feedback control system, where the MPP condition and voltage regulation requirements were used as the system inputs. Next, a fuzzy controller was developed to perform the voltage-regulated MPPT function for the hybrid power system. A simulation model based on Matrix laboratory (MATLAB/SIMULINK (a block diagram environment for multi-domain simulation and model-based design and a piecewise linear electric circuit simulation (PLECS tool for controlling the dc motor velocity was developed to verify the voltage-regulated solar power MPPT system.

On conditional scalar increment and joint velocity-scalar increment statistics

International Nuclear Information System (INIS)

Zhang Hengbin; Wang Danhong; Tong Chenning

2004-01-01

Conditional velocity and scalar increment statistics are usually studied in the context of Kolmogorov's refined similarity hypotheses and are considered universal (quasi-Gaussian) for inertial-range separations. In such analyses the locally averaged energy and scalar dissipation rates are used as conditioning variables. Recent studies have shown that certain local turbulence structures can be captured when the local scalar variance (φ 2 ) r and the local kinetic energy k r are used as the conditioning variables. We study the conditional increments using these conditioning variables, which also provide the local turbulence scales. Experimental data obtained in the fully developed region of an axisymmetric turbulent jet are used to compute the statistics. The conditional scalar increment probability density function (PDF) conditional on (φ 2 ) r is found to be close to Gaussian for (φ 2 ) r small compared with its mean and is sub-Gaussian and bimodal for large (φ 2 ) r , and therefore is not universal. We find that the different shapes of the conditional PDFs are related to the instantaneous degree of non-equilibrium (production larger than dissipation) of the local scalar. There is further evidence of this from the conditional PDF conditional on both (φ 2 ) r and χ r , which is largely a function of (φ 2 ) r /χ r , a measure of the degree of non-equilibrium. The velocity-scalar increment joint PDF is close to joint Gaussian and quad-modal for equilibrium and non-equilibrium local velocity and scalar, respectively. The latter shape is associated with a combination of the ramp-cliff and plane strain structures. Kolmogorov's refined similarity hypotheses also predict a dependence of the conditional PDF on the degree of non-equilibrium. Therefore, the quasi-Gaussian (joint) PDF, previously observed in the context of Kolmogorov's refined similarity hypotheses, is only one of the conditional PDF shapes of inertial range turbulence. The present study suggests that

Complete characterization of voltage sags: an alternative to achieve energy quality

International Nuclear Information System (INIS)

Zuniga Medina, Edgar Andres; Vasco Garcia, Carlos Andres

1992-01-01

In this paper, the meaning of the power quality and its negative influence in the automation processes are presented. Voltage sags, the problems they cause and a methodology to characterize the phenomenon are also presented. Once the problems associated with the different sensible loads connected to a power system are identified, the cause of the bad quality of the electrical energy provided those loads is then established; voltage sags are one of the most common phenomenon that requires characterization in order to diminish their negative impact on the industrial processes

Grid Integration of Single Stage Solar PV System using Three-level Voltage Source Converter

Science.gov (United States)

Hussain, Ikhlaq; Kandpal, Maulik; Singh, Bhim

2016-08-01

This paper presents a single stage solar PV (photovoltaic) grid integrated power generating system using a three level voltage source converter (VSC) operating at low switching frequency of 900 Hz with robust synchronizing phase locked loop (RS-PLL) based control algorithm. To track the maximum power from solar PV array, an incremental conductance algorithm is used and this maximum power is fed to the grid via three-level VSC. The use of single stage system with three level VSC offers the advantage of low switching losses and the operation at high voltages and high power which results in enhancement of power quality in the proposed system. Simulated results validate the design and control algorithm under steady state and dynamic conditions.

Power supply system for negative ion source at IPR

Science.gov (United States)

Gahlaut, Agrajit; Sonara, Jashwant; Parmar, K. G.; Soni, Jignesh; Bandyopadhyay, M.; Singh, Mahendrajit; Bansal, Gourab; Pandya, Kaushal; Chakraborty, Arun

2010-02-01

The first step in the Indian program on negative ion beams is the setting up of Negative ion Experimental Assembly - RF based, where 100 kW of RF power shall be coupled to a plasma source producing plasma of density ~5 × 1012 cm-3, from which ~ 10 A of negative ion beam shall be produced and accelerated to 35 kV, through an electrostatic ion accelerator. The experimental system is modelled similar to the RF based negative ion source, BATMAN presently operating at IPP, Garching, Germany. The mechanical system for Negative Ion Source Assembly is close to the IPP source, remaining systems are designed and procured principally from indigenous sources, keeping the IPP configuration as a base line. High voltage (HV) and low voltage (LV) power supplies are two key constituents of the experimental setup. The HV power supplies for extraction and acceleration are rated for high voltage (~15 to 35kV), and high current (~ 15 to 35A). Other attributes are, fast rate of voltage rise (< 5ms), good regulation (< ±1%), low ripple (< ±2%), isolation (~50kV), low energy content (< 10J) and fast cut-off (< 100μs). The low voltage (LV) supplies required for biasing and providing heating power to the Cesium oven and the plasma grids; have attributes of low ripple, high stability, fast and precise regulation, programmability and remote operation. These power supplies are also equipped with over-voltage, over-current and current limit (CC Mode) protections. Fault diagnostics, to distinguish abnormal rise in currents (breakdown faults) with over-currents is enabled using fast response breakdown and over-current protection scheme. To restrict the fault energy deposited on the ion source, specially designed snubbers are implemented in each (extraction and acceleration) high voltage path to swap the surge energy. Moreover, the monitoring status and control signals from these power supplies are required to be electrically (~ 50kV) isolated from the system. The paper shall present the

Power supply system for negative ion source at IPR

International Nuclear Information System (INIS)

Gahlaut, Agrajit; Sonara, Jashwant; Parmar, K G; Soni, Jignesh; Bandyopadhyay, M; Singh, Mahendrajit; Bansal, Gourab; Pandya, Kaushal; Chakraborty, Arun

2010-01-01

The first step in the Indian program on negative ion beams is the setting up of Negative ion Experimental Assembly - RF based, where 100 kW of RF power shall be coupled to a plasma source producing plasma of density ∼5 x 10 12 cm -3 , from which ∼ 10 A of negative ion beam shall be produced and accelerated to 35 kV, through an electrostatic ion accelerator. The experimental system is modelled similar to the RF based negative ion source, BATMAN presently operating at IPP, Garching, Germany. The mechanical system for Negative Ion Source Assembly is close to the IPP source, remaining systems are designed and procured principally from indigenous sources, keeping the IPP configuration as a base line. High voltage (HV) and low voltage (LV) power supplies are two key constituents of the experimental setup. The HV power supplies for extraction and acceleration are rated for high voltage (∼15 to 35kV), and high current (∼ 15 to 35A). Other attributes are, fast rate of voltage rise (< 5ms), good regulation (< ±1%), low ripple (< ±2%), isolation (∼50kV), low energy content (< 10J) and fast cut-off (< 100μs). The low voltage (LV) supplies required for biasing and providing heating power to the Cesium oven and the plasma grids; have attributes of low ripple, high stability, fast and precise regulation, programmability and remote operation. These power supplies are also equipped with over-voltage, over-current and current limit (CC Mode) protections. Fault diagnostics, to distinguish abnormal rise in currents (breakdown faults) with over-currents is enabled using fast response breakdown and over-current protection scheme. To restrict the fault energy deposited on the ion source, specially designed snubbers are implemented in each (extraction and acceleration) high voltage path to swap the surge energy. Moreover, the monitoring status and control signals from these power supplies are required to be electrically (∼ 50kV) isolated from the system. The paper shall

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

Single-InN-Nanowire Nanogenerator with Upto 1 V Output Voltage

KAUST Repository

Huang, Chi-Te

2010-07-30

Piezoelectric potential of a InN nanowire (NW) growing along [011̄0] can be positive, negative, and zero depending on the direction of the applied transverse force. By measuring the output voltage of a InN-NW-based nanogenerator, about 40% to 55% of output voltages are within the range of ?1 and ?20 mV, and 25% to 30% of output voltages would exceed ?100 mV. Some output voltages could reach the magnitude of ?1000 mV, showing its great potential for fabricating high-output nanogenerators. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Large area negative ion source for high voltage neutral beams

International Nuclear Information System (INIS)

Poulsen, P.; Hooper, E.B. Jr.

1979-11-01

A source of negative deuterium ions in the multi-ampere range is described that is readily extrapolated to reactor size, 10 amp or more of neutral beam, that is of interest in future experiments and reactors. The negative ion source is based upon the double charge exchange process. A beam of positive ions is created and accelerated to an energy at which the attachment process D + M → D - + M + proceeds efficiently. The positive ions are atomically neutralized either in D 2 or in the charge exchange medium M. Atomic species make a second charge exchange collision in the charge target to form D - . For a sufficiently thick target, the beam reaches an equilibrium fraction of negative ions. For reasons of efficiency, the target is typically alkali metal vapor; this experiment uses sodium. The beam of negative ions can be accelerated to high (>200 keV) energy, the electrons stripped from the ions, and a high energy neutral beam formed

Digital control of a high-voltage (2.5 kV) bidirectional DC-DC converter for driving a dielectric electro active polymer (DEAP) based capacitive actuator

DEFF Research Database (Denmark)

Thummala, Prasanth; Zhang, Zhe; Andersen, Michael A. E.

2014-01-01

This paper presents a digital control technique toachieve valley switching in a bidirectional flyback converterused to drive a dielectric electro active polymer basedincremental actuator. The incremental actuator consists ofthree electrically isolated, mechanically connected capacitiveactuators...... switchingtechnique during both charge and discharge processes, withoutthe need to sense signals on the output high-voltage side.Experimental results verifying the bidirectional operation of asingle high voltage flyback converter are presented, using afilm capacitor as the load. Energy efficiency measurements...

Analytical modeling of Schottky tunneling source impact ionization MOSFET with reduced breakdown voltage

Directory of Open Access Journals (Sweden)

Sangeeta Singh

2016-03-01

Full Text Available In this paper, we have investigated a novel Schottky tunneling source impact ionization MOSFET (STS-IMOS to lower the breakdown voltage of conventional impact ionization MOS (IMOS and developed an analytical model for the same. In STS-IMOS there is an accumulative effect of both impact ionization and source induced barrier tunneling. The silicide source offers very low parasitic resistance, the outcome of which is an increment in voltage drop across the intrinsic region for the same applied bias. This reduces operating voltage and hence, it exhibits a significant reduction in both breakdown and threshold voltage. STS-IMOS shows high immunity against hot electron damage. As a result of this the device reliability increases magnificently. The analytical model for impact ionization current (Iii is developed based on the integration of ionization integral (M. Similarly, to get Schottky tunneling current (ITun expression, Wentzel–Kramers–Brillouin (WKB approximation is employed. Analytical models for threshold voltage and subthreshold slope is optimized against Schottky barrier height (ϕB variation. The expression for the drain current is computed as a function of gate-to-drain bias via integral expression. It is validated by comparing it with the technology computer-aided design (TCAD simulation results as well. In essence, this analytical framework provides the physical background for better understanding of STS-IMOS and its performance estimation.

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

A flexible low-voltage ride-through operation for the distributed generation converters

DEFF Research Database (Denmark)

Chen, Hsin-Chih; Lee, Chia-Tse; Cheng, Po-Tai

2013-01-01

With more and more distributed energy resources (DERs) are installed in the utility grid, the utility requires the DER generation system to remain grid-connected and injects reactive and active power to support grid voltage during voltage sags. In this paper, a positive- and negative-sequence cur...

Apollo guidance, navigation and control: Guidance system operations plans for manned LM earth orbital and lunar missions using Program COLOSSUS 3. Section 7: Erasable memory programs

Science.gov (United States)

Hamilton, M. H.

1972-01-01

Erasable-memory programs (EMPs) designed for the guidance computers used in the command (CMC) and lunar modules (LGC) are described. CMC programs are designated COLOSSUS 3, and the associated EMPs are identified by a three-digit number beginning with 5. LGC programs are designated LUMINARY 1E, and the associated EMPs are identified, with one exception, by a three-digit number beginning with 1. The exception is EMP 99. The EMPs vary in complexity from a simple flagbit setting to a long and intricate logical structure. They all, however, cause the computer to behave in a way not intended in the original design of the programs; they accomplish this off-nominal behavior by some alteration of erasable memory to interface with existing fixed-memory programs to effect a desired result.

Two coupled Josephson junctions: dc voltage controlled by biharmonic current

International Nuclear Information System (INIS)

Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J

2012-01-01

We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)

A Comparison between Electrochemical Impedance Spectroscopy and Incremental Capacity-Differential Voltage as Li-ion Diagnostic Techniques to Identify and Quantify the Effects of Degradation Modes within Battery Management Systems

Science.gov (United States)

Pastor-Fernández, Carlos; Uddin, Kotub; Chouchelamane, Gael H.; Widanage, W. Dhammika; Marco, James

2017-08-01

Degradation of Lithium-ion batteries is a complex process that is caused by a variety of mechanisms. For simplicity, ageing mechanisms are often grouped into three degradation modes (DMs): conductivity loss (CL), loss of active material (LAM) and loss of lithium inventory (LLI). State of Health (SoH) is typically the parameter used by the Battery Management System (BMS) to quantify battery degradation based on the decrease in capacity and the increase in resistance. However, the definition of SoH within a BMS does not currently include an indication of the underlying DMs causing the degradation. Previous studies have analysed the effects of the DMs using incremental capacity and differential voltage (IC-DV) and electrochemical impedance spectroscopy (EIS). The aim of this study is to compare IC-DV and EIS on the same data set to evaluate if both techniques provide similar insights into the causes of battery degradation. For an experimental case of parallelized cells aged differently, the effects due to LAM and LLI were found to be the most pertinent, outlining that both techniques are correlated. This approach can be further implemented within a BMS to quantify the causes of battery ageing which would support battery lifetime control strategies and future battery designs.

Analysis of the effect of interface state charges on threshold voltage and transconductance of 6H-SiC N-channel MOSFET

International Nuclear Information System (INIS)

Tang Xiaoyan; Zhang Yimen; Zhang Yuming

2002-01-01

The effect of interface state charges on the threshold voltage and transconductance of 6H-SiC N-channel metal-oxide semiconductor field-effect transistor (MOSFET) is analyzed based on the non-uniformly distributed interface state density in the band gap and incomplete impurity ionization in silicon carbide. The results show that the nonuniform distribution of interface state density cause not only the increment of the threshold voltage but also the degradation of the transconductance of MOSFET so that it is one of the important factors to influence the characteristics of SiC MOSFET

Quick-low-density parity check and dynamic threshold voltage optimization in 1X nm triple-level cell NAND flash memory with comprehensive analysis of endurance, retention-time, and temperature variation

Science.gov (United States)

Doi, Masafumi; Tokutomi, Tsukasa; Hachiya, Shogo; Kobayashi, Atsuro; Tanakamaru, Shuhei; Ning, Sheyang; Ogura Iwasaki, Tomoko; Takeuchi, Ken

2016-08-01

NAND flash memory’s reliability degrades with increasing endurance, retention-time and/or temperature. After a comprehensive evaluation of 1X nm triple-level cell (TLC) NAND flash, two highly reliable techniques are proposed. The first proposal, quick low-density parity check (Quick-LDPC), requires only one cell read in order to accurately estimate a bit-error rate (BER) that includes the effects of temperature, write and erase (W/E) cycles and retention-time. As a result, 83% read latency reduction is achieved compared to conventional AEP-LDPC. Also, W/E cycling is extended by 100% compared with conventional Bose-Chaudhuri-Hocquenghem (BCH) error-correcting code (ECC). The second proposal, dynamic threshold voltage optimization (DVO) has two parts, adaptive V Ref shift (AVS) and V TH space control (VSC). AVS reduces read error and latency by adaptively optimizing the reference voltage (V Ref) based on temperature, W/E cycles and retention-time. AVS stores the optimal V Ref’s in a table in order to enable one cell read. VSC further improves AVS by optimizing the voltage margins between V TH states. DVO reduces BER by 80%.

Dissociating response systems: erasing fear from memory.

Science.gov (United States)

Soeter, Marieke; Kindt, Merel

2010-07-01

interventions persistently erasing fear responses from trauma memory without affecting the actual recollection.

48 CFR 3432.771 - Provision for incremental funding.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Provision for incremental funding. 3432.771 Section 3432.771 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION..., Incremental Funding, in a solicitation if a cost-reimbursement contract using incremental funding is...

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

Science.gov (United States)

Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

2015-08-01

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

A pragmatic approach to voltage stability analysis of large power systems

Energy Technology Data Exchange (ETDEWEB)

Sarmiento, H.G.; Pampin, G. [Inst. de Investigaciones Electricas, Morelos (Mexico); Diaz de Leon, J.A. [American Superconductor, Middleton, WI (United States)

2008-07-01

A methodology for performing voltage stability analyses for large power systems was presented. Modal and time-domain analyses were used for selection and siting solutions for potential voltage instability and collapse. Steady state systems were used to compute the smallest eigenvalues and associated eigenvalues of a reduced Jacobean matrix. The eigenvalues were used to provide a relative measure of proximity to voltage instability. The analysis was applied to provide an indication of a network's proximity to voltage collapse. Negative eigenvalues were representative of voltage instability conditions, while small positive values indicated proximity to voltage instability. The analysis technique was used to identify buses, lines, and generators prone to voltage instabilities for a 10-node network. A comparative analysis of results obtained from modal and time domain analyses were used to identify areas vulnerable to voltage instability conditions. Pre-fault, fault, and post-fault conditions were analyzed statically and dynamically. Results of the study showed that the combined method can be used to identify and place reactive power compensation solutions for voltage collapses in electric networks. 20 refs., 5 tabs., 7 figs.

Control Strategy of Three-Phase Photovoltaic Inverter under Low-Voltage Ride-Through Condition

Directory of Open Access Journals (Sweden)

Xianbo Wang

2015-01-01

Full Text Available The new energy promoting community has recently witnessed a surge of developments in photovoltaic power generation technologies. To fulfill the grid code requirement of photovoltaic inverter under low-voltage ride-through (LVRT condition, by utilizing the asymmetry feature of grid voltage, this paper aims to control both restraining negative sequence current and reactive power fluctuation on grid side to maintain balanced output of inverter. Two mathematical inverter models of grid-connected inverter containing LCL grid-side filter under both symmetrical and asymmetric grid are proposed. PR controller method is put forward based on inverter model under asymmetric grid. To ensure the stable operation of the inverter, grid voltage feedforward method is introduced to restrain current shock at the moment of voltage drop. Stable grid-connected operation and LVRT ability at grid drop have been achieved via a combination of rapid positive and negative sequence component extraction of accurate grid voltage synchronizing signals. Simulation and experimental results have verified the superior effectiveness of our proposed control strategy.

PLZT light transmittance memory driven with an asymmetric voltage pulse

International Nuclear Information System (INIS)

Inoue, Kazuhiko; Morita, Takeshi

2010-01-01

PLZT is a ferroelectric electro-optic material, which has been operated with a constant voltage supply to keep a certain optical property. In this study, we propose an optical transmittance memory effect by controlling the domain conditions. The keypoint is to use an asymmetric voltage pulse. In the positive direction, a sufficiently-large voltage is applied to align the polarization directions. After this operation, a relatively small light transmittance is memorized even after removing the electric field. On the other hand, in the negative direction, the amplitude of the voltage is adjusted to the coercive electric field. In this condition, the domain structure is almost the same as the depolarization state. With this voltage supply, the maximum light transmittance can be kept after removing the electric field. Using these voltage operations, the PLZT can obtain two light transmittance states depending on the domain structure. This memory effect should be useful for innovative optical scanners or shutters in the future.

Increment memory module for spectrometric data recording

International Nuclear Information System (INIS)

Zhuchkov, A.A.; Myagkikh, A.I.

1988-01-01

Incremental memory unit designed to input differential energy spectra of nuclear radiation is described. ROM application as incremental device has allowed to reduce the number of elements and do simplify information readout from the unit. 12-bit 2048 channels present memory unit organization. The device is connected directly with the bus of microprocessor systems similar to KR 580. Incrementation maximal time constitutes 3 mks. It is possible to use this unit in multichannel counting mode

Small Diameter Bomb Increment II (SDB II)

Science.gov (United States)

2015-12-01

Selected Acquisition Report (SAR) RCS: DD-A&T(Q&A)823-439 Small Diameter Bomb Increment II (SDB II) As of FY 2017 President’s Budget Defense... Bomb Increment II (SDB II) DoD Component Air Force Joint Participants Department of the Navy Responsible Office References SAR Baseline (Production...Mission and Description Small Diameter Bomb Increment II (SDB II) is a joint interest United States Air Force (USAF) and Department of the Navy

Characteristics and Breakdown Behaviors of Polysilicon Resistors for High Voltage Applications

Directory of Open Access Journals (Sweden)

Xiao-Yu Tang

2015-01-01

Full Text Available With the rapid development of the power integrated circuit technology, polysilicon resistors have been widely used not only in traditional CMOS circuits, but also in the high voltage applications. However, there have been few detailed reports about the polysilicon resistors’ characteristics, like voltage and temperature coefficients and breakdown behaviors which are critical parameters of high voltage applications. In this study, we experimentally find that the resistance of the polysilicon resistor with a relatively low doping concentration shows negative voltage and temperature coefficients, while that of the polysilicon resistor with a high doping concentration has positive voltage and temperature coefficients. Moreover, from the experimental results of breakdown voltages of the polysilicon resistors, it could be deduced that the breakdown of polysilicon resistors is thermally rather than electrically induced. We also proposed to add an N-type well underneath the oxide to increase the breakdown voltage in the vertical direction when the substrate is P-type doped.

Planning Through Incrementalism

Science.gov (United States)

Lasserre, Ph.

1974-01-01

An incremental model of decisionmaking is discussed and compared with the Comprehensive Rational Approach. A model of reconciliation between the two approaches is proposed, and examples are given in the field of economic development and educational planning. (Author/DN)

FDTD Stability: Critical Time Increment

OpenAIRE

Z. Skvor; L. Pauk

2003-01-01

A new approach suitable for determination of the maximal stable time increment for the Finite-Difference Time-Domain (FDTD) algorithm in common curvilinear coordinates, for general mesh shapes and certain types of boundaries is presented. The maximal time increment corresponds to a characteristic value of a Helmholz equation that is solved by a finite-difference (FD) method. If this method uses exactly the same discretization as the given FDTD method (same mesh, boundary conditions, order of ...

Incremental Visualizer for Visible Objects

DEFF Research Database (Denmark)

Bukauskas, Linas; Bøhlen, Michael Hanspeter

This paper discusses the integration of database back-end and visualizer front-end into a one tightly coupled system. The main aim which we achieve is to reduce the data pipeline from database to visualization by using incremental data extraction of visible objects in a fly-through scenarios. We...... also argue that passing only relevant data from the database will substantially reduce the overall load of the visualization system. We propose the system Incremental Visualizer for Visible Objects (IVVO) which considers visible objects and enables incremental visualization along the observer movement...... path. IVVO is the novel solution which allows data to be visualized and loaded on the fly from the database and which regards visibilities of objects. We run a set of experiments to convince that IVVO is feasible in terms of I/O operations and CPU load. We consider the example of data which uses...

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

Energy Technology Data Exchange (ETDEWEB)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

A comparative study of different transformer connections for railway power supply- mitigation of voltage unbalance

DEFF Research Database (Denmark)

Firat, Gurkan; Yang, Guangya; Ali Hussain Al-Ali, Haider

2015-01-01

The railway represents a large power consumer that can cause uneven loading of the phases in the high voltage grid. These unbalanced loads supplied by the utility may lead to voltage unbalance problems in the system and thereby affects the other consumers connected to the same network. It is fact...... that, voltage unbalance appears mainly as a result of unbalanced currents at the points of common coupling drawn by unevenly distributed loads. Because of a significant amount of negative sequence current injected to the system, the power system components will suffer from consequent negative effects...... such as overheating, additional losses of lines and transformers, interference with communication systems etc. This paper presents a comparative study of some transformer connections which commonly used in railway supplying AC traction loads, for voltage unbalance mitigations. Simulations for comparison...

Aging of electrochemical double layer capacitors with acetonitrile-based electrolyte at elevated voltages

International Nuclear Information System (INIS)

Ruch, P.W.; Cericola, D.; Foelske-Schmitz, A.; Koetz, R.; Wokaun, A.

2010-01-01

Laboratory-scale electrochemical capacitor cells with bound activated carbon electrodes and acetonitrile-based electrolyte were aged at various elevated constant cell voltages between 2.75 V and 4.0 V. During the constant voltage tests, the cell capacitance as well as the capacitance and resistance of each electrode was determined. Following each aging experiment, the cells were analyzed by means of electrochemical impedance spectroscopy, and the individual electrodes were characterized by gas adsorption and X-ray photoelectron spectroscopy. At cell voltages above 3.0 V, the positive electrode ages much faster than the negative. Both the capacitance loss and resistance increase of the cell could be totally attributed to the positive electrode. At cell voltages above 3.5 V also the negative electrode aged significantly. X-ray photoelectron spectroscopy indicated the presence of degradation products on the electrode surface with a much thicker layer on the positive electrode. Simultaneously, a significant decrease in electrode porosity could be detected by gas adsorption.

Flexible voltage support control for three-phase distributed generation inverters under grid fault

DEFF Research Database (Denmark)

Camacho, Antonio; Castilla, Miguel; Miret, Jaume

2013-01-01

Operators describe the behavior of the energy source, regulating voltage limits and reactive power injection to remain connected and support the grid under fault. On the basis that different kinds of voltage sags require different voltage support strategies, a flexible control scheme for three phase grid...... connected inverters is proposed. In three phase balanced voltage sags, the inverter should inject reactive power in order to raise the voltage in all phases. In one or two phase faults, the main concern of the distributed generation inverter is to equalize voltages by reducing the negative symmetric...... sequence and clear the phase jump. Due to system limitations, a balance between these two extreme policies is mandatory. Thus, over-voltage and undervoltage can be avoided, and the proposed control scheme prevents disconnection while achieving the desired voltage support service. The main contribution...

Adjunct Screening With Tomosynthesis or Ultrasound in Women With Mammography-Negative Dense Breasts: Interim Report of a Prospective Comparative Trial.

Science.gov (United States)

Tagliafico, Alberto S; Calabrese, Massimo; Mariscotti, Giovanna; Durando, Manuela; Tosto, Simona; Monetti, Francesco; Airaldi, Sonia; Bignotti, Bianca; Nori, Jacopo; Bagni, Antonella; Signori, Alessio; Sormani, Maria Pia; Houssami, Nehmat

2016-03-09

Debate on adjunct screening in women with dense breasts has followed legislation requiring that women be informed about their mammographic density and related adjunct imaging. Ultrasound or tomosynthesis can detect breast cancer (BC) in mammography-negative dense breasts, but these modalities have not been directly compared in prospective trials. We conducted a trial of adjunct screening to compare, within the same participants, incremental BC detection by tomosynthesis and ultrasound in mammography-negative dense breasts. Adjunct Screening With Tomosynthesis or Ultrasound in Women With Mammography-Negative Dense Breasts is a prospective multicenter study recruiting asymptomatic women with mammography-negative screens and dense breasts. Eligible women had tomosynthesis and physician-performed ultrasound with independent interpretation of adjunct imaging. Outcome measures included cancer detection rate (CDR), number of false-positive (FP) recalls, and incremental CDR for each modality; these were compared using McNemar's test for paired binary data in a preplanned interim analysis. Among 3,231 mammography-negative screening participants (median age, 51 years; interquartile range, 44 to 78 years) with dense breasts, 24 additional BCs were detected (23 invasive): 13 tomosynthesis-detected BCs (incremental CDR, 4.0 per 1,000 screens; 95% CI, 1.8 to 6.2) versus 23 ultrasound-detected BCs (incremental CDR, 7.1 per 1,000 screens; 95% CI, 4.2 to 10.0), P = .006. Incremental FP recall occurred in 107 participants (3.33%; 95% CI, 2.72% to 3.96%). FP recall (any testing) did not differ between tomosynthesis (FP = 53) and ultrasound (FP = 65), P = .26; FP recall (biopsy) also did not differ between tomosynthesis (FP = 22) and ultrasound (FP = 24), P = .86. The Adjunct Screening With Tomosynthesis or Ultrasound in Women With Mammography-Negative Dense Breasts' interim analysis shows that ultrasound has better incremental BC detection than tomosynthesis in mammography-negative

Power variation for Gaussian processes with stationary increments

DEFF Research Database (Denmark)

Barndorff-Nielsen, Ole Eiler; Corcuera, J.M.; Podolskij, Mark

2009-01-01

We develop the asymptotic theory for the realised power variation of the processes X=•G, where G is a Gaussian process with stationary increments. More specifically, under some mild assumptions on the variance function of the increments of G and certain regularity conditions on the path of the pr......We develop the asymptotic theory for the realised power variation of the processes X=•G, where G is a Gaussian process with stationary increments. More specifically, under some mild assumptions on the variance function of the increments of G and certain regularity conditions on the path...... a chaos representation....

