Cold-electrode voltage fall for impulse arcs in argon between copper electrodes
Energy Technology Data Exchange (ETDEWEB)
Diaz, O; Cooray, V, E-mail: oscar.diaz@angstrom.uu.se [Lightning Research Group, Division for Electricity, Uppsala University Angstroemlaboratoriet Box 5234, 751 20, Uppsala (Sweden)
2011-06-23
The full electric arc discharge in gases for short gaps in homogeneous electric field and pressure{center_dot}distance (pd) below 150 Torr{center_dot}cm, can be described as a transition between different discharge mechanisms such as: Townsend, glow, and arc. Once the arc is achieved the measured voltage drops to some volts and the current density increases several orders of magnitude. Depending upon the type of gas used, the electrode surface characteristics and type of electrical excitation, the cathode and anode voltage fall might change. The present work is directed to study the electrode fall (sum of anode and cathode falls) during a current impulse arc discharge between copper electrodes in ceramic tubes filled with argon between 0.01 and 6.5 Torr{center_dot}cm. The copper electrodes were cleaned, degassed and hydrogen reduced. The arc voltages were measured with fast/slow rise times and short/long duration current impulses produced by a RLC circuit. An increasing variation of the electrode fall was found at the pressure{center_dot}distance range analyzed.
Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.
Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming
2015-01-01
The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.
Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.
Directory of Open Access Journals (Sweden)
Zhibin Hao
Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.
High-voltage electrode optimization towards uniform surface treatment by a pulsed volume discharge
International Nuclear Information System (INIS)
Ponomarev, A V; Pedos, M S; Scherbinin, S V; Mamontov, Y I; Ponomarev, S V
2015-01-01
In this study, the shape and material of the high-voltage electrode of an atmospheric pressure plasma generation system were optimised. The research was performed with the goal of achieving maximum uniformity of plasma treatment of the surface of the low-voltage electrode with a diameter of 100 mm. In order to generate low-temperature plasma with the volume of roughly 1 cubic decimetre, a pulsed volume discharge was used initiated with a corona discharge. The uniformity of the plasma in the region of the low-voltage electrode was assessed using a system for measuring the distribution of discharge current density. The system's low-voltage electrode - collector - was a disc of 100 mm in diameter, the conducting surface of which was divided into 64 radially located segments of equal surface area. The current at each segment was registered by a high-speed measuring system controlled by an ARM™-based 32-bit microcontroller. To facilitate the interpretation of results obtained, a computer program was developed to visualise the results. The program provides a 3D image of the current density distribution on the surface of the low-voltage electrode. Based on the results obtained an optimum shape for a high-voltage electrode was determined. Uniformity of the distribution of discharge current density in relation to distance between electrodes was studied. It was proven that the level of non-uniformity of current density distribution depends on the size of the gap between electrodes. Experiments indicated that it is advantageous to use graphite felt VGN-6 (Russian abbreviation) as the material of the high-voltage electrode's emitting surface. (paper)
Evaluation of Niobium as Candidate Electrode Material for DC High Voltage Photoelectron Guns
BastaniNejad, M.; Mohamed, Abdullah; Elmustafa, A. A.; Adderley, P.; Clark, J.; Covert, S.; Hansknecht, J.; Hernandez-Garcia, C.; Poelker, M.; Mammei, R.;
2012-01-01
The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirror-like finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain) that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium) could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (< 10 pA) at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18:7 MV/m.
Evaluation of niobium as candidate electrode material for dc high voltage photoelectron guns
Directory of Open Access Journals (Sweden)
M. BastaniNejad
2012-08-01
Full Text Available The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirrorlike finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (<10 pA at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18.7 MV/m.
International Nuclear Information System (INIS)
Hilscher, A.
2002-01-01
A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)
Gómez-González, J F; Destexhe, A; Bal, T
2014-10-01
Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.
Cell voltage versus electrode potential range in aqueous supercapacitors
Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.
2015-01-01
Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670
TiN coated aluminum electrodes for DC high voltage electron guns
International Nuclear Information System (INIS)
Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew
2015-01-01
Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes
Novel high-voltage power lateral MOSFET with adaptive buried electrodes
International Nuclear Information System (INIS)
Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji
2012-01-01
A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Directory of Open Access Journals (Sweden)
Marek Kukucka
2016-01-01
Full Text Available Our paper deals with the method of the voltage-impedance map measurement process as a method useful for the electric mapping of human skin. The area of research extends from the basic research to its practical application in acupuncture skin mapping and acupuncture point localization and visualization. The problem of sufficient skin coverage and electrical contact with measuring electrodes is solved by the conventional mechanical telescopic electrodes and by the pneumatic matrix electrode probe. A 2D or 3D voltage-impedance map of skin is an output of the measuring, interpretation and evaluation process. New pneumatic construction of measuring probe was implemented to achieve a better coverage of specified skin area and get a reduced force range of the touching electrodes allowing the steady contact of the skin-electrode. A skin contact is related to the driving pressure of touching electrodes. Our paper offers experimentally measured results, voltage maps of skin on specific areas, selected measured and described acupuncture points and their applications in electro-acupuncture.
Technique eliminates high voltage arcing at electrode-insulator contact area
Mealy, G.
1967-01-01
Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.
Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.
Pervukhin, Viktor V; Sheven, Dmitriy G
2010-01-01
The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.
2017-09-01
The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.
Three phase voltage measurements with simple open air sensors
Heesch, van E.J.M.; Caspers, R.; Gulickx, P.F.M.; Jacobs, G.A.P.; Kersten, W.F.J.; Laan, van der P.C.T.
1991-01-01
A low cost, easy to install high-voltage measuring system is described for open air substations and overhead lines. Based on the Differentiating/Integrating (D/I) principle, three free-standing capacitive pickup electrodes are used to sense the three phase to ground voltages. Apart from the
A new method for analyzing and design of guard electrodes of high voltage insulators chain
International Nuclear Information System (INIS)
Vahidi, B.; Mohammad Zadeh, A.
2002-01-01
The main aim of this paper is analyzing design of guard electrodes of high voltage insulators chain. These electrodes are used for making the distribution of uniform potential across the insulators chain, reducing leakage current and preventing the degradation of insulators. If the design is not correct or in the case of insulators chain without guard electrodes, the potential distribution will not uniform. Thus the voltage drops on the insulators adjacent to conductors will be more than maximum voltage that can be tolerated by the insulators. Therefore these voltage drops can damage the insulators. In this paper A new method is introduced for analyzing and design of ga urad electrodes of high voltage insulators chain
International Nuclear Information System (INIS)
Gupta, G.P.; Rohatgi, V.K.
1982-01-01
Following a simplified approach, an expression is derived for the gas-dynamic voltage drop in a finitely segmented Faraday-type combustion MHD generator, taking into account the non-uniform Hall parameter across the channel. Combining the electrical sheath voltage drop, discussed briefly, with the gas-dynamic voltage drop, the effect of a non-uniform Hall parameter on the electrode voltage drop is studied using the theoretical and experimental input parameters of the Indian MHD channel test. The condition for the validity of the usual assumption of uniform Hall parameter across the channel is pointed out. Analysis of the measured electrode voltage drop predicts the real gas conductivity in the core to be in the range of 60 to 75 per cent of the theoretically calculated core conductivity. (author)
High voltage and high specific capacity dual intercalating electrode Li-ion batteries
West, William C. (Inventor); Blanco, Mario (Inventor)
2010-01-01
The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.
Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke
2012-01-01
We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.
Directory of Open Access Journals (Sweden)
Bernd M. Briechle
2012-11-01
Full Text Available We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current–voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.
Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki
2004-03-22
DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics
International Nuclear Information System (INIS)
Fordham, C.
1989-01-01
The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs
Methods for Specific Electrode Resistance Measurement during Transcranial Direct Current Stimulation
Khadka, Niranjan; Rahman, Asif; Sarantos, Chris; Truong, Dennis Q.; Bikson, Marom
2014-01-01
Background Transcranial Direct Current Stimulation (tDCS) is investigated to treat a wide range of neuropsychiatric disorders, for rehabilitation, and for enhancing cognitive performance. The monitoring of electrode resistance before and during tDCS is considered important for tolerability and safety, where an unusually high resistance is indicative of undesired electrode or poor skin contact conditions. Conventional resistance measurement methods do not isolate individual electrode resistance but rather measures overall voltage. Moreover, for HD-tDCS devices, cross talk across electrodes makes concurrent resistance monitoring unreliable. Objective We propose a novel method for monitoring of the individual electrode resistance during tDCS, using a super-position of direct current with a test-signal (low-intensity and low-frequency sinusoids with electrode– specific frequencies) and a single sentinel electrode (not used for DC). Methods To validate this methodology, we developed lumped-parameter models of two and multi-electrode tDCS. Approaches with and without a sentinel electrode were solved and underlying assumptions identified. Assumptions were tested and parameterized in healthy participants using forearm stimulation combining tDCS (2 mA) and sinusoidal test-signals (38 μA and 76 μA peak to peak at 1 Hz, 10 Hz, and 100 Hz) and an in vitro test (where varied electrode failure modes were created). DC and AC component voltages across the electrodes were compared and participants were asked to rate subjective pain. Results A sentinel electrode is required to isolate electrode resistance in a two-electrode tDCS system. For multi-electrode resistance tracking, cross talk was aggravated with electrode proximity and current/resistance mismatches, but could be corrected using proposed approaches. Average voltage and average pain scores were not significantly different across test current intensities and frequencies (two-way repeated measures ANOVA) indicating the
Directory of Open Access Journals (Sweden)
M. I. Baranov
2015-04-01
Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.
Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes
Wu, Kunlin
2014-07-07
The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that, similarly to the case of Au-vacuum-Au previously studied, the transition voltages of Ag and Pt metal-vacuum-metal junctions with atomic protrusions on the electrode surface are determined by the local density of states of the p-type atomic orbitals of the protrusion. Since the energy position of the Pt 6p atomic orbitals is higher than that of the 5p/6p of Ag and Au, the transition voltage of Pt-vacuum-Pt junctions is larger than that of both Ag-vacuum-Ag and Au-vacuum-Au junctions. When one moves to analyzing asymmetric molecular junctions constructed with biphenyl thiol as central molecule, then the transition voltage is found to depend on the specific bonding site for the sulfur atom in the thiol group. In particular agreement with experiments, where the largest transition voltage is found for Ag and the smallest for Pt, is obtained when one assumes S binding at the hollow-bridge site on the Ag/Au(111) surface and at the adatom site on the Pt(111) one. This demonstrates the critical role played by the linker-electrode binding geometry in determining the transition voltage of devices made of conjugated thiol molecules. © 2014 AIP Publishing LLC.
Directory of Open Access Journals (Sweden)
Korobeynikov S.M.
2017-08-01
Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Cell voltage versus electrode potential range in aqueous supercapacitors
Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.
2015-01-01
Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...
International Nuclear Information System (INIS)
Choi, Kyung Hyun; Ali, Adnan; Rahman, Ahsan; Malik Mohammad, Nauman; Rahman, Khalid; Khan, Arshad; Khan, Saleem; Kim, D S
2010-01-01
The electrode configuration of an electrostatic inkjet printing head is under study. This paper introduces the development of a new electrostatic inkjet head with an improved electrode configuration as compared to the conventional configuration. Two tungsten electrodes, connected in parallel, are inserted into the electrostatic print head at a certain angle from opposite sides. The aim of this double-side inserted angular electrodes (DSIAEs) head is to intensify the electrification of the fluid inside the head at minimum suitable exposure of the electrode, which results in maximizing surface charge density. The main advantage of the DSIAEs head is to get a very stable meniscus at low applied voltage for printing. This stable meniscus is transformed to a very stable jet by increasing the applied voltage. Therefore, printed patterns obtained with this DSIAEs head are more uniform because of a more stable meniscus and jet as compared to a conventional electrostatic vertically inserted single electrode head. Also, with this DSIAEs configuration, the life of the electrostatic inkjet printing head is increased.
Energy Technology Data Exchange (ETDEWEB)
Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)
2010-12-15
We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)
Energy Technology Data Exchange (ETDEWEB)
Pain, H. J.; Fearn, D. G.; Distefano, E. [Imperial College. London (United Kingdom)
1966-10-15
(a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 {mu}mHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the
International Nuclear Information System (INIS)
Pain, H.J.; Fearn, D.G.; Distefano, E.
1966-01-01
(a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 μmHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the
High-voltage measurements on the 5 ppm relative uncertainty level with collinear laser spectroscopy
Krämer, J.; König, K.; Geppert, Ch; Imgram, P.; Maaß, B.; Meisner, J.; Otten, E. W.; Passon, S.; Ratajczyk, T.; Ullmann, J.; Nörtershäuser, W.
2018-04-01
We present the results of high-voltage collinear laser spectroscopy measurements on the 5 ppm relative uncertainty level using a pump and probe scheme at the 4s ^2S1/2 → 4p ^2P3/2 transition of {\\hspace{0pt}}40Ca+ involving the 3d ^2D5/2 metastable state. With two-stage laser interaction and a reference measurement we can eliminate systematic effects such as differences in the contact potentials due to different electrode materials and thermoelectric voltages, and the unknown starting potential of the ions in the ion source. Voltage measurements were performed between -5 kV and -19 kV and parallel measurements with stable high-voltage dividers calibrated to 5 ppm relative uncertainty were used as a reference. Our measurements are compatible with the uncertainty limits of the high-voltage dividers and demonstrate an unprecedented (factor of 20) increase in the precision of direct laser-based high-voltage measurements.
Dark Current And Voltage Measurements Of Metal-Organic-Semiconductor (M-Or-S) Diode
International Nuclear Information System (INIS)
Adianto
1996-01-01
. Some Metal-Organic-Semiconductor (M-Or-S) thin film diodes, constructed with an organic polymer (polymerized toluene) as an active component has been successfully fabricated. The thin film M-Or-S diodes were fabricated on an n-type silicon with resistivity of 250-500 Ocm and p type silicon with resistivity of 10-20 Ocm as a substrate with polymerized toluene used as insulator. When deposited on silicon wafers with electrode of evaporated Ni on the n-type silicon and evaporated Au as the electrode on the polymerized toluene film, the electronic devices of Metal-Organic- Semiconductor (M-Or-S) type can be produced with one of its characteristics is that their light sensitivity. A plasma ion deposition system was constructed and used to deposit organic monomeric substance (toluene) that functioned as an isolator between semiconductor and the evaporated metal electrodes. The current-voltage measurements for different configurations of M-Or-S devices were carried out to determine the current-voltage (1-V) characteristics for M-Or-S devices with different materials and thicknesses. In addition to the 1-V measurement mentioned before, 1-V measurements of the devices were also carried out by using a curve tracer oscilloscope, and the picture of the effective parameters of each of the device could be taken by using a polaroid camera. Since the devices are very sensitive to light, the devices were all tested in a black-box which was covered by a black cloth to make sure that there was no light coming through. The experimental results for p- and n-type silicon substrates showed that an M-Or-S diode with n-type gave a higher breakdown voltage than that p- type silicon. In addition, the reverse bias breakdown voltage increased as the thickness of the thin film increased in the range of 50 -2500 V/μm
Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes
Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin
2014-01-01
The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green's function formalism combined with density functional theory. Our calculations show that, similarly
Directory of Open Access Journals (Sweden)
Kyoungho Kim
2015-01-01
Full Text Available As various wearable devices are emerging, self-generated power sources, such as piezoelectric generators, triboelectric generators, and thermoelectric generators, are of interest. To adapt self-generated power sources for application devices, a supercapacitor is necessary because of the short generation times (1–10 ms and low generated power (1–100 μW of self-generated power sources. However, to date, supercapacitors are too large to be adapted for wearable devices. There have been many efforts to reduce the size of supercapacitors by using polypyrrole (PPy for high energy supercapacitor electrodes. However, these supercapacitors have several disadvantages, such as a low operating voltage due to the use of an aqueous electrolyte, and complex manufacturing methods, such as the hydrogel and aerosol methods. In particular, the low operating voltage (~1.0 V is a significant issue because most electronic components operate above 3.0 V. In this study, we successfully demonstrated the high operating voltage (3.0 V of a supercapacitor using a PPy/activated carbon (AC composite electrode based on the chemical polymerization of the PPy by simple dipping. In addition, a twofold enhancement of its energy density was achieved compared with conventional supercapacitors using AC electrodes.
Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages
Kim, Jeonglae; Davidson, Scott; Mani, Ali
2017-11-01
Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.
International Nuclear Information System (INIS)
Hu, Fangrong; Li, Zhi; Xiong, Xianming; Niu, Junhao; Peng, Zhiyong; Qian, Yixian; Yao, Jun
2012-01-01
This paper presents a multi-electrode and pre-deformed bilayer spring structure electrostatic attractive microelectromechanical systems (MEMS) actuator; it has large stroke at relatively low actuation voltage. Generally, electrostatic-attractive-force-based actuators have small stroke due to the instability resulted from the electrostatic ‘pull-in’ phenomenon. However, in many applications, the electrostatic micro-actuator with large stroke at low voltage is more preferred. By introducing a multi-electrode and a pre-deformed bilayer spring structure, an electrostatic attractive MEMS actuator with large stroke at very low actuation voltage has been successfully demonstrated in this paper. The actuator contains a central plate with a size of 300 µm × 300 µm × 1.5 µm and it is supported by four L-shaped bilayer springs which are pre-deformed due to residual stresses. Each bilayer spring is simultaneously attracted by three adjacent fixed electrodes, and the factors affecting the electrostatic attractive force are analyzed by a finite element analysis method. The prototype of the actuator is fabricated by poly-multi-user-MEMS-process (PolyMUMP) and the static performance is tested using a white light interferometer. The measured stroke of the actuator reaches 2 µm at 13 V dc, and it shows a good agreement with the simulation. (paper)
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
International Nuclear Information System (INIS)
Bogónez-Franco, P; Nescolarde, L; Bragós, R; Rosell-Ferrer, J; Yandiola, I
2009-01-01
The purpose of this study is to compare measurement errors in two commercially available multi-frequency bioimpedance analyzers, a Xitron 4000B and an ImpediMed SFB7, including electrode impedance mismatch. The comparison was made using resistive electrical models and in ten human volunteers. We used three different electrical models simulating three different body segments: the right-side, leg and thorax. In the electrical models, we tested the effect of the capacitive coupling of the patient to ground and the skin–electrode impedance mismatch. Results showed that both sets of equipment are optimized for right-side measurements and for moderate skin–electrode impedance mismatch. In right-side measurements with mismatch electrode, 4000B is more accurate than SFB7. When an electrode impedance mismatch was simulated, errors increased in both bioimpedance analyzers and the effect of the mismatch in the voltage detection leads was greater than that in current injection leads. For segments with lower impedance as the leg and thorax, SFB7 is more accurate than 4000B and also shows less dependence on electrode mismatch. In both devices, impedance measurements were not significantly affected (p > 0.05) by the capacitive coupling to ground
Faradic resistance of the electrode/electrolyte interface.
Mayer, S; Geddes, L A; Bourland, J D; Ogborn, L
1992-09-01
A new method is used to measure the direct-current (Faradic) resistance of a single electrode/electrolyte interface. The method employs a constant-current pulse and a potential-sensing electrode. By choosing a sufficiently long pulse duration, the voltage between the test and potential-sensing electrode exhibits a three-phase response. In the steady-state phase, the voltage measured is equal to the current flowing through the electrode Faradic resistance and the resistance of the electrolyte between the test and potential-sensing electrode. By measuring this latter resistance with a high-frequency sinusoidal alternating current, the voltage drop in the electrolyte is calculated and subtracted from the voltage measured between the test and potential-sensing electrode, thereby allowing calculation of the Faradic resistance. By plotting the reciprocal of the Faradic resistance against current density and fitting the data points to a third-order polynomial, it is possible to determine the zero-current density (Faradic) resistance. This technique was used to determine the Faradic resistance of electrodes (0.1 cm2) of stainless-steel, platinum, platinum-iridium and rhodium in 0.9 per cent NaCl at 25 degrees. The zero current Faradic resistance is lowest for platinum (30.3 k omega), slightly higher for platinum-iridium (47.6k omega), much higher for rhodium (111k omega) and highest for type 316 stainless-steel (345k omega). In all cases, the Faradic resistance decreases dramatically with increasing current density.
Directory of Open Access Journals (Sweden)
Yufei Teng
2017-03-01
Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.
A thermoelectric voltage effect in polyethylene oxide
International Nuclear Information System (INIS)
Martin, Bjoern; Wagner, Achim; Kliem, Herbert
2003-01-01
The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential
A thermoelectric voltage effect in polyethylene oxide
Martin, B; Kliem, H
2003-01-01
The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...
Dragas, Jelena; Viswam, Vijay; Shadmani, Amir; Chen, Yihui; Bounik, Raziyeh; Stettler, Alexander; Radivojevic, Milos; Geissler, Sydney; Obien, Marie; Müller, Jan; Hierlemann, Andreas
2017-06-01
Biological cells are characterized by highly complex phenomena and processes that are, to a great extent, interdependent. To gain detailed insights, devices designed to study cellular phenomena need to enable tracking and manipulation of multiple cell parameters in parallel; they have to provide high signal quality and high spatiotemporal resolution. To this end, we have developed a CMOS-based microelectrode array system that integrates six measurement and stimulation functions, the largest number to date. Moreover, the system features the largest active electrode array area to date (4.48×2.43 mm 2 ) to accommodate 59,760 electrodes, while its power consumption, noise characteristics, and spatial resolution (13.5 μm electrode pitch) are comparable to the best state-of-the-art devices. The system includes: 2,048 action-potential (AP, bandwidth: 300 Hz to 10 kHz) recording units, 32 local-field-potential (LFP, bandwidth: 1 Hz to 300 Hz) recording units, 32 current recording units, 32 impedance measurement units, and 28 neurotransmitter detection units, in addition to the 16 dual-mode voltage-only or current/voltage-controlled stimulation units. The electrode array architecture is based on a switch matrix, which allows for connecting any measurement/stimulation unit to any electrode in the array and for performing different measurement/stimulation functions in parallel.
Halpern, Mark
2011-01-01
This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.
Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity
Directory of Open Access Journals (Sweden)
John H. Miller Jr.
2011-04-01
Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.
DNA-FET using carbon nanotube electrodes
International Nuclear Information System (INIS)
Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y
2006-01-01
We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
Detlefsen, D; Hu, Z; Troyk, P R
2006-01-01
Cyclic voltametry and recording of stimulation electrode voltage excursions are two critical methods of measurement for understanding the performance of implantable electrodes. Because implanted electrodes cannot easily be replaced, it is necessary to have an a-priori understanding of an electrode's implanted performance and capabilities. In-vitro exhaustive tests are often needed to quantify an electrodes performance. Using commonly available equipment, the human labor cost to conduct this work is immense. Presented is an automated experiment system that is highly configurable that can efficiently conduct a battery of repeatable CV and stimulation recording measurements. Results of preparing 96 electrodes prior to an animal implantation are also discussed.
Energy Technology Data Exchange (ETDEWEB)
Jin, Bin Bin [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Department of Chemical Engineering, Institute of Chemical Industry, Shaanxi Institute of Technology, Xi’an 710300 (China); Wang, Ye Feng [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Wang, Xue Qing [Faculty of Chemical, Environmental and Biological Science and Technology, Dalian University of Technology, Dalian 116024 (China); Zeng, Jing Hui, E-mail: jhzeng@ustc.edu [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China)
2016-04-30
Highlights: • PbSe thin film is deposited on FTO glass by a pulse voltage electrodeposition method. • The thin film is used as counter electrode (CE) in quantum dot-sensitized solar cell. • Superior electrocatalytic activity and stability in the polysulfide electrolyte is received. • The narrow band gap characteristics and p-type conductivity enhances the cell efficiency. • An efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells. - Abstract: Lead selenide (PbSe) thin films were deposited on fluorine doped tin oxide (FTO) glass by a facile one-step pulse voltage electrodeposition method, and used as counter electrode (CE) in CdS/CdSe quantum dot-sensitized solar cells (QDSSCs). A power conversion efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells, which is much better than that of 2.39% received using Pt CEs. The enhanced performance is attributed to the extended absorption in the near infrared region, superior electrocatalytic activity and p-type conductivity with a reflection of the incident light at the back electrode in addition. The physical and chemical properties were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), energy-dispersive spectroscopy (EDS), reflectance spectra, electrochemical impedance spectroscopy (EIS) and Tafel polarization measurements. The present work provides a facile pathway to an efficient CE in the QDSSCs.
An electrode polarization impedance based flow sensor for low water flow measurement
International Nuclear Information System (INIS)
Yan, Tinghu; Sabic, Darko
2013-01-01
This note describes an electrode polarization impedance based flow sensor for low water flow measurement. It consists of two pairs of stainless steel electrodes set apart and inserted into a non-conductive flow tube with each pair of electrodes placed diametrically at the opposite sides. The flow sensor is modeled as a typical four-electrode system of which two electrodes are current-carrying and the other two serve as output pick ups. The polarization impedances of the two current carrying electrodes are affected by water flows resulting in changes of differential potential between the two pick-up electrodes which are separated by the same fluid. The interrogation of the two excitation electrodes with dc biased ac signals offers significantly higher sensor sensitivities to flow. The prototype flow sensor constructed for a 20 mm diameter pipeline was able to measure water flow rate as low as tested at 1.06 l h −1 and remained sensitive at a flow rate of 25.18 l h −1 when it was driven with a sinusoidal voltage at 1000 Hz with a peak ac amplitude of 2 V and a dc offset of +8 V. The nonlinear characteristics of the sensor response indicate that the sensor is more sensitive at low flows and will not be able to measure at very high flows. Additional experiments are needed to evaluate the influences of impurities, chemical species, ions constituents, conductivity and temperature over a practical range of residential water conditions, the effects of fluctuating ground signals, measurement uncertainty, power consumption, compensation of effects and practical operations. The flow sensor (principle) presented may be used as (in) a secondary sensor in combination with an existing electronic water meter to extend the low end of measurement range in residential water metering. (technical design note)
Beattie, Shane D.; Loveridge, M. J.; Lain, Michael J.; Ferrari, Stefania; Polzin, Bryant J.; Bhagat, Rohit; Dashwood, Richard
2016-01-01
Commercial Li-ion batteries are typically cycled between 3.0 and 4.2 V. These voltages limits are chosen based on the characteristics of the cathode (e.g. lithium cobalt oxide) and anode (e.g. graphite). When alternative anode/cathode chemistries are studied the same cut-off voltages are often, mistakenly, used. Silicon (Si) based anodes are widely studied as a high capacity alternative to graphite for Lithium-ion batteries. When silicon-based anodes are paired with high capacity cathodes (e.g. Lithium Nickel Cobalt Aluminium Oxide; NCA) the cell typically suffers from rapid capacity fade. The purpose of this communication is to understand how the choice of upper cut-off voltage affects cell performance in Si/NCA cells. A careful study of three-electrode cell data will show that capacity fade in Si/NCA cells is due to an ever-evolving silicon voltage profile that pushes the upper voltage at the cathode to >4.4 V (vs. Li/Li+). This behaviour initially improves cycle efficiency, due to liberation of new lithium, but ultimately reduces cycling efficiency, resulting in rapid capacity fade.
The Significance of Breakdown Voltages for Quality Assurance of Low-Voltage BME Ceramic Capacitors
Teverovsky, Alexander A.
2014-01-01
Application of thin dielectric, base metal electrode (BME) ceramic capacitors for high-reliability applications requires development of testing procedures that can assure high quality and reliability of the parts. In this work, distributions of breakdown voltages (VBR) in variety of low-voltage BME multilayer ceramic capacitors (MLCCs) have been measured and analyzed. It has been shown that analysis of the distributions can indicate the proportion of defective parts in the lot and significance of the defects. Variations of the distributions after solder dip testing allow for an assessment of the robustness of capacitors to soldering-related stresses. The drawbacks of the existing screening and qualification methods to reveal defects in high-value, low-voltage MLCCs and the importance of VBR measurements are discussed. Analysis has shown that due to a larger concentration of oxygen vacancies, defect-related degradation of the insulation resistance (IR) and failures are more likely in BME compared to the precious metal electrode (PME) capacitors.
A Thorax Simulator for Complex Dynamic Bioimpedance Measurements With Textile Electrodes.
Ulbrich, Mark; Muhlsteff, Jens; Teichmann, Daniel; Leonhardt, Steffen; Walter, Marian
2015-06-01
Bioimpedance measurements on the human thorax are suitable for assessment of body composition or hemodynamic parameters, such as stroke volume; they are non-invasive, easy in application and inexpensive. When targeting personal healthcare scenarios, the technology can be integrated into textiles to increase ease, comfort and coverage of measurements. Bioimpedance is generally measured using two electrodes injecting low alternating currents (0.5-10 mA) and two additional electrodes to measure the corresponding voltage drop. The impedance is measured either spectroscopically (bioimpedance spectroscopy, BIS) between 5 kHz and 1 MHz or continuously at a fixed frequency around 100 kHz (impedance cardiography, ICG). A thorax simulator is being developed for testing and calibration of bioimpedance devices and other new developments. For the first time, it is possible to mimic the complete time-variant properties of the thorax during an impedance measurement. This includes the dynamic real part and dynamic imaginary part of the impedance with a peak-to-peak value of 0.2 Ω and an adjustable base impedance (24.6 Ω ≥ Z0 ≥ 51.6 Ω). Another novelty is adjustable complex electrode-skin contact impedances for up to 8 electrodes to evaluate bioimpedance devices in combination with textile electrodes. In addition, an electrocardiographic signal is provided for cardiographic measurements which is used in ICG devices. This provides the possibility to generate physiologic impedance changes, and in combination with an ECG, all parameters of interest such as stroke volume (SV), pre-ejection period (PEP) or extracellular resistance (Re) can be simulated. The speed of all dynamic signals can be altered. The simulator was successfully tested with commercially available BIS and ICG devices and the preset signals are measured with high correlation (r = 0.996).
Directory of Open Access Journals (Sweden)
M. Malík
2014-01-01
Full Text Available This paper deals with the effects surrounding phenomenon of a mechanical force generated on a high voltage asymmetrical capacitor (the so called Biefeld-Brown effect. A method to measure this force is described and a formula to calculate its value is also given. Based on this the authors derive a formula characterising the neutral air flow velocity impacting an asymmetrical capacitor connected to high voltage. This air flow under normal circumstances lessens the generated force. In the following part this velocity is measured using Particle Image Velocimetry measuring technique and the results of the theoretically calculated velocity and the experimentally measured value are compared. The authors found a good agreement between the results of both approaches.
On-site voltage measurement with capacitive sensors on high voltage systems
Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.
2011-01-01
In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little
International Nuclear Information System (INIS)
Rao Feng; Song Zhitang; Gong Yuefeng; Wu Liangcai; Feng Songlin; Chen, Bomy
2008-01-01
A phase change memory cell with tungsten trioxide bottom heating layer/electrode is investigated. The crystalline tungsten trioxide heating layer promotes the temperature rise in the Ge 2 Sb 2 Te 5 layer which causes the reduction in the reset voltage compared to a conventional phase change memory cell. Theoretical thermal simulation and calculation for the reset process are applied to understand the thermal effect of the tungsten trioxide heating layer/electrode. The improvement in thermal efficiency of the PCM cell mainly originates from the low thermal conductivity of the crystalline tungsten trioxide material.
International Nuclear Information System (INIS)
Frick, G.; Osswald, F.; Heusch, B.
1996-01-01
Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)
CAMAC system for data acquisition on output of digital panel meter for DC voltage measurement
International Nuclear Information System (INIS)
Noda, Nobuaki.
1979-03-01
An interface between the digital panel meter (DPM) for DC voltage measurement and the CAMAC system for T-2 experiment in JIPP (Japan Institute of Plasma Physics) was designed and produced. This panel meter is used for the purpose of monitoring the deflected electrode voltage of a 6 channel, neutral particle, energy analyzer (parallel plate electrodes, electro static type). The method of connecting the DPM to the CAMAC system is that of taking the gate pulses with the width proportional to the voltage to be measured out of the output of the DPM and counting the clock pulses. This system uses each one channel of output register, interrupting register, scaler and clock generator, and the binary digital data is obtained in the scaler, and sent to the main memory of the computer HITAC 10-2 through the CAMAC crate controller. At this time, the interface gives the output of the gate pulses with the width proportional to the DPM input voltage from the DPM BUSY output and PRINT COMMAND output, depending on the sampling pulses from the output register. The interface also gives the end pulse communicating the completion of the output of gate pulses to the interrupting register. The software is summarized in the flow chart of the program and in the program list used for the test on this data acquisition system. The features of this system are to be able to obtain the binary data directly, and to be capable of saving the number of transmission lines required for data transfer. (Wakatsuki, Y.)