C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

Science.gov (United States)

Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

2014-04-01

Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

Ferroelectric Negative Capacitance Domain Dynamics

OpenAIRE

Hoffmann, Michael; Khan, Asif Islam; Serrao, Claudy; Lu, Zhongyuan; Salahuddin, Sayeef; Pešić, Milan; Slesazeck, Stefan; Schroeder, Uwe; Mikolajick, Thomas

2017-01-01

Transient negative capacitance effects in epitaxial ferroelectric Pb(Zr$_{0.2}$Ti$_{0.8}$)O$_3$ capacitors are investigated with a focus on the dynamical switching behavior governed by domain nucleation and growth. Voltage pulses are applied to a series connection of the ferroelectric capacitor and a resistor to directly measure the ferroelectric negative capacitance during switching. A time-dependent Ginzburg-Landau approach is used to investigate the underlying domain dynamics. The transien...

Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

DEFF Research Database (Denmark)

Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

2017-01-01

This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

Response of dairy cattle to transient voltages and magnetic fields

International Nuclear Information System (INIS)

Reinemann, D.J.; Laughlin, N.K.; Stetson, L.E.

1995-01-01

Stray voltages in dairy facilities have been studied since the 1970's. Previous research using steady-state ac and dc voltages has defined cow-contact voltage levels which may cause behavior and associated production problems. This research was designed to address concerns over possible effects of transient voltages and magnetic fields on dairy cows. Dairy cows response to transient voltages and magnetic fields was measured. The waveforms of the transient voltages applied were: 5 cycles of 60-Hz ac with a total pulse time of 83 ms, 1 cycle of 60-Hz ac with a total pulse time of 16 ms, and 1 cycle of an ac square wave (spiking positive and negative) of 2-ms duration. Alternating magnetic fields were produced by passing 60-Hz ac fundamental frequency with 2nd and 3rd harmonic and random noise components in metal structures around the cows. The maximum magnetic field associated with this current flow was in excess of 4 G. A wide range of sensitivity to transient voltages was observed among cows. Response levels from 24 cows to each transient exposure were normally distributed. No responses to magnetic fields were observed

Incremental passivity and output regulation for switched nonlinear systems

Science.gov (United States)

Pang, Hongbo; Zhao, Jun

2017-10-01

This paper studies incremental passivity and global output regulation for switched nonlinear systems, whose subsystems are not required to be incrementally passive. A concept of incremental passivity for switched systems is put forward. First, a switched system is rendered incrementally passive by the design of a state-dependent switching law. Second, the feedback incremental passification is achieved by the design of a state-dependent switching law and a set of state feedback controllers. Finally, we show that once the incremental passivity for switched nonlinear systems is assured, the output regulation problem is solved by the design of global nonlinear regulator controllers comprising two components: the steady-state control and the linear output feedback stabilising controllers, even though the problem for none of subsystems is solvable. Two examples are presented to illustrate the effectiveness of the proposed approach.

Simulation of trapping properties of high κ material as the charge storage layer for flash memory application

International Nuclear Information System (INIS)

Yeo, Yee Ngee; Wang Yingqian; Samanta, Santanu Kumar; Yoo, Won Jong; Samudra, Ganesh; Gao, Dongyue; Chong, Chee Ching

2006-01-01

We investigated the trapping properties of high κ material as the charge storage layer in non-volatile flash memory devices using a two-dimensional device simulator, Medici. The high κ material is sandwiched between two silicon oxide layers, resulting in the Silicon-Oxide-High κ-Oxide-Silicon (SOHOS) structure. The trap energy levels of the bulk electron traps in high κ material were determined. The programming and erasing voltage and time using Fowler Nordheim tunneling were estimated by simulation. The effect of deep level traps on erasing was investigated. Also, the effect of bulk traps density, thickness of block oxide and thickness of high κ material on the threshold voltage of the device was simulated

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

International Nuclear Information System (INIS)

Patel, N.; Branch, D. W.; Cular, S.; Schamiloglu, E.

2015-01-01

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO 3 ) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment

Enhancement and character recognition of the erased colophon of a 15th-century Hebrew prayer book

Science.gov (United States)

Walvoord, Derek J.; Easton, Roger L., Jr.; Knox, Keith T.; Heimbueger, Matthew

2005-01-01

A handwritten codex often included an inscription that listed facts about its publication, such as the names of the scribe and patron, date of publication, the city where the book was copied, etc. These facts obviously provide essential information to a historian studying the provenance of the codex. Unfortunately, this page was sometimes erased after the sale of the book to a new owner, often by scraping off the original ink. The importance of recovering this information would be difficult to overstate. This paper reports on the methods of imaging, image enhancement, and character recognition that were applied to this page in a Hebrew prayer book copied in Florence in the 15th century.

Ferroelectric transistors with monolayer molybdenum disulfide and ultra-thin aluminum-doped hafnium oxide

Science.gov (United States)

Yap, Wui Chung; Jiang, Hao; Liu, Jialun; Xia, Qiangfei; Zhu, Wenjuan

2017-07-01

In this letter, we demonstrate ferroelectric memory devices with monolayer molybdenum disulfide (MoS2) as the channel material and aluminum (Al)-doped hafnium oxide (HfO2) as the ferroelectric gate dielectric. Metal-ferroelectric-metal capacitors with 16 nm thick Al-doped HfO2 are fabricated, and a remnant polarization of 3 μC/cm2 under a program/erase voltage of 5 V is observed. The capability of potential 10 years data retention was estimated using extrapolation of the experimental data. Ferroelectric transistors based on embedded ferroelectric HfO2 and MoS2 grown by chemical vapor deposition are fabricated. Clockwise hysteresis is observed at low program/erase voltages due to slow bulk traps located near the 2D/dielectric interface, while counterclockwise hysteresis is observed at high program/erase voltages due to ferroelectric polarization. In addition, the endurances of the devices are tested, and the effects associated with ferroelectric materials, such as the wake-up effect and polarization fatigue, are observed. Reliable writing/reading in MoS2/Al-doped HfO2 ferroelectric transistors over 2 × 104 cycles is achieved. This research can potentially lead to advances of two-dimensional (2D) materials in low-power logic and memory applications.

A study of fast bunch rotation in the negative mass region

CERN Document Server

Rumolo, Giovanni

2001-01-01

Fast bunch rotation of high-intensity proton or ion bunches above transition is - in principle - supported by the self-bunching effect of the attractive space charge force ("negative instabilities"). Due to the broad-band nature of the space charge impedance, the highest harmonics of this negative mass mode grow fast and inhibit compression, unless the bunch rotation is accelerated by a sufficiently high rf-voltage. Using particle-in-cell simulation we establish the threshold below which effective compression is still possible. We find that the required rf-voltage for compression of a given bunch above transition can be reduced at most by a factor 2 compared with compression below transition, where space charge requires extra voltage.

Influence of the polarity of the applied voltage on the reignition of a discharge below a dielectric layer in air at atmospheric pressure

International Nuclear Information System (INIS)

Pechereau, François; Bourdon, Anne

2014-01-01

The dynamics of an atmospheric pressure air discharge in a point-to-plane geometry with a dielectric layer obstacle on the discharge path is investigated numerically for different applied voltages. Whatever the polarity of the voltage applied, first, a streamer discharge of the same polarity ignites at the point and propagates towards the dielectric layer. After the impact on the dielectric surface, the streamer discharge spreads along the upper dielectric surface and charges it positively or negatively depending on its polarity. On the bottom surface of the dielectric layer, charges with an opposite polarity are deposited. Surface charges on both faces of the dielectric layer are shown to have a significant influence on the discharge reignition for a negative applied voltage, but not for a positive one. Furthermore, it is shown that the dynamics of the discharge reignition below the dielectric layer depends on the polarity of the applied voltage at the point electrode. For a positive applied voltage, the reignited discharge is a positive ionization wave propagating towards the grounded plane. For a negative applied voltage, a double headed discharge is observed with positive and negative fronts propagating in opposite directions. Finally, the minimal value of the ionization integral to have a discharge reignition below the dielectric obstacle is found to be less for a negative applied voltage than for a positive one. (paper)

Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

Science.gov (United States)

Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

2013-11-01

This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

A thermoelectric voltage effect in polyethylene oxide

International Nuclear Information System (INIS)

Martin, Bjoern; Wagner, Achim; Kliem, Herbert

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

A thermoelectric voltage effect in polyethylene oxide

CERN Document Server

Martin, B; Kliem, H

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

Theory of Single Point Incremental Forming

DEFF Research Database (Denmark)

Martins, P.A.F.; Bay, Niels; Skjødt, Martin

2008-01-01

This paper presents a closed-form theoretical analysis modelling the fundamentals of single point incremental forming and explaining the experimental and numerical results available in the literature for the past couple of years. The model is based on membrane analysis with bi-directional in-plan......-plane contact friction and is focused on the extreme modes of deformation that are likely to be found in single point incremental forming processes. The overall investigation is supported by experimental work performed by the authors and data retrieved from the literature.......This paper presents a closed-form theoretical analysis modelling the fundamentals of single point incremental forming and explaining the experimental and numerical results available in the literature for the past couple of years. The model is based on membrane analysis with bi-directional in...

Efficiency of Oral Incremental Rehearsal versus Written Incremental Rehearsal on Students' Rate, Retention, and Generalization of Spelling Words

Science.gov (United States)

Garcia, Dru; Joseph, Laurice M.; Alber-Morgan, Sheila; Konrad, Moira

2014-01-01

The purpose of this study was to examine the efficiency of an incremental rehearsal oral versus an incremental rehearsal written procedure on a sample of primary grade children's weekly spelling performance. Participants included five second and one first grader who were in need of help with their spelling according to their teachers. An…

Development of a New Cascade Voltage-Doubler for Voltage Multiplication

OpenAIRE

Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

2014-01-01

For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity

KAUST Repository

Savagatrup, Suchol

2017-09-27

Carbon monoxide (CO) outcompetes oxygen when binding to the iron center of hemeproteins, leading to a reduction in blood oxygen level and acute poisoning. Harvesting the strong specific interaction between CO and the iron porphyrin provides a highly selective and customizable sensor. We report the development of chemiresistive sensors with voltage-activated sensitivity for the detection of CO comprising iron porphyrin and functionalized single-walled carbon nanotubes (F-SWCNTs). Modulation of the gate voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV/Vis spectroscopy, differential pulse voltammetry, and density functional theory reveal that the in situ reduction of FeIII to FeII enhances the interaction between the F-SWCNTs and CO. Our results illustrate a new mode of sensors wherein redox active recognition units are voltage-activated to give enhanced and highly specific responses.

Performance Evaluation of Incremental K-means Clustering Algorithm

OpenAIRE

Chakraborty, Sanjay; Nagwani, N. K.

2014-01-01

The incremental K-means clustering algorithm has already been proposed and analysed in paper [Chakraborty and Nagwani, 2011]. It is a very innovative approach which is applicable in periodically incremental environment and dealing with a bulk of updates. In this paper the performance evaluation is done for this incremental K-means clustering algorithm using air pollution database. This paper also describes the comparison on the performance evaluations between existing K-means clustering and i...

Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories

Energy Technology Data Exchange (ETDEWEB)

Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)

2016-07-11

High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Superconductive microstrip exhibiting negative differential resistivity

International Nuclear Information System (INIS)

Huebener, R.P.; Gallus, D.E.

1975-01-01

A device capable of exhibiting negative differential electrical resistivity over a range of values of current and voltage is formed by vapor-depositing a thin layer of a material capable of exhibiting superconductivity on an insulating substrate, establishing electrical connections at opposite ends of the deposited strip, and cooling the alloy into its superconducting range. The device will exhibit negative differential resistivity when biased in the current-induced resistive state

Asymmetrical Grid Fault Ride-Through Strategy of Three-phase Grid-connected Inverter Considering Network Impedance Impact in Low Voltage Grid

DEFF Research Database (Denmark)

Guo, Xiaoqiang; Zhang, Xue; Wang, Baocheng

2014-01-01

This letter presents a new control strategy of threephase grid-connected inverter for the positive sequence voltage recovery and negative sequence voltage reduction under asymmetrical grid faults. Unlike the conventional control strategy based on an assumption that the network impedance is mainly...... of the proposed solution for the flexible voltage support in a low-voltage grid, where thenetwork impedance is mainly resistive.......This letter presents a new control strategy of threephase grid-connected inverter for the positive sequence voltage recovery and negative sequence voltage reduction under asymmetrical grid faults. Unlike the conventional control strategy based on an assumption that the network impedance is mainly...... inductive, the proposed control strategy is more flexible and effective by considering the network impedance impact, which is of great importance for the high penetration of grid-connected renewable energy systems into low-voltage grids. The experimental tests are carried out to validate the effectiveness...

Quantum independent increment processes

CERN Document Server

Franz, Uwe

2005-01-01

This volume is the first of two volumes containing the revised and completed notes lectures given at the school "Quantum Independent Increment Processes: Structure and Applications to Physics". This school was held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald during the period March 9 – 22, 2003, and supported by the Volkswagen Foundation. The school gave an introduction to current research on quantum independent increment processes aimed at graduate students and non-specialists working in classical and quantum probability, operator algebras, and mathematical physics. The present first volume contains the following lectures: "Lévy Processes in Euclidean Spaces and Groups" by David Applebaum, "Locally Compact Quantum Groups" by Johan Kustermans, "Quantum Stochastic Analysis" by J. Martin Lindsay, and "Dilations, Cocycles and Product Systems" by B.V. Rajarama Bhat.

Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier

Directory of Open Access Journals (Sweden)

Abdel-Salam Mazen

2016-01-01

Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.

Incremental short daily home hemodialysis: a case series.

Science.gov (United States)

Toth-Manikowski, Stephanie M; Mullangi, Surekha; Hwang, Seungyoung; Shafi, Tariq

2017-07-05

Patients starting dialysis often have substantial residual kidney function. Incremental hemodialysis provides a hemodialysis prescription that supplements patients' residual kidney function while maintaining total (residual + dialysis) urea clearance (standard Kt/Vurea) targets. We describe our experience with incremental hemodialysis in patients using NxStage System One for home hemodialysis. From 2011 to 2015, we initiated 5 incident hemodialysis patients on an incremental home hemodialysis regimen. The biochemical parameters of all patients remained stable on the incremental hemodialysis regimen and they consistently achieved standard Kt/Vurea targets. Of the two patients with follow-up >6 months, residual kidney function was preserved for ≥2 years. Importantly, the patients were able to transition to home hemodialysis without automatically requiring 5 sessions per week at the outset and gradually increased the number of treatments and/or dialysate volume as the residual kidney function declined. An incremental home hemodialysis regimen can be safely prescribed and may improve acceptability of home hemodialysis. Reducing hemodialysis frequency by even one treatment per week can reduce the number of fistula or graft cannulations or catheter connections by >100 per year, an important consideration for patient well-being, access longevity, and access-related infections. The incremental hemodialysis approach, supported by national guidelines, can be considered for all home hemodialysis patients with residual kidney function.

Voltage-dependent gating in a "voltage sensor-less" ion channel.

Directory of Open Access Journals (Sweden)

Harley T Kurata

2010-02-01

Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

Transient voltage sharing in series-coupled high voltage switches

Directory of Open Access Journals (Sweden)

Editorial Office

1992-07-01

Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

Simulation and resolution of voltage reversal in microbial fuel cell stack.

Science.gov (United States)

Sugnaux, Marc; Savy, Cyrille; Cachelin, Christian Pierre; Hugenin, Gérald; Fischer, Fabian

2017-08-01

To understand the biotic and non-biotic contributions of voltage reversals in microbial fuel cell stacks (MFC) they were simulated with an electronic MFC-Stack mimic. The simulation was then compared with results from a real 3L triple MFC-Stack with shared anolyte. It showed that voltage reversals originate from the variability of biofilms, but also the external load plays a role. When similar biofilm properties were created on all anodes the likelihood of voltage reversals was largely reduced. Homogenous biofilms on all anodes were created by electrical circuit alternation and electrostimulation. Conversely, anolyte recirculation, or increased nutriment supply, postponed reversals and unfavourable voltage asymmetries on anodes persisted. In conclusion, voltage reversals are often a negative event but occur also in close to best MFC-Stack performance. They were manageable and this with a simplified MFC architecture in which multiple anodes share the same anolyte. Copyright © 2017 Elsevier Ltd. All rights reserved.

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Anomalous Threshold Voltage Variability of Nitride Based Charge Storage Nonvolatile Memory Devices

Directory of Open Access Journals (Sweden)

Meng Chuan Lee

2013-01-01

Full Text Available Conventional technology scaling is implemented to meet the insatiable demand of high memory density and low cost per bit of charge storage nonvolatile memory (NVM devices. In this study, effect of technology scaling to anomalous threshold voltage ( variability is investigated thoroughly on postcycled and baked nitride based charge storage NVM devices. After long annealing bake of high temperature, cell’s variability of each subsequent bake increases within stable distribution and found exacerbate by technology scaling. Apparent activation energy of this anomalous variability was derived through Arrhenius plots. Apparent activation energy (Eaa of this anomalous variability is 0.67 eV at sub-40 nm devices which is a reduction of approximately 2 times from 110 nm devices. Technology scaling clearly aggravates this anomalous variability, and this poses reliability challenges to applications that demand strict control, for example, reference cells that govern fundamental program, erase, and verify operations of NVM devices. Based on critical evidence, this anomalous variability is attributed to lateral displacement of trapped charges in nitride storage layer. Reliability implications of this study are elucidated. Moreover, potential mitigation methods are proposed to complement technology scaling to prolong the front-runner role of nitride based charge storage NVM in semiconductor flash memory market.

All-optical loadable and erasable memory cell design based on inversionless lasing and electromagnetically induced transparency effects

International Nuclear Information System (INIS)

Gholipour Verki, N; HajiBadali, A; Abbasian, K; Rostami, A

2011-01-01

A loadable and erasable all-optical memory cell is designed by using two coupled micro-ring resonators with electromagnetically induced transparency (EIT) and lasing without inversion (LWI). To read out stored data, an additional phase is introduced in the upper ring resonator due to EIT. To compensate the fibre loss, use is made of LWI. The EIT is induced by inserting Λ-type three level quantum dots in the right-hand half of the upper ring and LWI is implemented by inserted Y-type four level quantum dots in the left-hand half of both rings. This optical memory cell can operate at a low light power level corresponding to several photons.

Recent negative ion source developments

International Nuclear Information System (INIS)

Alton, G.D.

1978-01-01

This report describes recent results obtained from studies associated with the development of negative ion sources which utilize sputtering in a diffuse cesium plasma as a means of ion beam generation. Data are presented which relate negative ion yield and important operational parameters such as cesium oven temperature and sputter probe voltage from each of the following sources: (1) A source based in principle according to the University of Aarhus design and (2) an axial geometry source. The important design aspects of the sources are given--along with a list of the negative ion intensities observed to date. Also a qualitative description and interpretation of the negative ion generation mechanism in sources which utilize sputtering in the presence of cesium is given

Quantum independent increment processes

CERN Document Server

Franz, Uwe

2006-01-01

This is the second of two volumes containing the revised and completed notes of lectures given at the school "Quantum Independent Increment Processes: Structure and Applications to Physics". This school was held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald in March, 2003, and supported by the Volkswagen Foundation. The school gave an introduction to current research on quantum independent increment processes aimed at graduate students and non-specialists working in classical and quantum probability, operator algebras, and mathematical physics. The present second volume contains the following lectures: "Random Walks on Finite Quantum Groups" by Uwe Franz and Rolf Gohm, "Quantum Markov Processes and Applications in Physics" by Burkhard Kümmerer, Classical and Free Infinite Divisibility and Lévy Processes" by Ole E. Barndorff-Nielsen, Steen Thorbjornsen, and "Lévy Processes on Quantum Groups and Dual Groups" by Uwe Franz.

Voltage-current characteristics of a pin-plate system with different plate configurations

International Nuclear Information System (INIS)

Feng, Zhuangbo; Long, Zhengwei

2013-01-01

In this paper, the voltage-current (V-I) characteristics of a pin-plate system with four types of collection plate configurations are studied experimentally. The collection plates consider a single metal plate, a metal plate with a fly ash cake layer, a metal plate with a clean filter media and a metal plate with a dirty filter media. The results show that the clean filter media has no obvious effect on the V-I characteristics. But the dirty filter media reduces the current density because of its high resistance. The thick fly ash cake layer increase current density because of the anti-corona effect but the increment is not very obvious.

Diurnal and seasonal changes in stem increment and water use by yellow poplar trees in response to environmental stress.

Science.gov (United States)

McLaughlin, Samuel B; Wullschleger, Stan D; Nosal, Miloslav

2003-11-01

To evaluate indicators of whole-tree physiological responses to climate stress, we determined seasonal, daily and diurnal patterns of growth and water use in 10 yellow poplar (Liriodendron tulipifera L.) trees in a stand recently released from competition. Precise measurements of stem increment and sap flow made with automated electronic dendrometers and thermal dissipation probes, respectively, indicated close temporal linkages between water use and patterns of stem shrinkage and swelling during daily cycles of water depletion and recharge of extensible outer-stem tissues. These cycles also determined net daily basal area increment. Multivariate regression models based on a 123-day data series showed that daily diameter increments were related negatively to vapor pressure deficit (VPD), but positively to precipitation and temperature. The same model form with slight changes in coefficients yielded coefficients of determination of about 0.62 (0.57-0.66) across data subsets that included widely variable growth rates and VPDs. Model R2 was improved to 0.75 by using 3-day running mean daily growth data. Rapid recovery of stem diameter growth following short-term, diurnal reductions in VPD indicated that water stored in extensible stem tissues was part of a fast recharge system that limited hydration changes in the cambial zone during periods of water stress. There were substantial differences in the seasonal dynamics of growth among individual trees, and analyses indicated that faster-growing trees were more positively affected by precipitation, solar irradiance and temperature and more negatively affected by high VPD than slower-growing trees. There were no negative effects of ozone on daily growth rates in a year of low ozone concentrations.

Mitigation of voltage sags in the distribution system with dynamic voltage restorer

International Nuclear Information System (INIS)

Viglas, D.; Belan, A.

2012-01-01

Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

Measurement of magnetically insulated line voltage using a Thomson Parabola Charged Particle Analyser

International Nuclear Information System (INIS)

Stanley, T.D.; Stinnett, R.W.

1981-01-01

The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed

Local Voltage Control in Distribution Networks: A Game-Theoretic Perspective

Energy Technology Data Exchange (ETDEWEB)

Zhou, Xinyang; Tian, Jie; Chen, Lijun; Dall' Anese, Emiliano

2016-11-21

Inverter-based voltage regulation is gaining importance to alleviate emerging reliability and power-quality concerns related to distribution systems with high penetration of photovoltaic (PV) systems. This paper seeks contribution in the domain of reactive power compensation by establishing stability of local Volt/VAr controllers. In lieu of the approximate linear surrogate used in the existing work, the paper establishes existence and uniqueness of an equilibrium point using nonlinear AC power flow model. Key to this end is to consider a nonlinear dynamical system with non-incremental local Volt/VAr control, cast the Volt/VAr dynamics as a game, and leverage the fixed-point theorem as well as pertinent contraction mapping argument. Numerical examples are provided to complement the analytical results.

Voltage regulating circuit

NARCIS (Netherlands)

2005-01-01

A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

Growth increments in teeth of Diictodon (Therapsida

Directory of Open Access Journals (Sweden)

J. Francis Thackeray

1991-09-01

Full Text Available Growth increments circa 0.02 mm in width have been observed in sectioned tusks of Diictodon from the Late Permian lower Beaufort succession of the South African Karoo, dated between about 260 and 245 million years ago. Mean growth increments show a decline from relatively high values in the Tropidostoma/Endothiodon Assemblage Zone, to lower values in the Aulacephalodon/Cistecephaluszone, declining still further in the Dicynodon lacerficeps/Whaitsia zone at the end of the Permian. These changes coincide with gradual changes in carbon isotope ratios measured from Diictodon tooth apatite. It is suggested that the decline in growth increments is related to environmental changes associated with a decline in primary production which contributed to the decline in abundance and ultimate extinction of Diictodon.

Incremental Integrity Checking: Limitations and Possibilities

DEFF Research Database (Denmark)

Christiansen, Henning; Martinenghi, Davide

2005-01-01

Integrity checking is an essential means for the preservation of the intended semantics of a deductive database. Incrementality is the only feasible approach to checking and can be obtained with respect to given update patterns by exploiting query optimization techniques. By reducing the problem...... to query containment, we show that no procedure exists that always returns the best incremental test (aka simplification of integrity constraints), and this according to any reasonable criterion measuring the checking effort. In spite of this theoretical limitation, we develop an effective procedure...

Investigation of Grid-connected Voltage Source Converter Performance under Unbalanced Faults

DEFF Research Database (Denmark)

Jia, Jundi; Yang, Guangya; Nielsen, Arne Hejde

2016-01-01

Renewable energy sources (RES) and HVDC links are typically interfaced with the grid by power converters, whose performance during grid faults is significantly different from that of traditional synchronous generators. This paper investigates the performance of grid-connected voltage source...... that the performance of VSCs varies with their control strategies. Negative-sequence current control is necessary to restrict converter current in each phase under unbalanced faults. Among presented control strategies, the balanced current control strategy complies with the present voltage support requirement best...

Design of methodology for incremental compiler construction

Directory of Open Access Journals (Sweden)

Pavel Haluza

2011-01-01

Full Text Available The paper deals with possibilities of the incremental compiler construction. It represents the compiler construction possibilities for languages with a fixed set of lexical units and for languages with a variable set of lexical units, too. The methodology design for the incremental compiler construction is based on the known algorithms for standard compiler construction and derived for both groups of languages. Under the group of languages with a fixed set of lexical units there belong languages, where each lexical unit has its constant meaning, e.g., common programming languages. For this group of languages the paper tries to solve the problem of the incremental semantic analysis, which is based on incremental parsing. In the group of languages with a variable set of lexical units (e.g., professional typographic system TEX, it is possible to change arbitrarily the meaning of each character on the input file at any time during processing. The change takes effect immediately and its validity can be somehow limited or is given by the end of the input. For this group of languages this paper tries to solve the problem case when we use macros temporarily changing the category of arbitrary characters.

Cost-effectiveness of negative pressure wound therapy in patients with many comorbidities and severe wounds of various etiology.

Science.gov (United States)

Driver, Vickie R; Eckert, Kristen A; Carter, Marissa J; French, Michael A

2016-11-01

This study analyzed a cross-section of patients with severe chronic wounds and multiple comorbidities at an outpatient wound clinic, with regard to the cost-effectiveness and cost-benefit of negative pressure wound therapy (intervention) vs. no negative pressure wound therapy (control) at 1 and 2 years. Medicare reimbursement charges for wound care were used to calculate costs. Amputation charges were assessed using diagnosis-related groups. Cost-benefit analysis was based on ulcer-free months and cost-effectiveness on quality-adjusted life-years. Undiscounted costs, benefits, quality-adjusted life-years, undiscounted and discounted incremental net health benefits, and incremental cost-effectiveness ratios were calculated for unmatched and matched cohorts. There were 150 subjects in the intervention group and 154 controls before matching and 103 subjects in each of the matched cohorts. Time to heal for the intervention cohort was significantly shorter compared to the controls (270 vs. 635 days, p = 1.0 × 10 -7 , matched cohorts). The intervention cohort had higher benefits and quality-adjusted life-year gains compared to the control cohort at years 1 and 2; by year 2, the gains were 68-73% higher. In the unmatched cohorts, the incremental net health benefit was $9,933 per ulcer-free month at year 2 for the intervention; the incremental cost-effectiveness ratio was -825,271 per quality-adjusted life-year gained (undiscounted costs and benefits). For the matched cohorts, the incremental net health benefits was only $1,371 per ulcer-free month for the intervention, but the incremental cost-effectiveness ratio was $366,683 per quality-adjusted life-year gained for year 2 (discounted costs and benefits). In a patient population with severe chronic wounds and serious comorbidities, negative pressure wound therapy resulted in faster healing wounds and was more cost-effective with greater cost-benefits than not using negative pressure wound therapy. Regarding overall

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

Science.gov (United States)

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

21 CFR 874.1070 - Short increment sensitivity index (SISI) adapter.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Short increment sensitivity index (SISI) adapter. 874.1070 Section 874.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... increment sensitivity index (SISI) adapter. (a) Identification. A short increment sensitivity index (SISI...

A Syntactic-Semantic Approach to Incremental Verification

OpenAIRE

Bianculli, Domenico; Filieri, Antonio; Ghezzi, Carlo; Mandrioli, Dino

2013-01-01

Software verification of evolving systems is challenging mainstream methodologies and tools. Formal verification techniques often conflict with the time constraints imposed by change management practices for evolving systems. Since changes in these systems are often local to restricted parts, an incremental verification approach could be beneficial. This paper introduces SiDECAR, a general framework for the definition of verification procedures, which are made incremental by the framework...

Maximum photovoltaic power tracking for the PV array using the fractional-order incremental conductance method

International Nuclear Information System (INIS)

Lin, Chia-Hung; Huang, Cong-Hui; Du, Yi-Chun; Chen, Jian-Liung

2011-01-01

Highlights: → The FOICM can shorten the tracking time less than traditional methods. → The proposed method can work under lower solar radiation including thin and heavy clouds. → The FOICM algorithm can achieve MPPT for radiation and temperature changes. → It is easy to implement in a single-chip microcontroller or embedded system. -- Abstract: This paper proposes maximum photovoltaic power tracking (MPPT) for the photovoltaic (PV) array using the fractional-order incremental conductance method (FOICM). Since the PV array has low conversion efficiency, and the output power of PV array depends on the operation environments, such as various solar radiation, environment temperature, and weather conditions. Maximum charging power can be increased to a battery using a MPPT algorithm. The energy conversion of the absorbed solar light and cell temperature is directly transferred to the semiconductor, but electricity conduction has anomalous diffusion phenomena in inhomogeneous material. FOICM can provide a dynamic mathematical model to describe non-linear characteristics. The fractional-order incremental change as dynamic variable is used to adjust the PV array voltage toward the maximum power point. For a small-scale PV conversion system, the proposed method is validated by simulation with different operation environments. Compared with traditional methods, experimental results demonstrate the short tracking time and the practicality in MPPT of PV array.

Effect of gate voltage polarity on the ionic liquid gating behavior of NdNiO3/NdGaO3 heterostructures

Directory of Open Access Journals (Sweden)

Yongqi Dong

2017-05-01

Full Text Available The effect of gate voltage polarity on the behavior of NdNiO3 epitaxial thin films during ionic liquid gating is studied using in situ synchrotron X-ray techniques. We show that while negative biases have no discernible effect on the structure or composition of the films, large positive gate voltages result in the injection of a large concentration of oxygen vacancies (∼3% and pronounced lattice expansion (0.17% in addition to a 1000-fold increase in sheet resistance at room temperature. Despite the creation of large defect densities, the heterostructures exhibit a largely reversible switching behavior when sufficient time is provided for the vacancies to migrate in and out of the thin film surface. The results confirm that electrostatic gating takes place at negative gate voltages for p-type complex oxides while positive voltages favor the electrochemical reduction of Ni3+. Switching between positive and negative gate voltages therefore involves a combination of electronic and ionic doping processes that may be utilized in future electrochemical transistors.

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

MOSFET-based high voltage short pulse generator for ultrasonic transducer excitation

Science.gov (United States)

Hidayat, Darmawan; Setianto, Syafei, Nendi Suhendi; Wibawa, Bambang Mukti

2018-02-01

This paper presents the generation of a high-voltage short pulse for the excitation of high frequency ultrasonic transducers. This is highly required in the purpose of various ultrasonic-based evaluations, particularly when high resolution measurement is necessary. A high voltage (+760 V) DC voltage source was pulsated by an ultrafast switching MOSFET which was driven by a pulse generator circuit consisting of an astable multivibrator, a one-shot multivibrator with Schmitt trigger input and a high current MOSFET driver. The generated pulses excited a 200-kHz and a 1-MHz ultrasonic transducers and tested in the transmission mode propagation to evaluate the performances of the generated pulse. The test results showed the generator were able to produce negative spike pulses up to -760 V voltage with the shortest time-width of 107.1 nanosecond. The transmission-received ultrasonic waves show frequency oscillation at 200 and 961 kHz and their amplitudes varied with the voltage of excitation pulse. These results conclude that the developed pulse generator is applicable to excite transducer for the generation of high frequency ultrasonic waves.

Secondary Voltage Unbalance Compensation for Three-Phase Four-Wire Islanded Microgrids

DEFF Research Database (Denmark)

Tang, Fen; Zhou, Xiao; Meng, Lexuan

2014-01-01

This paper proposes a secondary voltage unbalance control approach that compensate voltage unbalances in three-phase four-wire islanded microgrid systems. It is implemented in the secondary control level of the microgrid hierarchical control structure. By sending information through low......-bandwidth communication links to the primary control level, the required unbalanced factors at sensitive buses are achieved. Also, negative and zero sequence equivalent circuits and unbalance compensation principle are derived. Finally, real-time hardware-in-the-loop results show the feasibility of the proposed approach...

''Positive'' and ''negative'' electric-pulse-induced reversible resistance switching effect in Pr0.7Ca0.3MnO3 films

International Nuclear Information System (INIS)

Wang, Q.; Chen, L.D.; Li, X.M.; Shang, D.S.; Wu, Z.H.

2007-01-01

''Negative'' electric-pulse-induced reversible resistance (EPIR) switching phenomenon was found in In/PCMO/Pt sandwich, in which the high resistance can be written with positive voltage pulses, and the low resistance can be reset using negative voltage pulses (the positive voltage direction is defined as going from the top electrode to the bottom electrode). This is just the opposite from the ''positive'' EPIR effect in Ag/PCMO/Pt sandwich, in which the high resistance can be written only with negative voltage pulses, and the low resistance can be reset using positive voltage pulses. The I-V hysteresis curves of In/PCMO/Pt and Ag/PCMO/Pt sandwiches also show opposite directions, i.e., counterclockwise and clockwise under a negative voltage region for indium and Ag electrode systems, respectively. C-V characteristics show that the barrier does not exist in Ag/PCMO/Pt sandwich, while In/PCMO/Pt sandwich exhibits an obvious Schottky-like barrier. We suggest that in the negative EPIR behavior in In/PCMO/Pt structure, the resistance states are mainly controlled changing the Schottky-like barrier at the interface with the weak effect of carrier trapping process, while the positive EPIR behavior in Ag/PCMO/Pt sandwich mainly depends on the carrier trapping process at the interface. (orig.)

Shredder: GPU-Accelerated Incremental Storage and Computation

OpenAIRE

Bhatotia, Pramod; Rodrigues, Rodrigo; Verma, Akshat

2012-01-01

Redundancy elimination using data deduplication and incremental data processing has emerged as an important technique to minimize storage and computation requirements in data center computing. In this paper, we present the design, implementation and evaluation of Shredder, a high performance content-based chunking framework for supporting incremental storage and computation systems. Shredder exploits the massively parallel processing power of GPUs to overcome the CPU bottlenecks of content-ba...

Asymmetric functional contributions of acidic and aromatic side chains in sodium channel voltage-sensor domains

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Elstone, Fisal D; Niciforovic, Ana P

2014-01-01

largely enigmatic. To this end, natural and unnatural side chain substitutions were made in the S2 hydrophobic core (HC), the extracellular negative charge cluster (ENC), and the intracellular negative charge cluster (INC) of the four VSDs of the skeletal muscle sodium channel isoform (NaV1......Voltage-gated sodium (NaV) channels mediate electrical excitability in animals. Despite strong sequence conservation among the voltage-sensor domains (VSDs) of closely related voltage-gated potassium (KV) and NaV channels, the functional contributions of individual side chains in Nav VSDs remain.......4). The results show that the highly conserved aromatic side chain constituting the S2 HC makes distinct functional contributions in each of the four NaV domains. No obvious cation-pi interaction exists with nearby S4 charges in any domain, and natural and unnatural mutations at these aromatic sites produce...

Stray voltage mitigation

Energy Technology Data Exchange (ETDEWEB)

Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

2008-04-09

This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

Science.gov (United States)

Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

2017-05-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

Effect of driving voltage polarity on dynamic response characteristics of electrowetting liquid lens

Science.gov (United States)

Na, Xie; Ning, Zhang; Rong-Qing, Xu

2018-05-01

A test device is developed for studying the dynamic process of an electrowetting liquid lens. By analyzing the light signals through the liquid lens, the dynamical properties of the lens are investigated. In our experiment, three types of pulse, i.e., sine, bipolar pulse, and single pulse signals, are employed to drive the liquid lens, and the dynamic characteristics of the lens are subsequently analyzed. The results show that the positive and negative polarities of the driving voltage can cause a significant difference in the response of the liquid lens; meanwhile, the lens’s response to the negative polarity of the driving voltage is clearer. We use the theory of charge restraint to explain this phenomenon, and it is concluded that the negative ions are more easily restrained by a dielectric layer. This work gives direct guidance for practical applications based on an electrowetting liquid lens.

A maximal incremental effort alters tear osmolarity depending on the fitness level in military helicopter pilots.

Science.gov (United States)

Vera, Jesús; Jiménez, Raimundo; Madinabeitia, Iker; Masiulis, Nerijus; Cárdenas, David

2017-10-01

Fitness level modulates the physiological responses to exercise for a variety of indices. While intense bouts of exercise have been demonstrated to increase tear osmolarity (Tosm), it is not known if fitness level can affect the Tosm response to acute exercise. This study aims to compare the effect of a maximal incremental test on Tosm between trained and untrained military helicopter pilots. Nineteen military helicopter pilots (ten trained and nine untrained) performed a maximal incremental test on a treadmill. A tear sample was collected before and after physical effort to determine the exercise-induced changes on Tosm. The Bayesian statistical analysis demonstrated that Tosm significantly increased from 303.72 ± 6.76 to 310.56 ± 8.80 mmol/L after performance of a maximal incremental test. However, while the untrained group showed an acute Tosm rise (12.33 mmol/L of increment), the trained group experienced a stable Tosm physical effort (1.45 mmol/L). There was a significant positive linear association between fat indices and Tosm changes (correlation coefficients [r] range: 0.77-0.89), whereas the Tosm changes displayed a negative relationship with the cardiorespiratory capacity (VO2 max; r = -0.75) and performance parameters (r = -0.75 for velocity, and r = -0.67 for time to exhaustion). The findings from this study provide evidence that fitness level is a major determinant of Tosm response to maximal incremental physical effort, showing a fairly linear association with several indices related to fitness level. High fitness level seems to be beneficial to avoid Tosm changes as consequence of intense exercise. Copyright © 2017 Elsevier Inc. All rights reserved.

Effect of negative bias on the composition and structure of the tungsten oxide thin films deposited by magnetron sputtering

Science.gov (United States)

Wang, Meihan; Lei, Hao; Wen, Jiaxing; Long, Haibo; Sawada, Yutaka; Hoshi, Yoichi; Uchida, Takayuki; Hou, Zhaoxia

2015-12-01

Tungsten oxide thin films were deposited at room temperature under different negative bias voltages (Vb, 0 to -500 V) by DC reactive magnetron sputtering, and then the as-deposited films were annealed at 500 °C in air atmosphere. The crystal structure, surface morphology, chemical composition and transmittance of the tungsten oxide thin films were characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), X-ray photoelectron spectroscopy (XPS) and UV-vis spectrophotometer. The XRD analysis reveals that the tungsten oxide films deposited at different negative bias voltages present a partly crystallized amorphous structure. All the films transfer from amorphous to crystalline (monoclinic + hexagonal) after annealing 3 h at 500 °C. Furthermore, the crystallized tungsten oxide films show different preferred orientation. The morphology of the tungsten oxide films deposited at different negative bias voltages is consisted of fine nanoscale grains. The grains grow up and conjunct with each other after annealing. The tungsten oxide films deposited at higher negative bias voltages after annealing show non-uniform special morphology. Substoichiometric tungsten oxide films were formed as evidenced by XPS spectra of W4f and O1s. As a result, semi-transparent films were obtained in the visible range for all films deposited at different negative bias voltages.

Local Voltage Control in Distribution Networks: A Game-Theoretic Perspective: Preprint

Energy Technology Data Exchange (ETDEWEB)

Zhou, Xinyang; Tian, Jie; Chen, Lijun; Dall' Anese, Emiliano

2016-09-01

Inverter-based voltage regulation is gaining importance to alleviate emerging reliability and power-quality concerns related to distribution systems with high penetration of photovoltaic (PV) systems. This paper seeks contribution in the domain of reactive power compensation by establishing stability of local Volt/VAr controllers. In lieu of the approximate linear surrogate used in the existing work, the paper establishes existence and uniqueness of an equilibrium point using nonlinear AC power flow model. Key to this end is to consider a nonlinear dynamical system with non-incremental local Volt/VAr control, cast the Volt/VAr dynamics as a game, and leverage the fixed-point theorem as well as pertinent contraction mapping argument. Numerical examples are provided to complement the analytical results.

Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

Directory of Open Access Journals (Sweden)

Perić Dragoslav M.

2015-01-01

Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

Charge-pump voltage converter

Science.gov (United States)

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

Negative charging effect of traps on the gate leakage current of an AlGaN/GaN HEMT

Energy Technology Data Exchange (ETDEWEB)

Kim, J. J.; Lim, J. H.; Yang, J. W. [Chonbuk National University, Jeonju (Korea, Republic of); Stanchina, W. [University of Pittsburgh, Pittsburgh, PA (United States)

2014-08-15

The negative charging effect of surface traps on the gate leakage current of AlGaN/GaN high electron mobility transistors (HEMTs) was investigated. The gate leakage current could be decreased by two orders of magnitude by using a photo-electrochemical process to treat of the source and the drain region, but current flowed into the gate even at a negative voltage in a limited region when the measurement was executed with a gate voltage sweep from negative to positive voltage. Also the electrical characteristics of the HEMT were degraded by pulsed operation of the gate. Traps newly generated on the surface were regarded as sources for the current that flowed against the applied voltage, and the number of traps was estimated. Also, a slow transient in the drain current was confirmed based on the results of delayed sweep measurements.

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Positive and negative streamers in ambient air: measuring diameter, velocity and dissipated energy

International Nuclear Information System (INIS)

Briels, T M P; Kos, J; Van Veldhuizen, E M; Ebert, U; Winands, G J J

2008-01-01

Positive and negative streamers are studied in ambient air at 1 bar; they emerge from a needle electrode placed 40 mm above a planar electrode. The amplitudes of the applied voltage pulses range from 5 to 96 kV; most pulses have rise times of 30 ns or shorter. Diameters, velocities and energies of the streamers are measured. Two regimes are identified; a low voltage regime where only positive streamers appear and a high voltage regime where both positive and negative streamers exist. Below 5 kV, no streamers emerge. In the range from 5 to 40 kV, positive streamers form, while the negative discharges only form a glowing cloud at the electrode tip, but no streamers. For 5-20 kV, diameters and velocities of the positive streamers have the minimal values of d = 0.2 mm and v ∼ 10 5 m s -1 . For 20-40 kV, their diameters increase by a factor of 6 while the voltage increases only by a factor of 2. Above the transition value of 40 kV, streamers of both polarities form; they strongly resemble each other, though the positive ones propagate further; their diameters continue to increase with applied voltage. For 96 kV, positive streamers attain diameters of 3 mm and velocities of 4 x 10 6 m s -1 ; negative streamers are about 20% slower and thinner. An empirical fit formula for the relation between velocity v and diameter d is v = 0.5d 2 mm -1 ns -1 for both polarities. Streamers of both polarities dissipate energies of the order of several millijoules per streamer while crossing the gap.

Dynamic physiological responses to the incremental shuttle walk test in adults

Directory of Open Access Journals (Sweden)

Evandro Fornias Sperandio

Full Text Available Abstract Introduction: Understanding the normal dynamic physiological responses to the incremental shuttle walk test might enhance the interpretation of walking performance in clinical settings. Objective: To assess dynamic physiological responses to the incremental shuttle walk test and its predictors in healthy adults. Methods: We assessed the simultaneous rates of changes of Δoxygen uptake/Δwalking velocity (ΔVO 2 /ΔWV, Δheart rate/Δoxygen uptake (ΔHR/ΔVO 2 , Δventilation/Δcarbon dioxide production (ΔVE/ΔVCO 2 , and Δtidal volume/Δlinearized ventilation (ΔVT/ΔlnVE during the incremental shuttle walk test in 100 men and women older than 40 years. Fat and lean body masses (bioimpedance were also evaluated. Results: We found that the dynamic relationships were not sex-dependent. Participants aged ≥ 70 presented declines in ΔVO 2 /ΔWV slope compared to those aged 40-49 (215 ± 69 vs. 288 ± 84 mL.min-1.km.h-1. Obese participants presented shallower slopes for ΔVO 2 /ΔWV (2.94 ± 0.90 vs. 3.84 ± 1.21 mL.min-1.kg-1.km.h-1 and ΔVT/ΔlnVE (0.57 ± 0.20 vs. 0.67 ± 0.26. We found negative influence of fat body mass on ΔVT/ΔlnVE (R2 = 0.20 and positive influence of lean body mass on ΔVO 2 /ΔWV (R2 = 0.31, ΔHR/ΔVO2 (R2 = 0.25, and ΔVT/ΔlnVE (R2 = 0.44. Conclusion: Dynamic relationships during walking were slightly influenced by age, but not sex-dependent. Body composition played an important role in these indices. Our results may provide better interpretation of walking performance in patients with chronic diseases.

Efficient incremental relaying

KAUST Repository

Fareed, Muhammad Mehboob

2013-07-01

We propose a novel relaying scheme which improves the spectral efficiency of cooperative diversity systems by utilizing limited feedback from destination. Our scheme capitalizes on the fact that relaying is only required when direct transmission suffers deep fading. We calculate the packet error rate for the proposed efficient incremental relaying scheme with both amplify and forward and decode and forward relaying. Numerical results are also presented to verify their analytical counterparts. © 2013 IEEE.

Nature of negative microplastic deformation in alloys

International Nuclear Information System (INIS)

Palatnik, L.S.; Ivantsov, V.I.; Kagan, Ya.I.; Papirov, I.I.; Fat'yanova, N.B.; AN Ukrainskoj SSR, Kharkov. Fiziko-Tekhnicheskij Inst.)

1985-01-01

The paper deals with investigation of microplastic deformation of corrosion resistant aging 40KhNYU alloy and the study of physical nature of negative microdeformation in this alloy under tension. Investigation of microplasticity of 40KhNYU alloy was conducted by the method of mechanostatic hysteresis using resistance strain gauge for measuring stresses and deformations. Microplasticity curves for 40KhNYU alloy were obtained. They represent the result of competition between usual (positive) microdeformation and phase (negative) deformation under tensile effect on the alloy. It was established that the negative microdeformation increment occurs during secondary aging of the phase precipitated from initial supersat urated solid solution (primary decomposition product). This phase decomposes under tension with disperse phase precipitation which promotes decreasing its specific volume and specimen volume as a whole

Entity versus incremental theories predict older adults' memory performance.

Science.gov (United States)

Plaks, Jason E; Chasteen, Alison L

2013-12-01

The authors examined whether older adults' implicit theories regarding the modifiability of memory in particular (Studies 1 and 3) and abilities in general (Study 2) would predict memory performance. In Study 1, individual differences in older adults' endorsement of the "entity theory" (a belief that one's ability is fixed) or "incremental theory" (a belief that one's ability is malleable) of memory were measured using a version of the Implicit Theories Measure (Dweck, 1999). Memory performance was assessed with a free-recall task. Results indicated that the higher the endorsement of the incremental theory, the better the free recall. In Study 2, older and younger adults' theories were measured using a more general version of the Implicit Theories Measure that focused on the modifiability of abilities in general. Again, for older adults, the higher the incremental endorsement, the better the free recall. Moreover, as predicted, implicit theories did not predict younger adults' memory performance. In Study 3, participants read mock news articles reporting evidence in favor of either the entity or incremental theory. Those in the incremental condition outperformed those in the entity condition on reading span and free-recall tasks. These effects were mediated by pretask worry such that, for those in the entity condition, higher worry was associated with lower performance. Taken together, these studies suggest that variation in entity versus incremental endorsement represents a key predictor of older adults' memory performance. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Effect of driving voltages in dual capacitively coupled radio frequency plasma: A study by nonlinear global model

International Nuclear Information System (INIS)

Bora, B.

2015-01-01

On the basis of nonlinear global model, a dual frequency capacitively coupled radio frequency plasma driven by 13.56 MHz and 27.12 MHz has been studied to investigate the influences of driving voltages on the generation of dc self-bias and plasma heating. Fluid equations for the ions inside the plasma sheath have been considered to determine the voltage-charge relations of the plasma sheath. Geometrically symmetric as well as asymmetric cases with finite geometrical asymmetry of 1.2 (ratio of electrodes area) have been considered to make the study more reasonable to experiment. The electrical asymmetry effect (EAE) and finite geometrical asymmetry is found to work differently in controlling the dc self-bias. The amount of EAE has been primarily controlled by the phase angle between the two consecutive harmonics waveforms. The incorporation of the finite geometrical asymmetry in the calculations shift the dc self-bias towards negative polarity direction while increasing the amount of EAE is found to increase the dc self-bias in either direction. For phase angle between the two waveforms ϕ = 0 and ϕ = π/2, the amount of EAE increases significantly with increasing the low frequency voltage, whereas no such increase in the amount of EAE is found with increasing high frequency voltage. In contrast to the geometrically symmetric case, where the variation of the dc self-bias with driving voltages for phase angle ϕ = 0 and π/2 are just opposite in polarity, the variation for the geometrically asymmetric case is different for ϕ = 0 and π/2. In asymmetric case, for ϕ = 0, the dc self-bias increases towards the negative direction with increasing both the low and high frequency voltages, but for the ϕ = π/2, the dc-self bias is increased towards positive direction with increasing low frequency voltage while dc self-bias increases towards negative direction with increasing high frequency voltage

Fossil-based comparative analyses reveal ancient marine ancestry erased by extinction in ray-finned fishes.

Science.gov (United States)

Betancur-R, Ricardo; Ortí, Guillermo; Pyron, Robert Alexander

2015-05-01

The marine-freshwater boundary is a major biodiversity gradient and few groups have colonised both systems successfully. Fishes have transitioned between habitats repeatedly, diversifying in rivers, lakes and oceans over evolutionary time. However, their history of habitat colonisation and diversification is unclear based on available fossil and phylogenetic data. We estimate ancestral habitats and diversification and transition rates using a large-scale phylogeny of extant fish taxa and one containing a massive number of extinct species. Extant-only phylogenetic analyses indicate freshwater ancestry, but inclusion of fossils reveal strong evidence of marine ancestry in lineages now restricted to freshwaters. Diversification and colonisation dynamics vary asymmetrically between habitats, as marine lineages colonise and flourish in rivers more frequently than the reverse. Our study highlights the importance of including fossils in comparative analyses, showing that freshwaters have played a role as refuges for ancient fish lineages, a signal erased by extinction in extant-only phylogenies. © 2015 John Wiley & Sons Ltd/CNRS.

When Natural Disaster Follows Economic Downturn: The Incremental Impact of Multiple Stressor Events on Trajectories of Depression and Posttraumatic Stress Disorder.

Science.gov (United States)

Mandavia, Amar D; Bonanno, George A

2018-04-29

To determine whether there were incremental mental health impacts, specifically on depression trajectories, as a result of the 2008 economic crisis (the Great Recession) and subsequent Hurricane Sandy. Using latent growth mixture modeling and the ORANJ BOWL dataset, we examined prospective trajectories of depression among older adults (mean age, 60.67; SD, 6.86) who were exposed to the 2 events. We also collected community economic and criminal justice data to examine their impact upon depression trajectories. Participants (N=1172) were assessed at 3 times for affect, successful aging, and symptoms of depression. We additionally assessed posttraumatic stress disorder (PTSD) symptomology after Hurricane Sandy. We identified 3 prospective trajectories of depression. The majority (83.6%) had no significant change in depression from before to after these events (resilience), while 7.2% of the sample increased in depression incrementally after each event (incremental depression). A third group (9.2%) went from high to low depression symptomology following the 2 events (depressive-improving). Only those in the incremental depression group had significant PTSD symptoms following Hurricane Sandy. We identified a small group of individuals for whom the experience of multiple stressful events had an incremental negative effect on mental health outcomes. These results highlight the importance of understanding the perseveration of depression symptomology from one event to another. (Disaster Med Public Health Preparedness. 2018;page 1 of 10).

A future, intense source of negative hydrogen ions

Science.gov (United States)

Siefken, Hugh; Stein, Charles

1994-01-01

By directly heating lithium hydride in a vacuum, up to 18 micro-A/sq cm of negative hydrogen has been obtained from the crystal lattice. The amount of ion current extracted and analyzed is closely related to the temperature of the sample and to the rate at which the temperature is changed. The ion current appears to be emission limited and saturates with extraction voltage. For a fixed extraction voltage, the ion current could be maximized by placing a grid between the sample surface and the extraction electrode. Electrons accompanying the negative ions were removed by a magnetic trap. A Wein velocity filter was designed and built to provide definitive mass analysis of the extracted ion species. This technique when applied to other alkali hydrides may produce even higher intensity beams possessing low values of emittance.

Lifetime costs of lung transplantation : Estimation of incremental costs

NARCIS (Netherlands)

VanEnckevort, PJ; Koopmanschap, MA; Tenvergert, EM; VanderBij, W; Rutten, FFH

1997-01-01

Despite an expanding number of centres which provide lung transplantation, information about the incremental costs of lung transplantation is scarce. From 1991 until 1995, in The Netherlands a technology assessment was performed which provided information about the incremental costs of lung

Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

OpenAIRE

Okuma, Takanori; Yasuura, Hiroto

2001-01-01

This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

IGZO TFT-based circuit with tunable threshold voltage by laser annealing

Science.gov (United States)

Huang, Xiaoming; Yu, Guang; Wu, Chenfei

2017-11-01

In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.

Defense Agencies Initiative Increment 2 (DAI Inc 2)

Science.gov (United States)

2016-03-01

module. In an ADM dated September 23, 2013, the MDA established Increment 2 as a MAIS program to include budget formulation; grants financial...2016 Major Automated Information System Annual Report Defense Agencies Initiative Increment 2 (DAI Inc 2) Defense Acquisition Management...President’s Budget RDT&E - Research, Development, Test, and Evaluation SAE - Service Acquisition Executive TBD - To Be Determined TY - Then

Biometrics Enabling Capability Increment 1 (BEC Inc 1)

Science.gov (United States)

2016-03-01

modal biometrics submissions to include iris, face, palm and finger prints from biometrics collection devices, which will support the Warfighter in...2016 Major Automated Information System Annual Report Biometrics Enabling Capability Increment 1 (BEC Inc 1) Defense Acquisition Management...Phone: 227-3119 DSN Fax: Date Assigned: July 15, 2015 Program Information Program Name Biometrics Enabling Capability Increment 1 (BEC Inc 1) DoD

76 FR 53763 - Immigration Benefits Business Transformation, Increment I

Science.gov (United States)

2011-08-29

..., 100, et al. Immigration Benefits Business Transformation, Increment I; Final Rule #0;#0;Federal... Benefits Business Transformation, Increment I AGENCY: U.S. Citizenship and Immigration Services, DHS... USCIS is engaged in an enterprise-wide transformation effort to implement new business processes and to...

Shakedown analysis by finite element incremental procedures

International Nuclear Information System (INIS)

Borkowski, A.; Kleiber, M.