Reid, Margaret A.
1989-01-01
Impedances of fifteen electrodes form each of the four U.S. manufactures were measured at 0.200 V vs. the Hg/HgO reference electrode. This corresponds to a voltage of 1.145 for a Ni/H2 cell. Measurements were also made of a representative sample of these at 0.44 V. At the higher voltage, the impedances were small and very similar, but at the lower voltage there were major differences between manufacturers. Electrodes from the same manufacturers showed only small differences. The impedances of electrodes from two manufacturers were considerably different in 26 percent KOH from those in 31 percent KOH. These preliminary results seen to correlate with the limited data from earlier life testing of cells from these manufacturers. The impedances of cells being tested for Space Station Freedom are being followed, and more impendance measurements of electrodes are being performed as functions of manufacturer, voltage, electrolyte concentration, and cycle history in hopes of finding better correlations of impedance with life.
Dispersion of breakdown voltage of liquid helium
International Nuclear Information System (INIS)
Ishii, Itaru; Noguchi, Takuya
1978-01-01
As for the electrical insulation characteristics of liquid helium, the discrepancy among the measured values by each person is very large even in the fundamental DC breakdown voltage in uniform electric field. The dispersion of experimental values obtained in the experiments by the same person is also large. Hereafter, the difference among the mean values obtained by each experimenter will be referred to as ''deviation of mean values'', and the dispersion of measured values around the mean value obtained by the same person as ''deviation around the man value''. The authors have mainly investigated on the latter experimentally. The cryostat was made of stainless steel, and the innermost helium chamber was of 500 mm I.D. and approximately 1200 mm deep. The high voltage electrode was of brass sphere of 25 mm diameter, and the low voltage electrode was of brass plate. The experiment was conducted for liquid helium boiling at 4.2 K and 1 atm, and the breakdown voltage and time lag were measured by applying the approximately square wave impulses of fast rise and long tail, ramp and DC voltages. The cause of the deviation of mean values may be the presence of impurity particles or the effect of electrode shape. As for the deviation around the mean value, the dispersion is large, and its standard deviation may amount to 10 to 20% of the man value. The dispersion is not due to the statistical time lag, but is due to parameters that vary with breakdown. (Wakatsuki, Y.)
Flexible electrode belt for EIT using nanofiber web dry electrodes.
Oh, Tong In; Kim, Tae Eui; Yoon, Sun; Kim, Kap Jin; Woo, Eung Je; Sadleir, Rosalind J
2012-10-01
Efficient connection of multiple electrodes to the body for impedance measurement and voltage monitoring applications is of critical importance to measurement quality and practicality. Electrical impedance tomography (EIT) experiments have generally required a cumbersome procedure to attach the multiple electrodes needed in EIT. Once placed, these electrodes must then maintain good contact with the skin during measurements that may last several hours. There is usually also the need to manage the wires that run between the electrodes and the EIT system. These problems become more severe as the number of electrodes increases, and may limit the practicality and portability of this imaging method. There have been several trials describing human-electrode interfaces using configurations such as electrode belts, helmets or rings. In this paper, we describe an electrode belt we developed for long-term EIT monitoring of human lung ventilation. The belt included 16 embossed electrodes that were designed to make good contact with the skin. The electrodes were fabricated using an Ag-plated PVDF nanofiber web and metallic threads. A large contact area and padding were used behind each electrode to improve subject comfort and reduce contact impedances. The electrodes were incorporated, equally spaced, into an elasticated fabric belt. We tested the electrode belt in conjunction with the KHU Mark1 multi-frequency EIT system, and demonstrate time-difference images of phantoms and human subjects during normal breathing and running. We found that the Ag-plated PVDF nanofiber web electrodes were suitable for long-term measurement because of their flexibility and durability. Moreover, the contact impedance and stability of the Ag-plated PVDF nanofiber web electrodes were found to be comparable to similarly tested Ag/AgCl electrodes.
Directory of Open Access Journals (Sweden)
Joonwoo Kim
2015-09-01
Full Text Available The gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors (a-IGZO TFTs having an asymmetric graphene electrode structure are studied. A large positive shift in the threshold voltage, which is well fitted to a stretched-exponential equation, and an increase in the subthreshold slope are observed when drain current stress is applied. This is due to an increase in temperature caused by power dissipation in the graphene/a-IGZO contact region, in addition to the channel region, which is different from the behavior in a-IGZO TFTs with a conventional transparent electrode.
Electrode effects of a cellulose-based electro-active paper energy harvester
International Nuclear Information System (INIS)
Abas, Zafar; Kim, Heung Soo; Zhai, Lindong; Kim, Jaehwan; Kim, Joo-Hyung
2014-01-01
The possibility of cellulose-based electro-active paper (EAPap) as a vibrational energy transducer was investigated in this paper. Thin cellulose EAPap film specimens were prepared by the regenerating process. Three different metal electrodes of gold, silver and aluminum were deposited on a 50 × 50 mm 2 cellulose film using a thermal evaporator. An aluminum cantilever beam was used as a vibrational bender and EAPap was attached close to the root of the cantilever beam. The voltage output of the EAPap was measured under harmonic base excitation of the cantilever beam. The EAPap with aluminum electrode provided the largest open circuit voltage output compared to those with gold or silver electrodes. The output voltages of the EAPap increased linearly with increase of the area of the electrodes. The output voltages also increased with increasing input acceleration but became saturated at a certain magnitude. From the experimental results, we conclude that EAPap with metal electrodes can be used as a flexible energy harvesting transducer by external mechanical stress, and the output voltage is related to the electrode material due to its work function. (paper)
DEFF Research Database (Denmark)
Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav
2017-01-01
This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...
Energy Technology Data Exchange (ETDEWEB)
Sakai, C., E-mail: SAKAI.Chikako@nims.go.jp; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Fujita, D. [National Institute for Materials Science, Tsukuba, Ibaraki 305-0047 (Japan); Ogata, Y. [TAIYO YUDEN CO., LTD., Takasaki-shi, Gunma 370-3347 (Japan)
2016-08-01
We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO{sub 3} dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.
Time varying voltage combustion control and diagnostics sensor
Chorpening, Benjamin T [Morgantown, WV; Thornton, Jimmy D [Morgantown, WV; Huckaby, E David [Morgantown, WV; Fincham, William [Fairmont, WV
2011-04-19
A time-varying voltage is applied to an electrode, or a pair of electrodes, of a sensor installed in a fuel nozzle disposed adjacent the combustion zone of a continuous combustion system, such as of the gas turbine engine type. The time-varying voltage induces a time-varying current in the flame which is measured and used to determine flame capacitance using AC electrical circuit analysis. Flame capacitance is used to accurately determine the position of the flame from the sensor and the fuel/air ratio. The fuel and/or air flow rate (s) is/are then adjusted to provide reduced flame instability problems such as flashback, combustion dynamics and lean blowout, as well as reduced emissions. The time-varying voltage may be an alternating voltage and the time-varying current may be an alternating current.
Water Electrolysis at Different Current - Voltage Regimes
International Nuclear Information System (INIS)
Kleperis, J.; Blums, J.; Vanags, M.
2007-01-01
Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)
Means to remove electrode contamination effect of Langmuir probe measurement in space
Energy Technology Data Exchange (ETDEWEB)
Oyama, K.-I.; Lee, C. H.; Fang, H. K.; Cheng, C. Z. [Plasma and Space Science Center, National Cheng Kung University, No.1 Ta-Hsueh Rd., Tainan 70101, Taiwan (China)
2012-05-15
Precaution to remove the serious effect of electrode contamination in Langmuir probe experiments has not been taken in many space measurements because the effect is either not understood or ignored. We stress here that one should pay extra attention to the electrode contamination effect to get accurate and reliable plasma measurements so that the long time effort for sounding rocket/satellite missions does not end in vain or becomes less fruitful. In this paper, we describe two main features of voltage-current characteristic curves associated with the contaminated Langmuir probe, which are predicted from the equivalent circuit model, which we proposed in 1970's. We then show that fast sweeping dc Langmuir probes can give reliable results in the steady state regime. The fast sweeping probe can also give reliable results in transient situations such as satellite moves through plasma bubble in the ionosphere where the electron density drastically changes. This fact was first confirmed in our laboratory experiment.
Dependence of hydrogen arcjet operation on electrode geometry
Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.
1992-01-01
The dependence of 2kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and electrode agreed with Paschen curves for hydrogen. Preliminary characterization of the dependence of hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.
Voltage uniformity study in large-area reactors for RF plasma deposition
Energy Technology Data Exchange (ETDEWEB)
Sansonnens, L.; Pletzer, A.; Magni, D.; Howling, A.A.; Hollenstein, C. [Ecole Polytechnique Federale, Lausanne (Switzerland). Centre de Recherche en Physique des Plasma (CRPP); Schmitt, J.P.M. [Balzers Process Systems, Palaiseau (France)
1996-09-01
Non-uniform voltage distribution across the electrode area results in inhomogeneous thin-film RF plasma deposition in large area reactors. In this work, a two-dimensional analytic model for the calculation of the voltage distribution across the electrode area is presented. The results of this model are in good agreement with measurements performed without plasma at 13.56 MHz and 70 MHz in a large area reactor. The principal voltage inhomogeneities are caused by logarithmic singularities in the vicinity of RF connections and not by standing waves. These singularities are only described by a two-dimensional model and cannot be intuitively predicted by analogy to a one-dimensional case. Plasma light emission measurements and thickness homogeneity studies of a-Si:H films show that the plasma reproduces these voltage inhomogeneities. Improvement of the voltage uniformity is investigated by changing the number and position of the RF connections. (author) 13 figs., 20 refs.
High voltage distributions in RPCs
International Nuclear Information System (INIS)
Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.
1996-01-01
High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)
Real-time management of faulty electrodes in electrical impedance tomography.
Hartinger, Alzbeta E; Guardo, Robert; Adler, Andy; Gagnon, Hervé
2009-02-01
Completely or partially disconnected electrodes are a fairly common occurrence in many electrical impedance tomography (EIT) clinical applications. Several factors can contribute to electrode disconnection: patient movement, perspiration, manipulations by clinical staff, and defective electrode leads or electronics. By corrupting several measurements, faulty electrodes introduce significant image artifacts. In order to properly manage faulty electrodes, it is necessary to: 1) account for invalid data in image reconstruction algorithms and 2) automatically detect faulty electrodes. This paper presents a two-part approach for real-time management of faulty electrodes based on the principle of voltage-current reciprocity. The first part allows accounting for faulty electrodes in EIT image reconstruction without a priori knowledge of which electrodes are at fault. The method properly weights each measurement according to its compliance with the principle of voltage-current reciprocity. Results show that the algorithm is able to automatically determine the valid portion of the data and use it to calculate high-quality images. The second part of the approach allows automatic real-time detection of at least one faulty electrode with 100% sensitivity and two faulty electrodes with 80% sensitivity enabling the clinical staff to fix the problem as soon as possible to minimize data loss.
Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor
International Nuclear Information System (INIS)
Kim, N.; Cheong, Y.; Song, W.
2010-01-01
We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.
Dependence of hydrogen arcjet operation on electrode geometry
Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.
1992-01-01
The dependence of 2 kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet performance considerations over the ranges tested. Initial studies were conducted on hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.
Directory of Open Access Journals (Sweden)
Schullcke Benjamin
2016-09-01
Full Text Available Electrical impedance tomography (EIT is used to monitor the regional distribution of ventilation in a transversal plane of the thorax. In this manuscript we evaluate the impact of different quantities of electrodes used for current injection and voltage measurement on the reconstructed shape of the lungs. Results indicate that the shape of reconstructed impedance changes in the body depends on the number of electrodes. In this manuscript, we demonstrate that a higher number of electrodes do not necessarily increase the image quality. For the used stimulation pattern, utilizing neighboring electrodes for current injection and voltage measurement, we conclude that the shape of the lungs is best reconstructed if 16 electrodes are used.
A Self-diagnostic Method for the Electrode Adhesion of an Electromagnetic Flow-meter
Directory of Open Access Journals (Sweden)
Wen-Hua Cui
2014-07-01
Full Text Available Electrodes of electromagnetic flow-meter are subject to contamination in sewage measurement. In this paper, the relationship between the internal resistance of the flow-induced voltage and the electrode contamination is analyzed on the basis of numerical analysis. A new self- diagnostic method for electrode adhesion with additional excitation based on photovoltaic cell is proposed, in which magnetic excitation for flow-rate measurement and electric excitation for electrode self-diagnosis is divided in both time domain and frequency domain. A dual-excited electromagnetic flow-meter with electrode self-diagnosis was designed and validated. Simulation experiments based on the change of the internal resistance of the flow-induced voltage were carried out. And the experimental results fully show that this new method is feasible and promising.
Cavallo's multiplier for in situ generation of high voltage
Clayton, S. M.; Ito, T. M.; Ramsey, J. C.; Wei, W.; Blatnik, M. A.; Filippone, B. W.; Seidel, G. M.
2018-05-01
A classic electrostatic induction machine, Cavallo's multiplier, is suggested for in situ production of very high voltage in cryogenic environments. The device is suitable for generating a large electrostatic field under conditions of very small load current. Operation of the Cavallo multiplier is analyzed, with quantitative description in terms of mutual capacitances between electrodes in the system. A demonstration apparatus was constructed, and measured voltages are compared to predictions based on measured capacitances in the system. The simplicity of the Cavallo multiplier makes it amenable to electrostatic analysis using finite element software, and electrode shapes can be optimized to take advantage of a high dielectric strength medium such as liquid helium. A design study is presented for a Cavallo multiplier in a large-scale, cryogenic experiment to measure the neutron electric dipole moment.
High voltage switches having one or more floating conductor layers
Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson
2015-11-24
This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.
Fiber-optic voltage measuring system
Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang
1993-09-01
A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.
Measurements of Voltage Harmonics in 400 kV Transmission Network
Directory of Open Access Journals (Sweden)
Ryszard Pawełek
2014-06-01
Full Text Available The paper deals with the analysis of voltage harmonics measurements performed in the 400 kV transmission network. The voltage was measured by means of three transducers: resistive voltage divider, inductive measuring transformer and capacitive voltage measuring transformer. Instrument errors were estimated for measuring transformers with reference to the harmonic values obtained from the voltage divider.
International Nuclear Information System (INIS)
Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia
2014-01-01
Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet
Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.
Genc, Ayten; Bakirci, Busra
2015-01-01
The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.
Design of shielded voltage divider for impulse voltage measurement
International Nuclear Information System (INIS)
Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.
1976-01-01
The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)
Flow reversal at low voltage and low frequency in a microfabricated ac electrokinetic pump
DEFF Research Database (Denmark)
Gregersen, Misha Marie; Olesen, Laurits Højgaard; Brask, Anders
2007-01-01
measured in a regime, where both the applied voltage and the frequency are low, Vrms1.5 V and f20 kHz, compared to previously investigated parameter ranges. The impedance spectrum has been thoroughly measured and analyzed in terms of an equivalent circuit diagram to rule out trivial circuit explanations......Microfluidic chips have been fabricated in Pyrex glass to study electrokinetic pumping generated by a low-voltage ac bias applied to an in-channel asymmetric metallic electrode array. A measurement procedure has been established and followed carefully resulting in a high degree of reproducibility...... of the measurements over several days. A large coverage fraction of the electrode array in the microfluidic channels has led to an increased sensitivity allowing for pumping measurements at low bias voltages. Depending on the ionic concentration a hitherto unobserved reversal of the pumping direction has been...
Origin of the transition voltage in gold–vacuum–gold atomic junctions
International Nuclear Information System (INIS)
Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano
2013-01-01
The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)
Coulometry and Calorimetry of Electric Double Layer Formation in Porous Electrodes
Janssen, Mathijs; Griffioen, Elian; Biesheuvel, P. M.; Van Roij, René; Erné, Ben
2017-01-01
Coulometric measurements on salt-water-immersed nanoporous carbon electrodes reveal, at a fixed voltage, a charge decrease with increasing temperature. During far-out-of-equilibrium charging of these electrodes, calorimetry indicates the production of both irreversible Joule heat and reversible
Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.
Dharia, Sameera; Rabbitt, Richard D
2010-01-01
Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.
Nickel hydrogen bipolar battery electrode design
Puglisi, V. J.; Russell, P.; Verrier, D.; Hall, A.
1985-01-01
The preferred approach of the NASA development effort in nickel hydrogen battery design utilizes a bipolar plate stacking arrangement to obtain the required voltage-capacity configuration. In a bipolar stack, component designs must take into account not only the typical design considerations such as voltage, capacity and gas management, but also conductivity to the bipolar (i.e., intercell) plate. The nickel and hydrogen electrode development specifically relevant to bipolar cell operation is discussed. Nickel oxide electrodes, having variable type grids and in thicknesses up to .085 inch are being fabricated and characterized to provide a data base. A selection will be made based upon a system level tradeoff. Negative (hydrpogen) electrodes are being screened to select a high performance electrode which can function as a bipolar electrode. Present nickel hydrogen negative electrodes are not capable of conducting current through their cross-section. An electrode was tested which exhibits low charge and discharge polarization voltages and at the same time is conductive. Test data is presented.
Yan, Lincan; Zhou, Chenming; Reyes, Miguel; Whisner, Bruce; Damiano, Nicholas
2017-06-01
There are two types of through-the-earth (TTE) wireless communication in the mining industry: magnetic loop TTE and electrode-based (or linear) TTE. While the magnetic loop systems send signal through magnetic fields, the transmitter of an electrode-based TTE system sends signal directly through the mine overburden by driving an extremely low frequency (ELF) or ultralow frequency (ULF) AC current into the earth. The receiver at the other end (underground or surface) detects the resultant current and receives it as a voltage. A wireless communication link between surface and underground is then established. For electrode-based TTE communications, the signal is transmitted through the established electric field and is received as a voltage detected at the receiver. It is important to understand the electric field distribution within the mine overburden for the purpose of designing and improving the performance of the electrode-based TTE systems. In this paper, a complete explicit solution for all three electric field components for the electrode-based TTE communication was developed. An experiment was conducted using a prototype electrode-based TTE system developed by National Institute for Occupational Safety and Health. The mathematical model was then compared and validated with test data. A reasonable agreement was found between them.
Ionization detector, electrode configuration and single polarity charge detection method
He, Z.
1998-07-07
An ionization detector, an electrode configuration and a single polarity charge detection method each utilize a boundary electrode which symmetrically surrounds first and second central interlaced and symmetrical electrodes. All of the electrodes are held at a voltage potential of a first polarity type. The first central electrode is held at a higher potential than the second central or boundary electrodes. By forming the first and second central electrodes in a substantially interlaced and symmetrical pattern and forming the boundary electrode symmetrically about the first and second central electrodes, signals generated by charge carriers are substantially of equal strength with respect to both of the central electrodes. The only significant difference in measured signal strength occurs when the charge carriers move to within close proximity of the first central electrode and are received at the first central electrode. The measured signals are then subtracted and compared to quantitatively measure the magnitude of the charge. 10 figs.
Wearable Textile Electrodes for ECG Measurement
Directory of Open Access Journals (Sweden)
Lukas Vojtech
2013-01-01
Full Text Available The electrocardiogram (ECG is one of the most important parameters for monitoring of the physiological state of a person. Currently available systems for ECG monitoring are both stationary and wearable, but the comfort of the monitored person is not at a satisfactory level because these systems are not part of standard clothing. This article is therefore devoted to the development and measurement of wearable textile electrodes for ECG measurement device with high comfort for the user. The electrode material is made of electrically conductive textile. This creates a textile composite that guarantees high comfort for the user while ensuring good quality of ECG measurements. The composite is implemented by a carrier (a T-shirt with flame retardant and sensing electrodes embroidered with yarn based on a mixture of polyester coated with silver nanoparticles and cotton. The electrodes not only provide great comfort but are also antibacterial and antiallergic due to silver nanoparticles.
Measurement of Dynamic Resistance in Resistance Spot Welding
DEFF Research Database (Denmark)
Wu, Pei; Zhang, Wenqi; Bay, Niels
Through years, the dynamic resistance across the electrodes has been used for weld quality estimation and contact resistance measurement. However, the previous methods of determining the dynamic resistance were mostly based on measuring the voltage and current on the secondary side of the transfo......Through years, the dynamic resistance across the electrodes has been used for weld quality estimation and contact resistance measurement. However, the previous methods of determining the dynamic resistance were mostly based on measuring the voltage and current on the secondary side...... of the transformer in resistance welding machines, implying defects from induction noise and interference with the leads connected to the electrodes for measuring the voltage. In this study, the dynamic resistance is determined by measuring the voltage on the primary side and the current on the secondary side...
Origin of the transition voltage in gold–vacuum–gold atomic junctions
Wu, Kunlin
2012-12-13
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.
Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier
Directory of Open Access Journals (Sweden)
Abdel-Salam Mazen
2016-01-01
Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.
Pulsed voltage electrospray ion source and method for preventing analyte electrolysis
Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN
2011-12-27
An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.
Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.
1998-01-01
A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.
Electroencephalogram measurement using polymer-based dry microneedle electrode
Arai, Miyako; Nishinaka, Yuya; Miki, Norihisa
2015-06-01
In this paper, we report a successful electroencephalogram (EEG) measurement using polymer-based dry microneedle electrodes. The electrodes consist of needle-shaped substrates of SU-8, a silver film, and a nanoporous parylene protective film. Differently from conventional wet electrodes, microneedle electrodes do not require skin preparation and a conductive gel. SU-8 is superior as a structural material to poly(dimethylsiloxane) (PDMS; Dow Corning Toray Sylgard 184) in terms of hardness, which was used in our previous work, and facilitates the penetration of needles through the stratum corneum. SU-8 microneedles can be successfully inserted into the skin without breaking and could maintain a sufficiently low skin-electrode contact impedance for EEG measurement. The electrodes successfully measured EEG from the frontal pole, and the quality of acquired signals was verified to be as high as those obtained using commercially available wet electrodes without any skin preparation or a conductive gel. The electrodes are readily applicable to record brain activities for a long period with little stress involved in skin preparation to the users.
A HIGH CURRENT, HIGH VOLTAGE SOLID-STATE PULSE GENERATOR FOR THE NIF PLASMA ELECTRODE POCKELS CELL
International Nuclear Information System (INIS)
Arnold, P A; Barbosa, F; Cook, E G; Hickman, B C; Akana, G L; Brooksby, C A
2007-01-01
A high current, high voltage, all solid-state pulse modulator has been developed for use in the Plasma Electrode Pockels Cell (PEPC) subsystem in the National Ignition Facility. The MOSFET-switched pulse generator, designed to be a more capable plug-in replacement for the thyratron-switched units currently deployed in NIF, offers unprecedented capabilities including burst-mode operation, pulse width agility and a steady-state pulse repetition frequency exceeding 1 Hz. Capable of delivering requisite fast risetime, 17 kV flattop pulses into a 6 (Omega) load, the pulser employs a modular architecture characteristic of the inductive adder technology, pioneered at LLNL for use in acceleration applications, which keeps primary voltages low (and well within the capabilities of existing FET technology), reduces fabrication costs and is amenable to rapid assembly and quick field repairs
Study on the streamer inception characteristics under positive lightning impulse voltage
Directory of Open Access Journals (Sweden)
Zezhong Wang
2017-11-01
Full Text Available The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.
Study on the streamer inception characteristics under positive lightning impulse voltage
Wang, Zezhong; Geng, Yinan
2017-11-01
The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.
International Nuclear Information System (INIS)
Golota, V.I.; Zavada, L.M.; Karas, V.I.; Kotjukov, O.V.; Poliakov, O.V.; Pugach, S.G.
2007-01-01
We present the results of studies of the electrodynamic characteristics of a barrier less discharge with electrodes of the 'needle-plane' type and a high-voltage pulse of positive polarity, being applied to the edge electrode. The efficiency of ozone synthesis is determined as a function of the pulse duration and repetition rate. It is shown that the electrodynamic characteristics of the discharge and the effectiveness of ozone synthesis in oxygen-containing gas mixtures essentially depend on the parameters of the pulse supply
Measuring voltage transients with an ultrafast scanning tunneling microscope
DEFF Research Database (Denmark)
Keil, Ulrich Dieter Felix; Jensen, Jacob Riis; Hvam, Jørn Märcher
1997-01-01
circuit, where the tunneling tip is directly connected to the current amplifier of the scanning tunneling microscope, this dependence is eliminated. Ail results can be explained with coupling through the geometrical capacitance of the tip-electrode junction. By illuminating the current......We use an ultrafast scanning tunneling microscope to resolve propagating voltage transients in space and time. We demonstrate that the previously observed dependence of the transient signal amplitude on the tunneling resistance was only caused by the electrical sampling circuit. With a modified...
Li, Xiaoyan; Wang, Jun; Zhao, Yaping; Ge, Fengyan; Komarneni, Sridhar; Cai, Zaisheng
2016-10-05
The proposed approach for fabricating ultralight self-sustained electrodes facilitates the structural integration of highly flexible carbon nanofibers, amino-modified multiwalled carbon nanotubes (AM-MWNT), and MnO 2 nanoflakes for potential use in wearable supercapacitors. Because of the higher orientation of AM-MWNT and the sublimation of terephthalic acid (PTA) in the carbonization process, freestanding electrodes could be realized with high porosity and flexibility and could possess remarkable electrochemical properties without using polymer substrates. Wearable symmetric solid-state supercapacitors were further assembled using a LiCl/PVA gel electrolyte, which exhibit a maximum energy density of 44.57 Wh/kg (at a power density of 337.1 W/kg) and a power density of 13330 W/kg (at an energy density of 19.64 Wh/kg) with a working voltage as high as 1.8 V. Due to the combination of several favorable traits such as flexibility, high energy density, and excellent electrochemical cyclability, the presently developed wearable supercapacitors with wide potential windows are expected to be useful for new kinds of portable electric devices.
International Nuclear Information System (INIS)
Ruch, P.W.; Cericola, D.; Foelske-Schmitz, A.; Koetz, R.; Wokaun, A.
2010-01-01
Laboratory-scale electrochemical capacitor cells with bound activated carbon electrodes and acetonitrile-based electrolyte were aged at various elevated constant cell voltages between 2.75 V and 4.0 V. During the constant voltage tests, the cell capacitance as well as the capacitance and resistance of each electrode was determined. Following each aging experiment, the cells were analyzed by means of electrochemical impedance spectroscopy, and the individual electrodes were characterized by gas adsorption and X-ray photoelectron spectroscopy. At cell voltages above 3.0 V, the positive electrode ages much faster than the negative. Both the capacitance loss and resistance increase of the cell could be totally attributed to the positive electrode. At cell voltages above 3.5 V also the negative electrode aged significantly. X-ray photoelectron spectroscopy indicated the presence of degradation products on the electrode surface with a much thicker layer on the positive electrode. Simultaneously, a significant decrease in electrode porosity could be detected by gas adsorption.
Ion collection from laser-induced plasma by applying radio-frequency voltage
International Nuclear Information System (INIS)
Shibata, Takemasa; Ogura, Koichi
1995-01-01
Ions were collected on the electrodes from a laser resonance photoionized plasma by applying 1.8MHz radio-frequency voltage to the electrode. It was demonstrated that the ions are collected in a shorter time at the same kinetic energy of the collected ions compared with ion collection by applying DC voltage to the electrode. A simple one-dimensional model was extended for prediction of ion collection times in the cases of applications of not only the DC voltage but also the radio-frequency voltage. The ion collection times estimated using the simple one-dimensional model agreed with experimental values in both cases of DC and radio-frequency voltages. (author)
Evaluation of indices for voltage stability monitoring using PMU measurements
Directory of Open Access Journals (Sweden)
Sindy Lorena Ramirez Perdomo
2014-09-01
Full Text Available Large disturbances such as voltage collapse and its consequences represent a large challenge to the operational safety of power systems. Therefore, it is important to have indicators of the presence of voltage stability problems in real time. Using phasor measure-ments of voltage and current that are presented in Phasor Measurement Units (PMU, indices for voltage stability monitoring can be calculated in real time. This paper presents some indices for voltage stability monitoring using PMU measurements. Evaluation of such indices on a simplified system was carried out, and the indices were classified according to their method of calculation. Finally, one of these indices was used with the New England 39-bus system under different operating scenarios, including load increments, line output and generator output, to check the indices’ behavior for voltage stability monitoring based on synchronized local measurements.
Ansory, Achmad; Prajitno, Prawito; Wijaya, Sastra Kusuma
2018-02-01
Electrical Impedance Tomography (EIT) is an imaging method that is able to estimate electrical impedance distribution inside an object. This EIT system is developed by using 32 electrodes and microcontroller based module. From a pair of electrodes, sinusoidal current of 3 mA is injected and the voltage differences between other pairs of electrodes are measured. Voltage measurement data are then sent to MATLAB and EIDORS software; the data are used to reconstruct two dimensions image. The system can detect and determine the position of a phantom in the tank. The object's position is accurately reconstructed and determined with the average shifting of 0.69 cm but object's area cannot be accurately reconstructed. The object's image is more accurately reconstructed when the object is located near to electrodes, has a larger size, and when the current injected to the system has a frequency of 100 kHz or 200kHz.
Inan, O T; Kovacs, G T A
2010-04-01
A novel two-electrode biosignal amplifier circuit is demonstrated by using a composite transimpedance amplifier input stage with active current feedback. Micropower, low gain-bandwidth product operational amplifiers can be used, leading to the lowest reported overall power consumption in the literature for a design implemented with off-the-shelf commercial integrated circuits (11 μW). Active current feedback forces the common-mode input voltage to stay within the supply rails, reducing baseline drift and amplifier saturation problems that can be present in two-electrode systems. The bandwidth of the amplifier extends from 0.05-200 Hz and the midband voltage gain (assuming an electrode-to-skin resistance of 100 kΩ) is 48 dB. The measured output noise level is 1.2 mV pp, corresponding to a voltage signal-to-noise ratio approaching 50 dB for a typical electrocardiogram (ECG) level input of 1 mVpp. Recordings were taken from a subject by using the proposed two-electrode circuit and, simultaneously, a three-electrode standard ECG circuit. The residual of the normalized ensemble averages for both measurements was computed, and the power of this residual was 0.54% of the power of the standard ECG measurement output. While this paper primarily focuses on ECG applications, the circuit can also be used for amplifying other biosignals, such as the electroencephalogram.
Accuracy of Plantar Electrodes Compared with Hand and Foot Electrodes in Fat-free-mass Measurement
Directory of Open Access Journals (Sweden)
Michel Y. Jaffrin
2014-01-01
Full Text Available This paper investigates the measurement of fat-free mass (FFM by bioimpedance using foot-to-foot impedancemeters (FFI with plantar electrodes measuring the foot-to-foot resistance R34 and hand-to-foot medical impedancemeters. FFM measurements were compared with corresponding data using Dual X-ray absorptiometry (DXA. Equations giving FFM were established using linear multiple regression on DXA data in a first group of 170 subjects. For validation, these equations were used on a second group of 86 subjects, and FFM were compared with DXA data; no significant difference was observed. The same protocol was repeated, but using electrodes on the right hand and foot in standing position to measure the hand to-foot resistance R13. Mean differences with DXA were higher for R13 than for R34. Effect of electrode size and feet position on resistance was also investigated. R34 decreased when electrode area increased or if feet were moved forward. It decreased if feet were moved backward. A proper configuration of contact electrodes can improve measurement accuracy and reproducibility of FFI.