1979-01-01

It is a common occurence in many practical problems that external loads are variable and the exact time-dependent history of loading is unknown. Instead of it load is characterized by a given loading domain: a convex polyhedron in the n-dimensional space of load parameters. The problem is then to check whether a structure shakes down, i.e. responds elastically after a few elasto-plastic cycles, or not to a variable loading as defined above. Such check can be performed by an incremental procedure. One should reproduce incrementally a simple cyclic process which consists of proportional load paths that connect the origin of the load space with the corners of the loading domain. It was proved that if a structure shakes down to such loading history then it is able to adopt itself to an arbitrary load path contained in the loading domain. The main advantage of such approach is the possibility to use existing incremental finite-element computer codes. (orig.)

SM-1 negative ion source

International Nuclear Information System (INIS)

Huang Zhenjun; Wang Jianzhen

1987-01-01

The working principle and characteristics of SM-1 Negative Ion Source is mainly introduced. In the instrument, there is a device to remove O 3 . This instrument can keep high density of negative ions which is generated by the electrical coronas setting out electricity at negative high voltage and can remove the O 3 component which is harmful to the human body. The density of negative ions is higher than 2.5 x 10 6 p./cm 3 while that of O 3 components is less than 1 ppb at the distance of 50 cm from the panel of the instrument. The instrument sprays negative ions automatically without the help of electric fan, so it works noiselessly. It is widely used in national defence, industry, agriculture, forestry, stock raising, sidelines and in the places with an equipment of low density of negative ion or high concentration of O 3 components. Besides, the instrument may also be used to treat diseases, to prevent against rot, to arrest bacteria, to purify air and so on

The role of photoionization in negative corona discharge

Directory of Open Access Journals (Sweden)

B. X. Lu

2016-09-01

Full Text Available The effect of photoionization on the negative corona discharge was simulated based on the needle to plane air gaps. The Trichel pulse, pulse train, electron density and the distribution of electric field will be discussed in this manuscript. Effect of photoionization on the magnitude and interval of the first pulse will be discussed for different applied voltages. It is demonstrated that the peak of the first pulse current could be weakened by photoionization and a critical voltage of the first pulse interval influenced by photoionization was given.

Incremental Structured Dictionary Learning for Video Sensor-Based Object Tracking

Science.gov (United States)

Xue, Ming; Yang, Hua; Zheng, Shibao; Zhou, Yi; Yu, Zhenghua

2014-01-01

To tackle robust object tracking for video sensor-based applications, an online discriminative algorithm based on incremental discriminative structured dictionary learning (IDSDL-VT) is presented. In our framework, a discriminative dictionary combining both positive, negative and trivial patches is designed to sparsely represent the overlapped target patches. Then, a local update (LU) strategy is proposed for sparse coefficient learning. To formulate the training and classification process, a multiple linear classifier group based on a K-combined voting (KCV) function is proposed. As the dictionary evolves, the models are also trained to timely adapt the target appearance variation. Qualitative and quantitative evaluations on challenging image sequences compared with state-of-the-art algorithms demonstrate that the proposed tracking algorithm achieves a more favorable performance. We also illustrate its relay application in visual sensor networks. PMID:24549252

Spectrum analysis of a voltage source converter due to semiconductor voltage drops

DEFF Research Database (Denmark)

Rasmussen, Tonny Wederberg; Eltouki, Mustafa

2017-01-01

It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

Disruption of Memory Reconsolidation Erases a Fear Memory Trace in the Human Amygdala: An 18-Month Follow-Up.

Directory of Open Access Journals (Sweden)

Johannes Björkstrand

Full Text Available Fear memories can be attenuated by reactivation followed by disrupted reconsolidation. Using functional magnetic resonance imaging we recently showed that reactivation and reconsolidation of a conditioned fear memory trace in the basolateral amygdala predicts subsequent fear expression over two days, while reactivation followed by disrupted reconsolidation abolishes the memory trace and suppresses fear. In this follow-up study we demonstrate that the behavioral effect persists over 18 months reflected in superior reacquisition after undisrupted, as compared to disrupted reconsolidation, and that neural activity in the basolateral amygdala representing the initial fear memory predicts return of fear. We conclude that disrupting reconsolidation have long lasting behavioral effects and may permanently erase the fear component of an amygdala-dependent memory.

Ferromagnetic barrier-induced negative differential conductance on the surface of a topological insulator

International Nuclear Information System (INIS)

An Xing-Tao

2014-01-01

The effect of the negative differential conductance of a ferromagnetic barrier on the surface of a topological insulator is theoretically investigated. Due to the changes of the shape and position of the Fermi surfaces in the ferromagnetic barrier, the transport processes can be divided into three kinds: the total, partial, and blockade transmission mechanisms. The bias voltage can give rise to the transition of the transport processes from partial to blockade transmission mechanisms, which results in a considerable effect of negative differential conductance. With appropriate structural parameters, the current-voltage characteristics show that the minimum value of the current can reach to zero in a wide range of the bias voltage, and then a large peak-to-valley current ratio can be obtained. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Ultra-long-pulse microwave negative high voltage power supply with fast protection

International Nuclear Information System (INIS)

Xu Weihua; Wu Junshuan; Zheng Guanghua; Huang Qiaolin; Yang Chunsheng; Zhou Yuanwei; Chen Yonghao

1998-01-01

Two 1.4 MW high voltage power supply (HVPS) modules with 3-5 s pulse duration have been developed for LHCD experiment in the HT-7 tokamak. The power source consists of a pulsed generator and the electric circuit. Duration of the ultra-long-pulse is controlled by switching-on dc relay immediately and switching-off ac contactor after a given time, and the fast protection is executed by a crowbar. Due to the soft starting of the power source, the problem of overvoltage induced by dc relay switching-on has been solved. Each power supply module outputs a rated power (-35 kV, 40 A) on the dummy load. With the klystrons connected as the load of the power supply modules, LHCD experiments have been conducted successfully in the HT-7 tokamak

Positive and negative streamers in ambient air: measuring diameter, velocity and dissipated energy

Energy Technology Data Exchange (ETDEWEB)

Briels, T M P; Kos, J; Van Veldhuizen, E M; Ebert, U [Department of Applied Physics, Technische Universiteit Eindhoven, PO Box 513, 5600 MB Eindhoven (Netherlands); Winands, G J J [Department of Electrical Engineering, Technische Universiteit Eindhoven, PO Box 513, 5600 MB Eindhoven (Netherlands)], E-mail: e.m.v.veldhuizen@tue.nl, E-mail: ebert@cwi.nl

2008-12-07

Positive and negative streamers are studied in ambient air at 1 bar; they emerge from a needle electrode placed 40 mm above a planar electrode. The amplitudes of the applied voltage pulses range from 5 to 96 kV; most pulses have rise times of 30 ns or shorter. Diameters, velocities and energies of the streamers are measured. Two regimes are identified; a low voltage regime where only positive streamers appear and a high voltage regime where both positive and negative streamers exist. Below 5 kV, no streamers emerge. In the range from 5 to 40 kV, positive streamers form, while the negative discharges only form a glowing cloud at the electrode tip, but no streamers. For 5-20 kV, diameters and velocities of the positive streamers have the minimal values of d = 0.2 mm and v {approx} 10{sup 5} m s{sup -1}. For 20-40 kV, their diameters increase by a factor of 6 while the voltage increases only by a factor of 2. Above the transition value of 40 kV, streamers of both polarities form; they strongly resemble each other, though the positive ones propagate further; their diameters continue to increase with applied voltage. For 96 kV, positive streamers attain diameters of 3 mm and velocities of 4 x 10{sup 6} m s{sup -1}; negative streamers are about 20% slower and thinner. An empirical fit formula for the relation between velocity v and diameter d is v = 0.5d{sup 2} mm{sup -1} ns{sup -1} for both polarities. Streamers of both polarities dissipate energies of the order of several millijoules per streamer while crossing the gap.

Automatic incrementalization of Prolog based static analyses

DEFF Research Database (Denmark)

Eichberg, Michael; Kahl, Matthias; Saha, Diptikalyan

2007-01-01

Modem development environments integrate various static analyses into the build process. Analyses that analyze the whole project whenever the project changes are impractical in this context. We present an approach to automatic incrementalization of analyses that are specified as tabled logic...... programs and evaluated using incremental tabled evaluation, a technique for efficiently updating memo tables in response to changes in facts and rules. The approach has been implemented and integrated into the Eclipse IDE. Our measurements show that this technique is effective for automatically...

Co-ordinated Control Strategy for Hybrid Wind Farms with PMSG and FSIG under Unbalanced Grid Voltage Condition

DEFF Research Database (Denmark)

Zeng, Xin; Yao, Jun; Chen, Zhiqian

2016-01-01

-sequence current from the PMSG-based wind farm by the modified negative-sequence voltage and current double closed-loop control system is then developed. Finally, the correctness of theoretical analysis and the effectiveness of the proposed control strategy are validated by the experimental results....... to inject negative-sequence current for decreasing voltage unbalance factor (VUF) at point of common coupling (PCC), the double grid frequency oscillations in electromagnetic torque, active and reactive power output from the FSIG-based wind farm can be suppressed. In this paper, the maximum amplitude...... of the negative-sequence current provided by the PMSG-based wind farm under different average active power output and different VUF conditions is deduced, and the impacts of its phase angle on the VUF mitigation control effect are further studied. The improved control strategy of injecting negative...

Mission Planning System Increment 5 (MPS Inc 5)

Science.gov (United States)

2016-03-01

2016 Major Automated Information System Annual Report Mission Planning System Increment 5 (MPS Inc 5) Defense Acquisition Management Information...President’s Budget RDT&E - Research, Development, Test, and Evaluation SAE - Service Acquisition Executive TBD - To Be Determined TY - Then Year...Phone: 845-9625 DSN Fax: Date Assigned: May 19, 2014 Program Information Program Name Mission Planning System Increment 5 (MPS Inc 5) DoD

MRI: Modular reasoning about interference in incremental programming

OpenAIRE

Oliveira, Bruno C. D. S; Schrijvers, Tom; Cook, William R

2012-01-01

Incremental Programming (IP) is a programming style in which new program components are defined as increments of other components. Examples of IP mechanisms include: Object-oriented programming (OOP) inheritance, aspect-oriented programming (AOP) advice and feature-oriented programming (FOP). A characteristic of IP mechanisms is that, while individual components can be independently defined, the composition of components makes those components become tightly coupled, sh...

Incremental short daily home hemodialysis: a case series

OpenAIRE

Toth-Manikowski, Stephanie M.; Mullangi, Surekha; Hwang, Seungyoung; Shafi, Tariq

2017-01-01

Background Patients starting dialysis often have substantial residual kidney function. Incremental hemodialysis provides a hemodialysis prescription that supplements patients? residual kidney function while maintaining total (residual + dialysis) urea clearance (standard Kt/Vurea) targets. We describe our experience with incremental hemodialysis in patients using NxStage System One for home hemodialysis. Case presentation From 2011 to 2015, we initiated 5 incident hemodialysis patients on an ...

Volatilities, Traded Volumes, and Price Increments in Derivative Securities

Science.gov (United States)

Kim, Kyungsik; Lim, Gyuchang; Kim, Soo Yong; Scalas, Enrico

2007-03-01

We apply the detrended fluctuation analysis (DFA) to the statistics of the Korean treasury bond (KTB) futures from which the logarithmic increments, volatilities, and traded volumes are estimated over a specific time lag. For our case, the logarithmic increment of futures prices has no long-memory property, while the volatility and the traded volume exhibit the existence of long-memory property. To analyze and calculate whether the volatility clustering is due to the inherent higher-order correlation not detected by applying directly the DFA to logarithmic increments of the KTB futures, it is of importance to shuffle the original tick data of futures prices and to generate the geometric Brownian random walk with the same mean and standard deviation. It is really shown from comparing the three tick data that the higher-order correlation inherent in logarithmic increments makes the volatility clustering. Particularly, the result of the DFA on volatilities and traded volumes may be supported the hypothesis of price changes.

Space-time quantitative source apportionment of soil heavy metal concentration increments.

Science.gov (United States)

Yang, Yong; Christakos, George; Guo, Mingwu; Xiao, Lu; Huang, Wei

2017-04-01

Assessing the space-time trends and detecting the sources of heavy metal accumulation in soils have important consequences in the prevention and treatment of soil heavy metal pollution. In this study, we collected soil samples in the eastern part of the Qingshan district, Wuhan city, Hubei Province, China, during the period 2010-2014. The Cd, Cu, Pb and Zn concentrations in soils exhibited a significant accumulation during 2010-2014. The spatiotemporal Kriging technique, based on a quantitative characterization of soil heavy metal concentration variations in terms of non-separable variogram models, was employed to estimate the spatiotemporal soil heavy metal distribution in the study region. Our findings showed that the Cd, Cu, and Zn concentrations have an obvious incremental tendency from the southwestern to the central part of the study region. However, the Pb concentrations exhibited an obvious tendency from the northern part to the central part of the region. Then, spatial overlay analysis was used to obtain absolute and relative concentration increments of adjacent 1- or 5-year periods during 2010-2014. The spatial distribution of soil heavy metal concentration increments showed that the larger increments occurred in the center of the study region. Lastly, the principal component analysis combined with the multiple linear regression method were employed to quantify the source apportionment of the soil heavy metal concentration increments in the region. Our results led to the conclusion that the sources of soil heavy metal concentration increments should be ascribed to industry, agriculture and traffic. In particular, 82.5% of soil heavy metal concentration increment during 2010-2014 was ascribed to industrial/agricultural activities sources. Using STK and SOA to obtain the spatial distribution of heavy metal concentration increments in soils. Using PCA-MLR to quantify the source apportionment of soil heavy metal concentration increments. Copyright © 2017

Characterization and comprehension of corona partial discharge in air under power frequency to very low frequency voltage

Science.gov (United States)

Yuanxiang, ZHOU; Zhongliu, ZHOU; Ling, ZHANG; Yunxiao, ZHANG; Yajun, MO; Jiantao, SUN

2018-05-01

For the partial discharge test of electrical equipment with large capacitance, the use of low-frequency voltage instead of power frequency voltage can effectively reduce the capacity requirements of test power supply. However, the validity of PD test under low frequency voltage needs to be evaluated. In order to investigate the influence of voltage frequency on corona discharge in the air, the discharge test of the tip-plate electrode under the frequency from 50 to 0.1 Hz is carried out based on the impulse current method. The results show that some of the main features of corona under low frequency do not change. The magnitude of discharge in a positive half cycle is obviously larger than that in a negative cycle. The magnitude of discharge and interval in positive cycle are random, while that in negative cycle are regular. With the decrease of frequency, the inception voltage increases. The variation trend of maximum and average magnitude and repetition rate of the discharge in positive and negative half cycle with the variation of voltage frequency and magnitude is demonstrated, with discussion and interpretation from the aspects of space charge transportation, effective discharge time and transition of discharge modes. There is an obvious difference in the phase resolved pattern of partial discharge and characteristic parameters of discharge patterns between power and low frequency. The experimental results can be the reference for mode identification of partial discharge under low frequency tests. The trend of the measured parameters with the variation of frequency provides more information about the insulation defect than traditional measurements under a single frequency (usually 50 Hz). Also it helps to understand the mechanism of corona discharge with an explanation of the characteristics under different frequencies.

Support vector machine incremental learning triggered by wrongly predicted samples

Science.gov (United States)

Tang, Ting-long; Guan, Qiu; Wu, Yi-rong

2018-05-01

According to the classic Karush-Kuhn-Tucker (KKT) theorem, at every step of incremental support vector machine (SVM) learning, the newly adding sample which violates the KKT conditions will be a new support vector (SV) and migrate the old samples between SV set and non-support vector (NSV) set, and at the same time the learning model should be updated based on the SVs. However, it is not exactly clear at this moment that which of the old samples would change between SVs and NSVs. Additionally, the learning model will be unnecessarily updated, which will not greatly increase its accuracy but decrease the training speed. Therefore, how to choose the new SVs from old sets during the incremental stages and when to process incremental steps will greatly influence the accuracy and efficiency of incremental SVM learning. In this work, a new algorithm is proposed to select candidate SVs and use the wrongly predicted sample to trigger the incremental processing simultaneously. Experimental results show that the proposed algorithm can achieve good performance with high efficiency, high speed and good accuracy.

Average-case analysis of incremental topological ordering

DEFF Research Database (Denmark)

Ajwani, Deepak; Friedrich, Tobias

2010-01-01

Many applications like pointer analysis and incremental compilation require maintaining a topological ordering of the nodes of a directed acyclic graph (DAG) under dynamic updates. All known algorithms for this problem are either only analyzed for worst-case insertion sequences or only evaluated...... experimentally on random DAGs. We present the first average-case analysis of incremental topological ordering algorithms. We prove an expected runtime of under insertion of the edges of a complete DAG in a random order for the algorithms of Alpern et al. (1990) [4], Katriel and Bodlaender (2006) [18], and Pearce...

Enhanced Decoupled Double Synchronous Reference Frame Current Controller for Unbalanced Grid-Voltage Conditions

DEFF Research Database (Denmark)

Reyes, M.; Rodriguez, Pedro; Vazquez, S.

2012-01-01

. In these codes, the injection of positive- and negative-sequence current components becomes necessary for fulfilling, among others, the low-voltage ride-through requirements during balanced and unbalanced grid faults. However, the performance of classical dq current controllers, applied to power converters......, under unbalanced grid-voltage conditions is highly deficient, due to the unavoidable appearance of current oscillations. This paper analyzes the performance of the double synchronous reference frame controller and improves its structure by adding a decoupling network for estimating and compensating...

Phosphorene/rhenium disulfide heterojunction-based negative differential resistance device for multi-valued logic

Science.gov (United States)

Shim, Jaewoo; Oh, Seyong; Kang, Dong-Ho; Jo, Seo-Hyeon; Ali, Muhammad Hasnain; Choi, Woo-Young; Heo, Keun; Jeon, Jaeho; Lee, Sungjoo; Kim, Minwoo; Song, Young Jae; Park, Jin-Hong

2016-01-01

Recently, negative differential resistance devices have attracted considerable attention due to their folded current–voltage characteristic, which presents multiple threshold voltage values. Because of this remarkable property, studies associated with the negative differential resistance devices have been explored for realizing multi-valued logic applications. Here we demonstrate a negative differential resistance device based on a phosphorene/rhenium disulfide (BP/ReS2) heterojunction that is formed by type-III broken-gap band alignment, showing high peak-to-valley current ratio values of 4.2 and 6.9 at room temperature and 180 K, respectively. Also, the carrier transport mechanism of the BP/ReS2 negative differential resistance device is investigated in detail by analysing the tunnelling and diffusion currents at various temperatures with the proposed analytic negative differential resistance device model. Finally, we demonstrate a ternary inverter as a multi-valued logic application. This study of a two-dimensional material heterojunction is a step forward toward future multi-valued logic device research. PMID:27819264

Phosphorene/rhenium disulfide heterojunction-based negative differential resistance device for multi-valued logic

Science.gov (United States)

Shim, Jaewoo; Oh, Seyong; Kang, Dong-Ho; Jo, Seo-Hyeon; Ali, Muhammad Hasnain; Choi, Woo-Young; Heo, Keun; Jeon, Jaeho; Lee, Sungjoo; Kim, Minwoo; Song, Young Jae; Park, Jin-Hong

2016-11-01

Recently, negative differential resistance devices have attracted considerable attention due to their folded current-voltage characteristic, which presents multiple threshold voltage values. Because of this remarkable property, studies associated with the negative differential resistance devices have been explored for realizing multi-valued logic applications. Here we demonstrate a negative differential resistance device based on a phosphorene/rhenium disulfide (BP/ReS2) heterojunction that is formed by type-III broken-gap band alignment, showing high peak-to-valley current ratio values of 4.2 and 6.9 at room temperature and 180 K, respectively. Also, the carrier transport mechanism of the BP/ReS2 negative differential resistance device is investigated in detail by analysing the tunnelling and diffusion currents at various temperatures with the proposed analytic negative differential resistance device model. Finally, we demonstrate a ternary inverter as a multi-valued logic application. This study of a two-dimensional material heterojunction is a step forward toward future multi-valued logic device research.

Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

International Nuclear Information System (INIS)

Teyssedre, G.; Laurent, C.; Vu, T. T. N.

2015-01-01

Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10 −14 –10 −13  m 2  V −1  s −1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets

Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

Science.gov (United States)

Teyssedre, G.; Vu, T. T. N.; Laurent, C.

2015-12-01

Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

Motion-Induced Blindness Using Increments and Decrements of Luminance

Directory of Open Access Journals (Sweden)

Stine Wm Wren

2017-10-01

Full Text Available Motion-induced blindness describes the disappearance of stationary elements of a scene when other, perhaps non-overlapping, elements of the scene are in motion. We measured the effects of increment (200.0 cd/m2 and decrement targets (15.0 cd/m2 and masks presented on a grey background (108.0 cd/m2, tapping into putative ON- and OFF-channels, on the rate of target disappearance psychophysically. We presented two-frame motion, which has coherent motion energy, and dynamic Glass patterns and dynamic anti-Glass patterns, which do not have coherent motion energy. Using the method of constant stimuli, participants viewed stimuli of varying durations (3.1 s, 4.6 s, 7.0 s, 11 s, or 16 s in a given trial and then indicated whether or not the targets vanished during that trial. Psychometric function midpoints were used to define absolute threshold mask duration for the disappearance of the target. 95% confidence intervals for threshold disappearance times were estimated using a bootstrap technique for each of the participants across two experiments. Decrement masks were more effective than increment masks with increment targets. Increment targets were easier to mask than decrement targets. Distinct mask pattern types had no effect, suggesting that perceived coherence contributes to the effectiveness of the mask. The ON/OFF dichotomy clearly carries its influence to the level of perceived motion coherence. Further, the asymmetry in the effects of increment and decrement masks on increment and decrement targets might lead one to speculate that they reflect the ‘importance’ of detecting decrements in the environment.

Effects of bias voltage on the properties of ITO films prepared on polymer substrates

International Nuclear Information System (INIS)

Lee, Jaehyeong; Jung, Hakkee; Lim, Donggun; Yang, Keajoon; Song, Woochang; Yi, Junsin

2005-01-01

The ITO (indium tin oxide) thin films were deposited on acryl, glass, PET, and poly-carbonate substrates by DC reactive magnetron sputtering. The bias voltage was changed from -20 to -80 V. As the bias voltage increased, the deposition rate of ITO films decreased regardless of substrate types. The roughness of the films on PET increased with the bias voltage. The study demonstrated that the bias improved the electrical and optical properties of ITO films regardless of substrate types. The lowest electrical resistivity of 5.5x10 -4 no. OMEGAno. -cm and visible transmittance of about 80% were achieved by applying a negative bias of -60 V

Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

Directory of Open Access Journals (Sweden)

Chaichana Amornchai

2017-01-01

Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

Logistics Modernization Program Increment 2 (LMP Inc 2)

Science.gov (United States)

2016-03-01

Sections 3 and 4 of the LMP Increment 2 Business Case, ADM), key functional requirements, Critical Design Review (CDR) Reports, and Economic ...from the 2013 version of the LMP Increment 2 Economic Analysis and replace it with references to the Economic Analysis that will be completed...of ( inbound /outbound) IDOCs into the system. LMP must be able to successfully process 95% of ( inbound /outbound) IDOCs into the system. Will meet

Incremental Tensor Principal Component Analysis for Handwritten Digit Recognition

Directory of Open Access Journals (Sweden)

Chang Liu

2014-01-01

Full Text Available To overcome the shortcomings of traditional dimensionality reduction algorithms, incremental tensor principal component analysis (ITPCA based on updated-SVD technique algorithm is proposed in this paper. This paper proves the relationship between PCA, 2DPCA, MPCA, and the graph embedding framework theoretically and derives the incremental learning procedure to add single sample and multiple samples in detail. The experiments on handwritten digit recognition have demonstrated that ITPCA has achieved better recognition performance than that of vector-based principal component analysis (PCA, incremental principal component analysis (IPCA, and multilinear principal component analysis (MPCA algorithms. At the same time, ITPCA also has lower time and space complexity.

Temporary over voltages in the high voltage networks

International Nuclear Information System (INIS)

Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

2001-01-01

The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

Voltage regulator for generator

Energy Technology Data Exchange (ETDEWEB)

Naoi, K

1989-01-17

It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

The allosteric site regulates the voltage sensitivity of muscarinic receptors.

Science.gov (United States)

Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

2018-01-01

Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

Hardiness scales in Iranian managers: evidence of incremental validity in relationships with the five factor model and with organizational and psychological adjustment.

Science.gov (United States)

Ghorbani, Nima; Watson, P J

2005-06-01

This study examined the incremental validity of Hardiness scales in a sample of Iranian managers. Along with measures of the Five Factor Model and of Organizational and Psychological Adjustment, Hardiness scales were administered to 159 male managers (M age = 39.9, SD = 7.5) who had worked in their organizations for 7.9 yr. (SD=5.4). Hardiness predicted greater Job Satisfaction, higher Organization-based Self-esteem, and perceptions of the work environment as being less stressful and constraining. Hardiness also correlated positively with Assertiveness, Emotional Stability, Extraversion, Openness to Experience, Agreeableness, and Conscientiousness and negatively with Depression, Anxiety, Perceived Stress, Chance External Control, and a Powerful Others External Control. Evidence of incremental validity was obtained when the Hardiness scales supplemented the Five Factor Model in predicting organizational and psychological adjustment. These data documented the incremental validity of the Hardiness scales in a non-Western sample and thus confirmed once again that Hardiness has a relevance that extends beyond the culture in which it was developed.

First results from negative ion beam extraction in ROBIN in surface mode

Science.gov (United States)

Pandya, Kaushal; Gahlaut, Agrajit; Yadav, Ratnakar K.; Bhuyan, Manas; Bandyopadhyay, Mainak; Das, B. K.; Bharathi, P.; Vupugalla, Mahesh; Parmar, K. G.; Tyagi, Himanshu; Patel, Kartik; Bhagora, Jignesh; Mistri, Hiren; Prajapati, Bhavesh; Pandey, Ravi; Chakraborty, Arun. K.

2017-08-01

ROBIN, the first step in the Indian R&D program on negative ion beams has reached an important milestone, with the production of negative ions in the surface conversion mode through Cesium (Cs) vapor injection into the source. In the present set-up, negative hydrogen ion beam extraction is effected through an extraction area of ˜73.38 cm2 (146 apertures of 8mm diameter). The three grid electrostatic accelerator system of ROBIN is fed by high voltage DC power supplies (Extraction Power Supply System: 11kV, 35A and Acceleration Power Supply System: 35kV, 15A). Though, a considerable reduction of co-extracted electron current is usually observed during surface mode operation, in order to increase the negative ion current, various other parameters such as plasma grid temperature, plasma grid bias, extraction to acceleration voltage ratio, impurity control and Cs recycling need to be optimized. In the present experiments, to control and to understand the impurity behavior, a Cryopump (14,000 l/s for Hydrogen) is installed along with a Residual Gas Analyzer (RGA). To characterize the source plasma, two sets of Langmuir probes are inserted through the diagnostic flange ports available at the extraction plane. To characterize the beam properties, thermal differential calorimeter, Doppler Shift Spectroscopy and electrical current measurements are implemented in ROBIN. In the present set up, all the negative ion beam extraction experiments have been performed by varying different experimental parameters e.g. RF power (30-70 kW), source operational pressure (0.3 - 0.6Pa), plasma grid bias voltage, extraction & acceleration voltage combination etc. The experiments in surface mode operation is resulted a reduction of co-extracted electron current having electron to ion ratio (e/i) ˜2 whereas the extracted negative ion current density was increased. However, further increase in negative ion current density is expected to be improved after a systematic optimization of the

Negative-ion-beam generation with the ORNL SITEX source

International Nuclear Information System (INIS)

Dagenhart, W.K.; Stirling, W.L.; Kim, J.

1982-05-01

Parametric studies were made on a hot cathode reflex discharge H - Surface Ionization source with Transverse Extraction (SITEX) in both the pure hydrogen and the mixed hydrogen-cesium mode. Extraction current density, beam current, gas efficiency, extracted electron-to-H - current ratio, heavy negative ion impurities, optics, and long pulse operation were investigated as a function of time, arc voltage, arc current, converter voltage, H 2 gas flow, cesium feed rate, and plasma generator geometries. Initial results of the research were an extracted H - beam current density of 56 mA/cm 2 at 23 mA for 5 s pulses and, gas efficiency of 3%, theta/sub perpendicular/ (1/e) approx. 2 +- 1 0 , theta/sub parallel/ (1/e) approx. 1 +- 1 0 , at a beam energy of 25 keV. Negative heavy ion beam impurities were reduced to - ions are produced prinicpally by positive ion surface conversion using elemental cesium fractional monolayer coverage on a molybdenum converter substrate, which is biased negatively with respect to the anode

Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

Science.gov (United States)

Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

2018-03-01

Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

Voltage resonant inverter as a power source

OpenAIRE

Lupenko, Anatoliy; Stakhiv, Petro

2014-01-01

The operation mode of a voltage resonant inverter as a power source with variable load is analyzed. In order to reduce load power variations, an approach to development of the inverter’s load power response based on providing similar positive and negative power deviations from its nominal value has been proposed. The design procedure for resonant inverter with open loop structure as a power source has been elaborated. For a high pressure sodium lamp as a load, the power deviation of about 4% ...

Prediction of breakdown voltages in novel gases for high voltage insulation

International Nuclear Information System (INIS)

Koch, M.

2015-01-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

Validation of the periodicity of growth increment deposition in ...

African Journals Online (AJOL)

Validation of the periodicity of growth increment deposition in otoliths from the larval and early juvenile stages of two cyprinids from the Orange–Vaal river ... Linear regression models were fitted to the known age post-fertilisation and the age estimated using increment counts to test the correspondence between the two for ...

Creating Helical Tool Paths for Single Point Incremental Forming

DEFF Research Database (Denmark)

Skjødt, Martin; Hancock, Michael H.; Bay, Niels

2007-01-01

Single point incremental forming (SPIF) is a relatively new sheet forming process. A sheet is clamped in a rig and formed incrementally using a rotating single point tool in the form of a rod with a spherical end. The process is often performed on a CNC milling machine and the tool movement...

Single point incremental forming: Formability of PC sheets

Science.gov (United States)

Formisano, A.; Boccarusso, L.; Carrino, L.; Lambiase, F.; Minutolo, F. Memola Capece

2018-05-01

Recent research on Single Point Incremental Forming of polymers has slightly covered the possibility of expanding the materials capability window of this flexible forming process beyond metals, by demonstrating the workability of thermoplastic polymers at room temperature. Given the different behaviour of polymers compared to metals, different aspects need to be deepened to better understand the behaviour of these materials when incrementally formed. Thus, the aim of the work is to investigate the formability of incrementally formed polycarbonate thin sheets. To this end, an experimental investigation at room temperature was conducted involving formability tests; varying wall angle cone and pyramid frusta were manufactured by processing polycarbonate sheets with different thicknesses and using tools with different diameters, in order to draw conclusions on the formability of polymer sheets through the evaluation of the forming angles and the observation of the failure mechanisms.

Martingales, nonstationary increments, and the efficient market hypothesis

Science.gov (United States)

McCauley, Joseph L.; Bassler, Kevin E.; Gunaratne, Gemunu H.

2008-06-01

We discuss the deep connection between nonstationary increments, martingales, and the efficient market hypothesis for stochastic processes x(t) with arbitrary diffusion coefficients D(x,t). We explain why a test for a martingale is generally a test for uncorrelated increments. We explain why martingales look Markovian at the level of both simple averages and 2-point correlations. But while a Markovian market has no memory to exploit and cannot be beaten systematically, a martingale admits memory that might be exploitable in higher order correlations. We also use the analysis of this paper to correct a misstatement of the ‘fair game’ condition in terms of serial correlations in Fama’s paper on the EMH. We emphasize that the use of the log increment as a variable in data analysis generates spurious fat tails and spurious Hurst exponents.

Incremental Learning for Place Recognition in Dynamic Environments

OpenAIRE

Luo, Jie; Pronobis, Andrzej; Caputo, Barbara; Jensfelt, Patric

2007-01-01

This paper proposes a discriminative approach to template-based Vision-based place recognition is a desirable feature for an autonomous mobile system. In order to work in realistic scenarios, visual recognition algorithms should be adaptive, i.e. should be able to learn from experience and adapt continuously to changes in the environment. This paper presents a discriminative incremental learning approach to place recognition. We use a recently introduced version of the incremental SVM, which ...

On the instability increments of a stationary pinch

International Nuclear Information System (INIS)

Bud'ko, A.B.

1989-01-01

The stability of stationary pinch to helical modes is numerically studied. It is shown that in the case of a rather fast plasma pressure decrease to the pinch boundary, for example, for an isothermal diffusion pinch with Gauss density distribution instabilities with m=0 modes are the most quickly growing. Instability increments are calculated. A simple analytical expression of a maximum increment of growth of sausage instability for automodel Gauss profiles is obtained

Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

Science.gov (United States)

Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

2004-03-22

DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

5.0 kV breakdown-voltage vertical GaN p-n junction diodes

Science.gov (United States)

Ohta, Hiroshi; Hayashi, Kentaro; Horikiri, Fumimasa; Yoshino, Michitaka; Nakamura, Tohru; Mishima, Tomoyoshi

2018-04-01

A high breakdown voltage of 5.0 kV has been achieved for the first time in vertical GaN p-n junction diodes by using our newly developed guard-ring structures. A resistance device was inserted between the main diode portion and the guard-ring portion in a ring-shaped p-n diode to generate a voltage drop over the resistance device by leakage current flowing through the guard-ring portion under negatively biased conditions before breakdown. The voltage at the outer mesa edge of the guard-ring portion, where the electric field intensity is highest and the destructive breakdown usually occurs, is decreased by the voltage drop, so the electric field concentration in the portion is reduced. By adopting this structure, the breakdown voltage (V B) is raised by about 200 V. Combined with a low measured on-resistance (R on) of 1.25 mΩ cm2, Baliga’s figure of merit (V\\text{B}2/R\\text{on}) was as high as 20 GW/cm2.

Incremental Structured Dictionary Learning for Video Sensor-Based Object Tracking

Directory of Open Access Journals (Sweden)

Ming Xue

2014-02-01

Full Text Available To tackle robust object tracking for video sensor-based applications, an online discriminative algorithm based on incremental discriminative structured dictionary learning (IDSDL-VT is presented. In our framework, a discriminative dictionary combining both positive, negative and trivial patches is designed to sparsely represent the overlapped target patches. Then, a local update (LU strategy is proposed for sparse coefficient learning. To formulate the training and classification process, a multiple linear classifier group based on a K-combined voting (KCV function is proposed. As the dictionary evolves, the models are also trained to timely adapt the target appearance variation. Qualitative and quantitative evaluations on challenging image sequences compared with state-of-the-art algorithms demonstrate that the proposed tracking algorithm achieves a more favorable performance. We also illustrate its relay application in visual sensor networks.

Incremental Trust in Grid Computing

DEFF Research Database (Denmark)

Brinkløv, Michael Hvalsøe; Sharp, Robin

2007-01-01

This paper describes a comparative simulation study of some incremental trust and reputation algorithms for handling behavioural trust in large distributed systems. Two types of reputation algorithm (based on discrete and Bayesian evaluation of ratings) and two ways of combining direct trust and ...... of Grid computing systems....

Convergent systems vs. incremental stability

NARCIS (Netherlands)

Rüffer, B.S.; Wouw, van de N.; Mueller, M.

2013-01-01

Two similar stability notions are considered; one is the long established notion of convergent systems, the other is the younger notion of incremental stability. Both notions require that any two solutions of a system converge to each other. Yet these stability concepts are different, in the sense

On-site voltage measurement with capacitive sensors on high voltage systems

NARCIS (Netherlands)

Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

2011-01-01

In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

Power calculation of linear and angular incremental encoders

Science.gov (United States)

Prokofev, Aleksandr V.; Timofeev, Aleksandr N.; Mednikov, Sergey V.; Sycheva, Elena A.

2016-04-01

Automation technology is constantly expanding its role in improving the efficiency of manufacturing and testing processes in all branches of industry. More than ever before, the mechanical movements of linear slides, rotary tables, robot arms, actuators, etc. are numerically controlled. Linear and angular incremental photoelectric encoders measure mechanical motion and transmit the measured values back to the control unit. The capabilities of these systems are undergoing continual development in terms of their resolution, accuracy and reliability, their measuring ranges, and maximum speeds. This article discusses the method of power calculation of linear and angular incremental photoelectric encoders, to find the optimum parameters for its components, such as light emitters, photo-detectors, linear and angular scales, optical components etc. It analyzes methods and devices that permit high resolutions in the order of 0.001 mm or 0.001°, as well as large measuring lengths of over 100 mm. In linear and angular incremental photoelectric encoders optical beam is usually formulated by a condenser lens passes through the measuring unit changes its value depending on the movement of a scanning head or measuring raster. Past light beam is converting into an electrical signal by the photo-detecter's block for processing in the electrical block. Therefore, for calculating the energy source is a value of the desired value of the optical signal at the input of the photo-detecter's block, which reliably recorded and processed in the electronic unit of linear and angular incremental optoelectronic encoders. Automation technology is constantly expanding its role in improving the efficiency of manufacturing and testing processes in all branches of industry. More than ever before, the mechanical movements of linear slides, rotary tables, robot arms, actuators, etc. are numerically controlled. Linear and angular incremental photoelectric encoders measure mechanical motion and

Prediction of breakdown voltages in novel gases for high voltage insulation

Energy Technology Data Exchange (ETDEWEB)

Koch, M.

2015-07-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

Optimization of negative ion accelerators

International Nuclear Information System (INIS)

Pamela, J.

1991-01-01

We have started to study negative ion extraction and acceleration systems in view of designing a 1 MeV D - accelerator. This study is being made with a two-Dimensional code that has been specifically developed in our laboratory and validated by comparison to three sets of experimental data. We believe that the criteria for negative ion accelerator design optimization should be: (i) to provide the best optics; (ii) to reduce the power load on the extraction grid; (iii) to allow operation with low electric fields in order to reduce the problem of breakdowns. We show some results of optics calculations performed for two systems that will be operational in the next months: the CEA-JAERI collaboration at Cadarache and the european DRAGON experiment at Culham. Extrapolations to higher energies of 500 to 1100 keV have also been conducted. All results indicate that the overall accelerator length, whatever be the number of gaps, is constrained by space charge effects (Child-Langmuir). We have combined this constraint with high-voltage hold-off empirical laws. As a result, it appears that accelerating 10 mA/cm 2 of D - at 1 MeV with good optics, as required for NET or ITER, is close to the expected limit of high-voltage hold-off

Making context explicit for explanation and incremental knowledge acquisition

Energy Technology Data Exchange (ETDEWEB)

Brezillon, P. [Univ. Paris (France)

1996-12-31

Intelligent systems may be improved by making context explicit in problem solving. This is a lesson drawn from a study of the reasons why a number of knowledge-based systems (KBSs) failed. We discuss the interest to make context explicit in explanation generation and incremental knowledge acquisition, two important aspects of intelligent systems that aim to cooperate with users. We show how context can be used to better explain and incrementally acquire knowledge. The advantages of using context in explanation and incremental knowledge acquisition are discussed through SEPIT, an expert system for supporting diagnosis and explanation through simulation of power plants. We point out how the limitations of such systems may be overcome by making context explicit.

High voltage engineering

CERN Document Server

Rizk, Farouk AM

2014-01-01

Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

Device for monitoring cell voltage

Science.gov (United States)

Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

2012-08-21

A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

Ferroelectric negative capacitance domain dynamics

Science.gov (United States)

Hoffmann, Michael; Khan, Asif Islam; Serrao, Claudy; Lu, Zhongyuan; Salahuddin, Sayeef; Pešić, Milan; Slesazeck, Stefan; Schroeder, Uwe; Mikolajick, Thomas

2018-05-01

Transient negative capacitance effects in epitaxial ferroelectric Pb(Zr0.2Ti0.8)O3 capacitors are investigated with a focus on the dynamical switching behavior governed by domain nucleation and growth. Voltage pulses are applied to a series connection of the ferroelectric capacitor and a resistor to directly measure the ferroelectric negative capacitance during switching. A time-dependent Ginzburg-Landau approach is used to investigate the underlying domain dynamics. The transient negative capacitance is shown to originate from reverse domain nucleation and unrestricted domain growth. However, with the onset of domain coalescence, the capacitance becomes positive again. The persistence of the negative capacitance state is therefore limited by the speed of domain wall motion. By changing the applied electric field, capacitor area or external resistance, this domain wall velocity can be varied predictably over several orders of magnitude. Additionally, detailed insights into the intrinsic material properties of the ferroelectric are obtainable through these measurements. A new method for reliable extraction of the average negative capacitance of the ferroelectric is presented. Furthermore, a simple analytical model is developed, which accurately describes the negative capacitance transient time as a function of the material properties and the experimental boundary conditions.

Negative sequence current control in wind power plants with VSC-HVDC connection

DEFF Research Database (Denmark)

Chaudhary, Sanjay; Teodorescu, Remus; Rodriguez, Pedro

2012-01-01

Large offshore wind power plants may have multi-MW wind turbine generators (WTG) equipped with full-scale converters (FSC) and voltage source converter (VSC) based high voltaage direct-current (HVDC) transmission for grid connection. The power electronic converters in theWTG-FSC and the VSC......-HVDC allow fast current control in the offshore grid. This paper presents a method of controlling the negative sequence current injection into the offshore grid from the VSC-HVDC as well as WTG-FSCs. This would minimize the power oscillations and hence reduce the dc voltage overshoots in the VSC-HVDC system...... as well as in the WTG-FSCs; especially when the offshore grid is unbalanced due to asymmetric faults. The formulation for negative sequence current injection is mathematically derived and then implemented in electromagnetic transients (EMT) simulation model. The simulated results show that the negative...

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

Science.gov (United States)

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

Voltage stability in low voltage microgrids in aspects of active and reactive power demand

Directory of Open Access Journals (Sweden)

Parol Mirosław

2016-03-01

Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

Three routes forward for biofuels: Incremental, leapfrog, and transitional

International Nuclear Information System (INIS)

Morrison, Geoff M.; Witcover, Julie; Parker, Nathan C.; Fulton, Lew

2016-01-01

This paper examines three technology routes for lowering the carbon intensity of biofuels: (1) a leapfrog route that focuses on major technological breakthroughs in lignocellulosic pathways at new, stand-alone biorefineries; (2) an incremental route in which improvements are made to existing U.S. corn ethanol and soybean biodiesel biorefineries; and (3) a transitional route in which biotechnology firms gain experience growing, handling, or chemically converting lignocellulosic biomass in a lower-risk fashion than leapfrog biorefineries by leveraging existing capital stock. We find the incremental route is likely to involve the largest production volumes and greenhouse gas benefits until at least the mid-2020s, but transitional and leapfrog biofuels together have far greater long-term potential. We estimate that the Renewable Fuel Standard, California's Low Carbon Fuel Standard, and federal tax credits provided an incentive of roughly $1.5–2.5 per gallon of leapfrog biofuel between 2012 and 2015, but that regulatory elements in these policies mostly incentivize lower-risk incremental investments. Adjustments in policy may be necessary to bring a greater focus on transitional technologies that provide targeted learning and cost reduction opportunities for leapfrog biofuels. - Highlights: • Three technological pathways are compared that lower carbon intensity of biofuels. • Incremental changes lead to faster greenhouse gas reductions. • Leapfrog changes lead to greatest long-term potential. • Two main biofuel policies (RFS and LCFS) are largely incremental in nature. • Transitional biofuels offer medium-risk, medium reward pathway.

76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

Science.gov (United States)

2011-11-15

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

Erasing Bisexual Identity: The Visibility and Invisibility of Bisexuality as a Sexual Identity in the Dutch Homosexual Movement, 1946-1972.

Science.gov (United States)

van Alphen, Elise C J

2017-01-01

Scholars of bisexuality commonly agree that bisexuality as a distinct sexual identity remained invisible for epistemic reasons until the 1970s. This article examines this dominant explanation for the late invention of bisexual identity by discussing how bisexuality functioned in the homosexual movement in the Netherlands from 1946 to the early 1970s. This historical case study shows that in the Netherlands bisexuality as an identity existed in the movement in the first postwar decades and was erased in the late 1960s, not only for epistemic reasons but also for tactical ones. The article aims to contribute to a better insight into the history of bisexuality and the politics in the Dutch postwar homosexual movement.

Performance analysis of ‘Perturb and Observe’ and ‘Incremental Conductance’ MPPT algorithms for PV system

Science.gov (United States)

Lodhi, Ehtisham; Lodhi, Zeeshan; Noman Shafqat, Rana; Chen, Fieda

2017-07-01

Photovoltaic (PV) system usually employed The Maximum power point tracking (MPPT) techniques for increasing its efficiency. The performance of the PV system perhaps boosts by controlling at its apex point of power, in this way maximal power can be given to load. The proficiency of a PV system usually depends upon irradiance, temperature and array architecture. PV array shows a non-linear style for V-I curve and maximal power point on V-P curve also varies with changing environmental conditions. MPPT methods grantees that a PV module is regulated at reference voltage and to produce entire usage of the maximal output power. This paper gives analysis between two widely employed Perturb and Observe (P&O) and Incremental Conductance (INC) MPPT techniques. Their performance is evaluated and compared through theoretical analysis and digital simulation on the basis of response time and efficiency under varying irradiance and temperature condition using Matlab/Simulink.

Incrementality in naming and reading complex numerals: Evidence from eyetracking

NARCIS (Netherlands)

Korvorst, M.H.W.; Roelofs, A.P.A.; Levelt, W.J.M.

2006-01-01

Individuals speak incrementally when they interleave planning and articulation. Eyetracking, along with the measurement of speech onset latencies, can be used to gain more insight into the degree of incrementality adopted by speakers. In the current article, two eyetracking experiments are reported

Inductive voltage adder advanced hydrodynamic radiographic technology demonstration

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Maenchen; Rovang, D.C.

1997-04-01

This paper presents the design, results, and analysis of a high-brightness electron beam technology demonstration experiment completed at Sandia National Laboratories, performed in collaboration with Los Alamos National Laboratory. The anticipated electron beam parameters were: 12 MeV, 35-40 kA, 0.5-mm rms radius, and 40-ns full width half maximum (FWHM) pulse duration. This beam, on an optimum thickness tantalum converter, should produce a very intense x-ray source of ∼ 1.5-mm spot size and 1 kR dose at sign 1 m. The accelerator utilized was SABRE, a pulsed inductive voltage adder, and the electron source was a magnetically immersed foilless electron diode. For these experiments, SABRE was modified to high-impedance negative-polarity operation. A new 100-ohm magnetically insulated transmission line cathode electrode was designed and constructed; the cavities were rotated 180 degrees poloidally to invert the central electrode polarity to negative; and only one of the two pulse forming lines per cavity was energized. A twenty- to thirty-Tesla solenoidal magnet insulated the diode and contained the beam at its extremely small size. These experiments were designed to demonstrate high electron currents in submillimeter radius beams resulting in a high-brightness high-intensity flash x-ray source for high-resolution thick-object hydrodynamic radiography. The SABRE facility high-impedance performance was less than what was hoped. The modifications resulted in a lower amplitude (9 MV), narrower-than-anticipated triangular voltage pulse, which limited the dose to ∼ 20% of the expected value. In addition, halo and ion-hose instabilities increased the electron beam spot size to > 1.5 mm. Subsequent, more detailed calculations explain these reduced output parameters. An accelerator designed (versus retrofit) for this purpose would provide the desired voltage and pulse shape

Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

Science.gov (United States)

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-01

Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

Energy Technology Data Exchange (ETDEWEB)

Teyssedre, G., E-mail: gilbert.teyssedre@laplace.univ-tlse.fr; Laurent, C. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); CNRS, LAPLACE, F-31062 Toulouse (France); Vu, T. T. N. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); Electric Power University, 235 Hoang Quoc Viet, 10000 Hanoi (Viet Nam)

2015-12-21

Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

OXYGEN UPTAKE KINETICS DURING INCREMENTAL- AND DECREMENTAL-RAMP CYCLE ERGOMETRY

Directory of Open Access Journals (Sweden)

Fadıl Özyener

2011-09-01

Full Text Available The pulmonary oxygen uptake (VO2 response to incremental-ramp cycle ergometry typically demonstrates lagged-linear first-order kinetics with a slope of ~10-11 ml·min-1·W-1, both above and below the lactate threshold (ӨL, i.e. there is no discernible VO2 slow component (or "excess" VO2 above ӨL. We were interested in determining whether a reverse ramp profile would yield the same response dynamics. Ten healthy males performed a maximum incremental -ramp (15-30 W·min-1, depending on fitness. On another day, the work rate (WR was increased abruptly to the incremental maximum and then decremented at the same rate of 15-30 W.min-1 (step-decremental ramp. Five subjects also performed a sub-maximal ramp-decremental test from 90% of ӨL. VO2 was determined breath-by-breath from continuous monitoring of respired volumes (turbine and gas concentrations (mass spectrometer. The incremental-ramp VO2-WR slope was 10.3 ± 0.7 ml·min-1·W-1, whereas that of the descending limb of the decremental ramp was 14.2 ± 1.1 ml·min-1·W-1 (p < 0.005. The sub-maximal decremental-ramp slope, however, was only 9. 8 ± 0.9 ml·min-1·W-1: not significantly different from that of the incremental-ramp. This suggests that the VO2 response in the supra-ӨL domain of incremental-ramp exercise manifest not actual, but pseudo, first-order kinetics

Preliminary study on the modelling of negative leader discharges

International Nuclear Information System (INIS)

Arevalo, L; Cooray, V

2011-01-01

Nowadays, there is considerable interest in understanding the physics underlying positive and negative discharges because of the importance of improving lightning protection systems and of coordinating the insulation for high voltages. Numerical simulations of positive switching impulses made in long spark gaps in a laboratory are achievable because the physics of the process is reasonably well understood and because of the availability of powerful computational methods. However, the existing work on the simulation of negative switching discharges has been held up by a lack of experimental data and the absence of a full understanding of the physics involved. In the scientific community, it is well known that most of the lightning discharges that occur in nature are of negative polarity, and because of their complexity, the only way to understand them is to generate the discharges in laboratories under controlled conditions. The voltage impulse waveshape used in laboratories is a negative switching impulse. With the aim of applying the available information to a self-consistent physical method, an electrostatic approximation of the negative leader discharge process is presented here. The simulation procedure takes into consideration the physics of positive and negative discharges, considering that the negative leader propagates towards a grounded electrode and the positive leader towards a rod electrode. The simulation considers the leader channel to be thermodynamic, and assumes that the conditions required to generate a thermal channel are the same for positive and negative leaders. However, the magnitude of the electrical charge necessary to reproduce their propagation and thermalization is different, and both values are based on experimental data. The positive and negative streamer development is based on the constant electric field characteristics of these discharges, as found during experimental measurements made by different authors. As a computational tool

Finance for incremental housing: current status and prospects for expansion

NARCIS (Netherlands)

Ferguson, B.; Smets, P.G.S.M.

2010-01-01

Appropriate finance can greatly increase the speed and lower the cost of incremental housing - the process used by much of the low/moderate-income majority of most developing countries to acquire shelter. Informal finance continues to dominate the funding of incremental housing. However, new sources

One Step at a Time: SBM as an Incremental Process.

Science.gov (United States)

Conrad, Mark

1995-01-01

Discusses incremental SBM budgeting and answers questions regarding resource equity, bookkeeping requirements, accountability, decision-making processes, and purchasing. Approaching site-based management as an incremental process recognizes that every school system engages in some level of site-based decisions. Implementation can be gradual and…

History Matters: Incremental Ontology Reasoning Using Modules

Science.gov (United States)

Cuenca Grau, Bernardo; Halaschek-Wiener, Christian; Kazakov, Yevgeny

The development of ontologies involves continuous but relatively small modifications. Existing ontology reasoners, however, do not take advantage of the similarities between different versions of an ontology. In this paper, we propose a technique for incremental reasoning—that is, reasoning that reuses information obtained from previous versions of an ontology—based on the notion of a module. Our technique does not depend on a particular reasoning calculus and thus can be used in combination with any reasoner. We have applied our results to incremental classification of OWL DL ontologies and found significant improvement over regular classification time on a set of real-world ontologies.

Improve the open-circuit voltage of ZnO solar cells with inserting ZnS layers by two ways

International Nuclear Information System (INIS)

Sun, Yunfei; Yang, Jinghai; Yang, Lili; Cao, Jian; Gao, Ming; Zhang, Zhiqiang; Wang, Zhe; Song, Hang

2013-01-01

ZnS NPs layers were deposited on ZnO NRs by two different ways. One is spin coating; the other is successive ionic layer adsorption and reaction (SILAR) method. The ZnO NRs/ZnS NPs composites were verified by X-ray diffraction, X-ray photoelectron spectroscopy, and UV–visible spectrophotometer; their morphologies and thicknesses were examined by scanning electron microscopic and transmission electron microscopic images. The CdS quantum dot sensitized solar cells (QDSSCs) were constructed using ZnO NRs/ZnS NPs composites as photoanode and their photovoltaic characteristic was studied by J–V curves. The results indicated that the way of SILAR is more beneficial for retarding the back transfer of electrons to CdS and electrolyte than spin coating method. The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method. When ZnS NPs layer was deposited for 10 times on ZnO NRs, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. - Graphical abstract: When ZnO nanorods were deposited by ZnS for 10 times, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. Highlights: ► ZnS layers were deposited with two different ways. ► The way of SILAR is more beneficial for retarding the back transfer of electrons. ► The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method

Improve the open-circuit voltage of ZnO solar cells with inserting ZnS layers by two ways

Energy Technology Data Exchange (ETDEWEB)

Sun, Yunfei [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100049 (China); Yang, Jinghai, E-mail: jhyang1@jlnu.edu.cn [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Yang, Lili; Cao, Jian [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Gao, Ming [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100049 (China); Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Zhang, Zhiqiang; Wang, Zhe [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Song, Hang [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China)

2013-04-15

ZnS NPs layers were deposited on ZnO NRs by two different ways. One is spin coating; the other is successive ionic layer adsorption and reaction (SILAR) method. The ZnO NRs/ZnS NPs composites were verified by X-ray diffraction, X-ray photoelectron spectroscopy, and UV–visible spectrophotometer; their morphologies and thicknesses were examined by scanning electron microscopic and transmission electron microscopic images. The CdS quantum dot sensitized solar cells (QDSSCs) were constructed using ZnO NRs/ZnS NPs composites as photoanode and their photovoltaic characteristic was studied by J–V curves. The results indicated that the way of SILAR is more beneficial for retarding the back transfer of electrons to CdS and electrolyte than spin coating method. The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method. When ZnS NPs layer was deposited for 10 times on ZnO NRs, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. - Graphical abstract: When ZnO nanorods were deposited by ZnS for 10 times, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. Highlights: ► ZnS layers were deposited with two different ways. ► The way of SILAR is more beneficial for retarding the back transfer of electrons. ► The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings

Science.gov (United States)

Desrosiers, M. F.; Bandurski, R. S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Influence of current limitation on voltage stability with voltage sourced converter HVDC

DEFF Research Database (Denmark)

Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

2013-01-01

A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

76 FR 73475 - Immigration Benefits Business Transformation, Increment I; Correction

Science.gov (United States)

2011-11-29

... Benefits Business Transformation, Increment I, 76 FR 53764 (Aug. 29, 2011). The final rule removed form... [CIS No. 2481-09; Docket No. USCIS-2009-0022] RIN 1615-AB83 Immigration Benefits Business Transformation, Increment I; Correction AGENCY: U.S. Citizenship and Immigration Services, DHS. ACTION: Final...

Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

Science.gov (United States)

Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

1993-06-01

Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

Molecular mechanism of voltage sensing in voltage-gated proton channels

Science.gov (United States)

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Short-term load forecasting with increment regression tree

Energy Technology Data Exchange (ETDEWEB)

Yang, Jingfei; Stenzel, Juergen [Darmstadt University of Techonology, Darmstadt 64283 (Germany)

2006-06-15

This paper presents a new regression tree method for short-term load forecasting. Both increment and non-increment tree are built according to the historical data to provide the data space partition and input variable selection. Support vector machine is employed to the samples of regression tree nodes for further fine regression. Results of different tree nodes are integrated through weighted average method to obtain the comprehensive forecasting result. The effectiveness of the proposed method is demonstrated through its application to an actual system. (author)

Observation of ion-acoustic rarefaction solitons in a multicomponent plasma with negative ions

International Nuclear Information System (INIS)

Ludwig, G.O.; Ferreira, J.L.; Nakamura, Y.