Energy Technology Data Exchange (ETDEWEB)
Hourdakis, C J, E-mail: khour@gaec.gr [Ionizing Radiation Calibration Laboratory-Greek Atomic Energy Commission, PO Box 60092, 15310 Agia Paraskevi, Athens, Attiki (Greece)
2011-04-07
The practical peak voltage (PPV) has been adopted as the reference measuring quantity for the x-ray tube voltage. However, the majority of commercial kV-meter models measure the average peak, U-bar{sub P}, the average, U-bar, the effective, U{sub eff} or the maximum peak, U{sub P} tube voltage. This work proposed a method for determination of the PPV from measurements with a kV-meter that measures the average U-bar or the average peak, U-bar{sub p} voltage. The kV-meter reading can be converted to the PPV by applying appropriate calibration coefficients and conversion factors. The average peak k{sub PPV,kVp} and the average k{sub PPV,Uav} conversion factors were calculated from virtual voltage waveforms for conventional diagnostic radiology (50-150 kV) and mammography (22-35 kV) tube voltages and for voltage ripples from 0% to 100%. Regression equation and coefficients provide the appropriate conversion factors at any given tube voltage and ripple. The influence of voltage waveform irregularities, like 'spikes' and pulse amplitude variations, on the conversion factors was investigated and discussed. The proposed method and the conversion factors were tested using six commercial kV-meters at several x-ray units. The deviations between the reference and the calculated - according to the proposed method - PPV values were less than 2%. Practical aspects on the voltage ripple measurement were addressed and discussed. The proposed method provides a rigorous base to determine the PPV with kV-meters from U-bar{sub p} and U-bar measurement. Users can benefit, since all kV-meters, irrespective of their measuring quantity, can be used to determine the PPV, complying with the IEC standard requirements.
Hartveit, Espen; Veruki, Margaret Lin
2010-03-15
Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.
Automatic control and detector for three-terminal resistance measurement
Fasching, George E.
1976-10-26
A device is provided for automatic control and detection in a three-terminal resistance measuring instrument. The invention is useful for the rapid measurement of the resistivity of various bulk material with a three-terminal electrode system. The device maintains the current through the sample at a fixed level while measuring the voltage across the sample to detect the sample resistance. The three-electrode system contacts the bulk material and the current through the sample is held constant by means of a control circuit connected to a first of the three electrodes and works in conjunction with a feedback controlled amplifier to null the voltage between the first electrode and a second electrode connected to the controlled amplifier output. An A.C. oscillator provides a source of sinusoidal reference voltage of the frequency at which the measurement is to be executed. Synchronous reference pulses for synchronous detectors in the control circuit and an output detector circuit are provided by a synchronous pulse generator. The output of the controlled amplifier circuit is sampled by an output detector circuit to develop at an output terminal thereof a D.C. voltage which is proportional to the sample resistance R. The sample resistance is that segment of the sample between the area of the first electrode and the third electrode, which is connected to ground potential.
International Nuclear Information System (INIS)
Bruggeman, Peter; Graham, Leigh; Groote, Joris de; Vierendeels, Jan; Leys, Christophe
2007-01-01
Electrical breakdown and water surface deformation in a metal pin-water electrode system with dc applied voltages is studied for small inter-electrode distances (2-12 mm). The radius of curvature of the metal pin is 0.5 cm to exclude corona before breakdown at these small inter-electrode spacings. Calculations of the water surface deformation as a function of the applied voltage and initial inter-electrode spacing are compared with measurements of the water elevation. For distances smaller than 7 mm the calculated stability limit of the water surface corresponds with the experimentally obtained breakdown voltage. It is proved with fast CCD images and calculations of the electrical field distribution that the water surface instability triggers the electrical breakdown in this case. The images show that at breakdown the water surface has a Taylor cone-like shape. At inter-electrode distance of 7 mm and larger the breakdown voltage is well below the water stability limit and the conductive channel at breakdown is formed between the pin electrode and the static water surface. Both cases are discussed and compared
Design of High Voltage Electrical Breakdown Strength measuring system at 1.8K with a G-M cryocooler
Li, Jian; Huang, Rongjin; Li, Xu; Xu, Dong; Liu, Huiming; Li, Laifeng
2017-09-01
Impregnating resins as electrical insulation materials for use in ITER magnets and feeder system are required to be radiation stable, good mechanical performance and high voltage electrical breakdown strength. In present ITER project, the breakdown strength need over 30 kV/mm, for future DEMO reactor, it will be greater than this value. In order to develop good property insulation materials to satisfy the requirements of future fusion reactor, high voltage breakdown strength measurement system at low temperature is necessary. In this paper, we will introduce our work on the design of this system. This measuring system has two parts: one is an electrical supply system which provides the high voltage from a high voltage power between two electrodes; the other is a cooling system which consists of a G-M cryocooler, a superfluid chamber and a heat switch. The two stage G-M cryocooler pre-cool down the system to 4K, the superfluid helium pot is used for a container to depress the helium to superfluid helium which cool down the sample to 1.8K and a mechanical heat switch connect or disconnect the cryocooler and the pot. In order to provide the sufficient time for the test, the cooling system is designed to keep the sample at 1.8K for 300 seconds.
Vail, W.B. III.
1989-11-21
Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of differential current conducted into formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas are present. Lithological characteristics of the formation such as the presence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes. 48 figs.
A model for electrode effects using percolation theory
International Nuclear Information System (INIS)
Wuethrich, R.; Bleuler, H.
2004-01-01
Electrode effects are known for more than 150 years. These effects, with undesirable consequences in industrial aluminium electrolysis, can be used to micro-machine glass with Spark Assisted Chemical Engraving (SACE). In this paper, a novel approach for theoretical analysis of the phenomenon is proposed by considering the bubble growth and bubble departure from electrodes as a stochastic process. The critical conditions (critical voltage and current density) are predicted in function of electrode geometry and electrolyte concentration as well as the static mean current-voltage characteristics prior to the onset of the effects. The different regions of the current-voltage characteristics, as identified by previous authors, are described and explained. It is shown that all relevant processes for the onset of the electrodes effects happen in the adherence region of the bubble layer. The model is applied for vertical cylindrical electrodes and compared with experimental data
Electrochemical impedance measurement of a carbon nanotube probe electrode
International Nuclear Information System (INIS)
Inaba, Akira; Takei, Yusuke; Kan, Tetsuo; Shimoyama, Isao; Matsumoto, Kiyoshi
2012-01-01
We measured and analyzed the electrochemical impedance of carbon nanotube (CNT) probe electrodes fabricated through the physical separation of insulated CNT bridges. The fabricated CNT electrodes were free-standing CNTs that were completely covered with an insulator, except for their tips. Typical dimensions of the nanoelectrodes were 1–10 nm in CNT diameter, 80–300 nm in insulator diameter, 0.5–4 μm in exposed CNT length and 1–10 μm in probe length. The electrochemical impedance at frequencies ranging from 40 Hz to 1 MHz was measured in physiological saline. The measured impedance of the CNT electrode was constant at 32 MΩ at frequencies below 1 kHz and was inversely proportional to frequency at frequencies above 10 kHz. By means of comparison with the parasitic capacitive impedance of the insulator membrane, we confirmed that the electrode was sufficiently insulated such that the measured constant impedance was given by the exposed CNT tip. Consequently, we can use the CNT electrode for highly localized electrochemical impedance measurements below 1 kHz. Considering an equivalent circuit and the nanoscopic dimensions of the CNT electrode, we demonstrated that the constant impedance was governed by diffusion impedance, whereas the solution resistance, charge-transfer resistance and double-layer capacitance were negligible. (paper)
Beam based measurement of beam position monitor electrode gains
Directory of Open Access Journals (Sweden)
D. L. Rubin
2010-09-01
Full Text Available Low emittance tuning at the Cornell Electron Storage Ring (CESR test accelerator depends on precision measurement of vertical dispersion and transverse coupling. The CESR beam position monitors (BPMs consist of four button electrodes, instrumented with electronics that allow acquisition of turn-by-turn data. The response to the beam will vary among the four electrodes due to differences in electronic gain and/or misalignment. This variation in the response of the BPM electrodes will couple real horizontal offset to apparent vertical position, and introduce spurious measurements of coupling and vertical dispersion. To alleviate this systematic effect, a beam based technique to measure the relative response of the four electrodes has been developed. With typical CESR parameters, simulations show that turn-by-turn BPM data can be used to determine electrode gains to within ∼0.1%.
Beam based measurement of beam position monitor electrode gains
Rubin, D. L.; Billing, M.; Meller, R.; Palmer, M.; Rendina, M.; Rider, N.; Sagan, D.; Shanks, J.; Strohman, C.
2010-09-01
Low emittance tuning at the Cornell Electron Storage Ring (CESR) test accelerator depends on precision measurement of vertical dispersion and transverse coupling. The CESR beam position monitors (BPMs) consist of four button electrodes, instrumented with electronics that allow acquisition of turn-by-turn data. The response to the beam will vary among the four electrodes due to differences in electronic gain and/or misalignment. This variation in the response of the BPM electrodes will couple real horizontal offset to apparent vertical position, and introduce spurious measurements of coupling and vertical dispersion. To alleviate this systematic effect, a beam based technique to measure the relative response of the four electrodes has been developed. With typical CESR parameters, simulations show that turn-by-turn BPM data can be used to determine electrode gains to within ˜0.1%.
The LMF triaxial MITL voltage adder system
International Nuclear Information System (INIS)
Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.
1992-01-01
The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed
High performance cermet electrodes
Isenberg, Arnold O.; Zymboly, Gregory E.
1986-01-01
Disclosed is a method of increasing the operating cell voltage of a solid oxide electrochemical cell having metal electrode particles in contact with an oxygen-transporting ceramic electrolyte. The metal electrode is heated with the cell, and oxygen is passed through the oxygen-transporting ceramic electrolyte to the surface of the metal electrode particles so that the metal electrode particles are oxidized to form a metal oxide layer between the metal electrode particles and the electrolyte. The metal oxide layer is then reduced to form porous metal between the metal electrode particles and the ceramic electrolyte.
Indirect Electrochemical Oxidation with Multi Carbon Electrodes for Restaurant Wastewater Treatment
Directory of Open Access Journals (Sweden)
I Dewa Ketut Sastrawidana
2018-01-01
Full Text Available The removal of organic matter from the restaurant wastewater was investigated using the electrochemical oxida-tion method with multi carbon electrodes in a parallel construction. The degradation process was monitored by the measurement of COD concentration as a function of electrolysis time. The effectof operating parameter conditions on COD removal were investigated including initial pH, distance between electrodes, and the applied voltage difference.The results showed that the treatment of restaurant wastewater containing 2 g/L chloride ion using the electrochemical oxidation technique at the operation conditions characterized by: pH 5, distance between electrode of 10 cm and applied voltage of 12 V, enabled to obtained COD removal of 92.84% within 90 min electrolysis time. It is can be concluded that the indirect electrochemical oxidation method with multi carbon electrodes can be used effectivelyas an alternative technology for reducing COD and may be potentially applied for removal organic pollutants from wastewater at the industrial scale.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Optical sensors for the measurement of electric current and voltage
Energy Technology Data Exchange (ETDEWEB)
Rutgers, W R; Hulshof, H J.M.; Laurensse, I J; van der Wey, A H
1987-01-01
Optical sensors for the measurement of electrical current and voltage were developed for application in electric power systems. The current sensor, based on the Faraday effect in a monomode glass fiber, and the voltage sensor, based on the transverse Pockels effect in a crystal, are demonstrated in wide-band (10 MHz) interference-free measurements of pulsed currents and impulse voltages.
Safavi-Naeini, Payam; Zafar-Awan, Dreema; Zhu, Hongjian; Zablah, Gerardo; Ganapathy, Anand V; Rasekh, Abdi; Saeed, Mohammad; Razavi, Joanna Esther Molina; Razavi, Mehdi
2017-01-01
Current methods for measuring voltage during radiofrequency (RF) ablation (RFA) necessitate turning off the ablation catheter. If voltage could be accurately read without signal attenuation during RFA, turning off the catheter would be unnecessary, allowing continuous ablation. We evaluated the accuracy of the Thermocool SMARTTOUCH catheter for measuring voltage while RF traverses the catheter. We studied 26 patients undergoing RFA for arrhythmias. A 7.5F SMARTTOUCH catheter was used for sensing voltage and performing RFA. Data were collected from the Carto-3 3-dimensional mapping system. Voltages were measured during ablation (RF-ON) and immediately before or after ablation (RF-OFF). In evaluating the accuracy of RF-ON measurements, we utilized the RF-OFF measure as the gold standard. We measured 465 voltage signals. The median values were 0.2900 and 0.3100 for RF-ON and RF-OFF, respectively. Wilcoxon signed rank testing showed no significant difference in these values (P = 0.608). The intraclass correlation coefficient (ICC) was 0.96, indicating that voltage measurements were similarly accurate during RF-OFF versus RF-ON. Five patients had baseline atrial fibrillation (AF), for whom 82 ablation points were measured; 383 additional ablation points were measured for the remaining patients. The voltages measured during RF-ON versus RF-OFF were similar in the presence of AF (P = 0.800) versus non-AF rhythm (P = 0.456) (ICC, 0.96 for both). Voltage signal measurement was similarly accurate during RF-ON versus RF-OFF independent of baseline rhythm. Physicians should consider not turning off the SMARTTOUCH ablation catheter when measuring voltage during RFA. © 2016 Wiley Periodicals, Inc.
High voltage holding in the negative ion sources with cesium deposition
Energy Technology Data Exchange (ETDEWEB)
Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)
2016-02-15
High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.
Radiation effects on residual voltage of polyethylene films
International Nuclear Information System (INIS)
Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.
1986-01-01
It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)
New Insights into the Operating Voltage of Aqueous Supercapacitors.
Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong
2018-03-12
The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of low-pressure dc breakdown in nitrogen between two spherical iron electrodes
International Nuclear Information System (INIS)
Pejovic, Momcilo M.; Nesic, Nikola T.; Pejovic, Milic M.
2006-01-01
The influence of afterglow period τ, voltage increase rate k, and electrode gap d on breakdown voltage U b for a nitrogen-filled tube with spherical electrodes of diameter D>>d and p=6.5 mbar has been investigated. The data for the breakdown voltage were obtained for the case when there is a presence of N( 4 S) atoms, which release secondary electrons via recombination on the cathode. By fitting the experimental data of breakdown voltage mean values as a function of the voltage increase rate, the static breakdown voltages for afterglow periods of 15 and 100 s were estimated. The electrical field as a function of the electrode gap using breakdown voltage mean values was also determined. It is shown that experimental results of the breakdown voltage mean value as a function of pd in the interval of d from 0.82 to 1.62 mm can be very well described with Paschen's law, valid for the case of parallel-plate electrodes
Iron-substituted AB5-type MH electrode
Indian Academy of Sciences (India)
To study their electrochemical properties via measurements of discharge capacity, activation ... the higher electron attracting power of Fe, when substituted in small .... The phase analysis through XRD .... Only a small extra XRD peak of CeO2 is present in the alloy .... The open circuit voltage of MH electrode with respect to ...
International Nuclear Information System (INIS)
Wilken, L.; Hoffmann, V.; Wetzig, K.
2006-01-01
A radio frequency (rf) Grimm-type glow discharge source for the chemical analysis of solid samples, with integrated voltage and current probes, was developed. All elements of a plasma equivalent circuit are determined from the measured current-voltage characteristics. The procedure is based on the independent evaluation of the ion current and electron current region. The physical meaning of the parameters is investigated by comparisons with measurements from dc glow discharges. We found that the reduced rf current of the powered electrode is comparable to the reduced current in dc discharges. A formula is developed that corrects the reduced current due to gas heating. The sheath thickness at the powered rf electrode is evaluated and is between 75 and 1100 μm. The voltage of the bulk plasma is in the range 2-15 V, and the resistance is between 30 and 400 Ω. The bulk plasma consumes about 3% of the total power, and the reduced voltage is comparable to the reduced electrical field in the positive column of direct current discharges. The sheath voltage at the grounded electrode is in the range 25-100 V, the capacities are between 10 and 400 pF, and the resistances are in the range 100 Ω-5000 Ω. We also found invariants for the evaluated sheath parameters
Assessing the degradation of compliant electrodes for soft actuators
Rosset, Samuel; de Saint-Aubin, Christine; Poulin, Alexandre; Shea, Herbert R.
2017-10-01
We present an automated system to measure the degradation of compliant electrodes used in dielectric elastomer actuators (DEAs) over millions of cycles. Electrodes for DEAs generally experience biaxial linear strains of more than 10%. The decrease in electrode conductivity induced by this repeated fast mechanical deformation impacts the bandwidth of the actuator and its strain homogeneity. Changes in the electrode mechanical properties lead to reduced actuation strain. Rather than using an external actuator to periodically deform the electrodes, our measurement method consists of measuring the properties of an electrode in an expanding circle DEA. A programmable high voltage power supply drives the actuator with a square signal up to 1 kHz, periodically actuating the DEA, and thus stretching the electrodes. The DEA strain is monitored with a universal serial bus camera, while the resistance of the ground electrode is measured with a multimeter. The system can be used for any type of electrode. We validated the test setup by characterising a carbon black/silicone composite that we commonly use as compliant electrode. Although the composite is well-suited for tens of millions of cycles of actuation below 5%, we observe important degradation for higher deformations. When activated at a 20% radial strain, the electrodes suffer from important damage after a few thousand cycles, and an inhomogeneous actuation is observed, with the strain localised in a sub-region of the actuator only.
The high-sensitive magnetic levitated electrode ionization chamber of the noncontacting type
International Nuclear Information System (INIS)
Kawaguchi, Toshiro; Yoshimura, Atsushi
1999-01-01
There are two types of ionization chamber using magnetically levitated electrode: one is that by Tanaka et al. and the other, by authors'. The latter lacks the sensitivity relative to the former and thereby to solve the problem, authors made an improvement so that the electrode charge could be readout by noncontact after the leviated electrode was electrified by noncontact for an interval. This new type ionization chamber made it possible to measure the quite low dose radiation with stability and high sensitivity. Actually, the electrode was suspended by the teflon thread fixed on the steel cup levitated magnetically in the ionization chamber of which wall was covered by Al and equipped with an electrostatic charger for the electrode by noncontact. After measurement, the electrode was moved in the Faraday cage placed under the chamber to readout the voltage. For operation conditions of the apparatus, observation was done on the relationship between ionization current by 137 Cs and the applied voltage. For actual measurement, ionizations by low dose γ ray derived from KCl which containing 40 K in a small amount and by Rn at the fine and rainy days were measured. The exposure rate by KCl (500 g bottle) was found to be 12.7 x 10 -10 C/kg·h with the background value of 9.8 x 10 -10 . Rn concentrations in the air were 112.3 and 18.34 Bq/m 3 for 1 hr in the rainy and fine day, respectively, in Fukuoka City. (K.H.)
Classification of methods for measuring current-voltage characteristics of semiconductor devices
Directory of Open Access Journals (Sweden)
Iermolenko Ia. O.
2014-06-01
Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.
Study of electric field distorted by space charges under positive lightning impulse voltage
Wang, Zezhong; Geng, Yinan
2018-03-01
Actually, many insulation problems are related to electric fields. And measuring electric fields is an important research topic of high-voltage engineering. In particular, the electric field distortion caused by space charge is the basis of streamer theory, and thus quantitatively measuring the Poisson electric field caused by space charge is significant to researching the mechanism of air gap discharge. In this paper, we used our photoelectric integrated sensor to measure the electric field distribution in a 1-m rod-plane gap under positive lightning impulse voltage. To verify the reliability of this quantitative measurement, we compared the measured results with calculated results from a numerical simulation. The electric-field time domain waveforms on the axis of the 1-m rod-plane out of the space charge zone were measured with various electrodes. The Poisson electric fields generated by space charge were separated from the Laplace electric field generated by applied voltages, and the amplitudes and variations were measured for various applied voltages and at various locations. This work also supplies the feasible basis for directly measuring strong electric field under high voltage.
Zhou, Ge; Wang, Qiyu; Wang, Shuo; Ling, Shigang; Zheng, Jieyun; Yu, Xiqian; Li, Hong
2018-04-01
The post mortem electrochemical analysis, including charge-discharge and electrochemical impedance spectroscopy (EIS) measurements, are critical steps for revealing the failure mechanisms of commercial lithium-ion batteries (LIBs). These post measurements usually require the reassembling of coin-cell with electrode which is often double-side-coated in commercial LIBs. It is difficult to use such double-side-coated electrode to perform accurate electrochemical measurements because the back side of the electrode is coated with active materials, rather than single-side-coated electrode that is often used in coin-cell measurements. In this study, we report a facile tape-covering sample preparation method, which can effectively suppress the influence of back side of the double-side-coated electrodes on capacity and EIS measurements in coin-cells. By tape-covering the unwanted side, the areal capacity of the desired investigated side of the electrode has been accurately measured with an experimental error of about 0.5% at various current densities, and accurate EIS measurements and analysis have been conducted as well.
Prediction of breakdown voltages in novel gases for high voltage insulation
International Nuclear Information System (INIS)
Koch, M.
2015-01-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media
Characterization of textile electrodes and conductors using standardized measurement setups
International Nuclear Information System (INIS)
Beckmann, L; Neuhaus, C; Medrano, G; Walter, M; Leonhardt, S; Jungbecker, N; Gries, T
2010-01-01
Textile electrodes and conductors are being developed and used in different monitoring scenarios, such as ECG or bioimpedance spectroscopy measurements. Compared to standard materials, conductive textile materials offer improved wearing comfort and enable long-term measurements. Unfortunately, the development and investigation of such materials often suffers from the non-reproducibility of the test scenarios. For example, the materials are generally tested on human skin which is difficult since the properties of human skin differ for each person and can change within hours. This study presents two test setups which offer reproducible measurement procedures for the systematic analysis of textile electrodes and conductors. The electrode test setup was designed with a special skin dummy which allows investigation of not only the electrical properties of textile electrodes but also the contact behavior between electrode and skin. Using both test setups, eight textile electrodes and five textile conductors were analyzed and compared
Device for measurement of gas mass flow. Einrichtung zur Gasmassenstrommessung
Energy Technology Data Exchange (ETDEWEB)
Sass, W
1989-09-28
The invention is concerned with a device for the measurement of gas mass flow, particularly measuring air mass flow for vehicles with internal combustion engines, with a measurement bridge, in one branch of which a gas flow resistance, particularly a hot film sensor, with gas flowing round it, is connected in series with a measurement resistance and in another branch of which a compensation resistance measuring the gas temperature is connected in series with a fixed resistor, where the bridge differential voltage is measured in the zero branch of the measuring bridge and a control parameter is produced from this, in order to control a transistor valve situated in the bridge supply path of a DC voltage source via its control electrode until the bridge is balanced, and where the voltage at the measurement resistance after the bridge is balanced is used as a measure of the gas mass flow. In order to obtain exact results of measurement in spite of relatively high interference noise from the cables, it is proposed that an increased supply DC voltage appreciably decreasing the occurring interference noise from the cables should be produced from a small DC voltage and that the output of the DC/DC voltage converter should be connected to the control electrode of the transistor valve, so that the control parameter for the control electrode is derived from the raised DC supply voltage through reducers depending on the gas flow.
Technological Aspects: High Voltage
Faircloth, D.C.
2013-12-16
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.
Vail, W.B. III.
1991-08-27
Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation. 9 figures.
Vail, III, William B.
1991-01-01
Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation.
Determination of the cathode and anode voltage drops in high power low-pressure amalgam lamps
International Nuclear Information System (INIS)
Vasilyak, L. M.; Vasiliev, A. I.; Kostyuchenko, S. V.; Sokolov, D. V.; Startsev, A. Yu.; Kudryavtsev, N. N.
2011-01-01
For the first time, cathode and anode drops of powerful low-pressure amalgam lamps were measured. The lamp discharge current is 3.2 A, discharge current frequency is 43 kHz, linear electric power is 2.4 W/cm. The method of determination of a cathode drop is based on the change of a lamp operating voltage at variation of the electrode filament current at constant discharge current. The total (cathode plus anode) drop of voltage was measured by other, independent ways. The maximum cathode fall is 10.8 V; the anode fall corresponding to the maximal cathode fall is 2.4 V. It is shown that in powerful low pressure amalgam lamps the anode fall makes a considerable contribution (in certain cases, the basic one) to heating of electrodes. Therefore, the anode fall cannot be neglected, at design an electrode and ballast of amalgam lamps with operating discharge current frequency of tens of kHz.
Determination of the cathode and anode voltage drops in high power low-pressure amalgam lamps
Energy Technology Data Exchange (ETDEWEB)
Vasilyak, L. M., E-mail: vasilyak@ihed.ras.ru [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation); Vasiliev, A. I., E-mail: vasiliev@npo.lit.ru; Kostyuchenko, S. V.; Sokolov, D. V.; Startsev, A. Yu. [Joint Stock Company NPO LIT (Russian Federation); Kudryavtsev, N. N. [Moscow Institute of Physics and Technology (State University) (Russian Federation)
2011-12-15
For the first time, cathode and anode drops of powerful low-pressure amalgam lamps were measured. The lamp discharge current is 3.2 A, discharge current frequency is 43 kHz, linear electric power is 2.4 W/cm. The method of determination of a cathode drop is based on the change of a lamp operating voltage at variation of the electrode filament current at constant discharge current. The total (cathode plus anode) drop of voltage was measured by other, independent ways. The maximum cathode fall is 10.8 V; the anode fall corresponding to the maximal cathode fall is 2.4 V. It is shown that in powerful low pressure amalgam lamps the anode fall makes a considerable contribution (in certain cases, the basic one) to heating of electrodes. Therefore, the anode fall cannot be neglected, at design an electrode and ballast of amalgam lamps with operating discharge current frequency of tens of kHz.
Breast EIT using a new projected image reconstruction method with multi-frequency measurements.
Lee, Eunjung; Ts, Munkh-Erdene; Seo, Jin Keun; Woo, Eung Je
2012-05-01
We propose a new method to produce admittivity images of the breast for the diagnosis of breast cancer using electrical impedance tomography(EIT). Considering the anatomical structure of the breast, we designed an electrode configuration where current-injection and voltage-sensing electrodes are separated in such a way that internal current pathways are approximately along the tangential direction of an array of voltage-sensing electrodes. Unlike conventional EIT imaging methods where the number of injected currents is maximized to increase the total amount of measured data, current is injected only twice between two pairs of current-injection electrodes attached along the circumferential side of the breast. For each current injection, the induced voltages are measured from the front surface of the breast using as many voltage-sensing electrodes as possible. Although this electrode configurational lows us to measure induced voltages only on the front surface of the breast,they are more sensitive to an anomaly inside the breast since such an injected current tends to produce a more uniform internal current density distribution. Furthermore, the sensitivity of a measured boundary voltage between two equipotential lines on the front surface of the breast is improved since those equipotential lines are perpendicular to the primary direction of internal current streamlines. One should note that this novel data collection method is different from those of other frontal plane techniques such as the x-ray projection and T-scan imaging methods because we do not get any data on the plane that is perpendicular to the current flow. To reconstruct admittivity images using two measured voltage data sets, a new projected image reconstruction algorithm is developed. Numerical simulations demonstrate the frequency-difference EIT imaging of the breast. The results show that the new method is promising to accurately detect and localize small anomalies inside the breast.
Breast EIT using a new projected image reconstruction method with multi-frequency measurements
International Nuclear Information System (INIS)
Lee, Eunjung; Ts, Munkh-Erdene; Seo, Jin Keun; Woo, Eung Je
2012-01-01
We propose a new method to produce admittivity images of the breast for the diagnosis of breast cancer using electrical impedance tomography (EIT). Considering the anatomical structure of the breast, we designed an electrode configuration where current-injection and voltage-sensing electrodes are separated in such a way that internal current pathways are approximately along the tangential direction of an array of voltage-sensing electrodes. Unlike conventional EIT imaging methods where the number of injected currents is maximized to increase the total amount of measured data, current is injected only twice between two pairs of current-injection electrodes attached along the circumferential side of the breast. For each current injection, the induced voltages are measured from the front surface of the breast using as many voltage-sensing electrodes as possible. Although this electrode configuration allows us to measure induced voltages only on the front surface of the breast, they are more sensitive to an anomaly inside the breast since such an injected current tends to produce a more uniform internal current density distribution. Furthermore, the sensitivity of a measured boundary voltage between two equipotential lines on the front surface of the breast is improved since those equipotential lines are perpendicular to the primary direction of internal current streamlines. One should note that this novel data collection method is different from those of other frontal plane techniques such as the x-ray projection and T-scan imaging methods because we do not get any data on the plane that is perpendicular to the current flow. To reconstruct admittivity images using two measured voltage data sets, a new projected image reconstruction algorithm is developed. Numerical simulations demonstrate the frequency-difference EIT imaging of the breast. The results show that the new method is promising to accurately detect and localize small anomalies inside the breast. (paper)
First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment
Energy Technology Data Exchange (ETDEWEB)
König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)
2017-11-15
Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.
International Nuclear Information System (INIS)
Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj
2009-01-01
This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology
Anderson, Karl F. (Inventor); Parker, Allen R., Jr. (Inventor)
1993-01-01
A constant current loop measuring system measures a property including the temperature of a sensor responsive to an external condition being measured. The measuring system includes thermocouple conductors connected to the sensor, sensing first and second induced voltages responsive to the external condition. In addition, the measuring system includes a current generator and reverser generating a constant current, and supplying the constant current to the thermocouple conductors in forward and reverse directions generating first and second measured voltages, and a determining unit receiving the first and second measured voltages from the current generator and reverser, and determining the temperature of the sensor responsive to the first and second measured voltages.
High-voltage test and measuring techniques
Hauschild, Wolfgang
2014-01-01
It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.
International Nuclear Information System (INIS)
Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.
2016-01-01
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Energy Technology Data Exchange (ETDEWEB)
Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.
2016-07-11
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Current-voltage-temperature characteristics of DNA origami
Energy Technology Data Exchange (ETDEWEB)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)
2009-04-29
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Current-voltage-temperature characteristics of DNA origami
International Nuclear Information System (INIS)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander
2009-01-01
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
An ionization chamber with magnetic levitated electrodes
Kawaguchi, T
1999-01-01
A new type of ionization chamber which has magnetically levitated electrodes has been developed. The electrodes are supplied voltages for the repelling of ions by a battery which is also levitated with the electrodes. The characteristics of this ionization chamber are investigated in this paper.
Filtration influence in a constant potential X-ray machine peak voltage measurements
Energy Technology Data Exchange (ETDEWEB)
Santos, L.R.; Vivolo, V.; Xavier, M.; Potiens, M.P.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Navarro, M.V.T., E-mail: dossantos.lucasrodrigues@gmail.com [Instituto Federal de Educacao, Ciencia e Tecnologia da Bahia (IFBA), Salvador (Brazil)
2017-09-01
This work shows the peak voltage measurements for several beam filtrations used in diagnostic radiology, using two types of non-invasive detectors; a voltage meter and a high-resolution spectrometer. The technique chosen for the voltage peak measurements with the spectrometer was the endpoint. The results were compared to the measured ones and showed good similarity to the nominal values. However the voltage meter detector used in this work presented errors for heavier filtrations. (author)
Prediction of breakdown voltages in novel gases for high voltage insulation
Energy Technology Data Exchange (ETDEWEB)
Koch, M.
2015-07-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.
Electrode for improving electrochemical measurements in high temperature water
International Nuclear Information System (INIS)
Sengarsai, T.
2005-01-01
A silver/silver-chloride (Ag/AgCl) reference electrode was specially designed and constructed in a body of oxidized titanium for potentiometric measurements under high-temperature and high-pressure conditions. To avoid the thermal decomposition of silver-chloride, the electrode is designed to maintain the reference element at low temperature while it is still connected to high-temperature process zone via a non-isothermal electrolyte bridge. This configuration leads to the development of a thermal gradient along the length of the electrode. At room temperature, the stability of the Ag/AgCl reference electrode versus a standard calomel electrode (SCE) is maintained with an accuracy of 5 mV. The electrode's performance at high temperature and pressure (up to 300 o C and 1500 psi) was examined by measuring the potential difference against platinum, which acted as a reversible hydrogen electrode (RHE). Comparison of the experimental and theoretical values verifies the reliability and reproducibility of the electrode. Deviation from the Nernst equation is considered and related to the thermal liquid junction potential (TLJP). An empirical correction factor is used to maintain the Ag/AgCl potential within an acceptable accuracy limit of ±20 mV at high temperature. (author)
Engebretsen, Erik; Hinds, Gareth; Meyer, Quentin; Mason, Tom; Brightman, Edward; Castanheira, Luis; Shearing, Paul R.; Brett, Daniel J. L.
2018-04-01
Advances in bespoke diagnostic techniques for polymer electrolyte fuel cells continue to provide unique insight into the internal operation of these devices and lead to improved performance and durability. Localised measurements of current density have proven to be extremely useful in designing better fuel cells and identifying optimal operating strategies, with electrochemical impedance spectroscopy (EIS) now routinely used to deconvolute the various losses in fuel cells. Combining the two techniques provides another dimension of understanding, but until now each localised EIS has been based on 2-electrode measurements, composed of both the anode and cathode responses. This work shows that a reference electrode array can be used to give individual electrode-specific EIS responses, in this case the cathode is focused on to demonstrate the approach. In addition, membrane hydration dynamics are studied under current load steps from open circuit voltage. A three-stage process is identified associated with an initial rapid reduction in membrane resistance after 10 s of applying a current step, followed by a slower ramp to approximately steady state, which was achieved after ∼250 s. These results support previously published work that has looked at membrane swelling dynamics and reveal that membrane hydration/membrane resistance is highly heterogeneous.
Technological Aspects: High Voltage
International Nuclear Information System (INIS)
Faircloth, D C
2013-01-01
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)
General Voltage Feedback Circuit Model in the Two-Dimensional Networked Resistive Sensor Array
Directory of Open Access Journals (Sweden)
JianFeng Wu
2015-01-01
Full Text Available To analyze the feature of the two-dimensional networked resistive sensor array, we firstly proposed a general model of voltage feedback circuits (VFCs such as the voltage feedback non-scanned-electrode circuit, the voltage feedback non-scanned-sampling-electrode circuit, and the voltage feedback non-scanned-sampling-electrode circuit. By analyzing the general model, we then gave a general mathematical expression of the effective equivalent resistor of the element being tested in VFCs. Finally, we evaluated the features of VFCs with simulation and test experiment. The results show that the expression is applicable to analyze the VFCs’ performance of parameters such as the multiplexers’ switch resistors, the nonscanned elements, and array size.
International Nuclear Information System (INIS)
Wu, You-Lin; Liao, Chun-Wei; Ling, Jing-Jenn
2014-01-01
The electrical characterization of HfO 2 /ITO/Invar resistive switching memory structure was studied using conductive atomic force microscopy (AFM) with a semiconductor parameter analyzer, Agilent 4156C. The metal alloy Invar was used as the metal substrate to ensure good ohmic contact with the substrate holder of the AFM. A conductive Pt/Ir AFM tip was placed in direct contact with the HfO 2 surface, such that it acted as the top electrode. Nanoscale current-voltage (I-V) characteristics of the HfO 2 /ITO/Invar structure were measured by applying a ramp voltage through the conductive AFM tip at various current compliances and ramp voltage sweep rates. It was found that the resistance of the low resistance state (RLRS) decreased with increasing current compliance value, but resistance of high resistance state (RHRS) barely changed. However, both the RHRS and RLRS decreased as the voltage sweep rate increased. The reasons for this dependency on current compliance and voltage sweep rate are discussed.
International Nuclear Information System (INIS)
Ouyang, J T; Callegari, Th; Caillier, B; Boeuf, J-P
2003-01-01
In this paper we use a two-dimensional fluid model and a 'macroscopic' PDP cell to investigate the possibility of using large gap configurations with auxiliary electrodes to improve the efficiency of PDP discharge cells. The large gap allows operation in a transient positive column regime where energy is more efficiently deposited into xenon excitation, while the auxiliary electrodes are used to keep reasonable values of the operating voltage. Two types of auxiliary electrode configurations (floating and powered) are considered. The discharge characteristics and the discharge efficiency in exciting xenon are studied with simulations and by measuring the intensity of infrared emission from xenon and visible emission from neon in a macroscopic PDP cell. The results show that an efficient positive column regime can be achieved at reasonably low operating voltages when the auxiliary electrode configuration is carefully designed
Adaptive Voltage Stability Protection Based on Load Identification Using Phasor Measurement Units
DEFF Research Database (Denmark)
Liu, Leo; Bak, Claus Leth; Chen, Zhe
2011-01-01
collapse. In this paper, the online load identification using measurement-based approach based on Phasor Measurement Units (PMU) was proposed to evaluate the proximity to voltage instability in order to prevent voltage collapse. In the scenarios of disturbances, the proximity to voltage collapse...... scheme based on PMUs is promising, as it prevented the voltage collapse and minimized the load shedding area....
International Nuclear Information System (INIS)
Stanley, T.D.; Stinnett, R.W.
1981-01-01
The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed
Dai, Wanwan; Xie, Xingwang; Li, Dapeng; Han, Xinjie; Liu, Zhonglun; Wei, Dong; Xin, Zhaowei; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng
2018-02-01
Under the condition of existing intense turbulence, the object's wavefront may be severely distorted. So, the wavefront sensors based on the traditional microlens array (MLA) with a fixed focal length can not be used to measure the wavefront effectively. In order to obtain a larger measurement range and higher measurement accuracy, we propose a liquid-crystal microlens array (LCMLA) with needed ability of swing focus over the focal plane and further adjusting focal length, which is constructed by a dual patterned ITO electrodes. The main structure of the LCMLA is divided into two layers, which are made of glass substrate with ITO transparent electrodes. The top layer of each liquid-crystal microlens consists of four rectangular electrodes, and the bottom layer is a circular electrode. In common optical measurements performed, the operations are carried out such as adding the same signal voltage over four electrodes of each microlens to adjust the focal length of the lens cell and adding a signal voltage with different RMS amplitude to adjust the focus position on the focal plane. Experiments show that the LCMLA developed by us demonstrate a desired focal length adjustable function and dynamic swing ability, so as to indicate that the method can be used not only to measure wavefront but also correct the wavefront with strong distortion.
Site Selection for Hvdc Ground Electrodes
Freire, P. F.; Pereira, S. Y.
2014-12-01
High-Voltage Direct Current (HVDC) transmission systems are composed of a bipole transmission line with a converter substation at each end. Each substation may be equipped with a HVDC ground electrode, which is a wide area (up to 1 km Ø) and deep (from 3 to 100m) electrical grounding. When in normal operation, the ground electrode will dissipate in the soil the unbalance of the bipole (~1.5% of the rated current). When in monopolar operation with ground return, the HVDC electrode will inject in the soil the nominal pole continuous current, of about 2000 to 3000 Amperes, continuously for a period up to a few hours. HVDC ground electrodes site selection is a work based on extensive geophysical and geological surveys, in order to attend the desired design requirements established for the electrodes, considering both its operational conditions (maximum soil temperature, working life, local soil voltage gradients etc.) and the interference effects on the installations located up to 50 km away. This poster presents the geophysical investigations conducted primarily for the electrodes site selection, and subsequently for the development of the crust resistivity model, which will be used for the interference studies. A preliminary site selection is conducted, based on general geographical and geological criteria. Subsequently, the geology of each chosen area is surveyed in detail, by means of electromagnetic/electrical geophysical techniques, such as magnetotelluric (deep), TDEM (near-surface) and electroresistivity (shallow). Other complementary geologic and geotechnical surveys are conducted, such as wells drilling (for geotechnical characterization, measurement of the water table depth and water flow, and electromagnetic profiling), and soil and water sampling (for measurement of thermal parameters and evaluation of electrosmosis risk). The site evaluation is a dynamic process along the surveys, and some sites will be discarded. For the two or three final sites, the
Energy Technology Data Exchange (ETDEWEB)
Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng, E-mail: rchsh@dlut.edu.cn [School of Physics and Optoelectronic Technology, Key laboratory of Materials Modification by Laser, Ion and Electron Beams, Ministry of Education, Dalian University of Technology, Dalian 116023 (China)
2015-04-15
Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance.
International Nuclear Information System (INIS)
Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng
2015-01-01
Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance
Lee, Ju-Young; Chaimongkalayon, Nantanee; Lim, Jinho; Ha, Heung Yong; Moon, Seung-Hyeon
2016-01-01
Affordable carbon composite electrodes were developed to treat low-concentrated groundwater using capacitive deionization (CDI). A carbon slurry prepared using activated carbon powder (ACP), poly(vinylidene fluoride), and N-methyl-2-pyrrolidone was employed as a casting solution to soak in a low-cost porous substrate. The surface morphology of the carbon composite electrodes was investigated using a video microscope and scanning electron microscopy. The capacitance and electrical conductivity of the carbon composite electrodes were then examined using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS), respectively. According to the CV and EIS measurements, the capacitances and electrical conductivities of the carbon composite electrodes were in the range of 8.35-63.41 F g(-1) and 0.298-0.401 S cm(-1), respectively, depending on ACP contents. A CDI cell was assembled with the carbon composite electrodes instead of with electrodes and current collectors. The arsenate removal test included an investigation of the optimization of several important operating parameters, such as applied voltage and solution pH, and it achieved 98.8% removal efficiency using a 1 mg L(-1) arsenate solution at a voltage of 2 V and under a pH 9 condition.
The effect of the gate electrode on the C-V- characteristics of the structure M-TmF3-SiO2-Si
International Nuclear Information System (INIS)
Basily, R.R.
1979-09-01
The C-V characteristics of the structure M-TmF 3 -SiO 2 -Si, thermally treated at a temperature of 300 0 C for 15 minutes, were investigated. At higher temperatures to about 150 0 C, the hysteresis of the C-V characteristics is completely absent, whereas at room temperature hysteresis depends on the applied voltage and on the material of the gate electrode. The dependence of the flat band voltage shift on the applied voltage, the thickness of SiO 2 layer and the material of the gate electrode were measured. (author)
Voltage-Step Transient on Circular Electrodes
Czech Academy of Sciences Publication Activity Database
Wein, Ondřej; Tovčigrečko, Valentin
2011-01-01
Roč. 41, č. 9 (2011), s. 1065-1075 ISSN 0021-891X R&D Projects: GA ČR GA104/08/0428; GA ČR GA104/09/0972 Institutional research plan: CEZ:AV0Z40720504 Keywords : ohmic loss * voltage-step transient * cottrell asymptote Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.745, year: 2011
Capacitive divider for output voltage measurement of intense electron beam accelerator
International Nuclear Information System (INIS)
Ding Desheng; Yi Lingzhi; Yu Binxiong; Hong Zhiqiang; Liu Jinliang
2012-01-01
A kind of simple-mechanism, easy-disassembly self-integrating capacitive divider used for measuring diode output voltage of intense electron beam accelerator (IEBA) is developed. The structure of the capacitive divider is described, and the capacitance value of the capacitive divider is calculated by theoretical analysis and electromagnetic simulation. The dependence of measurement voltage on electrical parameters such as stray capacitance, earth capacitance of front resistance is obtained by PSpice simulation. Measured waveforms appear overshoot phenomenon when stray capacitance of front resistance is larger, and the wavefront will be affected when earth capacitance of front resistance is larger. The diode output voltage waveforms of intense electron beam accelerator, are measured by capacitive divider and calibrated by water resistance divider, which is accordance with that measured by a resistive divider, the division ratio is about 563007. The designed capacitive divider can be used to measure high-voltage pulse with 100 ns full width at half maximum. (authors)
Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.
Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong
2017-10-23
The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.
Development of DBD plasma actuators: The double encapsulated electrode
Erfani, Rasool; Zare-Behtash, Hossein; Hale, Craig; Kontis, Konstantinos
2015-04-01
Plasma actuators are electrical devices that generate a wall bounded jet without the use of any moving parts. For aerodynamic applications they can be used as flow control devices to delay separation and augment lift on a wing. The standard plasma actuator consists of a single encapsulated (ground) electrode. The aim of this project is to investigate the effect of varying the number and distribution of encapsulated electrodes in the dielectric layer. Utilising a transformer cascade, a variety of input voltages are studied for their effect. In the quiescent environment of a Faraday cage the velocity flow field is recorded using particle image velocimetry. Through understanding of the mechanisms involved in producing the wall jet and the importance of the encapsulated electrode a novel actuator design is proposed. The actuator design distributes the encapsulated electrode throughout the dielectric layer. The experiments have shown that actuators with a shallow initial encapsulated electrode induce velocities greater than the baseline case at the same voltage. Actuators with a deep initial encapsulated electrode are able to induce the highest velocities as they can operate at higher voltages without breakdown of the dielectric.
Absolute Determination of High DC Voltages by Means of Frequency Measurement
Peier, Dirk; Schulz, Bernd
1983-01-01
A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.
Solid electrolyte gas sensors based on cyclic voltammetry with one active electrode
Energy Technology Data Exchange (ETDEWEB)
Jasinski, G; Jasinski, P, E-mail: gregor@biomed.eti.pg.gda.pl [Gdansk University of Technology, Faculty of Electronics, Telecommunication and Informatics, Narutowicza 11/12, 80-233 Gdansk (Poland)
2011-10-29
Solid state gas sensors are cost effective, small, rugged and reliable. Typically electrochemical solid state sensors operate in either potentiometric or amperometric mode. However, a lack of selectivity is sometimes a shortcoming of such sensors. It seems that improvements of selectivity can be obtained in case of the electrocatalytic sensors, which operate in cyclic voltammetry mode. Their working principle is based on acquisition of an electric current, while voltage ramp is applied to the sensor. The current-voltage response depends in a unique way on the type and concentration of ambient gas. Most electrocatalytic sensors have symmetrical structure. They are in a form of pellets with two electrodes placed on their opposite sides. Electrochemical reactions occur simultaneously on both electrodes. In this paper results for sensors with only one active electrode exposed to ambient gas are presented. The other electrode was isolated from ambient gas with dielectric sealing. This sensor construction allows application of advanced measuring procedures, which permit sensor regeneration acceleration. Experiments were conducted on Nasicon sensors. Properties of two sensors, one with one active electrode and second with symmetrical structure, used for the detection of mixtures of NO{sub 2} and synthetic air are compared.
Multi-Electrode Impedance Method for Detection of Regional Ventilation
International Nuclear Information System (INIS)
Furuya, Norio; Sakamoto, Katsuyuki
2013-01-01
By means of computer simulation and experiment, we investigated the feasibility of simultaneously measuring the transfer impedance changes in the right apex, left apex, right base and left base of the lungs using the multi-electrode impedance method. To obtain the transfer impedance in each region, while suppressing the effects of other regions, changing the amplitude and polarity of the applied current must localize the high sensitivity areas in the interest region. Twelve current and eight voltage electrodes were equidistantly arranged on the anterior and posterior chest walls. The amplitudes and polarities of the currents that were simultaneously applied to the current electrodes, and which provided the appropriate sensitivity distribution, were theoretically obtained. The effects of the localized sensitivity distribution were verified by comparing the simulation results of the investigated method with the results of the conventional four-electrode method. From the results of the computer simulation, we developed a multi-electrode impedance pneumography and applied it to healthy adult volunteers who were both in sitting position and in left decubitus. We found that the measurement results were physiologically reasonable.
Wang, Xihua
2011-10-26
Colloidal quantum dots (CQDs) enable multijunction solar cells using a single material programmed using the quantum size effect. Here we report the systematic engineering of 1.6 eV PbS CQD solar cells, optimal as the front cell responsible for visible-wavelength harvesting in tandem photovoltaics. We rationally optimize each of the device\\'s collecting electrodes-the heterointerface with electron-accepting TiO2 and the deep-work-function hole-collecting MoO3 for ohmic contact-for maximum efficiency. We report an open-circuit voltage of 0.70 V, the highest observed in a colloidal quantum dot solar cell operating at room temperature. We report an AM1.5 solar power conversion efficiency of 3.5%, the highest observed in >1.5 eV bandgap CQD PV device. © 2011 American Chemical Society.
Increasing break-down strength of the support colomn of high-voltage accelerators
International Nuclear Information System (INIS)
Rezvykh, K.A.; Romanov, V.A.
1981-01-01
Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru
Research on uncertainty evaluation measure and method of voltage sag severity
Liu, X. N.; Wei, J.; Ye, S. Y.; Chen, B.; Long, C.
2018-01-01
Voltage sag is an inevitable serious problem of power quality in power system. This paper focuses on a general summarization and reviews on the concepts, indices and evaluation methods about voltage sag severity. Considering the complexity and uncertainty of influencing factors, damage degree, the characteristics and requirements of voltage sag severity in the power source-network-load sides, the measure concepts and their existing conditions, evaluation indices and methods of voltage sag severity have been analyzed. Current evaluation techniques, such as stochastic theory, fuzzy logic, as well as their fusion, are reviewed in detail. An index system about voltage sag severity is provided for comprehensive study. The main aim of this paper is to propose thought and method of severity research based on advanced uncertainty theory and uncertainty measure. This study may be considered as a valuable guide for researchers who are interested in the domain of voltage sag severity.
Water Treatment Using Plasma Discharge with Variation of Electrode Materials
Chanan, N.; Kusumandari; Saraswati, T. E.
2018-03-01
This research studied water treatment using plasma discharge. Plasma generated in this study produced active species that played a role in organic compound decomposition. The plasma reactor consisted of two needle electrodes made from stainless steel, tungsten, aluminium and grafit. It placed approximately 2 mm above the solution and connected with high-AC voltage. A solution of methylene blue used as an organic solution model. Plasma treatment times were 2, 4, 6, 8 and 10 min. The absorbance, temperature and pH of the solution were measured before and after treatment using various electrodes. The best electrode used in plasma discharging for methylene blue absorbance reduction was the graphite electrode, which provided the highest degradation efficiency of 98% at 6 min of treatment time.
Current voltage perspective of an organic electronic device
Mukherjee, Ayash K.; Kumari, Nikita
2018-05-01
Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.
Electrochemical cell and electrode designs for high-temperature/high-pressure kinetic measurements
International Nuclear Information System (INIS)
Nagy, Z.; Yonco, R.M.
1987-05-01
Many corrosion processes of interest to the nuclear power industry occur in high-temperature/high-pressure aqueous systems. The investigation of the kinetics of the appropriate electrode reactions is a serious experimental challenge, partially because of the high temperatures and pressures and partially because many of these reactions are very rapid, requiring fast relaxation measurements. An electrochemical measuring system is described which is suitable for measurements of the kinetics of fast electrode reactions at temperatures extending to at least 300 0 C and pressures to at least 10 MPa (100 atmospheres). The system includes solution preparation and handling equipment, the electrochemical cell, and several electrode designs. One of the new designs is a coaxial working electrode-counter electrode assembly; this electrode can be used with very fast-rising pulses, and it provides a well defined, repeatedly-polishable working surface. Low-impedance reference electrodes are also described, based on electrode concepts responding to the pH or the redox potential of the test solution. Additionally, a novel, long-life primary reference electrode design is reported, based on a modification of the external, pressure-balanced Ag/AgCl reference electrode
Electrochemical cell and electrode designs for high-temperature/high-pressure kinetic measurements
International Nuclear Information System (INIS)
Nagy, Z.; Yonco, R.M.
1988-01-01
Many corrosion processes of interest to the nuclear power industry occur in high-temperature/high-pressure aqueous systems. The investigation of the kinetics of the appropriate electrode reactions is a serious experimental challenge, partially because of the high temperatures and pressures and partially because many of these reactions are very rapid, requiring fast relaxation measurements. An electrochemical measuring system is described which is suitable for measurements of the kinetics of fast electrode reactions at temperatures extending to at least 300 0 C and pressures to at least 10 MPa (100 atmospheres). The system includes solution preparation and handling equipment, the electrochemical cell, and several electrode designs. One of the new designs is a coaxial working electrode-counter electrode assembly; this electrode can be used with very fast-rising pulses, and it provides a well defined, repeatedly-polishable working surface. Low-impedance reference electrodes are also described, based on electrode concepts responding to the pH or the redox potential of the test solution. Additionally, a novel, long-life primary reference electrode design is reported, based on a modification of the external, pressure-balanced Ag/AgCl reference electrode
International Nuclear Information System (INIS)
Pe, T.; McDonald, J.; Clem, J.R.
1995-01-01
The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section
Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.
Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun
2015-12-30
A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.
Electrode-Skin contact impedance: In vivo measurements on an ovine model
International Nuclear Information System (INIS)
Nguyen, D T; Kosobrodov, R; Jin, C; McEwan, A; Barry, M A; Chik, W; Thiagalingam, A; Oh, T I
2013-01-01
The problem of electrical impedance between the skin and the electrode is an on-going challenge in bio-electronics. This is particularly true in the case of Electrical Impedance Tomography (EIT), which uses a large number of skin-contact electrodes and is very sensitive to noise. In the present article, contact impedance is measured and compared for a range of electrodes placed on the thorax of an ovine model. The study has been approved by the Westmead Hospital Animal Ethics Committee. The electrode models that were employed in the research are Ag/AgCl electrodes (E1), commonly used for ECG and EIT measurements in both humans and animal models, stainless steel crocodile clips (E2), typically used on animal models, and novel multi-point dry electrodes in two modifications: bronze plated (E3) and nickel plated (E4). Further, since the contact impedance is mostly attributed to the acellular outer layer of the skin, in our experiment, we attempted to study the effect of this layer by comparing the results when the skin is intact and when electrodes are introduced underneath the skin through small cuts. This boundary effect was assessed by comparison of measurements obtained during E2 skin surface contact, and sub-cutaneous contact (E5). Twelve gauge intradermal needles were also tested as an electrode (E6). The full impedance spectrum, from 500 Hz to 300 kHz, was recorded, analysed and compared. As expected, the contact impedance in the more invasive cases, i.e the electrodes under the skin, is significantly lower than in the non-invasive cases. At the frequency of 50 kHz which is commonly used in lung EIT acquisition, electrodes E3, E4 and E6 demonstrated contact impedance of less than 200 Ω, compared to more than 400 Ω measured for electrodes E1, E2 and E5. In conclusion, the novel multipoint electrodes proved to be best suited for EIT purposes, because they are non-invasive and have lower contact impedance than Ag/AgCl and crocodile clips, in both invasive and
Digital measurement system for the LHC klystron high voltage modulator.
Mikkelsen, Anders
Accelerating voltage in the Large Hadron Collider (LHC) is created by a means of 16 superconducting standing wave RF cavities, each fed by a 400MHz/300kW continuous wave klystron amplifier. Part of the upgrade program for the LHC long shutdown one is to replace the obsolete analogue current and voltage measurement circuitry located in the high voltage bunkers by a new, digital system, using ADCs and optical fibres. A digital measurement card is implemented and integrated into the current HV modulator oil tank (floating at -58kV) and interfaced to the existing digital VME boards collecting the data for several klystrons at the ground potential. Measured signals are stored for the logging, diagnostics and post-mortem analysis purposes.
Lüpke, Felix; Cuma, David; Korte, Stefan; Cherepanov, Vasily; Voigtländer, Bert
2018-02-01
We present a four-point probe resistance measurement technique which uses four equivalent current measuring units, resulting in minimal hardware requirements and corresponding sources of noise. Local sample potentials are measured by a software feedback loop which adjusts the corresponding tip voltage such that no current flows to the sample. The resulting tip voltage is then equivalent to the sample potential at the tip position. We implement this measurement method into a multi-tip scanning tunneling microscope setup such that potentials can also be measured in tunneling contact, allowing in principle truly non-invasive four-probe measurements. The resulting measurement capabilities are demonstrated for \
Co-axial electrodes gun characteristics
International Nuclear Information System (INIS)
Masoud, M.M.; Soliman, H.M.
1981-01-01
A coaxial electrodes gun is constructed with inner electrode diameter of 3.2 cm; outer electrode diameter of 6.6 cm and length of 25 cm it is connected to a condenser bank which delivers 4 K joule stored energy. The maximum power of the discharge is equal to 4.5x10 4 K watt; for 5 KV charging voltage. The inductance showed two main peak values of 0.257μH and 0.27μH. Theoretical calculations using one-dimension-single fluid model is μ sed, which shows that the maximum acceleration is at 0.5 sec, and the gas breakdown takes place at the gun breech; at the start of the discharge, will leave the gun after 1.625μ sec, also the drift velocity, the force and the magnetic field are given. The measured results show quite reasonable agreement with the calculations for most of the results, and the position of the plasma sheath inside the gun slightly deviated from the theoretical calculations due to viscosity and wall interaction, as well as other parameters which did not be take into consideration. The plasma current density of the sheath has its maximum value at Z=18 cm, the plasma will leave the coaxial source after 1.5μ sec, from the start of the discharge, which conferms with the theoretical model. Resistance of the gas between the electrodes, changes with time according to the particle injected from this source, and the maximum efficiency of the installation for charging voltage 5kV and pressure 80μ Hg is at approx.=10μ sec and 20.5μ sec
Flexible and stretchable electrodes for dielectric elastomer actuators
Rosset, Samuel; Shea, Herbert R.
2013-02-01
Dielectric elastomer actuators (DEAs) are flexible lightweight actuators that can generate strains of over 100 %. They are used in applications ranging from haptic feedback (mm-sized devices), to cm-scale soft robots, to meter-long blimps. DEAs consist of an electrode-elastomer-electrode stack, placed on a frame. Applying a voltage between the electrodes electrostatically compresses the elastomer, which deforms in-plane or out-of plane depending on design. Since the electrodes are bonded to the elastomer, they must reliably sustain repeated very large deformations while remaining conductive, and without significantly adding to the stiffness of the soft elastomer. The electrodes are required for electrostatic actuation, but also enable resistive and capacitive sensing of the strain, leading to self-sensing actuators. This review compares the different technologies used to make compliant electrodes for DEAs in terms of: impact on DEA device performance (speed, efficiency, maximum strain), manufacturability, miniaturization, the integration of self-sensing and self-switching, and compatibility with low-voltage operation. While graphite and carbon black have been the most widely used technique in research environments, alternative methods are emerging which combine compliance, conduction at over 100 % strain with better conductivity and/or ease of patternability, including microfabrication-based approaches for compliant metal thin-films, metal-polymer nano-composites, nanoparticle implantation, and reel-to-reel production of μm-scale patterned thin films on elastomers. Such electrodes are key to miniaturization, low-voltage operation, and widespread commercialization of DEAs.
Receivers for processing electron beam pick-up electrode signals
International Nuclear Information System (INIS)
Anon.
1991-01-01
There are several methods of determining the transverse position of the electron beam, based upon sensing either the electric field, the magnetic field, or both. At the NSLS the transverse beam position monitors each consist of a set of four circular electrodes. There are 48 sets of pick-up electrodes in the X-ray ring and 24 in the VUV storage ring for determining the electron orbit, and a few extra sets installed for specialized purposes. When the beam passes between the four electrodes, charge is induced on each electrode, the amount depending upon the distance of the beam from that electrode. If V a , V b , V c and V d given by a difference between pairs of electrodes normalized for variations in beam current by dividing by the sum of electrode voltages. The method of processing these signals depends upon their time structure. The electrons circulating around the vacuum chamber are concentrated in short bunches within stability buckets produced by the accelerating voltage in the RF cavities. The charges induced on the pickup electrodes then are narrow pulses, a fraction of a nanosecond long, and would result in a monopolar voltage pulses if it were not for the impedance of the cable connecting the electrode to the processing apparatus. The capacitance between each electrode and the chamber wall is only a few picofarads and is effectively in parallel with the cable impedance (50 ohms). Thus an appreciable amount of the charge flows off the electrode while the bunch is between the electrodes, resulting in potential of opposite sign as the bunch is leaving the vicinity of the electrode. The resulting signal consists of a series of bipolar pulses, each of less than one nanosecond duration
Electrochemical characterisation of solid oxide cell electrodes for hydrogen production
DEFF Research Database (Denmark)
Bernuy-Lopez, Carlos; Knibbe, Ruth; He, Zeming
2011-01-01
Oxygen electrodes and steam electrodes are designed and tested to develop improved solid oxide electrolysis cells for H2 production with the cell support on the oxygen electrode. The electrode performance is evaluated by impedance spectroscopy testing of symmetric cells at open circuit voltage (OCV...
Low voltage initiation of damaging arcs between electrical contacts
International Nuclear Information System (INIS)
Cuthrell, R.E.
1975-07-01
Metallic arcs were found to precede the firm contacting of electrical contacts which were closed without bounce. When the open-circuit voltages were below the ionization potential, the initiation of these arcs was found to depend on the presence of asperities on the surfaces and on asperity contracting, melting, and pinching off by magnetic forces. The arc is thought to be initiated inductively when the molten metallic asperity contact is pinched off, and the electrode damage is similar to that produced by the arcing of opening contacts. Arcing could not be produced for exceptionally smooth surfaces, or, for rough surfaces when the open-circuit potential was below the melting voltages of the electrode metals. In order to prevent damage to contact surfaces by melting or arcing, it is suggested that test potentials be limited to below the melting voltages, that the current be limited, the test circuits be designed to prevent inductively generated high voltage transients, and the contact surfaces be very smooth. In order to facilitate arc initiation in arc welding applications, it is suggested that the surfaces of electrodes and work pieces be roughened. (U.S.)
International Nuclear Information System (INIS)
Cabout, T.; Buckley, J.; Cagli, C.; Jousseaume, V.; Nodin, J.-F.; Salvo, B. de; Bocquet, M.; Muller, Ch.
2013-01-01
This paper deals with the role of platinum or titanium–titanium nitride electrodes on variability of resistive switching characteristics and electrical performances of HfO 2 -based memory elements. Capacitor-like Pt/HfO 2 (10 nm)/Pt and Ti/HfO 2 (10 nm)/TiN structures were fabricated on top of a tungsten pillar bottom electrode and integrated in-between two interconnect metal lines. First, quasi-static measurements were performed to apprehend the role of electrodes on electroforming, set and reset operations and their corresponding switching parameters. Memory elements with Pt as top and bottom electrodes exhibited a non-polar behavior with sharp decrease of current during reset operation while Ti/HfO 2 /TiN capacitors showed a bipolar switching behavior, with a gradual reset. In a second step, statistical distributions of switching parameters (voltage and resistance) were extracted from data obtained on few hundreds of capacitors. Even if the resistance in low resistive state and reset voltage was found to be comparable for both types of electrodes, the progressive reset operation observed on samples with Ti/TiN electrodes led to a lower variability of resistance in high resistive state and concomitantly of set voltage. In addition Ti–TiN electrodes enabled gaining: (i) lower forming and set voltages with significantly narrower capacitor-to-capacitor distributions; (ii) a better data retention capability (10 years at 65 °C instead of 10 years at 50 °C for Pt electrodes); (iii) satisfactory dynamic performances with lower set and reset voltages for ramp speed ranging from 10 −2 to 10 7 V/s. The significant improvement of switching behavior with Ti–TiN electrodes is mainly attributed to the formation of a native interface layer between HfO 2 oxide and Ti top electrode. - Highlights: ► HfO2 based capacitor-like structures were fabricated with Pt and Ti based electrodes. ► Influence of electrode materials on switching parameter variability is assessed.
Directory of Open Access Journals (Sweden)
Christopher J Love
Full Text Available It has long been known that there is a sustained electrical potential (voltage difference between the xylem of many plants and their surrounding soil, but the mechanism behind this voltage has remained controversial. After eliminating any extraneous capacitive or inductive couplings and ground-mediated electric current flows, we have measured sustained differences of 50-200 mV between the xylem region of a Faraday-caged, intact, potted Ficus benjamina tree and its soil, as well as between its cut branches and soils and ionic solutions standardized to various pH values. Using identical platinum electrodes, no correlation between the voltage and time of day, illumination, sap flow, electrode elevation, or ionic composition of soil was found, suggesting no direct connection to simple dissimilar-metal redox reactions or transpirational activity. Instead, a clear relationship between the voltage polarity and magnitude and the pH difference between xylem and soil was observed. We attribute these sustained voltages to a biological concentration cell likely set up by the homeostatic mechanisms of the tree. Potential applications of this finding are briefly explored.
Analysis of the Interphase on Carbon Black Formed in High Voltage Batteries
DEFF Research Database (Denmark)
Younesi, Reza; Christiansen, Ane Sælland; Scipioni, Roberto
2015-01-01
Carbon black (CB) additives commonly used to increase the electrical conductivity of electrodes in Li-ion batteries are generally believed to be electrochemically inert additives in cathodes. Decomposition of electrolyte in the surface region of CB in Li-ion cells at high voltages up to 4.9 V...... is here studied using electrochemical measurements as well as structural and surface characterizations. LiPF6 and LiClO4 dissolved in ethylene carbonate:diethylene carbonate (1:1) were used as the electrolyte to study irreversible charge capacity of CB cathodes when cycled between 4.9 V and 2.5 V....... Synchrotron-based soft X-ray photoelectron spectroscopy (SOXPES) results revealed spontaneous partial decomposition of the electrolytes on the CB electrode, without applying external current or voltage. Depth profile analysis of the electrolyte/cathode interphase indicated that the concentration of decomposed...