1984-01-01

The propagation of ion-acoustic solitons in a plasma with negative ions has been observed. For sufficiently large concentration of negative ions, applied rarefactive (negative) voltage pulses break up into solitons, whereas compressive pulses evolve into wave trains, with exactly the opposite behavior as that for a plasma composed only of positive ions. There is a critical value of the negative-ion concentration for which a finite-amplitude pulse propagates without steepening

Electrooptic Methods for Measurement of Small DC Currents at High Voltage Level

DEFF Research Database (Denmark)

Tønnesen, Ole; Beatty, Neville; Skilbreid, Asbjørn Ottar

1989-01-01

collectors are connected via resistors RA and RB to the protective side of the voltage to be measured and the emitters to the negative side. The currents flowing in to the bases of the transistors are independently controlled by the light levels following on the two photodiodes PDA, PDB....

Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

International Nuclear Information System (INIS)

Frick, G.; Osswald, F.; Heusch, B.

1996-01-01

Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

Separating positive and negative magnetoresistance in organic semiconductor devices

NARCIS (Netherlands)

Bloom, F.L.; Wagemans, W.; Kemerink, M.; Koopmans, B.

2007-01-01

We study the transition between positive and negative organic magnetoresistance (OMAR) in tris-(8 hydroxyquinoline) aluminium (Alq3), in order to identify the elementary mechanisms governing this phenomenon. We show how the sign of OMAR changes as function of the applied voltage and temperature. The

Asymmetric voltage behavior of the tunnel magnetoresistance in double barrier magnetic tunnel junctions

KAUST Repository

Useinov, Arthur

2012-06-01

In this paper, we study the value of the tunnel magnetoresistance (TMR) as a function of the applied voltage in double barrier magnetic tunnel junctions (DMTJs) with the left and right ferromagnetic (FM) layers being pinned and numerically estimate the possible difference of the TMR curves for negative and positive voltages in the homojunctions (equal barriers and electrodes). DMTJs are modeled as two single barrier junctions connected in series with consecutive tunneling (CST). We investigated the asymmetric voltage behavior of the TMR for the CST in the range of a general theoretical model. Significant asymmetries of the experimental curves, which arise due to different annealing regimes, are mostly explained by different heights of the tunnel barriers and asymmetries of spin polarizations in magnetic layers. © (2012) Trans Tech Publications.

Asymmetric voltage behavior of the tunnel magnetoresistance in double barrier magnetic tunnel junctions

KAUST Repository

Useinov, Arthur; Gooneratne, Chinthaka Pasan; Kosel, Jü rgen

2012-01-01

In this paper, we study the value of the tunnel magnetoresistance (TMR) as a function of the applied voltage in double barrier magnetic tunnel junctions (DMTJs) with the left and right ferromagnetic (FM) layers being pinned and numerically estimate the possible difference of the TMR curves for negative and positive voltages in the homojunctions (equal barriers and electrodes). DMTJs are modeled as two single barrier junctions connected in series with consecutive tunneling (CST). We investigated the asymmetric voltage behavior of the TMR for the CST in the range of a general theoretical model. Significant asymmetries of the experimental curves, which arise due to different annealing regimes, are mostly explained by different heights of the tunnel barriers and asymmetries of spin polarizations in magnetic layers. © (2012) Trans Tech Publications.

The Time Course of Incremental Word Processing during Chinese Reading

Science.gov (United States)

Zhou, Junyi; Ma, Guojie; Li, Xingshan; Taft, Marcus

2018-01-01

In the current study, we report two eye movement experiments investigating how Chinese readers process incremental words during reading. These are words where some of the component characters constitute another word (an embedded word). In two experiments, eye movements were monitored while the participants read sentences with incremental words…

Technological Aspects: High Voltage

CERN Document Server

Faircloth, D.C.

2013-12-16

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

DEFF Research Database (Denmark)

Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

2017-01-01

This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

DEFF Research Database (Denmark)

Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

2004-01-01

power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

Giant magnetoelectric effect in negative magnetostrictive/piezoelectric/positive magnetostrictive semiring structure

Science.gov (United States)

Zeng, Lingyu; Zhou, Minhong; Bi, Ke; Lei, Ming

2016-01-01

Magnetoelectric (ME) Ni/PZT/TbFe2 and TbFe2/PZT composites with two semiring structures are prepared. The dependence between ME coupling and magnetostrictive property of the composite is discussed. Because Ni possesses negative magnetostrictive property and TbFe2 shows positive magnetostrictive property, the ME voltage coefficient of Ni/PZT/TbFe2 semiring structure is much larger than that of TbFe2/PZT. In these composites, the ME voltage coefficient increases and the resonance frequency gradually decreases with the increase of the semiring radius, showing that structural parameters are key factors to the composite properties. Due to the strong ME coupling effect, a giant ME voltage coefficient αE = 44.8 V cm-1 Oe-1 is obtained. This approach opens a way for the design of ME composites with giant ME voltage coefficient.

Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

Science.gov (United States)

Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

2011-05-06

Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

Efficient Incremental Checkpointing of Java Programs

DEFF Research Database (Denmark)

Lawall, Julia Laetitia; Muller, Gilles

2000-01-01

This paper investigates the optimization of language-level checkpointing of Java programs. First, we describe how to systematically associate incremental checkpoints with Java classes. While being safe, the genericness of this solution induces substantial execution overhead. Second, to solve...

Bias voltage effect on electron tunneling across a junction with a ferroelectric–ferromagnetic two-phase composite barrier

International Nuclear Information System (INIS)

Wang Jian; Ju Sheng; Li, Z.Y.

2012-01-01

The effect of bias voltage on electron tunneling across a junction with a ferroelectric–ferromagnetic composite barrier is investigated theoretically. Because of the inversion symmetry breaking of the spontaneous ferroelectric polarization, bias voltage dependence of the electron tunneling shows significant differences between the positive bias and the negative one. The differences of spin filtering or tunnel magnetoresistance increase with the increasing absolute value of bias voltage. Such direction preferred electron tunneling is found intimately related with the unusual asymmetry of the electrical potential profile in two-phase composite barrier and provides a unique change to realize rectifying functions in spintronics. - Highlights: ► Electron tunneling across a ferroelectric–ferromagnetic composite barrier junction. ► TMR effect is different under the same value but opposite direction bias voltage. ► This directionality of the electron tunneling enhances with increasing bias voltage.

Single-point incremental forming and formability-failure diagrams

DEFF Research Database (Denmark)

Silva, M.B.; Skjødt, Martin; Atkins, A.G.

2008-01-01

In a recent work [1], the authors constructed a closed-form analytical model that is capable of dealing with the fundamentals of single point incremental forming and explaining the experimental and numerical results published in the literature over the past couple of years. The model is based...... of deformation that are commonly found in general single point incremental forming processes; and (ii) to investigate the formability limits of SPIF in terms of ductile damage mechanics and the question of whether necking does, or does not, precede fracture. Experimentation by the authors together with data...

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Science.gov (United States)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Technological Aspects: High Voltage

International Nuclear Information System (INIS)

Faircloth, D C

2013-01-01

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

Impact of Negative Sequence Current Injection by Wind Power Plants

DEFF Research Database (Denmark)

Chaudhary, Sanjay; Göksu, Ömer; Teodorescu, Remus

2013-01-01

This paper presents an analysis of the impact from negative sequence current injection by wind power plants in power systems under steady-state and short-term unbalanced conditions, including faults. The separate positive and negative sequence current control capability of the grid-side converters...... of full scale converter type wind turbines may be utilized to alter voltage imbalance at the point of connection and further into the grid, in turn changing the resultant negative sequence current flow in the grid. The effects of such control actions have been analyzed and discussed through theoretical...

Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

DEFF Research Database (Denmark)

Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

2014-01-01

The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

Automatic voltage imbalance detector

Science.gov (United States)

Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

1984-01-01

A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Directory of Open Access Journals (Sweden)

Alicia Lundby

2008-06-01

Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Complex Incremental Product Innovation in Established Service Firms: A Micro Institutional Perspective

OpenAIRE

Vermeulen, Patrick; Bosch, Frans; Volberda, Henk

2007-01-01

textabstractMany product innovation studies have described key determinants that should lead to successful incremental product innovation. Despite numerous studies suggesting how incremental product innovation should be successfully undertaken, many firms still struggle with this type of innovation. In this paper, we use an institutional perspective to investigate why established firms in the financial services industry struggle with their complex incremental product innovation efforts. We ar...

Incremental binding free energies of aluminum (III) vs. magnesium (II) complexes

International Nuclear Information System (INIS)

Mercero, Jose M.; Mujika, Jon I.; Matxain, Jon M.; Lopez, Xabier; Ugalde, Jesus M.

2003-01-01

A sequential ligand addition to the aluminum (III) cation has been studied using the B3LYP functional and a combined all-electron/pseudopotentials basis set. The aluminum complexes are compared with analogous magnesium (II) complexes. Different thermodynamical data, such as incremental binding energies, enthalpies, entropies and free energies, are presented for these addition reactions. While the magnesium (II) cation can only accommodate three negatively charged ligands, aluminum (III) accommodates four even after including bulk solvent effects. The main differences between both cations complexing with the neutral ligands, is that aluminum (III) is not able to form complexes with methanol until the number of methanol ligands is equal to 3. Magnesium (II) prefers to bind methanol and formamide when the number of ligands is small, while aluminum prefers formamide. For the largest complexes both cations prefer to bind water

Incremental Innovation and Competitive Pressure in the Presence of Discrete Innovation

DEFF Research Database (Denmark)

Ghosh, Arghya; Kato, Takao; Morita, Hodaka

2017-01-01

Technical progress consists of improvements made upon the existing technology (incremental innovation) and innovative activities aiming at entirely new technology (discrete innovation). Incremental innovation is often of limited relevance to the new technology invented by successful discrete...

Breast size increment during pregnancy and breastfeeding in mothers with polycystic ovary syndrome: a follow-up study of a randomised controlled trial on metformin versus placebo.

Science.gov (United States)

Vanky, E; Nordskar, J J; Leithe, H; Hjorth-Hansen, A K; Martinussen, M; Carlsen, S M

2012-10-01

To study the significance of breast size increment in pregnancy, and the impact of metformin during pregnancy on breastfeeding in women with polycystic ovary syndrome (PCOS). A follow-up study of a randomised controlled trial (the PregMet study). Eleven secondary care centres. Women with PCOS during pregnancy and postpartum. Women with PCOS were randomised to treatment with metformin or placebo from the first trimester to delivery. Questionnaires were sent to 240 participants 1 year postpartum: 186 responded. Pre-pregnancy and late-pregnancy brassiere size and breastfeeding patterns were registered, and androgen levels were measured in the mothers. No difference in breast size increment and breastfeeding were found between the placebo and metformin groups. Breast size increment correlated positively with the duration of both exclusive and partial breastfeeding, whereas body mass index (BMI) correlated negatively with the duration of partial breastfeeding. Dehydroepiandrostenedione-sulphate (DHEAS), testosterone and free testosterone index (FTI) in pregnancy did not correlate with breast size increment or duration of breastfeeding. Women with no change in breast size were more obese, had higher blood pressure, serum triglycerides and fasting insulin levels, and had a shorter duration of breastfeeding compared with those with breast size increment. Metformin and androgens had no impact on breastfeeding. Women with PCOS who had no breast size increment in pregnancy seem to be more metabolically disturbed and less able to breastfeed. © 2012 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2012 RCOG.

Calculation of the increment reduction in spruce stands by charcoal smoke

Energy Technology Data Exchange (ETDEWEB)

Guede, J

1954-01-01

Chronic damage to spruce trees by charcoal smoke, often hardly noticeable from outward appearance but causing marked reductions of wood increment can be determined by means of a calculation by increment cores. Sulfurous acid anhydride causes the closure of the stomates of needles by which the circulation of water is checked. The assimilation and the wood increment are reduced. The cores are taken from uninjured trees belonging to the dominant class. These trees are liable to irregular variations in the trend of growth only by atmospheric influences and disturbances in the circulation of water. The decrease of increment of a stand can be judged by the trend of growth of the basal area of sample trees. Two methods are applied: in the first method, the difference between the mean total increment before the damage has been caused and that after it is calculated by the yield table in deriving the site quality classes from the basal area growth of dominant stems. This is possible by using the mean diameter of each age class and the frequency curve of basal area for each site class. In the other method, the reduction of basal area increment of sample trees is measured directly. The total reduction of a stand can be judged by the share of the dominant class of stem in the total current growth of the basal area of a sound stand and by the percent of reduction of the sample trees.

DC-link voltage oscillations reduction during unbalanced grid faults for high power wind turbines

DEFF Research Database (Denmark)

Delpino, Hernan Anres Miranda; Teodorescu, Remus; Rodriguez, Pedro

2011-01-01

During unbalanced grid voltage faults the Power injected to the grid experiences 100Hz oscillations as a result of interactions between positive and negative sequence components of three-phase voltages and currents. These oscillations can become as high as %50 percent of the rated power....... In this article an improved controller is proposed which present different behavior during normal operation and faults to keep track of non-sinusoidal current reference signals. The reference signals are calculated to obtain zero power oscillations. Reconfigurable resonant controllers are used for this purpose...

Correlation of dynamic parameter modification and ASET sensitivity in a shunt voltage reference

International Nuclear Information System (INIS)

Roche, N.J.H.; Buchner, S.P.; Warner, J.H.; McMorrow, D.; Dusseau, L.; Boch, J.; Saigne, F.; Kruckmeyer, K.; Auriel, G.; Azais, B.

2012-01-01

Analog Single Event Transients (ASETs) in two different shunt voltage references used in power management systems are investigated. Little has been published regarding how the dynamic parameter changes induced by external circuit design, such as time constant, damping coefficient or natural frequency affect ASET shapes. Modifications of the dynamic parameters of the circuit are measured by step response measurement. A correlation between dynamic parameters and ASET laser testing results is proposed. This study establishes the correlation between the dynamic parameters of a shunt voltage reference and ASET parameters such as pulse duration, and positive and negative amplitude. (authors)

Do otolith increments allow correct inferences about age and growth of coral reef fishes?

Science.gov (United States)

Booth, D. J.

2014-03-01

Otolith increment structure is widely used to estimate age and growth of marine fishes. Here, I test the accuracy of the long-term otolith increment analysis of the lemon damselfish Pomacentrus moluccensis to describe age and growth characteristics. I compare the number of putative annual otolith increments (as a proxy for actual age) and widths of these increments (as proxies for somatic growth) with actual tagged fish-length data, based on a 6-year dataset, the longest time course for a coral reef fish. Estimated age from otoliths corresponded closely with actual age in all cases, confirming annual increment formation. However, otolith increment widths were poor proxies for actual growth in length [linear regression r 2 = 0.44-0.90, n = 6 fish] and were clearly of limited value in estimating annual growth. Up to 60 % of the annual growth variation was missed using otolith increments, suggesting the long-term back calculations of otolith growth characteristics of reef fish populations should be interpreted with caution.

The Dark Side of Malleability: Incremental Theory Promotes Immoral Behaviors.

Science.gov (United States)

Huang, Niwen; Zuo, Shijiang; Wang, Fang; Cai, Pan; Wang, Fengxiang

2017-01-01

Implicit theories drastically affect an individual's processing of social information, decision making, and action. The present research focuses on whether individuals who hold the implicit belief that people's moral character is fixed (entity theorists) and individuals who hold the implicit belief that people's moral character is malleable (incremental theorists) make different choices when facing a moral decision. Incremental theorists are less likely to make the fundamental attribution error (FAE), rarely make moral judgment based on traits and show more tolerance to immorality, relative to entity theorists, which might decrease the possibility of undermining the self-image when they engage in immoral behaviors, and thus we posit that incremental beliefs facilitate immorality. Four studies were conducted to explore the effect of these two types of implicit theories on immoral intention or practice. The association between implicit theories and immoral behavior was preliminarily examined from the observer perspective in Study 1, and the results showed that people tended to associate immoral behaviors (including everyday immoral intention and environmental destruction) with an incremental theorist rather than an entity theorist. Then, the relationship was further replicated from the actor perspective in Studies 2-4. In Study 2, implicit theories, which were measured, positively predicted the degree of discrimination against carriers of the hepatitis B virus. In Study 3, implicit theories were primed through reading articles, and the participants in the incremental condition showed more cheating than those in the entity condition. In Study 4, implicit theories were primed through a new manipulation, and the participants in the unstable condition (primed incremental theory) showed more discrimination than those in the other three conditions. Taken together, the results of our four studies were consistent with our hypotheses.

The Dark Side of Malleability: Incremental Theory Promotes Immoral Behaviors

Directory of Open Access Journals (Sweden)

Niwen Huang

2017-08-01

Full Text Available Implicit theories drastically affect an individual’s processing of social information, decision making, and action. The present research focuses on whether individuals who hold the implicit belief that people’s moral character is fixed (entity theorists and individuals who hold the implicit belief that people’s moral character is malleable (incremental theorists make different choices when facing a moral decision. Incremental theorists are less likely to make the fundamental attribution error (FAE, rarely make moral judgment based on traits and show more tolerance to immorality, relative to entity theorists, which might decrease the possibility of undermining the self-image when they engage in immoral behaviors, and thus we posit that incremental beliefs facilitate immorality. Four studies were conducted to explore the effect of these two types of implicit theories on immoral intention or practice. The association between implicit theories and immoral behavior was preliminarily examined from the observer perspective in Study 1, and the results showed that people tended to associate immoral behaviors (including everyday immoral intention and environmental destruction with an incremental theorist rather than an entity theorist. Then, the relationship was further replicated from the actor perspective in Studies 2–4. In Study 2, implicit theories, which were measured, positively predicted the degree of discrimination against carriers of the hepatitis B virus. In Study 3, implicit theories were primed through reading articles, and the participants in the incremental condition showed more cheating than those in the entity condition. In Study 4, implicit theories were primed through a new manipulation, and the participants in the unstable condition (primed incremental theory showed more discrimination than those in the other three conditions. Taken together, the results of our four studies were consistent with our hypotheses.

Charge Gain, Voltage Gain, and Node Capacitance of the SAPHIRA Detector Pixel by Pixel

Science.gov (United States)

Pastrana, Izabella M.; Hall, Donald N. B.; Baker, Ian M.; Jacobson, Shane M.; Goebel, Sean B.

2018-01-01

The University of Hawai`i Institute for Astronomy has partnered with Leonardo (formerly Selex) in the development of HgCdTe linear mode avalanche photodiode (L-APD) SAPHIRA detectors. The SAPHIRA (Selex Avalanche Photodiode High-speed Infra-Red Array) is ideally suited for photon-starved astronomical observations, particularly near infrared (NIR) adaptive optics (AO) wave-front sensing. I have measured the stability, and linearity with current, of a 1.7-um (10% spectral bandpass) infrared light emitting diode (IR LED) used to illuminate the SAPHIRA and have then utilized this source to determine the charge gain (in e-/ADU), voltage gain (in uV/ADU), and node capacitance (in fF) for each pixel of the 320x256@24um SAPHIRA. These have previously only been averages over some sub-array. Determined from the ratio of the temporal averaged signal level to variance under constant 1.7-um LED illumination, I present the charge gain pixel-by-pixel in a 64x64 sub-array at the center of the active area of the SAPHIRA (analyzed separately as four 32x32 sub-arrays) to be about 1.6 e-/ADU (σ=0.5 e-/ADU). Additionally, the standard technique of varying the pixel reset voltage (PRV) in 10 mV increments and recording output frames for the same 64x64 subarray found the voltage gain per pixel to be about 11.7 uV/ADU (σ=0.2 uV/ADU). Finally, node capacitance was found to be approximately 23 fF (σ=6 fF) utilizing the aforementioned charge and voltage gain measurements. I further discuss the linearity measurements of the 1.7-um LED used in the charge gain characterization procedure.

Electrocardiogram voltage discordance: Interpretation of low QRS voltage only in the precordial leads.

Science.gov (United States)

Kim, Diana H; Verdino, Ralph J

To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.

Dental caries increments and related factors in children with type 1 diabetes mellitus.

Science.gov (United States)

Siudikiene, J; Machiulskiene, V; Nyvad, B; Tenovuo, J; Nedzelskiene, I

2008-01-01

The aim of this study was to analyse possible associations between caries increments and selected caries determinants in children with type 1 diabetes mellitus and their age- and sex-matched non-diabetic controls, over 2 years. A total of 63 (10-15 years old) diabetic and non-diabetic pairs were examined for dental caries, oral hygiene and salivary factors. Salivary flow rates, buffer effect, concentrations of mutans streptococci, lactobacilli, yeasts, total IgA and IgG, protein, albumin, amylase and glucose were analysed. Means of 2-year decayed/missing/filled surface (DMFS) increments were similar in diabetics and their controls. Over the study period, both unstimulated and stimulated salivary flow rates remained significantly lower in diabetic children compared to controls. No differences were observed in the counts of lactobacilli, mutans streptococci or yeast growth during follow-up, whereas salivary IgA, protein and glucose concentrations were higher in diabetics than in controls throughout the 2-year period. Multivariable linear regression analysis showed that children with higher 2-year DMFS increments were older at baseline and had higher salivary glucose concentrations than children with lower 2-year DMFS increments. Likewise, higher 2-year DMFS increments in diabetics versus controls were associated with greater increments in salivary glucose concentrations in diabetics. Higher increments in active caries lesions in diabetics versus controls were associated with greater increments of dental plaque and greater increments of salivary albumin. Our results suggest that, in addition to dental plaque as a common caries risk factor, diabetes-induced changes in salivary glucose and albumin concentrations are indicative of caries development among diabetics. Copyright 2008 S. Karger AG, Basel.

Temporal and voltage stress stability of high performance indium-zinc-oxide thin film transistors

Science.gov (United States)

Song, Yang; Katsman, Alexander; Butcher, Amy L.; Paine, David C.; Zaslavsky, Alexander

2017-10-01

Thin film transistors (TFTs) based on transparent oxide semiconductors, such as indium zinc oxide (IZO), are of interest due to their improved characteristics compared to traditional a-Si TFTs. Previously, we reported on top-gated IZO TFTs with an in-situ formed HfO2 gate insulator and IZO active channel, showing high performance: on/off ratio of ∼107, threshold voltage VT near zero, extracted low-field mobility μ0 = 95 cm2/V·s, and near-perfect subthreshold slope at 62 mV/decade. Since device stability is essential for technological applications, in this paper we report on the temporal and voltage stress stability of IZO TFTs. Our devices exhibit a small negative VT shift as they age, consistent with an increasing carrier density resulting from an increasing oxygen vacancy concentration in the channel. Under gate bias stress, freshly annealed TFTs show a negative VT shift during negative VG gate bias stress, while aged (>1 week) TFTs show a positive VT shift during negative VG stress. This indicates two competing mechanisms, which we identify as the field-enhanced generation of oxygen vacancies and the field-assisted migration of oxygen vacancies, respectively. A simplified kinetic model of the vacancy concentration evolution in the IZO channel under electrical stress is provided.

Production of hydrogen and deuterium negative ions in an electron cyclotron resonance driven plasma

Energy Technology Data Exchange (ETDEWEB)

Dougar-Jabon, V.D. [Industrial Univ. of Santander, Bucaramanga (Colombia)

2001-04-01

An electron cyclotron resonance source with driven plasma rings for hydrogen isotope ion production is studied. Extracted currents of positive and negative ions depending on gas pressure, microwave power value and extraction voltage are obtained. The study shows that the negative ion yield is an order of magnitude higher than the yield of positive particles when a driven ring is in contact with the surface of the plasma electrode. The production of negative ions of deuterium, D{sup -}, is close to the production of negative ions of light hydrogen isotope, H{sup -}. The comparison of the experimental data with the calculated ones shows that the most probable process of the H{sup -} and D{sup -} ion formation in the electron cyclotron driven plasma is dissociative attachment of electrons to molecules in high Rydberg states. For hydrogen ions and ions of deuterium, the negative current at a microwave power of 200 W through a 3-mm aperture and 8 kV extraction voltage are 4.7 mA and 3.1 mA respectively. (orig.)

Production of hydrogen and deuterium negative ions in an electron cyclotron resonance driven plasma

International Nuclear Information System (INIS)

Dougar-Jabon, V.D.

2001-01-01

An electron cyclotron resonance source with driven plasma rings for hydrogen isotope ion production is studied. Extracted currents of positive and negative ions depending on gas pressure, microwave power value and extraction voltage are obtained. The study shows that the negative ion yield is an order of magnitude higher than the yield of positive particles when a driven ring is in contact with the surface of the plasma electrode. The production of negative ions of deuterium, D - , is close to the production of negative ions of light hydrogen isotope, H - . The comparison of the experimental data with the calculated ones shows that the most probable process of the H - and D - ion formation in the electron cyclotron driven plasma is dissociative attachment of electrons to molecules in high Rydberg states. For hydrogen ions and ions of deuterium, the negative current at a microwave power of 200 W through a 3-mm aperture and 8 kV extraction voltage are 4.7 mA and 3.1 mA respectively. (orig.)

The effect of external visible light on the breakdown voltage of a long discharge tube

Science.gov (United States)

Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

2016-06-01

The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

Large negative differential resistance in graphene nanoribbon superlattices

Science.gov (United States)

Tseng, P.; Chen, C. H.; Hsu, S. A.; Hsueh, W. J.

2018-05-01

A graphene nanoribbon superlattice with a large negative differential resistance (NDR) is proposed. Our results show that the peak-to-valley ratio (PVR) of the graphene superlattices can reach 21 at room temperature with bias voltages between 90-220 mV, which is quite large compared with the one of traditional graphene-based devices. It is found that the NDR is strongly influenced by the thicknesses of the potential barrier. Therefore, the NDR effect can be optimized by designing a proper barrier thickness. The large NDR effect can be attributed to the splitting of the gap in transmission spectrum (segment of Wannier-Stark ladder) with larger thicknesses of barrier when the applied voltage increases.

Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control

DEFF Research Database (Denmark)

Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal

2014-01-01

This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...

Testing the relations between impulsivity-related traits, suicidality, and nonsuicidal self-injury: a test of the incremental validity of the UPPS model.

Science.gov (United States)

Lynam, Donald R; Miller, Joshua D; Miller, Drew J; Bornovalova, Marina A; Lejuez, C W

2011-04-01

Borderline personality disorder (BPD) has received significant attention as a predictor of suicidal behavior (SB) and nonsuicidal self-injury (NSSI). Despite significant promise, trait impulsivity has received less attention. Understanding the relations between impulsivity and SB and NSSI is confounded, unfortunately, by the heterogeneous nature of impulsivity. This study examined the relations among 4 personality pathways to impulsive behavior studied via the UPPS model of impulsivity and SB and NSSI in a residential sample of drug abusers (N = 76). In this study, we tested whether these 4 impulsivity-related traits (i.e., Negative Urgency, Sensation Seeking, Lack of Premeditation, and Lack of Perseverance) provide incremental validity in the statistical prediction of SB and NSSI above and beyond BPD; they do. We also tested whether BPD symptoms provide incremental validity in the prediction of SB and NSSI above and beyond these impulsivity-related traits; they do not. In addition to the main effects of Lack of Premeditation and Negative Urgency, we found evidence of a robust interaction between these 2 personality traits. The current results argue strongly for the consideration of these 2 impulsivity-related domains--alone and in interaction--when attempting to understand and predict SB and NSSI.

DC-link Voltage Control to Compensate Voltage Deviation for PV–BESSs Integrated System in Low-Voltage (LV Networks

Directory of Open Access Journals (Sweden)

Lee Gyu-sub

2016-01-01

Full Text Available The exhaustion of fossil fuel and the greenhouse gas emission are one of the most significant energy and environmental issues, respectively. Photovoltaic (PV generators and battery energy storage systems (BESSs have been significantly increased for recent years. The BESSs are mainly used for smoothing active power fluctuation of the PV. In this paper, PV–BESSs integration of two DC/DC converters and one AC/DC converter is investigated and DC-link voltage control to compensate the AC voltage deviation is proposed for the PV‒BESS system in low-voltage (LV networks.

Enabling Incremental Query Re-Optimization.