A systematic study of BNL's 3D-Trench Electrode detectors
International Nuclear Information System (INIS)
Montalbano, A.; Bassignana, D.; Li, Z.; Liu, S.; Lynn, D.; Pellegrini, G.; Tsybychev, D.
2014-01-01
New types of silicon pixel detectors have been proposed because of the need for more radiation hard semiconductor devices for the high luminosity tracking detector upgrades at the Large Hadron Collider. A novel type of 3D Si pixel detectors is proposed, with each cell of the 3D-Trench Electrode pixel detector featuring a concentric trench electrode surrounding the central collecting column electrode. The pixel sensor is an array of those individual cells. Systematic 3D simulations using Silvacos TCAD programs have been carried out to study the characteristics of this novel 3D pixel design and to compare to the traditional 3D column electrode pixel design. The 3D simulations show a much lower depletion voltage and a more uniform electric field in the new 3D-Trench Electrode pixel detectors as compared to the traditional 3D column Electrode detectors. The first prototype 3D-Trench Electrode pixel detectors have been manufactured at the Centro Nacional De Microelectronica. Preliminary electrical measurements are discussed and charge collection efficiency measurements are presented
International Nuclear Information System (INIS)
Spassov, Velin
1996-01-01
This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)
High frequency breakdown voltage
International Nuclear Information System (INIS)
Chu, Thanh Duy.
1992-03-01
This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance
DEFF Research Database (Denmark)
Hyvönen, N.; Majander, H.; Staboulis, Stratos
2017-01-01
Electrical impedance tomography aims at reconstructing the conductivity inside a physical body from boundary measurements of current and voltage at a finite number of contact electrodes. In many practical applications, the shape of the imaged object is subject to considerable uncertainties...
Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films
International Nuclear Information System (INIS)
Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David
2007-01-01
We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching
Ultrasonic cleaning of electrodes of wire chambers
International Nuclear Information System (INIS)
Krasnov, V.A.; Kurepin, A.B.; Razin, V.I.
1980-01-01
A technological process of cleaning electrodes and working volume surfaces of wire chambers from contaminations by the simultaneous mechanical action of the energy of ultrasonic oscillations and the chemical action of detergents is discussed. A device for cleaning wire electrodes of proportional chambers of 0.3x0.4 m is described. The device uses two ultrasonic generators with a total power of 0.5 kW. As a detergent use is made of a mixture of ethyl alcohol, gasoline and freon. In the process of cleaning production defects can be detected in the wire chambers which makes it possible to timely remove the defects. Measurements of the surface resistance of fiberglass laminate of printed drift chamber electrodes at a voltage of 2 kV showed that after completing the cleaning process the resistance increases 15-20%
Energy Technology Data Exchange (ETDEWEB)
Motomura, Hideki; Oka, Kojiro; Sogabe, Toru; Jinno, Masafumi, E-mail: hmoto@mayu.ee.ehime-u.ac.jp [Department of Electrical and Electronic Engineering, Ehime University 3 Bunkyo-cho, Matsuyama, Ehime 790-8577 (Japan)
2011-06-08
As the environmental awareness of people becomes stronger, the demand for mercury-free light sources also becomes stronger. The authors have been developing cold cathode fluorescent lamps in which xenon gas is filled as an ultraviolet radiator instead of mercury. Previously the authors reported the luminous flux enhancement method using a grounded auxiliary external electrode (AEE). In this paper, in order to improve the luminous flux much more, a positive voltage pulse which was synchronized to the main driving negative voltage pulse was applied to the AEE. As a result, the maximum input power increased under which the positive column did not constrict and the luminous flux improved by 70% at the xenon filling pressure of 6.7 kPa. It is proved that the positive voltage pulse application to the AEE with the amplitude of more than 2 kV expands the positive column in the radial direction. It is attributed to the phenomenon that the residual ions and electrons, which are generated by dielectric barrier discharge between the AEE and the anode during the falling edge of the negative pulse to the cathode, spread the discharge path from the anode towards the AEE during the cold cathode discharge mode. By increasing the xenon filling pressure, luminous efficacy was improved to 25 lm W{sup -1}.
A High-Voltage SOI CMOS Exciter Chip for a Programmable Fluidic Processor System.
Current, K W; Yuk, K; McConaghy, C; Gascoyne, P R C; Schwartz, J A; Vykoukal, J V; Andrews, C
2007-06-01
A high-voltage (HV) integrated circuit has been demonstrated to transport fluidic droplet samples on programmable paths across the array of driving electrodes on its hydrophobically coated surface. This exciter chip is the engine for dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip systems, creating field excitations that inject and move fluidic droplets onto and about the manipulation surface. The architecture of this chip is expandable to arrays of N X N identical HV electrode driver circuits and electrodes. The exciter chip is programmable in several senses. The routes of multiple droplets may be set arbitrarily within the bounds of the electrode array. The electrode excitation waveform voltage amplitude, phase, and frequency may be adjusted based on the system configuration and the signal required to manipulate a particular fluid droplet composition. The voltage amplitude of the electrode excitation waveform can be set from the minimum logic level up to the maximum limit of the breakdown voltage of the fabrication technology. The frequency of the electrode excitation waveform can also be set independently of its voltage, up to a maximum depending upon the type of droplets that must be driven. The exciter chip can be coated and its oxide surface used as the droplet manipulation surface or it can be used with a top-mounted, enclosed fluidic chamber consisting of a variety of materials. The HV capability of the exciter chip allows the generated DEP forces to penetrate into the enclosed chamber region and an adjustable voltage amplitude can accommodate a variety of chamber floor thicknesses. This demonstration exciter chip has a 32 x 32 array of nominally 100 V electrode drivers that are individually programmable at each time point in the procedure to either of two phases: 0deg and 180deg with respect to the reference clock. For this demonstration chip, while operating the electrodes with a 100-V peak-to-peak periodic waveform, the maximum HV electrode
Low-voltage circuit breaker arcs—simulation and measurements
International Nuclear Information System (INIS)
Yang, Fei; Wu, Yi; Rong, Mingzhe; Sun, Hao; Ren, Zhigang; Niu, Chunping; Murphy, Anthony B
2013-01-01
As one of the most important electrical components, the low-voltage circuit breaker (LVCB) has been widely used for protection in all types of low-voltage distribution systems. In particular, the low-voltage dc circuit breaker has been arousing great research interest in recent years. In this type of circuit breaker, an air arc is formed in the interrupting process which is a 3D transient arc in a complex chamber geometry with splitter plates. Controlling the arc evolution and the extinction are the most significant problems. This paper reviews published research works referring to LVCB arcs. Based on the working principle, the arcing process is divided into arc commutation, arc motion and arc splitting; we focus our attention on the modelling and measurement of these phases. In addition, previous approaches in papers of the critical physical phenomenon treatment are discussed, such as radiation, metal erosion, wall ablation and turbulence in the air arc. Recommendations for air arc modelling and measurement are presented for further investigation. (topical review)
Current, K. Wayne; Yuk, Kelvin; McConaghy, Charles; Gascoyne, Peter R. C.; Schwartz, Jon A.; Vykoukal, Jody V.; Andrews, Craig
2010-01-01
A high-voltage (HV) integrated circuit has been demonstrated to transport droplets on programmable paths across its coated surface. This chip is the engine for a dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip system. This chip creates DEP forces that move and help inject droplets. Electrode excitation voltage and frequency are variable. With the electrodes driven with a 100V peak-to-peak periodic waveform, the maximum high-voltage electrode waveform frequency is about 200Hz. Data communication rate is variable up to 250kHz. This demonstration chip has a 32×32 array of nominally 100V electrode drivers. It is fabricated in a 130V SOI CMOS fabrication technology, dissipates a maximum of 1.87W, and is about 10.4 mm × 8.2 mm. PMID:23989241
Methods for calculating the electrode position Jacobian for impedance imaging.
Boyle, A; Crabb, M G; Jehl, M; Lionheart, W R B; Adler, A
2017-03-01
Electrical impedance tomography (EIT) or electrical resistivity tomography (ERT) current and measure voltages at the boundary of a domain through electrodes. The movement or incorrect placement of electrodes may lead to modelling errors that result in significant reconstructed image artifacts. These errors may be accounted for by allowing for electrode position estimates in the model. Movement may be reconstructed through a first-order approximation, the electrode position Jacobian. A reconstruction that incorporates electrode position estimates and conductivity can significantly reduce image artifacts. Conversely, if electrode position is ignored it can be difficult to distinguish true conductivity changes from reconstruction artifacts which may increase the risk of a flawed interpretation. In this work, we aim to determine the fastest, most accurate approach for estimating the electrode position Jacobian. Four methods of calculating the electrode position Jacobian were evaluated on a homogeneous halfspace. Results show that Fréchet derivative and rank-one update methods are competitive in computational efficiency but achieve different solutions for certain values of contact impedance and mesh density.
Papaioannou, G.; Giacomozzi, F.; Papandreou, E.; Margesin, B.
2011-08-01
The paper investigates the actuation mechanism in floating electrode microelectromechanical system capacitive switches. It is demonstrated that in the pull-in state, the device operation turns from voltage to current controlled actuation. The current arises from Poole-Frenkel mechanism in the dielectric film and Fowler-Nordheim in the bridge-floating electrode air gap. The pull-out voltage seems to arise from the abrupt decrease of Fowler-Nordheim electric field intensity. This mechanism seems to be responsible for the very small difference with respect to the pull-in voltage.
Low-voltage FIB/SEM Tomography for 3D Microstructure Evolution of LiFePO4/C Electrode
DEFF Research Database (Denmark)
Scipioni, Roberto; Jørgensen, Peter Stanley; Ngo, Duc-The
2015-01-01
This work presents an investigation of the degradation mechanisms that occur in LiFePO4/C battery electrodes during charge/discharge cycling. Impedance spectra were measured on a fresh electrode and an electrode aged by cycling. The spectra were modeled with an equivalent circuit which indicates...
Synthesis and characterization of DSSC by using Pt nano-counter electrode: photosensor applications
Yahia, I. S.; AlFaify, S.; Al-ghamdi, Attieh A.; Hafez, Hoda S.; EL-Bashir, S.; Al-Bassam, A.; El-Naggar, A. M.; Yakuphanoglu, F.
2016-06-01
Pt electrode prepared by chemical method has been employed as counter electrode in dye-sensitized solar cell. TiO2 nanomaterial was deposited on fluorine-doped tin oxide substrate to be used as photoanode. Structure of the TiO2 and Pt films was investigated by atomic force microscope. The effect of illumination intensity on the photovoltaic parameters such as open circuit voltage, short circuit current density, output power, fill factor and efficiency of these cells was investigated in the range 2.5-130 mW/cm-2. The cell efficiency is stable above 70 mW/cm2. The fill factor is almost constant all over the studied range of illumination intensity. Impedance spectroscopy of the studied device as the summary measurements of the capacitance-voltage, conductance-voltage and series resistance-voltage characteristics were investigated in a wide range of frequencies (5 kHz-1 MHz). At low frequencies, the capacitance has positive values with peak around the origin due to the interfaces. At 200 and 300 kHz, the capacitance is inverted to negative with further increasing of the positive biasing voltage. Above 400 kHz, C-V profile shows complete negative behavior. Also, the impedance-voltage and phase-voltage characteristics were investigated. This cell shows a new promising device for photosensor applications due to high sensitivity in low and high illuminations.
Electrode-tissues interface: modeling and experimental validation
International Nuclear Information System (INIS)
Sawan, M; Laaziri, Y; Mounaim, F; Elzayat, E; Corcos, J; Elhilali, M M
2007-01-01
The electrode-tissues interface (ETI) is one of the key issues in implantable devices such as stimulators and sensors. Once the stimulator is implanted, safety and reliability become more and more critical. In this case, modeling and monitoring of the ETI are required. We propose an empirical model for the ETI and a dedicated integrated circuit to measure its corresponding complex impedance. These measurements in the frequency range of 1 Hz to 100 kHz were achieved in acute dog experiments. The model demonstrates a closer fitting with experimental measurements. In addition, a custom monitoring device based on a stimuli current generator has been completed to evaluate the phase shift and voltage across the electrodes and to transmit wirelessly the values to an external controller. This integrated circuit has been fabricated in a CMOS 0.18 μm process, which consumes 4 mW only during measurements and occupies an area of 1 mm 2 . (review article)
Electrochemical thermodynamic measurement system
Reynier, Yvan [Meylan, FR; Yazami, Rachid [Los Angeles, CA; Fultz, Brent T [Pasadena, CA
2009-09-29
The present invention provides systems and methods for accurately characterizing thermodynamic and materials properties of electrodes and electrochemical energy storage and conversion systems. Systems and methods of the present invention are configured for simultaneously collecting a suite of measurements characterizing a plurality of interconnected electrochemical and thermodynamic parameters relating to the electrode reaction state of advancement, voltage and temperature. Enhanced sensitivity provided by the present methods and systems combined with measurement conditions that reflect thermodynamically stabilized electrode conditions allow very accurate measurement of thermodynamic parameters, including state functions such as the Gibbs free energy, enthalpy and entropy of electrode/electrochemical cell reactions, that enable prediction of important performance attributes of electrode materials and electrochemical systems, such as the energy, power density, current rate and the cycle life of an electrochemical cell.
Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh
2016-08-10
This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.
Directory of Open Access Journals (Sweden)
Wen-Jeng Ho
2016-08-01
Full Text Available This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs and an indium-tin-oxide (ITO electrode with periodic holes (perforations under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.
Addition of internal electrodes is beneficial for focused bioimpedance measurements in the lung.
Orschulik, Jakob; Hochhausen, Nadine; Czaplik, Michael; Teichmann, Daniel; Leonhardt, Steffen; Walter, Marian
2018-03-29
Bioimpedance measurements such as bioimpedance spectroscopy (BIS) or electrical impedance tomography (EIT) are used in many biomedical applications. While BIS measures and analyzes the impedance in a frequency range at constant electrode positions, EIT aims to reconstruct images of the conductivity distribution from multiple measurements at different electrode positions. Our aim is to add spatial information to tetrapolar BIS measurements by using electrode positions that focus measurements on desired regions of interest. In this paper, we aim to investigate, whether internal electrodes that can be integrated into breathing or gastroesophageal tubes, can improve the local sensitivity of bioimpedance spectroscopy measurements. We present the results of a simulation study, in which we investigated more than 4 M different electrode configurations on their ability to monitor specific regions of interest (ROI) in the lung. Based on the sensitivity, which describes the impact of a conductivity change on the measured impedance, we define three main criteria which we use to evaluate our simulation results: the selectivity [Formula: see text], which describes the impact of a conductivity change inside the region of interest compared to a conductivity change outside the ROI; the homogeneity [Formula: see text], which describes the distribution of the sensitivity inside the ROI; and the absolute impedance contribution ratio [Formula: see text], which describes the contribution of the ROI to the measured impedance. Depending on the region of interest, electrode configurations using internal electrodes are between 9.8 % and 90 % better with respect to these criteria than configurations using external electrodes only. The combination of internal and external electrodes improves the focusing ability of tetrapolar impedance measurements on specific lung regions, which may be especially beneficial for lung monitoring in intensive care.
New perspectives in vacuum high voltage insulation. II. Gas desorption
Diamond, W T
1998-01-01
An examination has been made of gas desorption from unbaked electrodes of copper, niobium, aluminum, and titanium subjected to high voltage in vacuum. It has been shown that the gas is composed of water vapor, carbon monoxide, and carbon dioxide, the usual components of vacuum outgassing, plus an increased yield of hydrogen and light hydrocarbons. The gas desorption was driven by anode conditioning as the voltage was increased between the electrodes. The gas is often desorbed as microdischarges-pulses of a few to hundreds of microseconds-and less frequently in a more continuous manner without the obvious pulsed structure characteristic of microdischarge activity. The quantity of gas released was equivalent to many monolayers and consisted mostly of neutral molecules with an ionic component of a few percent. A very significant observation was that the gas desorption was more dependent on the total voltage between the electrodes than on the electric field. It was not triggered by field-emitted electrons but oft...
Aspirated capacitor measurements of air conductivity and ion mobility spectra
International Nuclear Information System (INIS)
Aplin, K.L.
2005-01-01
Measurements of ions in atmospheric air are used to investigate atmospheric electricity and particulate pollution. Commonly studied ion parameters are (1) air conductivity, related to the total ion number concentration, and (2) the ion mobility spectrum, which varies with atmospheric composition. The physical principles of air ion instrumentation are long established. A recent development is the computerized aspirated capacitor, which measures ions from (a) the current of charged particles at a sensing electrode, and (b) the rate of charge exchange with an electrode at a known initial potential, relaxing to a lower potential. As the voltage decays, only ions of higher and higher mobility are collected by the central electrode and contribute to the further decay of the voltage. This enables extension of the classical theory to calculate ion mobility spectra by inverting voltage decay time series. In indoor air, ion mobility spectra determined from both the voltage decay inversion, and an established voltage switching technique, were compared and shown to be of similar shape. Air conductivities calculated by integration were: 5.3±2.5 and 2.7±1.1 fSm -1 , respectively, with conductivity determined to be 3 fSm -1 by direct measurement at a constant voltage. Applications of the relaxation potential inversion method include air ion mobility spectrum retrieval from historical data, and computation of ion mobility spectra in planetary atmospheres
Gong, Jianying; Zhang, Xingwang; Wang, Xiaoping; Lei, Lecheng
2013-12-01
Oxidation of S(IV) to S(VI) in the effluent of a flue gas desulfurization(FGD) system is very critical for industrial applications of seawater FGD. This paper reports a pulsed corona discharge oxidation process combined with a TiO2 photocatalyst to convert S(IV) to S(VI) in artificial seawater. Experimental results show that the oxidation of S(IV) in artificial seawater is enhanced in the pulsed discharge plasma process through the application of TiO2 coating electrodes. The oxidation rate of S(IV) using Ti metal as a ground electrode is about 2.0×10-4 mol · L-1 · min-1, the oxidation rate using TiO2/Ti electrode prepared by annealing at 500°C in air is 4.5×10-4 mol · L-1 · min-1, an increase with a factor 2.25. The annealing temperature for preparing TiO2/Ti electrode has a strong effect on the oxidation of S(IV) in artificial seawater. The results of in-situ emission spectroscopic analysis show that chemically active species (i.e. hydroxyl radicals and oxygen radicals) are produced in the pulsed discharge plasma process. Compared with the traditional air oxidation process and the sole plasma-induced oxidation process, the combined application of TiO2 photocatalysts and a pulsed high-voltage electrical discharge process is useful in enhancing the energy and conversion efficiency of S(IV) for the seawater FGD system.
Low Energy Desalination Using Battery Electrode Deionization
Kim, Taeyoung
2017-09-21
New electrochemical technologies that use capacitive or battery electrodes are being developed to minimize energy requirements for desalinating brackish waters. When a pair of electrodes is charged in capacitive deionization (CDI) systems, cations bind to the cathode and anions bind to the anode, but high applied voltages (>1.2 V) result in parasitic reactions and irreversible electrode oxidation. In the battery electrode deionization (BDI) system developed here, two identical copper hexacyanoferrate (CuHCF) battery electrodes were used that release and bind cations, with anion separation occurring via an anion exchange membrane. The system used an applied voltage of 0.6 V, which avoided parasitic reactions, achieved high electrode desalination capacities (up to 100 mg-NaCl/g-electrode, 50 mM NaCl influent), and consumed less energy than CDI. Simultaneous production of desalinated and concentrated solutions in two channels avoided a two-cycle approach needed for CDI. Stacking additional membranes between CuHCF electrodes (up to three anion and two cation exchange membranes) reduced energy consumption to only 0.02 kWh/m3 (approximately an order of magnitude lower than values reported for CDI), for an influent desalination similar to CDI (25 mM decreased to 17 mM). These results show that BDI could be effective as a very low energy method for brackish water desalination.
International Nuclear Information System (INIS)
Takata, N.
2000-01-01
It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the
Alkali metal ion battery with bimetallic electrode
Boysen, Dane A; Bradwell, David J; Jiang, Kai; Kim, Hojong; Ortiz, Luis A; Sadoway, Donald R; Tomaszowska, Alina A; Wei, Weifeng; Wang, Kangli
2015-04-07
Electrochemical cells having molten electrodes having an alkali metal provide receipt and delivery of power by transporting atoms of the alkali metal between electrode environments of disparate chemical potentials through an electrochemical pathway comprising a salt of the alkali metal. The chemical potential of the alkali metal is decreased when combined with one or more non-alkali metals, thus producing a voltage between an electrode comprising the molten the alkali metal and the electrode comprising the combined alkali/non-alkali metals.
Development of a power electrode for plasma biasing on RFX
International Nuclear Information System (INIS)
Desideri, D.; Lorenzi, A. de; Zaccaria, P.
1999-01-01
A movable power electrode has been developed on the RFX experiment to modify the radial electric field at the edge of the plasma configuration. The electrode insertion head is a mushroom shaped limiter made of a carbon-carbon composite, and boron nitride is used as insulating material to be exposed to the plasma. The power electrode is designed to carry a 10 kA impulsive current and is insulated for 10 kV DC. The current into the electrode is driven by a power supply based on capacitor banks, and protective actions to cope with fault conditions have been implemented. The design of the electrode supporting structure has been done by using 3D finite element analyses, performed to evaluate the dynamic response of the system subjected to impulsive electromagnetic loads. The system has been used on the RFX experiment, showing the expected capability and flexibility. The current and voltage electrode waveforms are reported and discussed as far as the experimental results are concerned. Displacements of the electrode stiffening structure under electromagnetic load have been measured and compared to the numerical results. (orig.)
Measurement Error Estimation for Capacitive Voltage Transformer by Insulation Parameters
Directory of Open Access Journals (Sweden)
Bin Chen
2017-03-01
Full Text Available Measurement errors of a capacitive voltage transformer (CVT are relevant to its equivalent parameters for which its capacitive divider contributes the most. In daily operation, dielectric aging, moisture, dielectric breakdown, etc., it will exert mixing effects on a capacitive divider’s insulation characteristics, leading to fluctuation in equivalent parameters which result in the measurement error. This paper proposes an equivalent circuit model to represent a CVT which incorporates insulation characteristics of a capacitive divider. After software simulation and laboratory experiments, the relationship between measurement errors and insulation parameters is obtained. It indicates that variation of insulation parameters in a CVT will cause a reasonable measurement error. From field tests and calculation, equivalent capacitance mainly affects magnitude error, while dielectric loss mainly affects phase error. As capacitance changes 0.2%, magnitude error can reach −0.2%. As dielectric loss factor changes 0.2%, phase error can reach 5′. An increase of equivalent capacitance and dielectric loss factor in the high-voltage capacitor will cause a positive real power measurement error. An increase of equivalent capacitance and dielectric loss factor in the low-voltage capacitor will cause a negative real power measurement error.
Water desalination using capacitive deionization with microporous carbon electrodes.
Porada, S; Weinstein, L; Dash, R; van der Wal, A; Bryjak, M; Gogotsi, Y; Biesheuvel, P M
2012-03-01
Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in electrostatic double layers inside the negatively charged cathode and the anions are removed by the positively charged anode. One of the key parameters for commercial realization of CDI is the salt adsorption capacity of the electrodes. State-of-the-art electrode materials are based on porous activated carbon particles or carbon aerogels. Here we report the use for CDI of carbide-derived carbon (CDC), a porous material with well-defined and tunable pore sizes in the sub-nanometer range. When comparing electrodes made with CDC with electrodes based on activated carbon, we find a significantly higher salt adsorption capacity in the relevant cell voltage window of 1.2-1.4 V. The measured adsorption capacity for four materials tested negatively correlates with known metrics for pore structure of the carbon powders such as total pore volume and BET-area, but is positively correlated with the volume of pores of sizes <1 nm, suggesting the relevance of these sub-nanometer pores for ion adsorption. The charge efficiency, being the ratio of equilibrium salt adsorption over charge, does not depend much on the type of material, indicating that materials that have been identified for high charge storage capacity can also be highly suitable for CDI. This work shows the potential of materials with well-defined sub-nanometer pore sizes for energy-efficient water desalination. © 2012 American Chemical Society
Energy harvesting in high voltage measuring techniques
International Nuclear Information System (INIS)
Żyłka, Pawel; Doliński, Marcin
2016-01-01
The paper discusses selected problems related to application of energy harvesting (that is, generating electricity from surplus energy present in the environment) to supply autonomous ultra-low-power measurement systems applicable in high voltage engineering. As a practical example of such implementation a laboratory model of a remote temperature sensor is presented, which is self-powered by heat generated in a current-carrying busbar in HV- switchgear. Presented system exploits a thermoelectric harvester based on a passively cooled Peltier module supplying micro-power low-voltage dc-dc converter driving energy-efficient temperature sensor, microcontroller and a fibre-optic transmitter. Performance of the model in laboratory simulated conditions are presented and discussed. (paper)
A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme
Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol
2018-02-01
We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.
Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.
1998-01-01
The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured
Environmental and biotechnological applications of high-voltage pulsed discharges in water
International Nuclear Information System (INIS)
Sato, Masayuki
2008-01-01
A high-voltage pulse has wide application in fields such as chemistry, physics and biology and their combinations. The high-voltage pulse forms two kinds of physical processes in water, namely (a) a pulsed electric field (PEF) in the parallel electrode configuration and (b) plasma generation by a pulsed discharge in the water phase with a concentrated electric field. The PEF can be used for inactivation of bacteria in liquid foods as a non-thermal process, and the underwater plasma is applicable not only for the decomposition of organic materials in water but also for biological treatment of wastewater. These discharge states are controlled mainly by the applied pulse voltage and the electrode shape. Some examples of environmental and biotechnological applications of a high-voltage pulse are reviewed.
Directory of Open Access Journals (Sweden)
Słania J.
2014-10-01
Full Text Available The article presents the process of production of coated electrodes and their welding properties. The factors concerning the welding properties and the currently applied method of assessing are given. The methodology of the testing based on the measuring and recording of instantaneous values of welding current and welding arc voltage is discussed. Algorithm for creation of reference data base of the expert system is shown, aiding the assessment of covered electrodes welding properties. The stability of voltage–current characteristics was discussed. Statistical factors of instantaneous values of welding current and welding arc voltage waveforms used for determining of welding process stability are presented. The results of coated electrodes welding properties are compared. The article presents the results of linear regression as well as the impact of the independent variables on the welding process performance. Finally the conclusions drawn from the research are given.
International Nuclear Information System (INIS)
Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.
1988-01-01
A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown
Directory of Open Access Journals (Sweden)
Shigehiro Hashimoto
2008-10-01
Full Text Available A measurement system has been designed with a micro-vibrating electrode at ultrasonic frequency to measure local impedance of biological gel in vitro. The designed system consists of two electrodes, where one of the electrodes vibrates with a piezoelectric actuator. The component of variation at impedance between two electrodes with vibration of one electrode is analyzed at the corresponding spectrum. The manufactured system was applied to measure impedance of a physiological saline solution, a potassium chloride solution, a dextran aqueous solution, and an egg. The experimental results show that the designed system is effective to measure local mechatronic property of biological gel.
Identification of voltage stability condition of a power system using measurements of bus variables
Directory of Open Access Journals (Sweden)
Durlav Hazarika
2014-12-01
Full Text Available Several online methods were proposed for investigating the voltage stability condition of an interconnected power system using the measurements of voltage and current phasors at a bus. For this purpose, phasor measurement units (PMUs are used. A PMU is a device which measures the electrical waves on an electrical network, using a common time source (reference bus for synchronisation. This study proposes a method for online monitoring of voltage stability condition of a power system using measurements of bus variables namely – (i real power, (ii reactive power and (iii bus voltage magnitude at a bus. The measurements of real power, reactive power and bus voltage magnitude could be extracted/captured from a smart energy meter. The financial involvement for implementation of the proposed method would significantly lower compared with the PMU-based method.
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Developing barbed microtip-based electrode arrays for biopotential measurement.
Hsu, Li-Sheng; Tung, Shu-Wei; Kuo, Che-Hsi; Yang, Yao-Joe
2014-07-10
This study involved fabricating barbed microtip-based electrode arrays by using silicon wet etching. KOH anisotropic wet etching was employed to form a standard pyramidal microtip array and HF/HNO3 isotropic etching was used to fabricate barbs on these microtips. To improve the electrical conductance between the tip array on the front side of the wafer and the electrical contact on the back side, a through-silicon via was created during the wet etching process. The experimental results show that the forces required to detach the barbed microtip arrays from human skin, a polydimethylsiloxane (PDMS) polymer, and a polyvinylchloride (PVC) film were larger compared with those required to detach microtip arrays that lacked barbs. The impedances of the skin-electrode interface were measured and the performance levels of the proposed dry electrode were characterized. Electrode prototypes that employed the proposed tip arrays were implemented. Electroencephalogram (EEG) and electrocardiography (ECG) recordings using these electrode prototypes were also demonstrated.
Developing Barbed Microtip-Based Electrode Arrays for Biopotential Measurement
Directory of Open Access Journals (Sweden)
Li-Sheng Hsu
2014-07-01
Full Text Available This study involved fabricating barbed microtip-based electrode arrays by using silicon wet etching. KOH anisotropic wet etching was employed to form a standard pyramidal microtip array and HF/HNO3 isotropic etching was used to fabricate barbs on these microtips. To improve the electrical conductance between the tip array on the front side of the wafer and the electrical contact on the back side, a through-silicon via was created during the wet etching process. The experimental results show that the forces required to detach the barbed microtip arrays from human skin, a polydimethylsiloxane (PDMS polymer, and a polyvinylchloride (PVC film were larger compared with those required to detach microtip arrays that lacked barbs. The impedances of the skin-electrode interface were measured and the performance levels of the proposed dry electrode were characterized. Electrode prototypes that employed the proposed tip arrays were implemented. Electroencephalogram (EEG and electrocardiography (ECG recordings using these electrode prototypes were also demonstrated.
Directory of Open Access Journals (Sweden)
Chin Fhong SOON
2015-04-01
Full Text Available This study aimed at the development of a biosensor to examine the growth confluency of human derived keratinocytes (HaCaT cell lines in-situ. The biosensor consists of a sputter- coated glass substrate with platinum patterns. Cells were grown on the conductive substrates and the confluency of the cells were monitored in-situ based on the conductivity changes of the substrates. Characterization of the cell proliferation and confluency were interrogated using electrical cell-substrate impedance sensing (ECIS techniques and current change of cells using a pico-ammeter. The investigation was followed by the electrical characterization of the platinum electrode (PE using a two probe I-V measurement system. The surface morphology of platinum electrodes were studied using an atomic force microscopy (AFM and the HaCaT cell morphology was studied using Field-Emission Scanning Electron Microscopy (FE-SEM. The microscopy results showed that the cells coupled and proliferated on the platinum electrodes. For monitoring the conductivity and impedance changes of the cell-electrode in-situ, the cover of a Petri dish was inserted with pogo pins to be in contact with the platinum electrodes. The impedance was sampled using the ECIS technique at a twenty-four hour interval. In our findings, the cell proliferation rate can be measured by observing the changes in capacitance or impedance measured at low ac frequencies ranged from 10 - 1 kHz. In good agreement, the current measured at micro-ampere range by the biosensor decreased as the cell coverage area increased over the time. Thus, the percent of cell confluence was shown inversely proportional to the current changes.
Wireless desalination using inductively powered porous carbon electrodes
Kuipers, J.; Porada, S.
2013-01-01
Water desalination by capacitive deionization (CDI) uses electrochemical cell pairs formed of porous carbon electrodes, which are brought in contact with the water that must be desalinated. Upon applying a cell voltage or current between the electrodes, ions are electrosorbed and water is produced
Badawi, Ali; Mostafa, Nasser Y.; Al-Hosiny, Najm M.; Merazga, Amar; Albaradi, Ateyyah M.; Abdel-Wahab, F.; Atta, A. A.
2018-06-01
The photovoltaic performance of silver sulfide (Ag2S) quantum dots-sensitized solar cells (QDSSCs) using different concentrations (0, 0.05, 0.1, 0.3 and 0.5 wt.%) of plasmonic Au nanoparticles (NPs)/titania (TiO2) electrodes has been investigated. Ag2S quantum dots (QDs) were adsorbed onto the Au NPs/titania electrodes using the successive ionic layer adsorption and reaction (SILAR) deposition technique. The morphological properties of the Au NPs and the prepared titania electrodes were characterized using transmission electron microscope (TEM) and scanning electron microscope (SEM), respectively. The energy-dispersive X-ray (EDX) spectra of the bare titania and Ag2S QDs-sensitized titania electrodes were recorded. The optical properties of the prepared Ag2S QDs-sensitized titania electrodes were measured using a UV-visible spectrophotometer. The estimated energy band gap of Ag2S QDs-sensitized titania electrodes is 1.96 eV. The photovoltaic performance of the assembled Ag2S QDSSCs was measured under 100 mW/cm2 solar illumination. The optimal photovoltaic parameters were obtained as follows: open circuit voltage Voc = 0.50 V, current density Jsc = 3.18 mA/cm2, fill factor (FF) = 0.35 and energy conversion efficiency η = 0.55% for 0.3 wt.% of Au NPs/titania electrode. These results are attributed to the enhancement in the absorption and decrease in the electron-hole pairs recombination rate. The open circuit voltage decay (OCVD) measurements of the assembled Ag2S QDSSCs were measured. The calculated electron lifetime (τ) in Ag2S QDSSCs with Au NPs/titania electrodes is at least one order of magnitude more than that with bare titania electrode. The cut-on-cut-off cycles of the solar illumination measurements show the rapid sensitivity and good reproducibility of the assembled Ag2S QDSSCs.
Additional magnetoelectric effect in electrode-arrayed magnetoelectric composite
Directory of Open Access Journals (Sweden)
D. A. Pan
2014-11-01
Full Text Available An electrode-arrayed magnetoelectric (ME composite was proposed, in which the positive and negative electrodes of the PZT-5H plate (Pb(Zr0.52Ti0.48O3 were equally divided into a 2 × 5 array, while the PZT plate remained intact. The ME voltage coefficients of these 10 sections were measured individually and in parallel/series modes. The magnetoelectric coefficient is doubled compared with un-arrayed condition, when the 10 sections are connected in parallel/series using an optimized connecting sequence derived from the charge matching rule. This scheme can also be applied to other types of layered magnetoelectric composites to obtain additional magnetoelectric effect from the original composite structure.
A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements
Hafiz, Md Abdullah Al
2017-11-10
We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.
A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements
Hafiz, Md Abdullah Al; Ilyas, Saad; Ahmed, Sally; Younis, Mohammad I.; Fariborzi, Hossein
2017-01-01
We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.
Pang, Wei Kong; Lu, Cheng-Zhang; Liu, Chia-Erh; Peterson, Vanessa K; Lin, Hsiu-Fen; Liao, Shih-Chieh; Chen, Jin-Ming
2016-06-29
High-voltage spinel LiNi0.5Mn1.5O4 (LNMO) is considered a potential high-power-density positive electrode for lithium-ion batteries, however, it suffers from capacity decay after extended charge-discharge cycling, severely hindering commercial application. Capacity fade is thought to occur through the significant volume change of the LNMO electrode occurring on cycling, and in this work we use operando neutron powder diffraction to compare the structural evolution of the LNMO electrode in an as-assembled 18650-type battery containing a Li4Ti5O12 negative electrode with that in an identical battery following 1000 cycles at high-current. We reveal that the capacity reduction in the battery post cycling is directly proportional to the reduction in the maximum change of the LNMO lattice parameter during its evolution. This is correlated to a corresponding reduction in the MnO6 octahedral distortion in the spinel structure in the cycled battery. Further, we find that the rate of lattice evolution, which reflects the rate of lithium insertion and removal, is ∼9 and ∼10% slower in the cycled than in the as-assembled battery during the Ni(2+)/Ni(3+) and Ni(3+)/Ni(4+) transitions, respectively.
The high voltage divider - a tool for comparison of measurement equipment in diagnostic radiology
International Nuclear Information System (INIS)
Slavchev, A.; Litchev, A.; Constantinov, B.
2004-01-01
The high voltage divider (HVD) is designed for control and analysis of the characteristics of the X-ray generator. The low voltage analogous signals produced by the divider are proportional to the high voltage (kVp) applied to the x-ray tube by a ratio 1:1000 or 1:10000 and can be measured with external test devices like storage oscilloscope (or digital multimeter). The exposure duration and the wave form may be visualized, too. Apart of this invasive way the high voltage also may be measured non-invasively by means of appropriate devices as well as indirectly through calculations. Since the invasive method of measurement with the high voltage divider is distinguished by a high accuracy, it may be utilized as an effective tool for calibration of different devices and for comparison of the measurement methods. (authors)
International Nuclear Information System (INIS)
Khalifeh, Omid; Mosallanejad, Amin; Taghvaei, Hamed; Rahimpour, Mohammad Reza; Shariati, Alireza
2016-01-01
Highlights: • CH 4 conversion into H 2 is investigated in a nanosecond pulsed DBD reactor. • The absence of CO and CO 2 in the product gas is highly favorable. • Effects of external electrode length, applied voltage and frequency are examined. • The maximum efficiency of 7.23% is achieved at the electrode length of 15 cm. • The maximum CH 4 conversion of 87.2% is obtained at discharge power 268.92 W. - Abstract: In this paper, the methane conversion into hydrogen is investigated experimentally in a nanosecond pulsed DBD reactor. In order to achieve pure hydrogen production with minimum power consumption, effects of some operating parameters including external electrode length, applied voltage and pulse repetition frequency have been evaluated. Results show that although higher CH 4 conversion and H 2 concentration can be obtained at longer electrode lengths, higher applied voltages and pulse repetition frequencies, these parameters should be optimized for efficient hydrogen production. Actually, the maximum CH 4 conversion of 87.2% and maximum hydrogen percentage of 80% are obtained at the external electrode length, discharge power, voltage and frequency of 15 cm, 268.92 W, 12 kV and 10 kHz, respectively. However, the maximum efficiency of 7.23% is achieved at the external electrode length of 15 cm, applied voltage of 6 kV, pulse repetition frequency of 0.9 kHz and discharge power of 4 W. Furthermore, at this condition, due to low temperature of discharge zone very little amount of solid carbon was observed on the inner electrode surface of the reactor.
A study of the electrochemical behaviour of electrodes in operating solid-state supercapacitors
International Nuclear Information System (INIS)
Staiti, P.; Lufrano, F.
2007-01-01
The electrochemical behaviour of electrodes and of complete solid-state supercapacitors has been studied by cyclic voltammetry (CV) and galvanostatic charge/discharge (CD) measurements using two independent electrochemical equipments. The first one controlled the execution of the test and recorded the voltage and current values of the complete supercapacitor while the other one recorded the potential changes of the single electrodes. In this work, two different types of capacitors were studied: (a) a symmetric supercapacitor using carbon electrodes, and (b) a hybrid (asymmetric) supercapacitor with ruthenium oxide/carbon in the positive electrode and carbon in the negative electrode. The studies evidenced that in the symmetric capacitors the positive electrode controlled the capacitive performance and an optimal mass ratio from 1.2:1 to 1.3:1 between the positive and the negative electrodes was found in the investigated conditions. For the hybrid supercapacitor it was observed that the ruthenium-based positive electrode influenced the capacitive performance of carbon-based negative electrode and that an accurate balance of carbon loading in the negative electrode was necessary
Zhu, Xinlei; Zhang, Liancheng; Huang, Yifan; Wang, Jin; Liu, Zhen; Yan, Keping
2017-07-01
A new sparker system based on pulsed spark discharge with a single electrode has already been utilized for oceanic seismic exploration. However, the electro-acoustic energy efficiency of this system is lower than that of arc discharge based systems. A simple electrode structure was investigated in order to improve the electro-acoustic energy efficiency of the spark discharge. Experiments were carried out on an experimental setup with discharge in water driven by a pulsed power source. The voltage-current waveform, acoustic signal and bubble oscillation were recorded when the relative position of the electrode varied. The electro-acoustic energy efficiency was also calculated. The load voltage had a saltation for the invaginated electrode tip, namely an obvious voltage remnant. The more the electrode tip was invaginated, the larger the pressure peaks and first period became. The results show that electrode recessing into the insulating layer is a simple and effective way to improve the electro-acoustic energy efficiency from 2% to about 4%.
High-voltage pulsed generator for dynamic fragmentation of rocks.
Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High-voltage pulsed generator for dynamic fragmentation of rocks
Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
A Fabrication Technique for Nano-gap Electrodes by Atomic Force Microscopy Nano lithography
International Nuclear Information System (INIS)
Jalal Rouhi; Shahrom Mahmud; Hutagalung, S.D.; Kakooei, S.
2011-01-01
A simple technique is introduced for fabrication of nano-gap electrodes by using nano-oxidation atomic force microscopy (AFM) lithography with a Cr/ Pt coated silicon tip. AFM local anodic oxidation was performed on silicon-on-insulator (SOI) surfaces by optimization of desired conditions to control process in contact mode. Silicon electrodes with gaps of sub 31 nm were fabricated by nano-oxidation method. This technique which is simple, controllable, inexpensive and fast is capable of fabricating nano-gap structures. The current-voltage measurements (I-V) of the electrodes demonstrated very good insulating characteristics. The results show that silicon electrodes have a great potential for fabrication of single molecule transistors (SMT), single electron transistors (SET) and the other nano electronic devices. (author)
International Nuclear Information System (INIS)
Lee, Byung Il; Oh, Suk Hoon; Woo, Eung Je; Lee, Soo Yeol; Cho, Min Hyoung; Kwon, Ohin; Seo, Jin Keun; Lee, June-Yub; Baek, Woon Sik
2003-01-01
In magnetic resonance electrical impedance tomography (MREIT), we try to reconstruct a cross-sectional resistivity (or conductivity) image of a subject. When we inject a current through surface electrodes, it generates a magnetic field. Using a magnetic resonance imaging (MRI) scanner, we can obtain the induced magnetic flux density from MR phase images of the subject. We use recessed electrodes to avoid undesirable artefacts near electrodes in measuring magnetic flux densities. An MREIT image reconstruction algorithm produces cross-sectional resistivity images utilizing the measured internal magnetic flux density in addition to boundary voltage data. In order to develop such an image reconstruction algorithm, we need a three-dimensional forward solver. Given injection currents as boundary conditions, the forward solver described in this paper computes voltage and current density distributions using the finite element method (FEM). Then, it calculates the magnetic flux density within the subject using the Biot-Savart law and FEM. The performance of the forward solver is analysed and found to be enough for use in MREIT for resistivity image reconstructions and also experimental designs and validations. The forward solver may find other applications where one needs to compute voltage, current density and magnetic flux density distributions all within a volume conductor
Biomedical implementation of liquid metal ink as drawable ECG electrode and skin circuit.
Directory of Open Access Journals (Sweden)
Yang Yu
Full Text Available BACKGROUND: Conventional ways of making bio-electrodes are generally complicated, expensive and unconformable. Here we describe for the first time the method of applying Ga-based liquid metal ink as drawable electrocardiogram (ECG electrodes. Such material owns unique merits in both liquid phase conformability and high electrical conductivity, which provides flexible ways for making electrical circuits on skin surface and a prospective substitution of conventional rigid printed circuit boards (PCBs. METHODS: Fundamental measurements of impedance and polarization voltage of the liquid metal ink were carried out to evaluate its basic electrical properties. Conceptual experiments were performed to draw the alloy as bio-electrodes to acquire ECG signals from both rabbit and human via a wireless module developed on the mobile phone. Further, a typical electrical circuit was drawn in the palm with the ink to demonstrate its potential of implementing more sophisticated skin circuits. RESULTS: With an oxide concentration of 0.34%, the resistivity of the liquid metal ink was measured as 44.1 µΩ·cm with quite low reactance in the form of straight line. Its peak polarization voltage with the physiological saline was detected as -0.73 V. The quality of ECG wave detected from the liquid metal electrodes was found as good as that of conventional electrodes, from both rabbit and human experiments. In addition, the circuit drawn with the liquid metal ink in the palm also runs efficiently. When the loop was switched on, all the light emitting diodes (LEDs were lit and emitted colorful lights. CONCLUSIONS: The liquid metal ink promises unique printable electrical properties as both bio-electrodes and electrical wires. The implemented ECG measurement on biological surface and the successfully run skin circuit demonstrated the conformability and attachment of the liquid metal. The present method is expected to innovate future physiological measurement and
Correcting electrode modelling errors in EIT on realistic 3D head models.
Jehl, Markus; Avery, James; Malone, Emma; Holder, David; Betcke, Timo
2015-12-01
Electrical impedance tomography (EIT) is a promising medical imaging technique which could aid differentiation of haemorrhagic from ischaemic stroke in an ambulance. One challenge in EIT is the ill-posed nature of the image reconstruction, i.e., that small measurement or modelling errors can result in large image artefacts. It is therefore important that reconstruction algorithms are improved with regard to stability to modelling errors. We identify that wrongly modelled electrode positions constitute one of the biggest sources of image artefacts in head EIT. Therefore, the use of the Fréchet derivative on the electrode boundaries in a realistic three-dimensional head model is investigated, in order to reconstruct electrode movements simultaneously to conductivity changes. We show a fast implementation and analyse the performance of electrode position reconstructions in time-difference and absolute imaging for simulated and experimental voltages. Reconstructing the electrode positions and conductivities simultaneously increased the image quality significantly in the presence of electrode movement.
International Nuclear Information System (INIS)
Jäger, Timo; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N.; Schwenk, Johannes
2015-01-01
Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se 2 (CIGS) solar cells, leading to an open circuit voltage V OC enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V OC . Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V OC . Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V OC increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V OC of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability
Abdulsamad, Feras; Florsch, Nicolas; Schmutz, Myriam; Camerlynck, Christian
2016-12-01
During the last decades, the usage of spectral induced polarization (SIP) measurements in hydrogeology and detecting environmental problems has been extensively increased. However, the physical mechanisms which are responsible for the induced polarization response over the usual frequency range (typically 1 mHz to 10-20 kHz) require better understanding. The phase shift observed at high frequencies is sometimes attributed to the so-called Maxwell-Wagner polarization which takes place when charges cross an interface. However, SIP measurements of tap water show a phase shift at frequencies higher than 1 kHz, where no Maxwell-Wagner polarization may occur. In this paper, we enlighten the possible origin of this phase shift and deduce its likely relationship with the types of the measuring electrodes. SIP Laboratory measurements of tap water using different types of measuring electrodes (polarizable and non-polarizable electrodes) are carried out to detect the origin of the phase shift at high frequencies and the influence of the measuring electrodes types on the observed complex resistivity. Sodium chloride is used to change the conductivity of the medium in order to quantify the solution conductivity role. The results of these measurements are clearly showing the impact of the measuring electrodes type on the measured phase spectrum while the influence on the amplitude spectrum is negligible. The phenomenon appearing on the phase spectrum at high frequency (> 1 kHz) whatever the electrode type is, the phase shows an increase compared to the theoretical response, and the discrepancy (at least in absolute value) increases with frequency, but it is less severe when medium conductivity is larger. Additionally, the frequency corner is shifted upward in frequency. The dependence of this phenomenon on the conductivity and the measuring electrodes type (electrode-electrolyte interface) seems to be due to some dielectric effects (as an electrical double layer of small
DEFF Research Database (Denmark)
Meyer, Kaspar Sinding; Andersen, Michael Andreas E.; Jensen, Flemming
2008-01-01
Ring shaped PTs (Piezoelectric Transformers) are an attractive alternative to magnetics in power converters. The achievable energy efficiency is 98% and the power density is up to 30W/cm3. Additionally power supplies based on PTs display low levels of conducted and radiated EMI due to power...... conversion based on the piezoelectric effect. Rooted in the physics of this effect, both the in- and output terminal of a PT has a noticeable parasitic capacitance. In a common half-bridge power stage without any supporting magnetic components, the input parasitic capacitance can lead to hard switching...... losses that are in the range of the actual power rating of a specific PT. In this paper it is demonstrated how the electrode layout of a PT can be designed to enable ZVS (Zero Voltage Switching). This optimization is made simple with a novel set of accurate and simple symbolic equations which relates ZVS...
A new method for measuring the wall charge waveforms of AC PDP
International Nuclear Information System (INIS)
Liang Zhihu; Liu Zujun; Liu Chunliang
2004-01-01
A new method is developed to measure the wall charge waveforms in coplanar alternating current plasma display panel (AC PDP). In the method, two groups of display electrodes are selected from a coplanar AC PDP and two capacitors are respectively connected with these two groups of display electrodes in series, and a measuring circuit and a reference circuit are thus constructed. With the help of special processing, discharge takes place in the cells included in the measuring circuit under a normal drive voltage but no discharge takes place in the cells included in the reference circuit under a normal drive voltage. The wall charge waveforms are obtained from the voltage difference between the two capacitors. Using the method, the wall charge waveforms are measured during resetting period, addressing period and sustaining period for the 304.8 mm (12-inch) test PDP panel. The result shows that the wall voltage is about 96 V during the sustaining period. (authors)
Chen, C Julian; Schwarz, Alex; Wiesendanger, Roland; Horn, Oliver; Müller, Jörg
2010-05-01
We present a novel quartz cantilever for frequency-modulation atomic force microscopy (FM-AFM) which has three electrodes: an actuating electrode, a sensing electrode, and a ground electrode. By applying an ac signal on the actuating electrode, the cantilever is set to vibrate. If the frequency of actuation voltage closely matches one of the characteristic frequencies of the cantilever, a sharp resonance should be observed. The vibration of the cantilever in turn generates a current on the sensing electrode. The arrangement of the electrodes is such that the cross-talk capacitance between the actuating electrode and the sensing electrode is less than 10(-16) F, thus the direct coupling is negligible. To verify the principle, a number of samples were made. Direct measurements with a Nanosurf easyPPL controller and detector showed that for each cantilever, one or more vibrational modes can be excited and detected. Using classical theory of elasticity, it is shown that such novel cantilevers with proper dimensions can provide optimized performance and sensitivity in FM-AFM with very simple electronics.
Antenna Characterization for the JOLT Impulsive Radiator via Low-Voltage Measurements
Tyo, J. S.; Schoenberg, J. S. H.; Baum, C. E.; Prather, W. D.; Hackett, R.; Burger, J. W.; Farr, E. G.; Giri, D. V.; McLemore, D. P.
The JOLT system is a highly directive, impulse-like radiator. The antenna for JOLT is a 10-ft-diameter half-impulse radiating antenna (HIRA). JOLT was one of the first impulse radiating systems to employ a half IRA. For that reason, extensive measurements were made with a prototype, scale model HIRA in order to understand the performance of this class of antenna. In addition, a series of low-voltage antenna subsystem tests were performed with the full JOLT antenna before it was couple to the pulsed power and run at high voltage. The low-voltage measurements proved to be quite valuable, as an important manufacturing defect—a failure to mount the dish perpendicular to the ground plane—was identified and mitigated.
A novel voltage clamp circuit for the measurement of transistor dynamic on-resistance
Gelagaev, R.; Jacqmaer, P.; Everts, J.; Driesen, Johan
2012-01-01
For determining the dynamic on-resistance Rdyn,on of a power transistor, the voltage and current waveforms have to be measured during the switching operation. In measurements of voltage waveforms, using an oscilloscope, the characteristics of an amplifier inside the oscilloscope are distorted when
Operation of a Segmented Hall Thruster with Low-sputtering Carbon-velvet Electrodes
International Nuclear Information System (INIS)
Raitses, Y.; Staack, D.; Dunaevsky, A.; Fisch, N.J.
2005-01-01
Carbon fiber velvet material provides exceptional sputtering resistance properties exceeding those for graphite and carbon composite materials. A 2 kW Hall thruster with segmented electrodes made of this material was operated in the discharge voltage range of 200-700 V. The arcing between the floating velvet electrodes and the plasma was visually observed, especially, during the initial conditioning time, which lasted for about 1 h. The comparison of voltage versus current and plume characteristics of the Hall thruster with and without segmented electrodes indicates that the magnetic insulation of the segmented thruster improves with the discharge voltage at a fixed magnetic field. The observations reported here also extend the regimes wherein the segmented Hall thruster can have a narrower plume than that of the conventional nonsegmented thruster
Autonomous Voltage Oscillations in a Direct Methanol Fuel Cell
International Nuclear Information System (INIS)
Nogueira, Jéssica A.; Peña Arias, Ivonne K.; Hanke-Rauschenbach, Richard; Vidakovic-Koch, Tanja; Varela, Hamilton; Sundmacher, Kai
2016-01-01
Proton exchange membrane fuel cells fed with H_2/CO mixtures at the anode have a considerably lower performance than fuel cells fed with pure hydrogen. However, when operated in an autonomous oscillatory regime, the overall voltage loss decreases due to a self-cleaning mechanism. Another molecule, also widely used as feed in the fuel cell and susceptible to kinetic instabilities, is methanol. To the best of our knowledge, there are no reports on autonomous voltage oscillations in the direct methanol fuel cell (DMFC). The purpose of this work was to explore if such instabilities also occur in the DMFC system. Initially, half-cell experiments with a gas diffusion electrode were performed. Then, a DMFC was operated under current control and studied by means of electrochemical impedance spectroscopy. The half-cell measurements revealed that the induction period for oscillations depends on the mass transfer conditions, where on stagnant electrode the induction time was shorter than in the case of forced convection. The DMFC showed also autonomous voltage oscillations above a certain threshold current. The results obtained by electrochemical impedance spectroscopy give evidence of a negative differential resistance in the fuel cell, hitherto not described in the literature, which can be related to the appearance of oscillations during galvanostatic methanol electro-oxidation. These results open the possibility to evaluate the performance of low-temperature fuel cells fed with carbon-containing fuels under oscillatory operating conditions.
Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D
2018-01-01
Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p0.74 corresponded to bipolar voltage voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, pvoltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.
Determination of HID electrode falls in a model lamp I: Pyrometric measurements
International Nuclear Information System (INIS)
Dabringhausen, L.; Nandelstaedt, D.; Luhmann, J.; Mentel, J.
2002-01-01
To verify models describing the near-electrode regions electrodes of pure and doped tungsten for high intensity discharge lamps are investigated in a special model lamp. It can be operated with arc currents of 1 A to 10 A, DC or AC with arbitrary waveforms up to a few kHz. Argon and xenon, at pressures from 0.1 MPa to 1 MPa, are used as fill gases. A large variety of electrodes can be inserted. To perform spatially resolved measurements they are displaced reproducibly within the discharge tube during lamp operation. Spatially resolved pyrometric measurements of the electrode surface temperature in the case of DC operation are presented. From the temperature distribution the power loss of the electrodes by thermal radiation and heat conduction is determined. It increases almost linearly with the arc current at the anode and less than linear at the cathode. A relation is deduced between the cathode fall and the power fed into the cathode setting up the power balance of the cathodic current transfer zone. The resulting cathode falls show a strong dependence on the electrode diameter. Electrical measurements of separate cathode and anode falls are given in a subsequent paper. The outcomes of both methods and of modelling are compared in a third paper. (author)
Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors
Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.
2013-11-01
This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.
Water Desalination Using Capacitive Deionization with Microporous Carbon Electrodes
Porada, S.; Weinstein, L.; Dash, R.; Wal, van der A.F.; Bryjak, M.; Gogotsi, Y.; Biesheuvel, P.M.
2012-01-01
Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in
Spin-Dependent Processes Measured without a Permanent Magnet.
Fontanesi, Claudio; Capua, Eyal; Paltiel, Yossi; Waldeck, David H; Naaman, Ron
2018-05-07
A novel Hall circuit design that can be incorporated into a working electrode, which is used to probe spin-selective charge transfer and charge displacement processes, is reviewed herein. The general design of a Hall circuit based on a semiconductor heterostructure, which forms a shallow 2D electron gas and is used as an electrode, is described. Three different types of spin-selective processes have been studied with this device in the past: i) photoinduced charge exchange between quantum dots and the working electrode through chiral molecules is associated with spin polarization that creates a local magnetization and generates a Hall voltage; ii) charge polarization of chiral molecules by an applied voltage is accompanied by a spin polarization that generates a Hall voltage; and iii) cyclic voltammetry (current-voltage) measurements of electrochemical redox reactions that can be spin-analyzed by the Hall circuit to provide a third dimension (spin) in addition to the well-known current and voltage dimensions. The three studies reviewed open new doors into understanding both the spin current and the charge current in electronic materials and electrochemical processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Supercapacitive transport of pharmacologic agents using nanoporous gold electrodes.
Gittard, Shaun D; Pierson, Bonnie E; Ha, Cindy M; Wu, Chung-An Max; Narayan, Roger J; Robinson, David B
2010-02-01
In this study, nanoporous gold supercapacitors were produced by electrochemical dealloying of gold-silver alloy. Scanning electron microscopy and energy dispersive X-ray spectroscopy confirmed completion of the dealloying process and generation of a porous gold material with approximately 10 nm diameter pores. Cyclic voltammetry and chronoamperometry of the nanoporous gold electrodes indicated that these materials exhibited supercapacitor behavior. The storage capacity of the electrodes measured by chronoamperometry was approximately 3 mC at 200 mV. Electrochemical storage and voltage-controlled delivery of two model pharmacologic agents, benzylammonium and salicylic acid, was demonstrated. These results suggest that capacitance-based storage and delivery of pharmacologic agents may serve as an alternative to conventional drug delivery methods.
A magnetically levitated electrode ionization chamber of the noncontact measurement type
International Nuclear Information System (INIS)
Kawaguchi, Toshiro; Yoshimura, Atsushi
2002-01-01
A new type of ionization chamber with levitated electrode has been developed. In this ionization chamber, an ion-collection electrode levitates in the air without getting any physical support from the insulator. The electrode is charged by an electrostatic charger without physical contact. The charge of the electrode is read out at a Faraday cage periodically at a given time interval without physical contact. Because its electrode levitates, the ionization chamber produces no background current caused by leaks or piezo current. In addition, as the charging of its electrode and the read-out of its charge are carried out without physical contact, no irregular charge or contact potential difference due to the chattering between electrode and contact point occurs. Through experiments, it was found that this ionization chamber was able to measure the γ-ray dose such as the environmental radiation with a high degree of sensitivity. The minimum detectable value of ionization current when accumulated for 1 h is about 1.3x10 -17 A
A magnetically levitated electrode ionization chamber of the noncontact measurement type
Kawaguchi, T
2002-01-01
A new type of ionization chamber with levitated electrode has been developed. In this ionization chamber, an ion-collection electrode levitates in the air without getting any physical support from the insulator. The electrode is charged by an electrostatic charger without physical contact. The charge of the electrode is read out at a Faraday cage periodically at a given time interval without physical contact. Because its electrode levitates, the ionization chamber produces no background current caused by leaks or piezo current. In addition, as the charging of its electrode and the read-out of its charge are carried out without physical contact, no irregular charge or contact potential difference due to the chattering between electrode and contact point occurs. Through experiments, it was found that this ionization chamber was able to measure the gamma-ray dose such as the environmental radiation with a high degree of sensitivity. The minimum detectable value of ionization current when accumulated for 1 h is a...
Flexible probe for measuring local conductivity variations in Li-ion electrode films
Hardy, Emilee; Clement, Derek; Vogel, John; Wheeler, Dean; Mazzeo, Brian
2018-04-01
Li-ion battery performance is governed by electronic and ionic properties of the battery. A key metric that characterizes Li-ion battery cell performance is the electronic conductivity of the electrodes, which are metal foils with thin coatings of electrochemically active materials. To accurately measure the spatial variation of electronic conductivity of these electrodes, a micro-four-line probe (μ4LP) was designed and used to non-destructively measure the properties of commercial-quality Li-ion battery films. This previous research established that the electronic conductivity of film electrodes is not homogeneous throughout the entirety of the deposited film area. In this work, a micro-N-line probe (μNLP) and a flexible micro-flex-line probe (μFLP) were developed to improve the non-destructive micro-scale conductivity measurements that we can take. These devices were validated by comparing test results to that of the predecessor, the micro-four-line probe (μ4LP), on various commercial-quality Li-ion battery electrodes. Results show that there is significant variation in conductivity on a millimeter and even micrometer length scale through the electrode film. Compared to the μ4LP, the μNLP and μFLP also introduce additional measurement configuration possibilities, while providing a more robust design. Researchers and manufacturers can use these probes to identify heterogeneity in their electrodes during the fabrication process, which will lead to the development of better batteries.
International Nuclear Information System (INIS)
De Los Santos Valladares, L.; Reeve, R.M.; Mitrelias, T.; Langford, R.M.; Barnes, C.H.W.; Bustamante Dominguez, A.; Aguiar, J. Albino; Majima, Y.