Science.gov (United States)

Liu, Mengmeng; Ives, Zachary G; Loo, Boon Thau

2016-01-01

As declarative query processing techniques expand to the Web, data streams, network routers, and cloud platforms, there is an increasing need to re-plan execution in the presence of unanticipated performance changes. New runtime information may affect which query plan we prefer to run. Adaptive techniques require innovation both in terms of the algorithms used to estimate costs , and in terms of the search algorithm that finds the best plan. We investigate how to build a cost-based optimizer that recomputes the optimal plan incrementally given new cost information, much as a stream engine constantly updates its outputs given new data. Our implementation especially shows benefits for stream processing workloads. It lays the foundations upon which a variety of novel adaptive optimization algorithms can be built. We start by leveraging the recently proposed approach of formulating query plan enumeration as a set of recursive datalog queries ; we develop a variety of novel optimization approaches to ensure effective pruning in both static and incremental cases. We further show that the lessons learned in the declarative implementation can be equally applied to more traditional optimizer implementations.

Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

International Nuclear Information System (INIS)

Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

2016-01-01

We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

High voltage test techniques

CERN Document Server

Kind, Dieter

2001-01-01

The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

Pulse-voltage fast generator

International Nuclear Information System (INIS)

Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

1988-01-01

The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

Low-voltage gyrotrons

International Nuclear Information System (INIS)

Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

2013-01-01

For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

Directory of Open Access Journals (Sweden)

M. R. Aghamohammadi

2011-06-01

Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

Directory of Open Access Journals (Sweden)

Dung Vo Tien

2018-01-01

Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

A uniform laminar air plasma plume with large volume excited by an alternating current voltage

Science.gov (United States)

Li, Xuechen; Bao, Wenting; Chu, Jingdi; Zhang, Panpan; Jia, Pengying

2015-12-01

Using a plasma jet composed of two needle electrodes, a laminar plasma plume with large volume is generated in air through an alternating current voltage excitation. Based on high-speed photography, a train of filaments is observed to propagate periodically away from their birth place along the gas flow. The laminar plume is in fact a temporal superposition of the arched filament train. The filament consists of a negative glow near the real time cathode, a positive column near the real time anode, and a Faraday dark space between them. It has been found that the propagation velocity of the filament increases with increasing the gas flow rate. Furthermore, the filament lifetime tends to follow a normal distribution (Gaussian distribution). The most probable lifetime decreases with increasing the gas flow rate or decreasing the averaged peak voltage. Results also indicate that the real time peak current decreases and the real time peak voltage increases with the propagation of the filament along the gas flow. The voltage-current curve indicates that, in every discharge cycle, the filament evolves from a Townsend discharge to a glow one and then the discharge quenches. Characteristic regions including a negative glow, a Faraday dark space, and a positive column can be discerned from the discharge filament. Furthermore, the plasma parameters such as the electron density, the vibrational temperature and the gas temperature are investigated based on the optical spectrum emitted from the laminar plume.

Improved Control Strategies for a DFIG-Based Wind-Power Generation System with SGSC under Unbalanced and Distorted Grid Voltage Conditions

DEFF Research Database (Denmark)

Yao, Jun; Yu, Mengting; Hu, Weihao

2016-01-01

This paper investigates an improved control strategy for a doubly-fed induction generator (DFIG) based wind-power generation system with series grid-side converter (SGSC) under network unbalance and harmonic grid voltage distortion conditions. The integrated mathematical modeling of the DFIG system...... with SGSC is established by taking both the negative-sequence and harmonic components of the grid voltages into consideration with multiple synchronous rotating reference frames. Under network unbalance and harmonic distortion situations, stator voltage can be kept symmetrical and sinusoidal by the control...

VENTILATION BEHAVIOR IN TRAINED AND UNTRAINED MEN DURING INCREMENTAL TEST: EVIDENCE OF ONE METABOLIC TRANSITION POINT

Directory of Open Access Journals (Sweden)

Flávio O. Pires

2008-09-01

Full Text Available This study aimed to describe and compare the ventilation behavior during an incremental test utilizing three mathematical models and to compare the feature of ventilation curve fitted by the best mathematical model between aerobically trained (TR and untrained (UT men. Thirty five subjects underwent a treadmill test with 1 km·h-1 increases every minute until exhaustion. Ventilation averages of 20 seconds were plotted against time and fitted by: bi-segmental regression model (2SRM; three-segmental regression model (3SRM; and growth exponential model (GEM. Residual sum of squares (RSS and mean square error (MSE were calculated for each model. The correlations between peak VO2 (VO2PEAK, peak speed (SpeedPEAK, ventilatory threshold identified by the best model (VT2SRM and the first derivative calculated for workloads below (moderate intensity and above (heavy intensity VT2SRM were calculated. The RSS and MSE for GEM were significantly higher (p < 0.01 than for 2SRM and 3SRM in pooled data and in UT, but no significant difference was observed among the mathematical models in TR. In the pooled data, the first derivative of moderate intensities showed significant negative correlations with VT2SRM (r = -0.58; p < 0.01 and SpeedPEAK (r = -0.46; p < 0.05 while the first derivative of heavy intensities showed significant negative correlation with VT2SRM (r = -0. 43; p < 0.05. In UT group the first derivative of moderate intensities showed significant negative correlations with VT2SRM (r = -0.65; p < 0.05 and SpeedPEAK (r = -0.61; p < 0.05, while the first derivative of heavy intensities showed significant negative correlation with VT2SRM (r= -0.73; p< 0.01, SpeedPEAK (r = -0.73; p < 0.01 and VO2PEAK (r = -0.61; p < 0.05 in TR group. The ventilation behavior during incremental treadmill test tends to show only one threshold. UT subjects showed a slower ventilation increase during moderate intensities while TR subjects showed a slower ventilation increase

Improvements of the versatile multiaperture negative ion source NIO1

Science.gov (United States)

Cavenago, M.; Serianni, G.; De Muri, M.; Veltri, P.; Antoni, V.; Baltador, C.; Barbisan, M.; Brombin, M.; Galatá, A.; Ippolito, N.; Kulevoy, T.; Pasqualotto, R.; Petrenko, S.; Pimazzoni, A.; Recchia, M.; Sartori, E.; Taccogna, F.; Variale, V.; Zaniol, B.; Barbato, P.; Baseggio, L.; Cervaro, V.; Fasolo, D.; Franchin, L.; Ghiraldelli, R.; Laterza, B.; Maniero, M.; Martini, D.; Migliorato, L.; Minarello, A.; Molon, F.; Moro, G.; Patton, T.; Ravarotto, D.; Rizzieri, R.; Rizzolo, A.; Sattin, M.; Stivanello, F.; Zucchetti, S.

2017-08-01

The ion source NIO1 (Negative Ion Optimization 1) was developed and installed as a reduced-size model of multi-aperture sources used in neutral beam injectors. NIO1 beam optics is optimized for a 135 mA H- current (subdivided in 9 beamlets) at a Vs = 60 kV extraction voltage, with an electron-to-ion current ratio Rj up to 2. Depending on gas pressure used, NIO1 was up to now operated with Vs qualitative agreement with theoretical and numerical models. A second bias voltage was tested for hydrogen. Beam footprints and a spectral emission sample are shown.

Context-dependent incremental timing cells in the primate hippocampus.

Science.gov (United States)

Sakon, John J; Naya, Yuji; Wirth, Sylvia; Suzuki, Wendy A

2014-12-23

We examined timing-related signals in primate hippocampal cells as animals performed an object-place (OP) associative learning task. We found hippocampal cells with firing rates that incrementally increased or decreased across the memory delay interval of the task, which we refer to as incremental timing cells (ITCs). Three distinct categories of ITCs were identified. Agnostic ITCs did not distinguish between different trial types. The remaining two categories of cells signaled time and trial context together: One category of cells tracked time depending on the behavioral action required for a correct response (i.e., early vs. late release), whereas the other category of cells tracked time only for those trials cued with a specific OP combination. The context-sensitive ITCs were observed more often during sessions where behavioral learning was observed and exhibited reduced incremental firing on incorrect trials. Thus, single primate hippocampal cells signal information about trial timing, which can be linked with trial type/context in a learning-dependent manner.

Statistics of wind direction and its increments

International Nuclear Information System (INIS)

Doorn, Eric van; Dhruva, Brindesh; Sreenivasan, Katepalli R.; Cassella, Victor

2000-01-01

We study some elementary statistics of wind direction fluctuations in the atmosphere for a wide range of time scales (10 -4 sec to 1 h), and in both vertical and horizontal planes. In the plane parallel to the ground surface, the direction time series consists of two parts: a constant drift due to large weather systems moving with the mean wind speed, and fluctuations about this drift. The statistics of the direction fluctuations show a rough similarity to Brownian motion but depend, in detail, on the wind speed. This dependence manifests itself quite clearly in the statistics of wind-direction increments over various intervals of time. These increments are intermittent during periods of low wind speeds but Gaussian-like during periods of high wind speeds. (c) 2000 American Institute of Physics

Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching

Science.gov (United States)

Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest

2017-09-01

A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k  =  2) at 1 MHz and 0.5 part in 106 (k  =  2) at 100 kHz is within reach.

Voltage Dependence of Supercapacitor Capacitance

Directory of Open Access Journals (Sweden)

Szewczyk Arkadiusz

2016-09-01

Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

Negative pressure dressing combined with a traditional approach for ...

African Journals Online (AJOL)

2011-07-21

Jul 21, 2011 ... Deep burns of the calvarium due to high-voltage electrical current present serious therapeutic challenges in the healing. In this study, as an alternative approach to the treatment of burned skull, negative pressure dressing is used to facilitate separation of the necrotic bones from healthy margins of the ...

The Effect of Current-Limiting Reactors on the Tripping of Short Circuits in High-Voltage Electrical Equipment

International Nuclear Information System (INIS)

Volkov, M. S.; Gusev, Yu. P.; Monakov, Yu. V.; Cho, Gvan Chun

2016-01-01

The insertion of current-limiting reactors into electrical equipment operating at a voltage of 110 and 220 kV produces a change in the parameters of the transient recovery voltages at the contacts of the circuit breakers for disconnecting short circuits, which could be the reason for the increase in the duration of the short circuit, damage to the electrical equipment and losses in the power system. The results of mathematical modeling of the transients, caused by tripping of the short circuit in a reactive electric power transmission line are presented, and data are given on the negative effect of a current-limiting resistor on the rate of increase and peak value of the transient recovery voltages. Methods of ensuring the standard requirements imposed on the parameters of the transient recovery voltages when using current-limiting reactors in the high-voltage electrical equipment of power plants and substations are proposed and analyzed

Tunable negative differential resistance in planar graphene superlattice resonant tunneling diode

Science.gov (United States)

Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.

2017-04-01

Here, we study the negative differential resistance (NDR) of Dirac electrons in biased planar graphene superlattice (PGSL) and investigate the transport characteristics by adopted transfer matrix method within Landauer-Buttiker formalism. Our model device is based on one-dimensional Kronig-Penney type electrostatic potential in monolayer graphene deposited on a substrate, where the bias voltage is applied by two electrodes in the left and right. At Low bias voltages, we found that NDR appears due to breaking of minibands to Wannier-Stark ladders (WSLs). At the critical bias voltage, delocalization appeared by WS states leads to tunneling peak current in current-voltage (I-V) characteristics. With increasing bias voltage, crossing of rungs from various WSL results in multi-peak NDR. The results demonstrate that the structure parameters like barrier/well thickness and barrier height have remarkable effect on I-V characteristics of PGSL. In addition, Dirac gap enhances peak to valley (PVR) value due to suppressing Klein tunneling. Our results show that the tunable PVR in PGSL resonant tunneling diode can be achievable by structure parameters engineering. NDR at ultra-low bias voltages, such as 100 mV, with giant PVR of 20 is obtained. In our device, the multiple same NDR peaks with ultra-low bias voltage provide promising prospect for multi-valued memories and the low power nanoelectronic tunneling devices.

Incremental Beliefs of Ability, Achievement Emotions and Learning of Singapore Students

Science.gov (United States)

Luo, Wenshu; Lee, Kerry; Ng, Pak Tee; Ong, Joanne Xiao Wei

2014-01-01

This study investigated the relationships of students' incremental beliefs of math ability to their achievement emotions, classroom engagement and math achievement. A sample of 273 secondary students in Singapore were administered measures of incremental beliefs of math ability, math enjoyment, pride, boredom and anxiety, as well as math classroom…

Measurement Error Estimation for Capacitive Voltage Transformer by Insulation Parameters

Directory of Open Access Journals (Sweden)

Bin Chen

2017-03-01

Full Text Available Measurement errors of a capacitive voltage transformer (CVT are relevant to its equivalent parameters for which its capacitive divider contributes the most. In daily operation, dielectric aging, moisture, dielectric breakdown, etc., it will exert mixing effects on a capacitive divider’s insulation characteristics, leading to fluctuation in equivalent parameters which result in the measurement error. This paper proposes an equivalent circuit model to represent a CVT which incorporates insulation characteristics of a capacitive divider. After software simulation and laboratory experiments, the relationship between measurement errors and insulation parameters is obtained. It indicates that variation of insulation parameters in a CVT will cause a reasonable measurement error. From field tests and calculation, equivalent capacitance mainly affects magnitude error, while dielectric loss mainly affects phase error. As capacitance changes 0.2%, magnitude error can reach −0.2%. As dielectric loss factor changes 0.2%, phase error can reach 5′. An increase of equivalent capacitance and dielectric loss factor in the high-voltage capacitor will cause a positive real power measurement error. An increase of equivalent capacitance and dielectric loss factor in the low-voltage capacitor will cause a negative real power measurement error.

The Cognitive Underpinnings of Incremental Rehearsal

Science.gov (United States)

Varma, Sashank; Schleisman, Katrina B.

2014-01-01

Incremental rehearsal (IR) is a flashcard technique that has been developed and evaluated by school psychologists. We discuss potential learning and memory effects from cognitive psychology that may explain the observed superiority of IR over other flashcard techniques. First, we propose that IR is a form of "spaced practice" that…

Effect of applied voltage and inter-pulse delay in spark-assisted LIBS

Science.gov (United States)

Robledo-Martinez, A.; Sobral, H.; Garcia-Villarreal, A.

2018-06-01

We report the results obtained in an investigation on the effect of the time delay between the laser and electrical pulses in a spark-assisted laser-induced breakdown spectroscopy (LIBS) experiment. The electrical discharge is produced by the discharge of a charged coaxial cable. This arrangement produces a fast unipolar current pulse (500 ns) that applies high power ( 600 kW) to the laser ablation plasma. The delay between the laser pulse and the electric pulse can be controlled at will in order to find the optimal time in terms of enhancement of the emitted lines. It was found that the application of the high voltage pulse enhances the ionic lines emitted by up to two orders of magnitude. An additional enhancement by a factor of 2-4 can be obtained delaying the application of the electric pulse by a time of 0.6-20 μs. In the tests it was noticed that the ionic lines were found to be clearly responsive to increments in the applied electric energy while the neutral lines did so marginally. Our results show that the intensification of the lines is mainly due to reheating of the ablation plasma as the application of the electrical pulse increments the temperature of the ablation plasma by about 50%. It is demonstrated that the present technique is an efficient way of intensifying the lines emitted without incurring in additional damage to the sample.

Intense negative hydrogen ion source for neutral injection into tokamaks

International Nuclear Information System (INIS)

Prelec, K.; Sluyters, T.

1975-01-01

In this scheme negative ions are extracted from a plasma source, accelerated to the required energy and then neutralized by stripping in a gas, metal vapor or plasma jet. One of the most promising direct extraction sources is the magnetron source, operating in the mixed hydrogen-cesium mode. In the present source cathode current densities are up to 20 A/cm 2 at arc voltages between 100 V and 150 V. In order to utilize the discharge more efficiently multislit extraction geometry was adopted. Highest currents were obtained by using six slits, with a total extraction area of 1.35 cm 2 . At an extraction voltage of 18 kV negative hydrogen ion currents close to 1 A were obtained, which corresponds to current densities of about 0.7 A/cm 2 at the extraction aperture. Pulse length was 10-20 ms and the repetition rate 0.1 Hz. The total extracted current was usually 2-3 times the H - current

Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

DEFF Research Database (Denmark)

Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

2014-01-01

This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

The Dark Side of Malleability: Incremental Theory Promotes Immoral Behaviors

OpenAIRE

Huang, Niwen; Zuo, Shijiang; Wang, Fang; Cai, Pan; Wang, Fengxiang

2017-01-01

Implicit theories drastically affect an individual’s processing of social information, decision making, and action. The present research focuses on whether individuals who hold the implicit belief that people’s moral character is fixed (entity theorists) and individuals who hold the implicit belief that people’s moral character is malleable (incremental theorists) make different choices when facing a moral decision. Incremental theorists are less likely to make the fundamental attribution err...

Organization Strategy and Structural Differences for Radical Versus Incremental Innovation

OpenAIRE

John E. Ettlie; William P. Bridges; Robert D. O'Keefe

1984-01-01

The purpose of this study was to test a model of the organizational innovation process that suggests that the strategy-structure causal sequence is differentiated by radical versus incremental innovation. That is, unique strategy and structure will be required for radical innovation, especially process adoption, while more traditional strategy and structure arrangements tend to support new product introduction and incremental process adoption. This differentiated theory is strongly supported ...

Symmetric voltage-controlled variable resistance

Science.gov (United States)

Vanelli, J. C.

1978-01-01

Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

Directory of Open Access Journals (Sweden)

Yukiko eMishina

2014-09-01

Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

Science.gov (United States)

Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

2014-01-01

Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Incremental deformation: A literature review

Directory of Open Access Journals (Sweden)

Nasulea Daniel

2017-01-01

Full Text Available Nowadays the customer requirements are in permanent changing and according with them the tendencies in the modern industry is to implement flexible manufacturing processes. In the last decades, metal forming gained attention of the researchers and considerable changes has occurred. Because for a small number of parts, the conventional metal forming processes are expensive and time-consuming in terms of designing and manufacturing preparation, the manufacturers and researchers became interested in flexible processes. One of the most investigated flexible processes in metal forming is incremental sheet forming (ISF. ISF is an advanced flexible manufacturing process which allows to manufacture complex 3D products without expensive dedicated tools. In most of the cases it is needed for an ISF process the following: a simple tool, a fixing device for sheet metal blank and a universal CNC machine. Using this process it can be manufactured axis-symmetric parts, usually using a CNC lathe but also complex asymmetrical parts using CNC milling machines, robots or dedicated equipment. This paper aim to present the current status of incremental sheet forming technologies in terms of process parameters and their influences, wall thickness distribution, springback effect, formability, surface quality and the current main research directions.

Effects of negative bias on structure and surface topography of titanium films deposited by DC magnetron sputtering

International Nuclear Information System (INIS)

Duan Linglong

2008-01-01

Pure Ti films were fabricated by bias sputtering. The deposition rate, the density and the surface topography of the Ti films at different negative bias were studied. The results show that the deposition rate is weakly affected when the bias power is low. As the bias voltage increases, the deposition rate decreases strongly due to the increase of the layer density and the resputtering phenomena. The film density increased and saturated to nearly bulk value at a bias voltage of -119.1 V. SEM view indicates that the columnar-type structure of Ti films can be destroyed by applying negative bias. The experiments demonstrated that a dense Ti film with more smooth surface can be produced by applying negative bias. (authors)

Complex Incremental Product Innovation in Established Service Firms: A Micro Institutional Perspective

NARCIS (Netherlands)

P.A.M. Vermeulen (Patrick); F.A.J. van den Bosch (Frans); H.W. Volberda (Henk)

2006-01-01

textabstractMany product innovation studies have described key determinants that should lead to successful incremental product innovation. Despite numerous studies suggesting how incremental product innovation should be successfully undertaken, many firms still struggle with this type of innovation.

Complex Incremental Product Innovation in Established Service Firms: A Micro Institutional Perspective

NARCIS (Netherlands)

P.A.M. Vermeulen (Patrick); F.A.J. van den Bosch (Frans); H.W. Volberda (Henk)

2007-01-01

textabstractMany product innovation studies have described key determinants that should lead to successful incremental product innovation. Despite numerous studies suggesting how incremental product innovation should be successfully undertaken, many firms still struggle with this type of innovation.

Longitudinal and Incremental Relation of Cybervictimization to Negative Self-Cognitions and Depressive Symptoms in Young Adolescents.

Science.gov (United States)

Cole, David A; Zelkowitz, Rachel L; Nick, Elizabeth; Martin, Nina C; Roeder, Kathryn M; Sinclair-McBride, Keneisha; Spinelli, Tawny

2016-10-01

Adolescents are among the most frequent users of social media websites, raising concern about the dangers of cyber bullying or cybervictimization (CV). A 12-month longitudinal study examined the unique, prospective relation of CV to the development of negative self-cognitions and depressive symptoms in a community sample of 827 children and young adolescents (ages 8-13; 55.1 % female) from the southeastern United States. Over and above conventional types of peer victimization, CV significantly predicted changes in self-referential negative cognitions, victimization-related cognitive reactions, and depressive symptoms, even after controlling for baseline levels of the dependent variables. Results also showed that CV was significantly less stable than other forms of victimization and tended to increase slightly with time. The study highlights the unique effects of CV and has implications for research and practice.

Novel high-voltage power lateral MOSFET with adaptive buried electrodes

International Nuclear Information System (INIS)

Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

2012-01-01

A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Teraflop-scale Incremental Machine Learning

OpenAIRE

Özkural, Eray

2011-01-01

We propose a long-term memory design for artificial general intelligence based on Solomonoff's incremental machine learning methods. We use R5RS Scheme and its standard library with a few omissions as the reference machine. We introduce a Levin Search variant based on Stochastic Context Free Grammar together with four synergistic update algorithms that use the same grammar as a guiding probability distribution of programs. The update algorithms include adjusting production probabilities, re-u...

A Self-Organizing Incremental Neural Network based on local distribution learning.

Science.gov (United States)

Xing, Youlu; Shi, Xiaofeng; Shen, Furao; Zhou, Ke; Zhao, Jinxi

2016-12-01

In this paper, we propose an unsupervised incremental learning neural network based on local distribution learning, which is called Local Distribution Self-Organizing Incremental Neural Network (LD-SOINN). The LD-SOINN combines the advantages of incremental learning and matrix learning. It can automatically discover suitable nodes to fit the learning data in an incremental way without a priori knowledge such as the structure of the network. The nodes of the network store rich local information regarding the learning data. The adaptive vigilance parameter guarantees that LD-SOINN is able to add new nodes for new knowledge automatically and the number of nodes will not grow unlimitedly. While the learning process continues, nodes that are close to each other and have similar principal components are merged to obtain a concise local representation, which we call a relaxation data representation. A denoising process based on density is designed to reduce the influence of noise. Experiments show that the LD-SOINN performs well on both artificial and real-word data. Copyright © 2016 Elsevier Ltd. All rights reserved.

A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level

DEFF Research Database (Denmark)

Newman, M.J.; Holmes, D.G.; Nielsen, J.G.

2005-01-01

Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... be advantageous if the series-connected inverter of a DVR could also be used to compensate for any steady-state load voltage harmonics, since this would increase the power quality "value-added" benefits to the grid system. However, before this can be done, consideration must be given to the control of steady......-state power through the DVR, the increased losses, and the low modulation depths at which the scheme must operate to achieve acceptable harmonic compensation performance. This paper presents a selective harmonic feedback control strategy that can be easily added to medium-voltage DVR systems to provide...

Charge effects controlling the current hysteresis and negative differential resistance in periodical nanosize Si/CaF sub 2 structures

CERN Document Server

Berashevich, Y A; Kholod, A N; Borisenko, V E

2002-01-01

A kinetic model of charge carrier transport in nanosize periodical Si/CaF sub 2 structures via localized states in dielectric is proposed. Computer simulation of the current-voltage characteristics of such structures has shown that the built-in field arises in a dielectric due to polarization of the trapped charge by localized centers. This results in current hysteresis and negative differential resistance region at the current-voltage characteristics when the bias polarity is changed. At temperature below 250 K, the portion of negative differential resistance vanishes

Comparative Analysis of Reduced-Rule Compressed Fuzzy Logic Control and Incremental Conductance MPPT Methods

Science.gov (United States)

Kandemir, Ekrem; Borekci, Selim; Cetin, Numan S.

2018-04-01

Photovoltaic (PV) power generation has been widely used in recent years, with techniques for increasing the power efficiency representing one of the most important issues. The available maximum power of a PV panel is dependent on environmental conditions such as solar irradiance and temperature. To extract the maximum available power from a PV panel, various maximum-power-point tracking (MPPT) methods are used. In this work, two different MPPT methods were implemented for a 150-W PV panel. The first method, known as incremental conductance (Inc. Cond.) MPPT, determines the maximum power by measuring the derivative of the PV voltage and current. The other method is based on reduced-rule compressed fuzzy logic control (RR-FLC), using which it is relatively easier to determine the maximum power because a single input variable is used to reduce computing loads. In this study, a 150-W PV panel system model was realized using these MPPT methods in MATLAB and the results compared. According to the simulation results, the proposed RR-FLC-based MPPT could increase the response rate and tracking accuracy by 4.66% under standard test conditions.

The evaluation of the radiation dose and image quality through the change of the tube voltage in cerebral CT angiography

Energy Technology Data Exchange (ETDEWEB)

Lee, Ji Won; Jung, Kang Kyo; Cho, Pyong Kon [Radiological Science, Catholic University of Daegu, Daegu (Korea, Republic of)

2015-06-15

To image diagnosis in neurovascular diseases using Multi-Detector Computed Tomography (MDCT), injected the same contrast material when inspecting Brain Computed Tomography Angiography (BCTA) to examine radiation dose and Image quality on changing Cerebral Artery CT number by tube voltage. Executed an examination with same condition[Beam Collimation 128 x 0.6 mm, Pitch 0.6, Rotation Time 0.5s, Slice Thickness 5.0 mm, Increment 5.0 mm, Delay Time 3.0 sec, Care Dose 4D (Demension ; D)] except for tube voltage on 50 call patients for BCTA and divided them into two groups (25 people for a group, group A: 80, group B: 120 kVp). From all the acquired images, set a ROI(Region of Interest) on four spots such as left cerebral artery, right cerebral artery, posterior cerebral artery and cerebral parenchyma to compare quantitative evaluation, qualitative evaluation and effective dose after measuring CT number value from Picture Archiving Communications System(PACS). Evaluating images with CT number acquired from BCTA examination, images with 80 kVp was 18 % higher in Signal to Noise Ratio and 19 % in Contrast to Noise Ratio than those with 120 kVp. It was seen that expose dose was decreased by over 50 % with tube voltage 80 kVp than with 120 kVp. Group A (25 patients) was examination with tube voltage 80 kVp while group B with 120 kVp to examine radiation dose and Image quality. It is considered effective to inspect with lower tube voltage than with conventional high kVp, which can reduce radiation dose without any affect on diagnosis.

Incremental Reconstruction of Urban Environments by Edge-Points Delaunay Triangulation

OpenAIRE

Romanoni, Andrea; Matteucci, Matteo

2016-01-01

Urban reconstruction from a video captured by a surveying vehicle constitutes a core module of automated mapping. When computational power represents a limited resource and, a detailed map is not the primary goal, the reconstruction can be performed incrementally, from a monocular video, carving a 3D Delaunay triangulation of sparse points; this allows online incremental mapping for tasks such as traversability analysis or obstacle avoidance. To exploit the sharp edges of urban landscape, we ...

Capacitor voltage balance performance comparison of MMC-STATCOM using NLC and PS-PWM strategies during negative sequence current injection

DEFF Research Database (Denmark)

Pereira, Heverton A.; F. Cupertino, Allan; S. Xavier, Lucus

2016-01-01

This paper addresses the modular multilevel converter applied as a static synchronous compensator. The main objective of this work is to compare the converter performance considering two different submodule capacitor voltage balancing strategies: nearest level control and phase-shifted pulse width...