2013-01-01
In this work, we report the mechanical reorientation of thiolated ferromagnetic microspheres bridging a pair of gold electrodes under an external magnetic field. When an external magnetic field (7 kG) is applied during the measurement of the current-voltage characteristics of a carboxyl ferromagnetic microsphere (4 μm diameter) attached to two gold electrodes by self-assembled monolayers (SAMs) of octane dithiol (C 8 H 18 S 2 ), the current signal is distorted. Rather than due to magnetoresistance, this effect is caused by a mechanical reorientation of the ferromagnetic sphere, which alters the number of SAMs between the sphere and the electrodes and therefore affects conduction. To study the physical reorientation of the ferromagnetic particles, we measure their hysteresis loops while suspended in a liquid solution. (author)
Energy Technology Data Exchange (ETDEWEB)
De Los Santos Valladares, L.; Reeve, R.M.; Mitrelias, T.; Langford, R.M.; Barnes, C.H.W., E-mail: luis_d_v@hotmail.com [Cavendish Laboratory, Department of Physics, University of Cambridge Materials and Structures Laboratory (United Kingdom); Bustamante Dominguez, A. [Laboratorio de Ceramicos y Nanomateriales, Facultad de Ciencias Fisicas, Universidad Nacional Mayor de San Marcos, Lima (Peru); Aguiar, J. Albino [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Fisica; Azuma, Y. [Materials and Structures Laboratory, Tokyo Institute of Technology, Midori-ku, Yokohama (Japan); Majima, Y. [CREST, Japan Science and Technology Agency (JST), Midori-ku, Yokohama (Japan)
2013-08-15
In this work, we report the mechanical reorientation of thiolated ferromagnetic microspheres bridging a pair of gold electrodes under an external magnetic field. When an external magnetic field (7 kG) is applied during the measurement of the current-voltage characteristics of a carboxyl ferromagnetic microsphere (4 μm diameter) attached to two gold electrodes by self-assembled monolayers (SAMs) of octane dithiol (C{sub 8}H{sub 18}S{sub 2}), the current signal is distorted. Rather than due to magnetoresistance, this effect is caused by a mechanical reorientation of the ferromagnetic sphere, which alters the number of SAMs between the sphere and the electrodes and therefore affects conduction. To study the physical reorientation of the ferromagnetic particles, we measure their hysteresis loops while suspended in a liquid solution. (author)
Directory of Open Access Journals (Sweden)
Abderrahmane Beroual
2017-04-01
Full Text Available This paper deals with a comparative study of AC and DC breakdown voltages of based mineral oil mixtures with natural and synthetic esters mainly used in high voltage power transformers. The goal was to analyze the performances of oil mixtures from the dielectric withstand point of view and to predict the behavior of transformers originally filled with mineral oil and re-filled with synthetic or natural ester oils when emptied for maintenance. The study concerns mixtures based on 20%, 50%, and 80% of natural and synthetic ester oils. AC breakdown voltages were measured using a sphere-sphere electrode system according to IEC 60156 specifications; the same specification was adopted for DC measurements since there is no standard specifications for this voltage waveform. A statistical analysis of the mean values, standard deviations, and histograms of breakdown voltage data was carried out. The Normal and Weibull distribution functions were used to analyze the experimental data and the best function that the data followed was used to estimate the breakdown voltage with risk of 1%, 10%, and 50% probability. It was shown that whatever the applied voltage waveforms, ester oils always have a significantly higher breakdown voltage than mineral oil. The addition of only 20% of natural or synthetic ester oil was sufficient to considerably increase the breakdown voltage of mineral oil. The dielectric strength of such a mixture is much higher than that of mineral oil alone and can reach that of ester oils. From the point of view of dielectric strength, the mixtures constitute an option for improving the performance of mineral oil. Thus, re-filling of transformers containing up to 20% mineral oil residues with ester oils, does not present any problem; it is even advantageous when considering only the breakdown voltage. Under AC, the mixtures with natural ester always follow the behavior of vegetable oil alone. With the exception of the 20% mixture of natural
Directory of Open Access Journals (Sweden)
Šarūnas MEŠKINIS
2013-03-01
Full Text Available In present study five synthesized organic semiconductor compounds have been used for fabrication of the planar metal / organic semiconductor / metal structures. Both top electrode and bottom electrode configurations were used. Current-voltage (I-V characteristics of the samples were investigated. Effect of the hysteresis of the I-V characteristics was observed for all the investigated samples. However, strength of the hysteresis was dependent on the organic semiconductor used. Study of I-V characteristics of the top contact Al/AT-RB-1/Al structures revealed, that in (0 – 500 V voltages range average current of the samples measured in air is only slightly higher than current measured in nitrogen ambient. Deposition of the ultra-thin diamond like carbon interlayer resulted in both decrease of the hysteresis of I-V characteristics of top contact Al/AT-RB-1/Al samples. However, decreased current and decreased slope of the I-V characteristics of the samples with diamond like carbon interlayer was observed as well. I-V characteristic hysteresis effect was less pronounced in the case of the bottom contact metal/organic semiconductor/metal samples. I-V characteristics of the bottom contact samples were dependent on electrode metal used.DOI: http://dx.doi.org/10.5755/j01.ms.19.1.3816
Operational features and air plasma characteristics of a thermal plasma torch with hollow electrodes
International Nuclear Information System (INIS)
Hur, Min; Kim, Keun Su; Hong, Sang Hee
2003-01-01
The operational features and thermal plasma characteristics of a plasma torch with hollow electrodes are investigated based on their dependence on input current, gas flow rate and electrode diameter when air is used as a plasma gas. A plasma torch with a hollow cathode and anode has been designed and fabricated, and the arc voltages and thermal efficiencies are measured from its discharge. The newly modified similarity criteria are derived from the measured data related to torch performances. From the fact that these criteria successfully describe both the arc voltage and thermal efficiency behaviour of the torch, depending on its operating and geometrical parameters, it is proved that they can be usefully applied to the design and operation of high power torches. For the numerical modelling of the interior region of the torch, a cold flow analysis is employed along with a simplified balance equation of the Lorentz and gas dynamic drag forces in order to determine a cathode spot position on the cathode surface. The validity of this method is confirmed by comparison of the calculated and measured net powers. As a practically useful result of this analysis, carried out through this numerical and experimental work, it is suggested that low input current, high gas flow rate and relatively large electrode diameter are more favourable as appropriate operating conditions of the torch for the efficient treatment of hazardous organic wastes
Electrical Measurements on a Moving Argon Plasma
Energy Technology Data Exchange (ETDEWEB)
Abbas, A. A.M.; Howatson, A. M. [Oxford University (United Kingdom)
1966-10-15
Experimental current-voltage characteristic curves were obtained for a moving argon plasma at two stations in an electrically-driven 5 cm shock tube. The standard energy was 1 kj and the base pressure 10 torr, giving a shock of about Mach 4. The measurements were made on the highly-ionized driver gas which followed the shock at speeds between 800 and 1100 m/sec. Two types of electrode were used. One comprised circular solid electrodes of aluminium, molybdenum or stainless steel so machined as to be quite flush with the tube wall; the other comprised filaments of tungsten wire which were immersed in the free stream and could be used cold or heated for thermionic emission. Characteristics were obtained both for applied voltages and for MHD-generated voltages; for the latter a magnetic field of good uniformity up to 0.9 Wb/m{sup 2} was used. The results were always markedly dependent on the surface condition of the electrodes. For consistent results the flush electrodes had to be cleaned carefully by hand after every third discharge, while the filament electrodes were thermionically cleaned before every discharge. In general the cold electrode characteristics for applied voltage showed three distinct regions: a current increase such as would be expected from a double probe; a saturation region; and a linear increase, in order of increasing voltage. For the flush electrodes another apparent saturation was found before, finally, the transition to an arc-type discharge. The first saturation current for flush electrodes corresponded to a random ion current much less than that estimated to exist away from the tube walls, as is expected from a consideration of diffusion through a boundary layer. The value of the current varied somewhat with the electrode material. For the cold filaments, the saturation current density was of the same order as for the flush electrodes. From the linear region of the curves, an effective plasma conductivity was obtained. For comparison, the
Near-uv photon efficiency in a TiO2 electrode - Application to hydrogen production from solar energy
Desplat, J.-L.
1976-01-01
An n-type (001) TiO2 electrode irradiated at 365 nm was tested under anodic polarization. A saturation current independent of pH and proportional to light intensity has been observed. Accurate measurements of the incident power lead to a 60 per cent photon efficiency. A photoelectrochemical cell built with such an electrode, operated under solar irradiation without concentration, produced an electrolysis current of 0.7 mA/sq cm without applied voltage.
Nanothorn electrodes for ionic polymer-metal composite artificial muscles.
Palmre, Viljar; Pugal, David; Kim, Kwang J; Leang, Kam K; Asaka, Kinji; Aabloo, Alvo
2014-08-22
Ionic polymer-metal composites (IPMCs) have recently received tremendous interest as soft biomimetic actuators and sensors in various bioengineering and human affinity applications, such as artificial muscles and actuators, aquatic propulsors, robotic end-effectors, and active catheters. Main challenges in developing biomimetic actuators are the attainment of high strain and actuation force at low operating voltage. Here we first report a nanostructured electrode surface design for IPMC comprising platinum nanothorn assemblies with multiple sharp tips. The newly developed actuator with the nanostructured electrodes shows a new way to achieve highly enhanced electromechanical performance over existing flat-surfaced electrodes. We demonstrate that the formation and growth of the nanothorn assemblies at the electrode interface lead to a dramatic improvement (3- to 5-fold increase) in both actuation range and blocking force at low driving voltage (1-3 V). These advances are related to the highly capacitive properties of nanothorn assemblies, increasing significantly the charge transport during the actuation process.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Curved Microneedle Array-Based sEMG Electrode for Robust Long-Term Measurements and High Selectivity
Directory of Open Access Journals (Sweden)
Minjae Kim
2015-07-01
Full Text Available Surface electromyography is widely used in many fields to infer human intention. However, conventional electrodes are not appropriate for long-term measurements and are easily influenced by the environment, so the range of applications of sEMG is limited. In this paper, we propose a flexible band-integrated, curved microneedle array electrode for robust long-term measurements, high selectivity, and easy applicability. Signal quality, in terms of long-term usability and sensitivity to perspiration, was investigated. Its motion-discriminating performance was also evaluated. The results show that the proposed electrode is robust to perspiration and can maintain a high-quality measuring ability for over 8 h. The proposed electrode also has high selectivity for motion compared with a commercial wet electrode and dry electrode.
Energy harvesting efficiency of piezoelectric polymer film with graphene and metal electrodes.
Park, Sanghoon; Kim, Yura; Jung, Hyosub; Park, Jun-Young; Lee, Naesung; Seo, Yongho
2017-12-11
In this study, we investigated an energy harvesting effect of tensile stress using piezoelectric polymers and flexible electrodes. A chemical-vapor-deposition grown graphene film was transferred onto both sides of the PVDF and P(VDF-TrFE) films simultaneously by means of a conventional wet chemical method. Output voltage induced by sound waves was measured and analyzed when a mechanical tension was applied to the device. Another energy harvester was made with a metallic electrode, where Al and Ag were deposited by using an electron-beam evaporator. When acoustic vibrations (105 dB) were applied to the graphene/PVDF/graphene device, an induced voltage of 7.6 V pp was measured with a tensile stress of 1.75 MPa, and this was increased up to 9.1 V pp with a stress of 2.18 MPa for the metal/P(VDF-TrFE)/metal device. The 9 metal/PVDF/metal layers were stacked as an energy harvester, and tension was applied by using springs. Also, we fabricated a full-wave rectifying circuit to store the electrical energy in a 100 μF capacitor, and external vibration generated the electrical charges. As a result, the stored voltage at the capacitor, obtained from the harvester via a bridge diode rectifier, was saturated to ~7.04 V after 180 s charging time.
Calibration of kV measurers with the practical peak voltage (IEC 1676)
International Nuclear Information System (INIS)
Becker, Paulo H.B.; Peres, Marcos A.L.; Ludwig, Jaime L.; Chernicharo, Carlos C.
2002-01-01
The IEC 1676 standard introduces a new quantity for the measurements of the high voltages applied to the X ray tubes used for diagnosis, the 'Practical Peak Voltage' (PPV). In order to start the introduction of this new quantity in Brazil the National Laboratory for Metrology of Ionizing Radiation has developed a procedure for calibrating measuring instruments in this quantity. This procedure is based in the same set up used for the calibration of the conventional kVp, which consists in a high voltage divider (Dynalyser III from Radcal Corporation), a fast analogue to digital conversion board and a data acquisition software. In order to evaluate this procedure a commercial kVp measure instrument that is able to measure PPV (Universal Diavolt from PTW) was calibrated and the results compared. This work presents a summary of the procedure developed and the results obtained with the comparison. (author)
Effect of multipactor conditioning on technical electrode surfaces
International Nuclear Information System (INIS)
Graves, T. P.; Spektor, R.; Stout, P.
2009-01-01
Historically, multipactor conditioning has been utilized to remove surface contaminants from rf electrodes by electron-stimulated gas desorption, and such conditioning has been shown to reduce multipactor susceptibility. Multipactor threshold improvements are due to increasing E 1 , the minimum energy for the secondary electron coefficient, δ>1, such that resonant electrons are incapable of producing discharge-sustaining secondary emission. Using an rf amplitude sweep technique, the evolution of the multipactor threshold is measured as a function of multipactor conditioning time for a series of technical electrode surfaces. Results show over +3 dB of threshold improvement in copper and gold electrodes, while the aluminum threshold actually decreases with conditioning exposure. Additionally, these conditioning results indicate the possible voltage region for transient-mode multipaction (TMM), which can cause significant risk to rf systems such as space satellite components for which in-situ conditioning is generally not possible. Experimental results and supporting Monte Carlo particle tracking simulation results are presented.
Energy Technology Data Exchange (ETDEWEB)
Esch, H. P. L. de, E-mail: hubert.de-esch@cea.fr; Simonin, A.; Grand, C. [CEA-Cadarache, IRFM, F-13108 St. Paul-lez-Durance (France)
2015-04-08
IRFM have conducted resilience tests on electrodes made of Cu, stainless steel 304L, Ti and Mo against breakdowns up to 170 kV and 300 J. The tests of the 10×10 cm{sup 2} electrodes have been performed at an electrode distance d=11 mm under vacuum (P∼5×10{sup −6} mbar). No great difference in voltage holding between the materials could be identified; all materials could reach a voltage holding between 140 and 170 kV over the 11 mm gap, i.e. results scatter within a ±10% band. After exposure to ∼10000 seconds of high-voltage (HV) on-time, having accumulated ∼1000 breakdowns, the electrodes were inspected. The anodes were covered with large and small craters. The rugosity of the anodes had increased substantially, that of the cathodes to a lesser extent. The molybdenum electrodes are least affected, but this does not show in their voltage holding capability. It is hypothesized that penetrating high-energy electrons from the breakdown project heat below the surface of the anode and cause a micro-explosion of material when melting point is exceeded. Polished electrodes have also been tested. The polishing results in a substantially reduced breakdown rate in the beginning, but after having suffered a relatively small number (∼100) of breakdowns, the polished electrodes behaved the same as the unpolished ones.
Grisham, Larry R
2013-12-17
The present invention provides systems and methods for the magnetic insulation of accelerator electrodes in electrostatic accelerators. Advantageously, the systems and methods of the present invention improve the practically obtainable performance of these electrostatic accelerators by addressing, among other things, voltage holding problems and conditioning issues. The problems and issues are addressed by flowing electric currents along these accelerator electrodes to produce magnetic fields that envelope the accelerator electrodes and their support structures, so as to prevent very low energy electrons from leaving the surfaces of the accelerator electrodes and subsequently picking up energy from the surrounding electric field. In various applications, this magnetic insulation must only produce modest gains in voltage holding capability to represent a significant achievement.
Measurement of microchannel fluidic resistance with a standard voltage meter
International Nuclear Information System (INIS)
Godwin, Leah A.; Deal, Kennon S.; Hoepfner, Lauren D.; Jackson, Louis A.; Easley, Christopher J.
2013-01-01
Highlights: ► Standard voltage meter used to measure fluidic resistance. ► Manual measurement takes a few seconds, akin to electrical resistance measurements. ► Measurement error is reduced compared to other approaches. ► Amenable to dynamic measurement of fluidic resistance. - Abstract: A simplified method for measuring the fluidic resistance (R fluidic ) of microfluidic channels is presented, in which the electrical resistance (R elec ) of a channel filled with a conductivity standard solution can be measured and directly correlated to R fluidic using a simple equation. Although a slight correction factor could be applied in this system to improve accuracy, results showed that a standard voltage meter could be used without calibration to determine R fluidic to within 12% error. Results accurate to within 2% were obtained when a geometric correction factor was applied using these particular channels. When compared to standard flow rate measurements, such as meniscus tracking in outlet tubing, this approach provided a more straightforward alternative and resulted in lower measurement error. The method was validated using 9 different fluidic resistance values (from ∼40 to 600 kPa s mm −3 ) and over 30 separately fabricated microfluidic devices. Furthermore, since the method is analogous to resistance measurements with a voltage meter in electrical circuits, dynamic R fluidic measurements were possible in more complex microfluidic designs. Microchannel R elec was shown to dynamically mimic pressure waveforms applied to a membrane in a variable microfluidic resistor. The variable resistor was then used to dynamically control aqueous-in-oil droplet sizes and spacing, providing a unique and convenient control system for droplet-generating devices. This conductivity-based method for fluidic resistance measurement is thus a useful tool for static or real-time characterization of microfluidic systems.
A method and an electrode for excitation of a plasma
International Nuclear Information System (INIS)
Glejboel, K.
1998-01-01
The method for excitation of a plasma comprises the step of subjecting a gas to an electric field generated by an electrode system. Each of 3 to 30 electrodes are connected to one of three specified AC voltages. The frequency is preferably between 50 and 60 Hz. The invention also concerns an electrode system for carrying out the method. 3 figs
Alternating voltage-induced electrochemical synthesis of colloidal Au nanoicosahedra
Energy Technology Data Exchange (ETDEWEB)
McCann, Kevin; Cloud, Jacqueline E.; Yang, Yongan, E-mail: yonyang@mines.edu [Colorado School of Mines, Department of Chemistry and Geochemistry (United States)
2013-11-15
A simple method of alternating voltage-induced electrochemical synthesis has been developed to synthesize highly dispersed colloidal Au nanoicosahedra of 14 ± 3 nm in size. This simple and effective method uses a common transformer to apply a zero-offset alternating voltage to a pair of identical Au electrodes that are immersed in an electrolyte solution containing ligands. The obtained Au nanoicosahedra in this work are among the smallest Au icosahedra synthesized in aqueous solutions. A series of experimental conditions have been studied, such as voltage, the electrolyte identity and concentration, stabilizer identity and concentration, and reaction temperature. The mechanistic study indicates that Au nanoicosahedra are produced on electrode surfaces through an intermediate state of AuO{sub x}. The kinetic rate constant of these Au icosahedra in catalyzing the reduction of 4-nitrophenol with sodium borohydride is found much larger than the literature values of similar Au nanocrystals. In addition, the synthesis of Au–Pd-alloyed NCs has also been attempted.Graphical Abstract.
Energy Technology Data Exchange (ETDEWEB)
Jäger, Timo, E-mail: timo.jaeger@empa.ch; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N. [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Thin Films and Photovoltaics, Überlandstrasse 129, 8600 Dübendorf (Switzerland); Schwenk, Johannes [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Nanoscale Materials Science, Überlandstrasse 129, 8600 Dübendorf (Switzerland)
2015-06-14
Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se{sub 2} (CIGS) solar cells, leading to an open circuit voltage V{sub OC} enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V{sub OC}. Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V{sub OC}. Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V{sub OC} increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V{sub OC} of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability.
International Nuclear Information System (INIS)
Avellaneda, Cesar O.; Goncalves, Agnaldo D.; Benedetti, Joao E.; Nogueira, Ana F.
2010-01-01
Core-shell electrodes based on TiO 2 covered with different oxides were prepared and characterized. These electrodes were applied in gel electrolyte-based dye-sensitized solar cells (DSSC). The TiO 2 electrodes were prepared from TiO 2 powder (P25 Degussa) and coated with thin layers of Al 2 O 3 , MgO, Nb 2 O 5 , and SrTiO 3 prepared by the sol-gel method. The core-shell electrodes were characterized by X-ray diffraction, scanning electron microscopy and atomic force microscopy measurements. J-V curves in the dark and under standard AM 1.5 conditions and photovoltage decay measurements under open-circuit conditions were carried out in order to evaluate the influence of the oxide layer on the charge recombination dynamics and on the device's performance. The results indicated an improvement in the conversion efficiency as a result of an increase in the open circuit voltage. The photovoltage decay curves under open-circuit conditions showed that the core-shell electrodes provide longer electron lifetime values compared to uncoated TiO 2 electrodes, corroborating with a minimization in the recombination losses at the nanoparticle surface/electrolyte interface. This is the first time that a study has been applied to DSSC based on gel polymer electrolyte. The optimum performance was achieved by solar cells based on TiO 2 /MgO core-shell electrodes: fill factor of ∼0.60, short-circuit current density J sc of 12 mA cm -2 , open-circuit voltage V oc of 0.78 V and overall energy conversion efficiency of ∼5% (under illumination of 100 mW cm -2 ).
Impact of electrode geometry on an atmospheric pressure surface barrier discharge
Hasan, M. I.; Morabit, Y.; Dickenson, A.; Walsh, J. L.
2017-06-01
Several of the key characteristics of an atmospheric pressure surface barrier discharge (SBD) are heavily dependent on the geometrical configuration of the plasma generating electrodes. This paper reveals that increasing the surface area of an SBD device by reducing the gaps within the electrodes can have major and unforeseen consequence on the discharge properties. It is experimentally demonstrated that a critical limit exists when reducing the diameter of a circular electrode gap below 5 mm, beyond which the required breakdown voltage increases exponentially and the power deposited in the discharge is impeded. Using a numerical model, it is shown that a reduced electrode gap diameter yields a decrease in the voltage difference between the electrode and dielectric surface, thus lowering the maximum electric field. This study indicates a link between the electrode geometry and the nature of the reactive chemistry produced in the plasma, findings which have wide-reaching implications for many applications where multiple closely packed surface barrier discharges are employed to achieve uniform and large area plasma processing.
Effect of voltage waveform on dielectric barrier discharge ozone production efficiency
Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.
2012-03-01
Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.
Directory of Open Access Journals (Sweden)
Nobuyuki Nishimori
2014-05-01
Full Text Available We demonstrated the generation of a 500-keV electron beam from a high dc voltage photoemission gun for an energy recovery linac light source [N. Nishimori et al., Appl. Phys. Lett. 102, 234103 (2013]. This demonstration was achieved by addressing two discharge problems that lead to vacuum breakdown in the dc gun. One is field emission generated from a central stem electrode. We employed a segmented insulator to protect the ceramic insulator surface from the field emission. The other is microdischarge at an anode electrode or a vacuum chamber, which is triggered by microparticle transfer or field emission from a cathode electrode. An experimental investigation revealed that a larger acceleration gap, optimized mainly to reduce the surface electric field of the anode electrode, suppresses the microdischarge events that accompany gas desorption. It was also found that nonevaporable getter pumps placed around the acceleration gap greatly help to suppress those microdischarge events. The applied voltage as a function of the total gas desorption is shown to be a good measure for finding the optimum dc gun configuration.
Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2017-02-16
The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Modifying cochlear implant design: advantages of placing a return electrode in the modiolus.
Ho, Steven Y; Wiet, Richard J; Richter, Claus-Peter
2004-07-01
A modiolar return electrode significantly increases the current flow across spiral ganglion cells into the modiolus, and may decrease the cochlear implant's power requirements. Ideal cochlear implants should maximize current flow into the modiolus to stimulate auditory neurons. Previous efforts to facilitate current flow through the modiolus included the fabrication and use of precurved electrodes designed to "hug" the modiolus and silastic positioners designed to place the electrodes closer to the modiolus. In contrast to earlier efforts, this study explores the effects of return electrode placement on current distributions in the modiolus. The effects of return electrode positioning on current flow in the modiolus were studied in a Plexiglas model of the cochlea. Results of model measurements were confirmed by measurements in the modiolus of human temporal bones. The return electrode was placed either within the modiolus, or remotely, outside the temporal bone, simulating contemporary cochlear implant configurations using monopolar stimulation. Cochlear model results clearly show that modiolar current amplitudes can be influenced significantly by the location of the return electrode, being larger when placed into the modiolus. Temporal bone data show similar findings. Voltages recorded in the modiolus are, on average, 2.8 times higher with the return electrode in the modiolus compared with return electrode locations outside the temporal bone. Placing a cochlear implant's return electrode in the modiolus should significantly reduce its power consumption. Reducing power requirements should lead to improved efficiency, safer long-term use, and longer device life.
Surface effects of electrode-dependent switching behavior of resistive random-access memory
Ke, Jr Jian; Wei, Tzu Chiao; Tsai, Dung Sheng; Lin, Chun-Ho; He, Jr-Hau
2016-01-01
of the oxygen chemisorption process was proposed to explain this electrode-dependent switching behavior. The temperature-dependent switching voltage demonstrates that the ReRAM devices fabricated with Pt electrodes have a lower activation energy
On Leakage Current Measured at High Cell Voltages in Lithium-Ion Batteries
Energy Technology Data Exchange (ETDEWEB)
Vadivel, Nicole R.; Ha, Seungbum; He, Meinan; Dees, Dennis; Trask, Steve; Polzin, Bryant; Gallagher, Kevin G.
2017-01-01
In this study, parasitic side reactions in lithium-ion batteries were examined experimentally using a potentiostatic hold at high cell voltage. The experimental leakage current measured during the potentiostatic hold was compared to the Tafel expression and showed poor agreement with the expected transfer coefficient values, indicating that a more complicated expression could be needed to accurately capture the physics of this side reaction. Here we show that cross-talk between the electrodes is the primary contribution to the observed leakage current after the relaxation of concentration gradients has ceased. This cross-talk was confirmed with experiments using a lithium-ion conducting glass ceramic (LICGC) separator, which has high conductance only for lithium cations. The cells with LICGC separators showed significantly less leakage current during the potentiostatic hold test compared to cells with standard microporous separators where cross-talk is present. In addition, direct-current pulse power tests show an impedance rise for cells held at high potentials and for cells held at high temperatures, which could be attributed to film formation from the parasitic side reaction. Based on the experimental findings, a phenomenological mechanism is proposed for the parasitic side reaction which accounts for cross-talk and mass transport of the decomposition products across the separator.
Lee, Kyoung-Ryul; Jang, Sung Hwan; Jung, Inhwa
2018-08-10
We investigated the acoustic performance of electrostatic sound-generating devices consisting of bi-layer graphene on polyimide film. The total sound pressure level (SPL) of the sound generated from the devices was measured as a function of source frequency by sweeping, and frequency spectra were measured at 1/3 octave band frequencies. The relationship between various operation conditions and total SPL was determined. In addition, the effects of changing voltage level, adding a DC offset, and using two pairs of electrodes were evaluated. It should be noted that two pairs of electrode operations improved sound generation by about 10 dB over all frequency ranges compared with conventional operation. As for the sound-generating capability, total SPL was 70 dBA at 4 kHz when an AC voltage of 100 V pp was applied with a DC offset of 100 V. Acoustic characteristics differed from other types of graphene-based sound generators, such as graphene thermoacoustic devices and graphene polyvinylidene fluoride devices. The effects of diameter and distance between electrodes were also studied, and we found that diameter greatly influenced the frequency response. We anticipate that the design information provided in this paper, in addition to describing key parameters of electrostatic sound-generating devices, will facilitate the commercial development of electrostatic sound-generating systems.
Long Life Nickel Electrodes for Nickel-Hydrogen Cells: Fiber Substrates Nickel Electrodes
Rogers, Howard H.
2000-01-01
Samples of nickel fiber mat electrodes were investigated over a wide range of fiber diameters, electrode thickness, porosity and active material loading levels. Thickness' were 0.040, 0.060 and 0.080 inches for the plaque: fiber diameters were primarily 2, 4, and 8 micron and porosity was 85, 90, and 95%. Capacities of 3.5 in. diameter electrodes were determined in the flooded condition with both 26 and 31% potassium hydroxide solution. These capacity tests indicated that the highest capacities per unit weight were obtained at the 90% porosity level with a 4 micron diameter fiber plaque. It appeared that the thinner electrodes had somewhat better performance, consistent with sintered electrode history. Limited testing with two-positive-electrode boiler plate cells was also carried out. Considerable difficulty with constructing the cells was encountered with short circuits the major problem. Nevertheless, four cells were tested. The cell with 95% porosity electrodes failed during conditioning cycling due to high voltage during charge. Discharge showed that this cell had lost nearly all of its capacity. The other three cells after 20 conditioning cycles showed capacities consistent with the flooded capacities of the electrodes. Positive electrodes made from fiber substrates may well show a weight advantage of standard sintered electrodes, but need considerably more work to prove this statement. A major problem to be investigated is the lower strength of the substrate compared to standard sintered electrodes. Problems with welding of leads were significant and implications that the electrodes would expand more than sintered electrodes need to be investigated. Loading levels were lower than had been expected based on sintered electrode experiences and the lower loading led to lower capacity values. However, lower loading causes less expansion and contraction during cycling so that stress on the substrate is reduced.
Measurement scheme of kicker impedances via beam-induced voltages of coaxial cables
Energy Technology Data Exchange (ETDEWEB)
Shobuda, Yoshihiro, E-mail: yoshihiro.shobuda@j-parc.jp [J-PARC Center, JAEA and KEK, 2-4 Shirakata Shirane, Tokaimura, Nakagun, Ibaraki 319-1195 (Japan); Irie, Yoshiro [KEK, High Energy Accelerator Research Organization, 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Toyama, Takeshi; Kamiya, Junichiro [J-PARC Center, JAEA and KEK, 2-4 Shirakata Shirane, Tokaimura, Nakagun, Ibaraki 319-1195 (Japan); Watanabe, Masao [Ministry of Education, Culture, Sports, Science and Technology, 3-2-2 Kasumigaseki, Chiyoda, Tokyo 100-8959 (Japan)
2013-06-11
A new theory, which satisfies the causality condition, is developed to describe impedances of kicker magnets with coaxial cables. The theoretical results well describe measurement results, which are obtained by standard wire methods. On the other hand, when beams pass through the kicker, voltages are induced at the terminals of coaxial cables. In other words, by analyzing the voltages, the kicker impedance for the beams can be obtained. The observed impedances are consistent with the theoretical results. The theory describes the impedance for non-relativistic beams, as well. The theoretical, simulation and measurement results indicate that the horizontal kicker impedance is drastically reduced by the non-relativistic effect. -- Highlights: ► We develop an innovative method to measure kicker impedance including power cable. ► By analyzing voltages at the ends of coaxial cables, the impedance is derived. ► The horizontal impedance is reduced as the beam becomes non-relativistic.
Measuring Vitamin C Content of Commercial Orange Juice Using a Pencil Lead Electrode
King, David; Friend, Jeffrey; Kariuki, James
2010-01-01
A pencil lead successfully served as an electrode for the determination of ascorbic acid in commercial orange juice. Cyclic voltammetry was used as an electrochemical probe to measure the current produced from the oxidation of ascorbic acid with a variety of electrodes. The data demonstrate that the less expensive pencil lead electrode gives…
Insulating electrodes: a review on biopotential front ends for dielectric skin–electrode interfaces
International Nuclear Information System (INIS)
Spinelli, Enrique; Haberman, Marcelo
2010-01-01
Insulating electrodes, also known as capacitive electrodes, allow acquiring biopotentials without galvanic contact with the body. They operate with displacement currents instead of real charge currents, and the electrolytic electrode–skin interface is replaced by a dielectric film. The use of insulating electrodes is not the end of electrode interface problems but the beginning of new ones: coupling capacitances are of the order of pF calling for ultra-high input impedance amplifiers and careful biasing, guarding and shielding techniques. In this work, the general requirements of front ends for capacitive electrodes are presented and the different contributions to the overall noise are discussed and estimated. This analysis yields that noise bounds depend on features of the available devices as current and voltage noise, but the final noise level also depends on parasitic capacitances, requiring a careful shield and printed circuit design. When the dielectric layer is placed on the skin, the present-day amplifiers allow achieving noise levels similar to those provided by wet electrodes. Furthermore, capacitive electrode technology allows acquiring high quality ECG signals through thin clothes. A prototype front end for capacitive electrodes was built and tested. ECG signals were acquired with these electrodes in direct contact with the skin and also through cotton clothes 350 µm thick. They were compared with simultaneously acquired signals by means of wet electrodes and no significant differences were observed between both output signals
Analysis of voltage-drop near cold-electrodes of a combustion MHD generator
International Nuclear Information System (INIS)
Satyamurthy, P.; Venkatramani, N.; Rohatgi, V.K.
1983-01-01
In this paper turbulent compressible boundary layer equations for mass, momentum and energy are solved near the cold electrode wall of a combustion MHD generator. Arcs are simulated by freezing the electron temperature (and hence electrical conductivity) to a temperature called Tsub(arc) when gas temperature is less than Tsub(arc). Theoretical near electrode drop for various current densities along the flow direction is analysed for various Tsub(arc) temperatures and compared with experimentally obtained near electrode drop. It is found that the Tsub(arc) temperature increases as a square root along the flow direction and has linear dependency on current density. (author)
Low Impedance Carbon Adhesive Electrodes with Long Shelf Life.
Posada-Quintero, Hugo F; Reyes, Bersaín A; Burnham, Ken; Pennace, John; Chon, Ki H
2015-10-01
A novel electrocardiogram (ECG) electrode film is developed by mixing carbon black powder and a quaternary salt with a visco-elastic polymeric adhesive. Unlike traditional wet gel-based electrodes, carbon/salt/adhesive (CSA) electrodes should theoretically have an infinite shelf life as they do not dehydrate even after a prolonged period of storage. The CSA electrodes are electrically activated for use through the process of electrophoresis. Specifically, the activation procedure involves sending a high voltage and current through the electrode, which results in significant reduction of impedance so that high fidelity ECG signals can be obtained. Using the activation procedure, the ideal concentration of carbon black powder in the mixture with the adhesive was examined. It was determined that the optimum concentration of carbon black which minimized post-activation impedance was 10%. Once the optimal carbon black powder concentration was determined, extensive signal analysis was performed to compare the performance of the CSA electrodes to the standard silver-silver chloride (Ag/AgCl) electrodes. As a part of data analysis, electrode-skin contact impedance of the CSA was measured and compared to the standard Ag/AgCl electrodes; we found consistently lower impedance for CSA electrodes. For quantitative data analysis, we simultaneously collected ECG data with CSA and Ag/AgCl electrodes from 17 healthy subjects. Heart rate variability (HRV) indices and ECG morphological waveforms were calculated to compare CSA and Ag/AgCl electrodes. Non-significant differences for most of the HRV indices between CSA and Ag/AgCl electrodes were found. Of the morphological waveform metrics consisting of R-wave peak amplitude, ST-segment elevation and QT interval, only the first index was found to be significantly different between the two media. The response of CSA electrodes to motion artifacts was also tested, and we found in general no difference in the quality of the ECG signal
Dual mode antimony electrode for simultaneous measurements of PO2 and pH.