Quasi-static incremental behavior of granular materials: Elastic-plastic coupling and micro-scale dissipation

Science.gov (United States)

Kuhn, Matthew R.; Daouadji, Ali

2018-05-01

The paper addresses a common assumption of elastoplastic modeling: that the recoverable, elastic strain increment is unaffected by alterations of the elastic moduli that accompany loading. This assumption is found to be false for a granular material, and discrete element (DEM) simulations demonstrate that granular materials are coupled materials at both micro- and macro-scales. Elasto-plastic coupling at the macro-scale is placed in the context of thermomechanics framework of Tomasz Hueckel and Hans Ziegler, in which the elastic moduli are altered by irreversible processes during loading. This complex behavior is explored for multi-directional loading probes that follow an initial monotonic loading. An advanced DEM model is used in the study, with non-convex non-spherical particles and two different contact models: a conventional linear-frictional model and an exact implementation of the Hertz-like Cattaneo-Mindlin model. Orthotropic true-triaxial probes were used in the study (i.e., no direct shear strain), with tiny strain increments of 2 ×10-6 . At the micro-scale, contact movements were monitored during small increments of loading and load-reversal, and results show that these movements are not reversed by a reversal of strain direction, and some contacts that were sliding during a loading increment continue to slide during reversal. The probes show that the coupled part of a strain increment, the difference between the recoverable (elastic) increment and its reversible part, must be considered when partitioning strain increments into elastic and plastic parts. Small increments of irreversible (and plastic) strain and contact slipping and frictional dissipation occur for all directions of loading, and an elastic domain, if it exists at all, is smaller than the strain increment used in the simulations.

Analyses of electron runaway in front of the negative streamer channel

DEFF Research Database (Denmark)

Babich, L. P.; Bochkov, E. I.; Kutsyk, I. M.

2017-01-01

X-and γ-ray emissions, observed in correlation with negative leaders of lightning and long sparks of high-voltage laboratory experiments, are conventionally connected with the bremsstrahlung of high-energy runaway electrons (REs). Here we extend a focusing mechanism, analyzed in our previous paper...

Sensing voltage across lipid membranes

Science.gov (United States)

Swartz, Kenton J.

2009-01-01

The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

Science.gov (United States)

2011-11-22

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

The impact of positive and negative emotions on loyalty intentions and their interactions with customer equity drivers

NARCIS (Netherlands)

Ou, Yi-Chun; Verhoef, Peter C.

2017-01-01

Customer equity drivers (CEDs) include value, brand, and relationship equity, which have a strong link with loyalty intentions. This study aims to examine the incremental effects of positive and negative emotions on loyalty intentions and to determine whether these emotions moderate the positive

The impact of positive and negative emotions on loyalty intentions and their interactions with customer equity drivers

NARCIS (Netherlands)

Ou, Yi-Chun; Verhoef, Peter C.

Customer equity drivers (CEDs) include value, brand, and relationship equity, which have a strong link with loyalty intentions. This study aims to examine the incremental effects of positive and negative emotions on loyalty intentions and to determine whether these emotions moderate the positive

When mere exposure leads to less liking: the incremental threat effect in intergroup contexts.

Science.gov (United States)

Crisp, Richard J; Hutter, Russell R C; Young, Bryony

2009-02-01

In two experiments we tested the hypothesis that repeated exposure to out-group-relevant attitude objects would lead to less liking following a threat to identity. In Experiment 1 exposure to abstract artwork ostensibly created by a member of an out-group university led to more liking under baseline conditions, but not following a manipulation of threat. In Experiment 2 we observed a negative relationship between exposure and liking following threat: liking reversed the typical mere exposure effect. Reported emotion mediated the interactive effect of threat and exposure on liking. These findings illustrate how social identity threat can be experienced incrementally as a function of exposure. We discuss the findings in the context of an integration of research on exposure, identity, attitudes, and contact.

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-07-05

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Study of Au- production in a plasma-sputter type negative ion source

International Nuclear Information System (INIS)

Okabe, Yushirou.

1991-10-01

A negative ion source of plasma-sputter type has been constructed for the purpose of studying physical processes which take place in the ion source. Negative ions of gold are produced on the gold target which is immersed in an argon discharge plasma and biased negatively with respect to the plasma. The work function of the target surface was lowered by the deposition of Cs on the target. An in-situ method has been developed to determine the work function of the target surface in the ion source under discharge conditions. The observed minimum work function of a cesiated gold surface in an argon plasma was 1.3 eV, when the negative ion production rate took the maximum value. The production rate increased monotonically and saturated when the surface work function was reduced from 1.9 eV to 1.3 eV. The dependence of Au - production rate on the incident ion energy and on the number of the incident ion was studied. From the experimental results, it is shown that the sputtering process is an important physical process for the negative ion production in the plasma-sputter type negative ion source. The energy distribution function was also measured. When the bias voltage was smaller than 280 V, the high energy component in the distribution decreased as the target voltage was decreased. Therefore, the energy spread ΔE, of the observed negative ion energy distribution also decreased. This tendency is also seen in the energy spectrum of Cu atoms sputtered in normal direction by Ar + ions. (J.P.N.)

Increments and duplication events of enzymes and transcription factors influence metabolic and regulatory diversity in prokaryotes.

Directory of Open Access Journals (Sweden)

Mario Alberto Martínez-Núñez

Full Text Available In this work, the content of enzymes and DNA-binding transcription factors (TFs in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM and structural domains (Superfamily. For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22% than in the bacterial ones (27% was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected.

Testing the Relations Between Impulsivity-Related Traits, Suicidality, and Nonsuicidal Self-Injury: A Test of the Incremental Validity of the UPPS Model

Science.gov (United States)

Lynam, Donald R.; Miller, Joshua D.; Miller, Drew J.; Bornovalova, Marina A.; Lejuez, C. W.

2011-01-01

Borderline personality disorder (BPD) has received significant attention as a predictor of suicidal behavior (SB) and nonsuicidal self-injury (NSSI). Despite significant promise, trait impulsivity has received less attention. Understanding the relations between impulsivity and SB and NSSI is confounded, unfortunately, by the heterogeneous nature of impulsivity. This study examined the relations among 4 personality pathways to impulsive behavior studied via the UPPS model of impulsivity and SB and NSSI in a residential sample of drug abusers (N = 76). In this study, we tested whether these 4 impulsivity-related traits (i.e., Negative Urgency, Sensation Seeking, Lack of Premeditation, and Lack of Perseverance) provide incremental validity in the statistical prediction of SB and NSSI above and beyond BPD; they do. We also tested whether BPD symptoms provide incremental validity in the prediction of SB and NSSI above and beyond these impulsivity-related traits; they do not. In addition to the main effects of Lack of Premeditation and Negative Urgency, we found evidence of a robust interaction between these 2 personality traits. The current results argue strongly for the consideration of these 2 impulsivity-related domains—alone and in interaction—when attempting to understand and predict SB and NSSI. PMID:21833346

Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

Science.gov (United States)

Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

2018-05-07

Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

Ultra Low-Voltage Energy Harvesting

Science.gov (United States)

2013-09-01

if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

Energy distribution extraction of negative charges responsible for positive bias temperature instability

International Nuclear Information System (INIS)

Ren Shang-Qing; Yang Hong; Wang Wen-Wu; Tang Bo; Tang Zhao-Yun; Wang Xiao-Lei; Xu Hao; Luo Wei-Chun; Zhao Chao; Yan Jiang; Chen Da-Peng; Ye Tian-Chun

2015-01-01

A new method is proposed to extract the energy distribution of negative charges, which results from electron trapping by traps in the gate stack of nMOSFET during positive bias temperature instability (PBTI) stress based on the recovery measurement. In our case, the extracted energy distribution of negative charges shows an obvious dependence on energy, and the energy level of the largest energy density of negative charges is 0.01 eV above the conduction band of silicon. The charge energy distribution below that energy level shows strong dependence on the stress voltage. (paper)

Automatic incrementalization of Prolog based static analyses

DEFF Research Database (Denmark)

Eichberg, Michael; Kahl, Matthias; Saha, Diptikalyan

2007-01-01

Modem development environments integrate various static analyses into the build process. Analyses that analyze the whole project whenever the project changes are impractical in this context. We present an approach to automatic incrementalization of analyses that are specified as tabled logic prog...

A new recursive incremental algorithm for building minimal acyclic deterministic finite automata

NARCIS (Netherlands)

Watson, B.W.; Martin-Vide, C.; Mitrana, V.

2003-01-01

This chapter presents a new algorithm for incrementally building minimal acyclic deterministic finite automata. Such minimal automata are a compact representation of a finite set of words (e.g. in a spell checker). The incremental aspect of such algorithms (where the intermediate automaton is

Design of shielded voltage divider for impulse voltage measurement

International Nuclear Information System (INIS)

Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

1976-01-01

The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV

DEFF Research Database (Denmark)

Demirok, Erhan; Sera, Dezso; Teodorescu, Remus

2010-01-01

Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....

High voltage investigations for ITER coils

International Nuclear Information System (INIS)

Fink, S.; Fietz, W.H.

2006-01-01

The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

Benchmarking of Voltage Sag Generators

DEFF Research Database (Denmark)

Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

2012-01-01

The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

Global Combat Support System - Army Increment 2 (GCSS-A Inc 2)

Science.gov (United States)

2016-03-01

2016 Major Automated Information System Annual Report Global Combat Support System - Army Increment 2 (GCSS-A Inc 2) Defense Acquisition...Secretary of Defense PB - President’s Budget RDT&E - Research, Development, Test, and Evaluation SAE - Service Acquisition Executive TBD - To Be...Date Assigned: Program Information Program Name Global Combat Support System - Army Increment 2 (GCSS-A Inc 2) DoD Component Army Responsible

The balanced scorecard: an incremental approach model to health care management.

Science.gov (United States)

Pineno, Charles J

2002-01-01

The balanced scorecard represents a technique used in strategic management to translate an organization's mission and strategy into a comprehensive set of performance measures that provide the framework for implementation of strategic management. This article develops an incremental approach for decision making by formulating a specific balanced scorecard model with an index of nonfinancial as well as financial measures. The incremental approach to costs, including profit contribution analysis and probabilities, allows decisionmakers to assess, for example, how their desire to meet different health care needs will cause changes in service design. This incremental approach to the balanced scorecard may prove to be useful in evaluating the existence of causality relationships between different objective and subjective measures to be included within the balanced scorecard.

Low-Voltage Switched-Capacitor Circuits

DEFF Research Database (Denmark)

Bidari, E.; Keskin, M.; Maloberti, F.

1999-01-01

Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

The impact of positive and negative emotions on loyalty intentions and their interactions with customer equity drivers

OpenAIRE

Ou, Yi-Chun; Verhoef, Peter C.

2017-01-01

Customer equity drivers (CEDs) include value, brand, and relationship equity, which have a strong link with loyalty intentions. This study aims to examine the incremental effects of positive and negative emotions on loyalty intentions and to determine whether these emotions moderate the positive link between CEDs and loyalty intentions. We use customer data with 102 leading firms across eighteen services industries in the Netherlands. The results show that (1) positive and negative emotions h...

Incremental diagnostic value of targeted biopsy using mpMRI-TRUS fusion versus 14-fragments prostatic biopsy. A prospective controlled study

International Nuclear Information System (INIS)

Mariotti, Guilherme C.; Falsarella, Priscila M.; Garcia, Rodrigo G.; Queiroz, Marcos R.G.; Lemos, Gustavo C.; Baroni, Ronaldo H.

2018-01-01

To compare the incremental diagnostic value of targeted biopsy using real-time multiparametric magnetic resonance imaging and transrectal ultrasound (mpMRI-TRUS) fusion to conventional 14-cores biopsy. Uni-institutional, institutional review board (IRB) approved prospective blinded study comparing TRUS-guided random and targeted biopsy using mpMRI-TRUS fusion, in 100 consecutive men. We included men with clinical-laboratorial suspicious for prostate cancer and Likert score ≥ 3 mp-MRI. Patients previously diagnosed with prostate cancer were excluded. All patients were submitted to 14-cores TRUS-guided biopsy (mpMRI data operator-blinded), followed by targeted biopsy using mpMRI-TRUS fusion. There was an overall increase in cancer detection rate, from 56% with random technique to 62% combining targeted biopsy using mpMRI-TRUS fusion; incremental diagnosis was even more relevant for clinically significant lesions (Gleason ≥ 7), diagnosing 10% more clinically significant lesions with fusion biopsy technique. Diagnosis upgrade occurred in 5 patients that would have negative results in random biopsies and had clinically significant tumours with the combined technique, and in 5 patients who had the diagnosis of significant tumours after fusion biopsy and clinically insignificant tumours in random biopsies(p=0.0010). Targeted biopsy using mpMRI-TRUS fusion has incremental diagnostic value in comparison to conventional random biopsy, better detecting clinically significant prostate cancers. (orig.)

Incremental diagnostic value of targeted biopsy using mpMRI-TRUS fusion versus 14-fragments prostatic biopsy. A prospective controlled study

Energy Technology Data Exchange (ETDEWEB)

Mariotti, Guilherme C.; Falsarella, Priscila M.; Garcia, Rodrigo G.; Queiroz, Marcos R.G. [Hospital Israelita Albert Einstein, Department of Interventional Radiology, Sao Paulo (Brazil); Lemos, Gustavo C. [Hospital Israelita Albert Einstein, Department of Urology, Sao Paulo (Brazil); Baroni, Ronaldo H. [Hospital Israelita Albert Einstein, Department of Radiology, Sao Paulo (Brazil)

2018-01-15

To compare the incremental diagnostic value of targeted biopsy using real-time multiparametric magnetic resonance imaging and transrectal ultrasound (mpMRI-TRUS) fusion to conventional 14-cores biopsy. Uni-institutional, institutional review board (IRB) approved prospective blinded study comparing TRUS-guided random and targeted biopsy using mpMRI-TRUS fusion, in 100 consecutive men. We included men with clinical-laboratorial suspicious for prostate cancer and Likert score ≥ 3 mp-MRI. Patients previously diagnosed with prostate cancer were excluded. All patients were submitted to 14-cores TRUS-guided biopsy (mpMRI data operator-blinded), followed by targeted biopsy using mpMRI-TRUS fusion. There was an overall increase in cancer detection rate, from 56% with random technique to 62% combining targeted biopsy using mpMRI-TRUS fusion; incremental diagnosis was even more relevant for clinically significant lesions (Gleason ≥ 7), diagnosing 10% more clinically significant lesions with fusion biopsy technique. Diagnosis upgrade occurred in 5 patients that would have negative results in random biopsies and had clinically significant tumours with the combined technique, and in 5 patients who had the diagnosis of significant tumours after fusion biopsy and clinically insignificant tumours in random biopsies(p=0.0010). Targeted biopsy using mpMRI-TRUS fusion has incremental diagnostic value in comparison to conventional random biopsy, better detecting clinically significant prostate cancers. (orig.)

Bootstrapped Low-Voltage Analog Switches

DEFF Research Database (Denmark)

Steensgaard-Madsen, Jesper

1999-01-01

Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

[Development of residual voltage testing equipment].

Science.gov (United States)

Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

2014-07-01

For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

Volatilities, traded volumes, and the hypothesis of price increments in derivative securities

Science.gov (United States)

Lim, Gyuchang; Kim, SooYong; Scalas, Enrico; Kim, Kyungsik

2007-08-01

A detrended fluctuation analysis (DFA) is applied to the statistics of Korean treasury bond (KTB) futures from which the logarithmic increments, volatilities, and traded volumes are estimated over a specific time lag. In this study, the logarithmic increment of futures prices has no long-memory property, while the volatility and the traded volume exhibit the existence of the long-memory property. To analyze and calculate whether the volatility clustering is due to a inherent higher-order correlation not detected by with the direct application of the DFA to logarithmic increments of KTB futures, it is of importance to shuffle the original tick data of future prices and to generate a geometric Brownian random walk with the same mean and standard deviation. It was found from a comparison of the three tick data that the higher-order correlation inherent in logarithmic increments leads to volatility clustering. Particularly, the result of the DFA on volatilities and traded volumes can be supported by the hypothesis of price changes.

Control Method for DC-Link Voltage Ripple Cancellation in Voltage Source Inverter under Unbalanced Three-Phase Voltage Supply Conditions

Czech Academy of Sciences Publication Activity Database

Chomát, Miroslav; Schreier, Luděk

2005-01-01

Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005

Negative differential resistance and switch behavior of T-BxNy (x, y = 5, 6, 11) molecular junctions

Science.gov (United States)

Wang, Shi-Liang; Yang, Chuan-Lu; Wang, Mei-Shan; Ma, Xiao-Guang; Xin, Jian-Guo

2017-05-01

The electronic transport properties of T-BxNy (x, y = 5, 6, 11) molecular junction are investigated based on first-principle density functional theory and non-equilibrium Green's function method. Strong negative differential resistance (NDR) behavior is observed for T-B5N6 molecule under negative and positive bias voltages, with an obvious switch effect for T-B6N5. However, only small NDR is shown for the complex of the two molecules. The projected device density of states, the spatial distribution of molecular orbitals, and the effect of transmission spectra under various bias voltages on the electronic transport properties are analyzed. The obvious effect of bias voltage on the changes in the electronic distribution of frontier molecular orbitals is responsible for the NDR or switch behavior. Therefore, different functional molecular devices can be obtained with different structures of T-BxNy.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements

DEFF Research Database (Denmark)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar

2008-01-01

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...

Software designs of image processing tasks with incremental refinement of computation.

Science.gov (United States)

Anastasia, Davide; Andreopoulos, Yiannis

2010-08-01

Software realizations of computationally-demanding image processing tasks (e.g., image transforms and convolution) do not currently provide graceful degradation when their clock-cycles budgets are reduced, e.g., when delay deadlines are imposed in a multitasking environment to meet throughput requirements. This is an important obstacle in the quest for full utilization of modern programmable platforms' capabilities since worst-case considerations must be in place for reasonable quality of results. In this paper, we propose (and make available online) platform-independent software designs performing bitplane-based computation combined with an incremental packing framework in order to realize block transforms, 2-D convolution and frame-by-frame block matching. The proposed framework realizes incremental computation: progressive processing of input-source increments improves the output quality monotonically. Comparisons with the equivalent nonincremental software realization of each algorithm reveal that, for the same precision of the result, the proposed approach can lead to comparable or faster execution, while it can be arbitrarily terminated and provide the result up to the computed precision. Application examples with region-of-interest based incremental computation, task scheduling per frame, and energy-distortion scalability verify that our proposal provides significant performance scalability with graceful degradation.

"Negative capacitance" in resistor-ferroelectric and ferroelectric-dielectric networks: Apparent or intrinsic?

Science.gov (United States)

Saha, Atanu K.; Datta, Suman; Gupta, Sumeet K.

2018-03-01

In this paper, we describe and analytically substantiate an alternate explanation for the negative capacitance (NC) effect in ferroelectrics (FE). We claim that the NC effect previously demonstrated in resistance-ferroelectric (R-FE) networks does not necessarily validate the existence of "S" shaped relation between polarization and voltage (according to Landau theory). In fact, the NC effect can be explained without invoking the "S"-shaped behavior of FE. We employ an analytical model for FE (Miller model) in which the steady state polarization strictly increases with the voltage across the FE and show that despite the inherent positive FE capacitance, reduction in FE voltage with the increase in its charge is possible in a R-FE network as well as in a ferroelectric-dielectric (FE-DE) stack. This can be attributed to a large increase in FE capacitance near the coercive voltage coupled with the polarization lag with respect to the electric field. Under certain conditions, these two factors yield transient NC effect. We analytically derive conditions for NC effect in R-FE and FE-DE networks. We couple our analysis with extensive simulations to explain the evolution of NC effect. We also compare the trends predicted by the aforementioned Miller model with Landau-Khalatnikov (L-K) model (static negative capacitance due to "S"-shape behaviour) and highlight the differences between the two approaches. First, with an increase in external resistance in the R-FE network, NC effect shows a non-monotonic behavior according to Miller model but increases according to L-K model. Second, with the increase in ramp-rate of applied voltage in the FE-DE stack, NC effect increases according to Miller model but decreases according to L-K model. These results unveil a possible way to experimentally validate the actual reason of NC effect in FE.

Current-voltage characteristics of carbon nanotubes with substitutional nitrogen

DEFF Research Database (Denmark)

Kaun, C.C.; Larade, B.; Mehrez, H.

2002-01-01

unit cell generates a metallic transport behavior. Nonlinear I-V characteristics set in at high bias and a negative differential resistance region is observed for the doped tubes. These behaviors can be well understood from the alignment/mis-alignment of the current carrying bands in the nanotube leads......We report ab initio analysis of current-voltage (I-V) characteristics of carbon nanotubes with nitrogen substitution doping. For zigzag semiconducting tubes, doping with a single N impurity increases current flow and, for small radii tubes, narrows the current gap. Doping a N impurity per nanotube...

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

Science.gov (United States)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

An improved design of virtual output impedance loop for droop-controlled parallel three-phase Voltage Source Inverters

DEFF Research Database (Denmark)

Wang, Xiongfei; Blaabjerg, Frede; Chen, Zhe

2012-01-01

-sequence virtual resistance even in the case of feeding a balanced three-phase load. Furthermore, to adapt to the variety of unbalanced loads, a dynamically-tuned negative-sequence resistance loop is designed, such that a good compromise between the quality of inverter output voltage and the performance of load......The virtual output impedance loop is known as an effective way to enhance the load sharing stability and quality of droop-controlled parallel inverters. This paper proposes an improved design of virtual output impedance loop for parallel three-phase voltage source inverters. In the approach...... sharing can be obtained. Finally, laboratory test results of two parallel three-phase voltage source inverters are shown to confirm the validity of the proposed method....

Development of Multi-Functional Voltage Restore System

Science.gov (United States)

Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki

Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.

Triple Line-Voltage Cascaded VIENNA Converter Applied as the Medium-Voltage AC Drive

Directory of Open Access Journals (Sweden)

Jia Zou

2018-04-01

Full Text Available A novel rectifier based on a triple line-voltage cascaded VIENNA converter (LVC-VC was proposed. Compared to the conventional cascaded H-bridge converters, the switch voltage stress is lower, and the numbers of switches and dc capacitors are fewer under similar operating conditions in the proposed new multilevel converter. The modeling and control for the LVC-VC ware presented. Based on the analysis of the operation principle of the new converter, the power factor correction of the proposed converter was realized by employing a traditional one-cycle control strategy. The minimum average value and maximum harmonic components of the dc-link voltages of the three VIENNA rectifier modules ware calculated. Three VIENNA dc-link voltages were unbalanced under the unbalanced load conditions, so the zero sequence current was injected to the three inner currents for balancing three VIENNA dc-link voltages. Simulation and the results of the experiment verified the availability of the new proposed multilevel converter and the effectiveness of the corresponding control strategy applied.

Coordinated single-phase control scheme for voltage unbalance reduction in low voltage network.

Science.gov (United States)

Pullaguram, Deepak; Mishra, Sukumar; Senroy, Nilanjan

2017-08-13

Low voltage (LV) distribution systems are typically unbalanced in nature due to unbalanced loading and unsymmetrical line configuration. This situation is further aggravated by single-phase power injections. A coordinated control scheme is proposed for single-phase sources, to reduce voltage unbalance. A consensus-based coordination is achieved using a multi-agent system, where each agent estimates the averaged global voltage and current magnitudes of individual phases in the LV network. These estimated values are used to modify the reference power of individual single-phase sources, to ensure system-wide balanced voltages and proper power sharing among sources connected to the same phase. Further, the high X / R ratio of the filter, used in the inverter of the single-phase source, enables control of reactive power, to minimize voltage unbalance locally. The proposed scheme is validated by simulating a LV distribution network with multiple single-phase sources subjected to various perturbations.This article is part of the themed issue 'Energy management: flexibility, risk and optimization'. © 2017 The Author(s).

Evidence combination for incremental decision-making processes

NARCIS (Netherlands)

Berrada, Ghita; van Keulen, Maurice; de Keijzer, Ander

The establishment of a medical diagnosis is an incremental process highly fraught with uncertainty. At each step of this painstaking process, it may be beneficial to be able to quantify the uncertainty linked to the diagnosis and steadily update the uncertainty estimation using available sources of

Resilient architecture design for voltage variation

CERN Document Server

Reddi, Vijay Janapa

2013-01-01

Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

Breakdown characteristics of electro-negative gases under needle-plane gap. Hari-hiraita gap ni okeru denkiteki fusei gas no zetsuen hakai tokusei

Energy Technology Data Exchange (ETDEWEB)

Nakayama, H.; Onoda, M.; Amakawa, K. (Himeji Institute of Technology, Hyogo (Japan)); Kuroda, S. (Nitto Denko Corp., Tokyo (Japan))

1990-07-20

The voltage-time (V-t) characteristics of corona onset and breakdown were examined in electro-negative gases as SF {sub 6} and CCl {sub 2} F {sub 2}, using a needle-plane electrode with small gap and {mu} s square pulse voltage with various wave fronts. The V-t characteristics in electro-neutral gas as N {sub 2} ordinarily descended rightwards, but those in SF {sub 6} descended rightwards only in smaller gaps and lower gas pressures. In the pulse voltage with shorter wave fronts, those in SF {sub 6} also offered a particular shape descending leftwards. The particular shape was dependent on the steepness of the pulse wave front, being strongly affected by shorter wave fronts, and also strongly related to the onset and development length of corona. The particular phenomenon of V-t characteristics was observed more obviously at a positive needle than negative one without any extremely long corona lengths at negative one, indicating a polarity effect. The phenomenon was also observed in CCl {sub 2} F {sub 2} as particular one in electro-negative gases. 21 refs., 12 figs.

Incremental Nonnegative Matrix Factorization for Face Recognition

Directory of Open Access Journals (Sweden)

Wen-Sheng Chen

2008-01-01

Full Text Available Nonnegative matrix factorization (NMF is a promising approach for local feature extraction in face recognition tasks. However, there are two major drawbacks in almost all existing NMF-based methods. One shortcoming is that the computational cost is expensive for large matrix decomposition. The other is that it must conduct repetitive learning, when the training samples or classes are updated. To overcome these two limitations, this paper proposes a novel incremental nonnegative matrix factorization (INMF for face representation and recognition. The proposed INMF approach is based on a novel constraint criterion and our previous block strategy. It thus has some good properties, such as low computational complexity, sparse coefficient matrix. Also, the coefficient column vectors between different classes are orthogonal. In particular, it can be applied to incremental learning. Two face databases, namely FERET and CMU PIE face databases, are selected for evaluation. Compared with PCA and some state-of-the-art NMF-based methods, our INMF approach gives the best performance.

Square-Wave Voltage Injection Algorithm for PMSM Position Sensorless Control With High Robustness to Voltage Errors

DEFF Research Database (Denmark)

Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede

2017-01-01

relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...

Grid-Current-Feedback Active Damping for LCL Resonance in Grid-Connected Voltage-Source Converters

DEFF Research Database (Denmark)

Wang, Xiongfei; Blaabjerg, Frede; Loh, Poh Chiang

2016-01-01

This paper investigates active damping of LCL-filter resonance in a grid-connected voltage-source converter with only grid-current feedback control. Basic analysis in the s-domain shows that the proposed damping technique with a negative high-pass filter along its damping path is equivalent...... of phase-lag, in turn, helps to shrink the region of nonminimum-phase behavior caused by negative virtual resistance inserted unintentionally by most digitally implemented active damping techniques. The presented high-pass-filtered active damping technique with a single grid-current feedback loop is thus...

Power-MOSFET Voltage Regulator

Science.gov (United States)

Miller, W. N.; Gray, O. E.

1982-01-01

Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

CMOS-compatible high-voltage integrated circuits

Energy Technology Data Exchange (ETDEWEB)

Parpia, Z

1988-01-01

Considerable savings in cost and development time can be achieved if high-voltage ICs (HVICs) are fabricated in an existing low-voltage process. In this thesis, the feasibility of fabricating HVICs in a standard CMOS process is investigated. The high-voltage capabilities of an existing 5-{mu}m CMOS process are first studied. High-voltage n- and p-channel transistors with breakdown voltages of 50 and 190 V, respectively, were fabricated without any modifications to the process under consideration. SPICE models for these transistors are developed, and their accuracy verified by comparison with experimental results. In addition, the effect of the interconnect metallization on the high-voltage performance of these devices is also examined. Polysilicon field plates are found to be effective in preventing premature interconnect induced breakdown in these devices. A novel high-voltage transistor structure, the insulated base transistor (IBT), based on a merged MOS-bipolar concept, is proposed and implemented. In order to enhance the high-voltage device capabilities, an improved CMOS-compatible HVIC process using junction isolation is developed.

Voltage-assisted polymer wafer bonding

International Nuclear Information System (INIS)

Varsanik, J S; Bernstein, J J

2012-01-01

Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)