Sjöberg, F; Nilsson, G
2000-01-01
In biomedical research and clinical medicine there is a demand for potent sensors to measure the components that make up blood gas analyses. Today, as when the electrochemical PO2, PCO2 and pH electrodes were first introduced, these measurements are usually made with the same type of sensor technology. The aims of the present study were, firstly, to find out whether the platinum cathode in the Clark electrode can be replaced by antimony for oxygen measurements (amperometry (A)); secondly, whether, during oxygen measurements, the inherent corrosion potential of the antimony metal can be used for measurement of pH in the same measurement area (potentiometry (P)). An electrode of purified, crystallographically orientated monocrystalline antimony (COMA) connected to a reference electrode (silver-silver chloride) was used for the P measurements. Measurements of A (at -900 mV) and P were made in an aqueous environment regulated for oxygen, pH, and temperature. Reproducible oxygen sensitivities of 0.925 nA/% oxygen (2% CV (coefficient of variation)) (A), 10.7 mV/% (P), and 0.7 mV/% (P) were found in the oxygen range: 0-21%, <5%, and above 5%, respectively. The pH sensitivity was 57 mV/pH unit (P). Oxygen and pH measurements were less accurate at oxygen concentrations close to 0%. Both the oxygen and pH part of the composite electrode signal can be identified by this dual mode technique (A and P). The sensor seems to be promising as it provides measurements of two separate variables (oxygen and pH) and also has the desirable characteristics of a solid state sensor.
On the mechanism of high-voltage discharge initiation in high-voltage accelerator accelerating tubes
International Nuclear Information System (INIS)
Zheleznikov, F.G.
1983-01-01
Experimental investigation into physical natupe of discharge processes in high-voltage accelerator accelerating tubes in the absence of the accelerated particle beam are conducted. The installation for the study of the mechanism of initiating vacuum isolation conductivity is used in the experiments. The vacuum chamber of the installation is made of steel and sealed with rubber packings. Electrodes 300-360 mm in diameter are made of stainless steel. Two variants of cleaning technology were used before electrode assembling: 1) degreasing by organic solvents; 2) cleaning by fine grinding cloth with successive washing by rectificated alcohol. Analysis of the obtained data shows that forma. tion of background flux of charged particles in interelectrode gap is caused by external photoelectric effect, excited by X radiation, which initiates the formation of intensive internal field in microfilms of non-conducting impurities on the electrode surfaces. The secondary electron emission plays the minor role at that
Textile Wastewater Treatment by Electrocoagulation Process using Aluminum Electrodes
Directory of Open Access Journals (Sweden)
Edris Bazrafshan
2014-03-01
Full Text Available Background and purpose: Textile industries are among the most polluting industries regarding the volume and the complexity of treatment of its effluents discharge. This study investigated the efficiency of electrocoagulation process using aluminum electrodes in basic red 18 dye removal from aqueous solutions. Materials and Methods: This study was performed in a bipolar batch reactor with six aluminum electrodes connected in parallel. Several important parameters, such as initial pH of solution, initial dye concentration, applied voltage; conductivity and reaction time were studied in an attempt to achieve higher removal efficiency. Results: The electrochemical technique showed satisfactory dye removal efficiency and reliable performance in treating of basic red 18. The maximum efficiency of dye removal which was obtained in voltage of 50 V, reaction time of 60 min, initial concentration 50 mg/L, conductivity 3000 μS/cm and pH 7 was equal to 97.7%. Dye removal efficiency was increased accordance to increase of applied voltage and in contrast electrode and energy consumption was increased simultaneously. Conclusion: As a conclusion, the method was found to be highly efficient and relatively fast compared to conventional existing techniques for dye removal from aqueous solutions.
Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Sugoh, Nozomu; Iwasaki, Hideharu; Iwakura, Chiaki
A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH) 2 positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities.
Method and device for measuring the smoke concentration in air
International Nuclear Information System (INIS)
Rennemo, B.
1994-01-01
The patent deals with a method and a device for measuring the smoke concentration in air. In a smoke chamber are located two electrodes, connected to a voltage source for forming a circuit in which a DC current flows. A radioactive radiation source to ionize the air molecules is located in the vicinity of the smoke chamber, so that the number of ionized air molecules which are formed is dependent upon the radiation intensity of the ion source and the concentration of smoke particles in the smoke chamber. The charging voltage will further imply that a cloud of high ion concentration is built up close to the surface of the electrodes. The ion cloud will be discharged capacitively upon a plurality of short voltages pulses applied to the electrodes to thereby result in current pulses substantially greater than the DC current flowing through the chamber. 8 figs
International Nuclear Information System (INIS)
Shah, J.G.; Yalmali, V.S.; Tawde, Manisha; Mishra, R.
2006-01-01
The need of nuclear power as an energy source requires the solution of many problems. One of the most important is fixation of high level radioactive waste (HLW) in suitable borosilicate glass formulation. The major issue with this process is maximum waste loading in the final vitrified product without compromising on long term product characteristics. The electrical resistivity measurement at high temperature could not be measured with good precision using standard parallel plate electrode configuration due to error in cell constant measurement. Hence a high accuracy, calibration free technique consisting of co-axial electrodes was employed
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Beam Based RF Voltage Measurements and Longitudinal Beam Tomography at the Fermilab Booster
Energy Technology Data Exchange (ETDEWEB)
Bhat, C. M. [Fermilab; Bhat, S. [Fermilab
2017-10-19
Increasing proton beam power on neutrino production targets is one of the major goals of the Fermilab long term accelerator programs. In this effort, the Fermilab 8 GeV Booster synchrotron plays a critical role for at least the next two decades. Therefore, understanding the Booster in great detail is important as we continue to improve its performance. For example, it is important to know accurately the available RF power in the Booster by carrying out beam-based measurements in order to specify the needed upgrades to the Booster RF system. Since the Booster magnetic field is changing continuously measuring/calibrating the RF voltage is not a trivial task. Here, we present a beam based method for the RF voltage measurements. Data analysis is carried out using computer programs developed in Python and MATLAB. The method presented here is applicable to any RCS which do not have flat-bottom and flat-top in the acceleration magnetic ramps. We have also carried out longitudinal beam tomography at injection and extraction energies with the data used for RF voltage measurements. Beam based RF voltage measurements and beam tomography were never done before for the Fermilab Booster. The results from these investigations will be very useful in future intensity upgrades.
A new measurement method for electrode gain in an orthogonally symmetric beam position monitor
International Nuclear Information System (INIS)
Zou Junying; Wu Fangfang; Yang Yongliang; Sun Baogen; Zhou Zeran; Luo Qing; Lu Ping; Xu Hongliang
2014-01-01
The new beam position monitor (BPM) system of the injector at the upgrade project of the Hefei Light Source (HLS Ⅱ) has 19 stripline beam position monitors. Most consist of four orthogonally symmetric stripline electrodes. Differences in electronic gain and mismaching tolerance can cause changes in the beam response of the BPM electrodes. This variation will couple the two measured horizontal positions, resulting in measuring error. To alleviate this effect, a new technique to measure the relative response of the four electrodes has been developed. It is independent of the beam charge, and the related coefficient can be calculated theoretically. The effect of electrode coupling on this technique is analyzed. The calibration data is used to fit the gain for all 19 injector beam position monitors. The results show the standard deviation of the distribution of measured gains is about 5%. (authors)
International Nuclear Information System (INIS)
Kaneda, S.; Shimosaki, M.; Hayashi, N.; Ihara, S.; Satoh, S.; Yamabe, C.
2002-01-01
In this paper, results on ozone production by atmospheric pulsed discharge, are reported. In the research, two types of ozonizer (Type I and Type II) have been used to investigate improvements of ozone concentration and production efficiency. The ozonizer has plane-to-plane metal electrodes structure, and pre-ionization electrodes are placed on the high voltage electrodes (Type I). In Type II, the surface of grounded electrode with 20 mm of width is covered partly by dielectric (thin rubber) with 11 mm of width, while the geometry of both metal electrodes is same to Type I. In the case of Type I, maximum concentration of about 100 ppm and maximum yield of 70 g/kWh were obtained at input power of 0.3 W. On the other hands, in the case of Type II, 800 ppm and 100 g/kWh were obtained at input power of 1.5 W. It was found that the ozone concentration and production yield were improved by using electrode covered by dielectric. (author)
Fluoride Removal From Drinking Water by Electrocoagulation Using Iron and Aluminum Electrodes
Directory of Open Access Journals (Sweden)
Takdastan
2014-07-01
Full Text Available Background Existence of fluoride in drinking water above the permissible level causes human skeletal fluorosis. Objectives Electrocoagulation by iron and aluminum electrodes was proposed for removing fluoride from drinking water. Materials and Methods Effects of different operating conditions such as treatment time, initial pH, applied voltage, type and number of electrodes, the spaces between aluminum and iron electrodes, and energy consumption during electrocoagulation were investigated in the batch reactor. Variable concentrations of fluoride solution were prepared by mixing proper amounts of sodium fluoride with deionized water. Results Experimental results showed that aluminum electrode is more effective in fluoride removal than iron, as in 40 minutes and initial pH of 7.5 at 20 V, the fluoride removal process reached to 97.86%. The final recommendable limit of fluoride (1.5 mg/L was obtained in 10 minutes at 20 V with the aluminum electrode. Conclusions In electrocoagulation with iron and aluminum electrodes, increase of voltage, number of electrodes and reaction time as well as decrease of the spaces between electrodes, enhanced the fluoride removal efficiency from drinking water. In addition the effect of pH and initial concentration of fluoride varied with types of electrodes.
Energy Technology Data Exchange (ETDEWEB)
Kimura, Tomoharu; Yamada, Hirofumi, E-mail: h-yamada@kuee.kyoto-u.ac.jp [Department of Electronic Science and Engineering, Kyoto University, Kyoto 615-8510 (Japan); Kobayashi, Kei [Department of Electronic Science and Engineering, Kyoto University, Kyoto 615-8510 (Japan); The Hakubi Center for Advanced Research, Kyoto University, Kyoto 615-8520 (Japan)
2015-08-07
The device performances of organic thin film transistors are often limited by the metal–organic interface because of the disordered molecular layers at the interface and the energy barriers against the carrier injection. It is important to study the local impedance at the interface without being affected by the interface morphology. We combined frequency modulation atomic force microscopy with scanning impedance microscopy (SIM) to sensitively measure the ac responses of the interface to an ac voltage applied across the interface and the dc potential drop at the interface. By using the frequency-modulation SIM (FM-SIM) technique, we characterized the interface impedance of a Pt electrode and a single pentacene grain as a parallel circuit of a contact resistance and a capacitance. We found that the reduction of the contact resistance was caused by the reduction of the energy level mismatch at the interface by the FM-SIM measurements, demonstrating the usefulness of the FM-SIM technique for investigation of the local interface impedance without being affected by its morphology.
Findl, E.
1984-12-21
A method for sensing or measuring the partial pressure or concentration of an electroactive species used in conjunction with an electrolyte, the method being characterized by providing a constant current between an anode and a cathode of an electrolyte-containing cell, while measuring changes in voltage that occur between either the anode and cathode or between a reference electrode and one of the main electrodes of the cell, thereby to determine the concentration or partial pressure of the electro-active species as a function of said measured voltage changes. The method of the invention can be practiced using either a cell having only an anode and a cathode, or using a cell having an anode and a cathode in combination with a reference electrode. Accurate measurements of small concentrations or partial pressures of electro-active species are obtainable with the method of the invention, by using constant currents of only a few microamperes between the anode and cathode of the cell, while the concentration-determining voltage is measured.
Measurement of Dynamic Resistance in Resistance Spot Welding
DEFF Research Database (Denmark)
Wu, Pei; Lu, J.; Zhang, Wenqi
2007-01-01
is influenced by inductive noise caused by the high welding current. In this study, the dynamic resistance is determined by measuring the voltage at primary side and current at secondary side. This increases the accuracy of measurement because of higher signal-noise ratio, and allows to apply to in-process......The conventional methods of determining the dynamic resistance were mostly done by measuring the voltage and current at secondary side of transformer in resistance welding machines, in which the measuring set-up normally interferes with the movement of electrode, and the measuring precision...
Impedances of nickel electrodes cycled in various KOH concentrations
Reid, Margaret A.; Loyselle, Patricia L.
1991-01-01
Recent tests at Hughes have shown that Ni/H2 cells cycled in 26 percent KOH have much longer lives than those cycled in other concentrations. As part of an ongoing program to try to correlate the impedances of nickel electrodes with their life and performance, impedances were measured of a number of electrodes from these tests that had been cycled in concentrations from 21 to 36 percent KOH. These had ranged from about 1000 to 40,000 cycles. After cycling ten times to reduce possible changes due to storage, impedances were measured at five voltages corresponding to low states of charge. The results were analyzed using a standard circuit model including Warburg impedance term. Lower kinetic resistances and Warburg slopes were found for several electrodes which had been cycled in 26 percent KOH even though they had been cycled for a much longer time than the others. Interpretation of the data is complicated by the fact that the cycle lives, storage times, and failure mechanisms varied. Several other circuit models have also been examined, but the best correlations with life were found with parameters obtained from the simple model.
Electrode and limiter biasing experiments on the tokamak ISTTOK
International Nuclear Information System (INIS)
Silva, C.; Figueiredo, H.; Cabral, J.A.C.; Nedzelsky, I.; Varandas, C.A.F.
2003-01-01
In this contribution limiter and electrode biasing experiments are compared, in particular in what concerns their effects on the edge plasma parameters. For electrode AC bias a substantial increase (>50%) in the average plasma density is observed with positive voltage, without significant changes in the edge density, leading to steeper profiles. The ratio n e /Hα also increases significantly (>20%), indicating an improvement in gross particle confinement. The plasma potential profile is strongly modified as both the edge E r and its shear increase significantly. For positive limiter bias an increase in the average plasma density and the radiation losses is observed, resulting in almost no modification, or a slight, in particle confinement. Preliminary results of simultaneous electrode and limiter bias experiments show that the control of the plasma potential profile is very limited, since negative voltages do not modify the plasma parameters significantly. (author)
International Nuclear Information System (INIS)
Shin, Hyung Seop; Nisay, Arman; Dedicatoria, Marlon; Sim, Ki Deok
2014-01-01
The critical current, I c of HTS superconducting tapes can be measured by transport or contactless method. Practically, the transport method using the four-probe method is the most common. In this study, a simple test procedure by clipping the voltage lead taps have been introduced instead of soldering which reduces time and effort and thereby achieving a much faster measurement of I c . When using a pair of iron clips, I c value decreased as compared with the measured one by standard method using soldered voltage taps and varies with the width of the clipped specimen part. However, when using a pure Cu clip, both by clipping and by soldering voltage taps give a comparable result and I c measured are equal and close to the samples specification. As a result, material to be used as voltage clip should be considered and should not influence the potential voltage between the leads during I c measurement. Furthermore, the simulation result of magnetic flux during I c measurement test showed that the decrease of I c observed in the experiment is due to the magnetic flux density, By produced at the clipped part of the sample by the operating current with iron clips attached to the sample.
Directory of Open Access Journals (Sweden)
Chien-Hao Liu
2017-11-01
Full Text Available In recent years, dielectric elastomer actuators (DEAs have been widely used in soft robots and artificial bio-medical applications. Most DEAs are composed of a thin dielectric elastomer layer sandwiched between two compliant electrodes. DEAs vary in their design to provide bending, torsional, and stretch/contraction motions under the application of high external voltages. Most compliant electrodes are made of carbon powders or thin metallic films. In situations involving large deformations or improper fabrication, the electrodes are susceptible to breakage and increased resistivity. The worst cases result in a loss of conductivity and functional failure. In this study, we developed a method by which to exploit stretchable metallic springs as compliant electrodes for cylindrical DEAs. This design was inspired by the extensibility of mechanical springs. The main advantage of this approach is the fact that the metallic spring-like compliant electrodes remain conductive and do not increase the stiffness as the tube-like DEAs elongate in the axial direction. This can be attributed to a reduction in thickness in the radial direction. The proposed cylindrical structure is composed of highly-stretchable VHB 4905 film folded within a hollow tube and then sandwiched between copper springs (inside and outside to allow for stretching and contraction in the axial direction under the application of high DC voltages. We fabricated a prototype and evaluated the mechanical and electromechanical properties of the device experimentally using a high-voltage source of 9.9 kV. This device demonstrated a non-linear increase in axial stretching with an increase in applied voltage, reaching a maximum extension of 0.63 mm (axial strain of 2.35% at applied voltage of 9.9 kV. Further miniaturization and the incorporation of compressive springs are expected to allow the implementation of the proposed method in soft micro-robots and bio-mimetic applications.
Seung, Hyun-Min; Kwon, Kyoung-Cheol; Lee, Gon-Sub; Park, Jea-Gun
2014-10-01
Flexible conductive-bridging random-access-memory (RAM) cells were fabricated with a cross-bar memory cell stacked with a top Ag electrode, conductive polymer (poly(n-vinylcarbazole): PVK), electrolyte (polyethylene oxide: PEO), bottom Pt electrode, and flexible substrate (polyethersulfone: PES), exhibiting the bipolar switching behavior of resistive random access memory (ReRAM). The cell also exhibited bending-fatigue-free nonvolatile memory characteristics: i.e., a set voltage of 1.0 V, a reset voltage of -1.6 V, retention time of >1 × 105 s with a memory margin of 9.2 × 105, program/erase endurance cycles of >102 with a memory margin of 8.4 × 105, and bending-fatigue-free cycles of ˜1 × 103 with a memory margin (Ion/Ioff) of 3.3 × 105.
Electrodes for bio-application: recording and stimulation
International Nuclear Information System (INIS)
Fontes, M B A
2013-01-01
Recording and stimulation electrodes applied on excitable tissue are the basis of electrophysiological research, such as brain, muscles, peripheral nerves or sensory systems. Electrode-electrolyte impedance is one of the important characteristics due to its influence on the signal/noise ratio, signal distortion and built-up voltage. Strategies to lowering and tuning the impedance are achieved by biasing iridium oxide modified platinum microelectrodes. Surface and impedance analysis after pulse stimulation are also addressed.
Shi, Haotian; Poudel, Nirakar; Hou, Bingya; Shen, Lang; Chen, Jihan; Benderskii, Alexander V; Cronin, Stephen B
2018-02-01
We report a novel approach to probe the local ion concentration at graphene/water interfaces using in situ Raman spectroscopy. Here, the upshifts observed in the G band Raman mode under applied electrochemical potentials are used to determine the charge density in the graphene sheet. For voltages up to ±0.8 V vs. NHE, we observe substantial upshifts in the G band Raman mode by as much as 19 cm -1 , which corresponds to electron and hole carrier densities of 1.4 × 10 13 cm -2 and Fermi energy shifts of ±430 meV. The charge density in the graphene electrode is also measured independently using the capacitance-voltage characteristics (i.e., Q = CV), and is found to be consistent with those measured by Raman spectroscopy. From charge neutrality requirements, the ion concentration in solution per unit area must be equal and opposite to the charge density in the graphene electrode. Based on these charge densities, we estimate the local ion concentration as a function of electrochemical potential in both pure DI water and 1 M KCl solutions, which span a pH range from 3.8 to 10.4 for pure DI water and net ion concentrations of ±0.7 mol L -1 for KCl under these applied voltages.
Activated carbon as a pseudo-reference electrode for electrochemical measurement inside concrete
Abbas, Yawar; Olthuis, Wouter; van den Berg, Albert
2015-01-01
The application of Kynol based activated carbon (KAC) as a pseudo-reference electrode for potentiometric measurement inside concrete is presented. Due to its high surface area the activated carbons has a large electrical double layer capacitance (EDLC > 50 F g(-1)) and are used as electrode material
Energy Technology Data Exchange (ETDEWEB)
Gonzaga, Fabiano B.; Sobral, Sidney P.; Ribeiro, Carla M.; Goncalves, Mary A., E-mail: fbgonzaga@inmetro.gov.br [Instituto Nacional de Metrologia, Qualidade e Tecnologia(INMETRO), Duque de Caxias, RJ (Brazil). Div. de Metrologia Quimica
2013-01-15
An ion selective field effect transistor (ISFET) electrode was evaluated for measuring pH and acid number (AN) of fuel ethanol and compared to two glass electrodes with different reference filling solutions: KCl aqueous solution (glass-KCl electrode)and LiCl ethanolic solution (glass-LiCl electrode). pH was determined at different measurement times and AN was determined using automatic potentiometric titration. For pH, the glass-KCl electrode showed the best precision and stability, with an average repeatability about four times better when compared to the ISFET electrode for the measurement time of 30 s (as indicated in the ASTM D6423 standard). For AN, the glass-KCl and glass-LiCl electrodes showed similar repeatabilities, which were about three times better than that of the ISFET electrode. In addition, the results from a recovery study demonstrated better accuracy of the glass-LiCl electrode, with a recovery value of 100.1% (author)
A planar micro-flame ionization detector with an integrated guard electrode
International Nuclear Information System (INIS)
Kuipers, W J; Müller, J
2008-01-01
The flame ionization detector (FID) quantifies small concentrations of organic compounds by flame ionization of hydrocarbons and measurement of the resulting ion current. The ion current represents the number of carbon atoms in the sample gas. The miniaturization of the FID by MEMS technology (µFID) is expected to increase its use, because of reduced oxyhydrogen consumption. This loosens safety precautions and makes portable applications possible. In contrast to a former µFID design, the current planar µFID is designed to prevent environmental air from entering the system and deteriorating the measurement signal. The oxyhydrogen flame burns in the silicon plane of an almost completely encapsulating glass–silicon–glass sandwich. Only a small opening remains for removal of the exhaust gas from the system. In between the detector electrodes, a guard electrode is integrated to intercept and by-pass leak currents past the picoammeter, which then only measures the ion current. Due to the design of the guard electrode, small leak currents are still measured by the picoammeter. Yet, these leak currents can be corrected for to obtain the ion current. Measurements of the ion current as a function of the applied voltage and the sample gas flow show expected FID behaviour
A compact 100 kV high voltage glycol capacitor.
Wang, Langning; Liu, Jinliang; Feng, Jiahuai
2015-01-01
A high voltage capacitor is described in this paper. The capacitor uses glycerol as energy storage medium, has a large capacitance close to 1 nF, can hold off voltages of up to 100 kV for μs charging time. Allowing for low inductance, the capacitor electrode is designed as coaxial structure, which is different from the common structure of the ceramic capacitor. With a steady capacitance at different frequencies and a high hold-off voltage of up to 100 kV, the glycol capacitor design provides a potential substitute for the ceramic capacitors in pulse-forming network modulator to generate high voltage pulses with a width longer than 100 ns.
Energy Technology Data Exchange (ETDEWEB)
Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Iwakura, Chiaki [Department of Applied Chemistry, Graduate School of Engineering, Osaka Prefecture University, 1-1 Gakuen-cho, Sakai, Osaka 599-8531 (Japan); Sugoh, Nozomu; Iwasaki, Hideharu [Kurashiki Research Laboratory, Kuraray Co., Ltd., 2045-1 Sakazu, Kurashiki, Okayama 710-8691 (Japan)
2006-06-19
A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH){sub 2} positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities. (author)
International Nuclear Information System (INIS)
Suprapto; Djasiman
2002-01-01
The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)
Preparation of Electrospun Polymer Fibers Using a Copper Wire Electrode in a Capillary Tube
Shinbo, Kazunari; Onozuka, Shintaro; Hoshino, Rikiya; Mizuno, Yoshinori; Ohdaira, Yasuo; Baba, Akira; Kato, Keizo; Kaneko, Futao
2010-04-01
Polymer fibers were prepared by an electrospinning method utilizing a copper wire electrode in a capillary tube. The morphology of electrospun poly(vinyl alcohol) (PVA) fibers was observed, and was found to be dependent on the wire electrode tip position in the capillary tube, the concentration of the polymer solution, the distance between the electrodes, and the applied voltage. By using the wire electrode, the experimental setup is simple and the distance between the electrodes and the applied voltage can be easily reduced. Furthermore, the preparation of poly(3-hexylthiophene) (P3HT) fibers was carried out. P3HT fibers were successfully prepared by mixing poly(ethylene oxide) (PEO) in P3HT solution. Orientation control was also carried out by depositing the fibers on a rotating collector electrode, and the alignment of the P3HT:PEO fibers was confirmed. Anisotropy of the optical absorption spectra was also observed for the aligned fibers.
Cochlear implant electrode localization in post-operative CT using a spherical measure
DEFF Research Database (Denmark)
Braithwaite, Benjamin Michael; Kjer, Hans Martin; Fagertun, Jens
2016-01-01
the ordering of electrode contacts on implanted electrode arrays from post-operative CT images. Our method applies a specialized filter chain to the images based on a threshold and spherical measure, and selects contact positions at local maxima in the filtered image. Two datasets of 13 temporal bone specimens...
Study of electric discharges between moving electrodes in air
International Nuclear Information System (INIS)
Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G.
2011-01-01
A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation
Study of electric discharges between moving electrodes in air
Energy Technology Data Exchange (ETDEWEB)
Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G. [Chuvash State University (Russian Federation)
2011-12-15
A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation.
Model tests for corrosion influence of electrode surface on electroosmosis in marine sludge
Zheng, Lingwei; Li, Jinzhu; Shi, Hanru
2017-11-01
The corrosion of metal electrodes is inevitable on electroosmosis in soil. Surface corrosion of electrodes is also one of the reasons for increasing energy consumption in electroosmosis treatment. A series of laboratory tests were conducted employing three kinds of materials, aluminium, steel, and brass. To explore the impact of surface corrosion degree on electroosmosis, metal electrodes were pretreated with durations 0 h, 12 h, 24 h, and 36 h. After the pretreatment, corroded electrodes are used as anodes on electroosmosis. Water discharge, current, voltage potential were measured during the tests; water content was also tested at three points after the electroosmosis. The results showed that aluminium was better than steel in electroosmotic drainage while brass provided the worst dewatering performance. Surface corrosion did not influence the aluminium and steel on electroosmosis in marine sludge, but brass did. In the pretreatment of brass electrodes, corrosion rate had started to slow down at later periods, with the deterioration rate of dewatering reduced afterwards. As the results showed, it is not recommended to employ those easily deteriorated electrode materials from surface corrosion in practical engineering, such as brass; electrode material with higher electroosmosis exchange rate is recommended, such as aluminium.
International Nuclear Information System (INIS)
Mayhall, D.J.; Eckard, R.D.
1979-01-01
We have used a Lawrence Livermore Laboratory (LLL) version of the WOLF ion source extractor design computer code to determine tolerable accel current and voltage limits during startup of a prototype 80 kV Mirror Fusion Test Facility (MFTF) sustaining neutral beam source. Arc current limits are also estimated. The source extractor has gaps of 0.236, 0.721, and 0.155 cm. The effective ion mass is 2.77 AMU. The measured optimum accel current density is 0.266 A/cm 2 . The gradient grid electrode runs at 5/6 V/sub a/ (accel voltage). The suppressor electrode voltage is zero for V/sub a/ < 3 kV and -3 kV for V/sub a/ greater than or equal to 3 kV. The accel current density for optimum beam divergence is obtained for 1 less than or equal to V/sub a/ less than or equal to 80 kV, as are the beam divergence and emittance
Wu, Kunlin
2013-01-01
The transition voltage of three different asymmetric Au/poly(phenylene) thiol/Au molecular junctions in which the central molecule is either benzene thiol, biphenyl thiol, or terphenyl thiol is investigated by first-principles quantum transport simulations. For all the junctions, the calculated transition voltage at positive polarity is in quantitative agreement with the experimental values and shows weak dependence on alterations of the Au-phenyl contact. When compared to the strong coupling at the Au-S contact, which dominates the alignment of various molecular orbitals with respect to the electrode Fermi level, the coupling at the Au-phenyl contact produces only a weak perturbation. Therefore, variations of the Au-phenyl contact can only have a minor influence on the transition voltage. These findings not only provide an explanation to the uniformity in the transition voltages found for π-conjugated molecules measured with different experimental methods, but also demonstrate the advantage of transition voltage spectroscopy as a tool for determining the positions of molecular levels in molecular devices. © 2013 AIP Publishing LLC.
On-Line Voltage Stability Assessment based on PMU Measurements
DEFF Research Database (Denmark)
Garcia-Valle, Rodrigo; P. Da Silva, Luiz C.; Nielsen, Arne Hejde
2009-01-01
This paper presents a method for on-line monitoring of risk voltage collapse based on synchronised phasor measurement. As there is no room for intensive computation and analysis in real-time, the method is based on the combination of off-line computation and on-line monitoring, which are correlat...
Carbon Deposition during CO2 Electrolysis in Ni-Based Solid-Oxide-Cell Electrodes
DEFF Research Database (Denmark)
Skafte, Theis Løye; Graves, Christopher R.; Blennow, P.
2015-01-01
. Electrochemical impedance spectroscopy in both H2/H2O and CO/CO2 revealed an increase in resistance of the fuel electrode after each CO2 electrolysis current-voltage curve, indicating possible carbon deposition. The difference in partial oxygen pressure between inlet and outlet was analyzed to verify carbon...... in detail. In an attempt to mitigate the degradation due to carbon deposition, the Ni-YSZ electrode was infiltrated with a gadolinium doped ceria (CGO) solution. Initial results indicate that the coking tolerance was not enhanced, but it is still unclear whether infiltrated cells degrade less. However......, infiltrated cells display a significant performance enhancement before coking, especially under electrolysis current. The investigation thus indicated carbon formation in the Ni containing fuel electrode before the thermodynamically calculated threshold for average measurements of the cell was reached...
Electrochemical impedance characterization of FeSn2 electrodes for Li-ion batteries
International Nuclear Information System (INIS)
Chamas, M.; Lippens, P-E.; Jumas, J-C.; Hassoun, J.; Panero, S.; Scrosati, B.
2011-01-01
Highlights: → In this paper we study a tin based, FeSn 2 , high capacity lithium-alloying electrode. → The electrochemical performance of this electrode in lithium batteries is remarkably influenced by the current rate. → This aspect is investigated by electrochemical techniques such as galvanostatic cycling and impedance spectroscopy. → The results demonstrated that the good electrochemical behavior of the electrode at the higher currents is due to the formation of a stable solid electrolyte interphase (SEI) film. - Abstract: This work reports the electrochemical characterization of a micro-scale FeSn 2 electrode in a lithium battery. The electrode is proposed as anode material for advanced lithium ion batteries due to its characteristics of high capacity (500 mAh g -1 ) and low working voltage (0.6 V vs. Li). The electrochemical alloying process is studied by cyclic voltammetry and galvanostatic cycling while the interfacial properties are investigated by electrochemical impedance spectroscopy. The impedance measurements in combination with the galvanostatic cycling tests reveal relatively low overall impedance values and good electrochemical performance for the electrode, both in terms of delivered capacity and cycling stability, even at the higher C-rate regimes.
Yan Hong; Yong Wang; Wang Ling Goh; Yuan Gao; Lei Yao
2015-08-01
This paper presents a mathematic method and a cost-efficient circuit to measure the value of each component of the bio-impedance model at electrode-electrolyte interface. The proposed current excited triple-time-voltage oversampling (TTVO) method deduces the component values by solving triple simultaneous electric equation (TSEE) at different time nodes during a current excitation, which are the voltage functions of time. The proposed triple simultaneous electric equations (TSEEs) allows random selections of the time nodes, hence numerous solutions can be obtained during a single current excitation. Following that, the oversampling approach is engaged by averaging all solutions of multiple TSEEs acquired after a single current excitation, which increases the practical measurement accuracy through the improvement of the signal-to-noise ratio (SNR). In addition, a print circuit board (PCB) that consists a switched current exciter and an analog-to-digital converter (ADC) is designed for signal acquisition. This presents a great cost reduction when compared against other instrument-based measurement data reported [1]. Through testing, the measured values of this work is proven to be in superb agreements on the true component values of the electrode-electrolyte interface model. This work is most suited and also useful for biological and biomedical applications, to perform tasks such as stimulations, recordings, impedance characterizations, etc.
Sahu, Anshuman Kumar; Chatterjee, Suman; Nayak, Praveen Kumar; Sankar Mahapatra, Siba
2018-03-01
Electrical discharge machining (EDM) is a non-traditional machining process which is widely used in machining of difficult-to-machine materials. EDM process can produce complex and intrinsic shaped component made of difficult-to-machine materials, largely applied in aerospace, biomedical, die and mold making industries. To meet the required applications, the EDMed components need to possess high accuracy and excellent surface finish. In this work, EDM process is performed using Nitinol as work piece material and AlSiMg prepared by selective laser sintering (SLS) as tool electrode along with conventional copper and graphite electrodes. The SLS is a rapid prototyping (RP) method to produce complex metallic parts by additive manufacturing (AM) process. Experiments have been carried out varying different process parameters like open circuit voltage (V), discharge current (Ip), duty cycle (τ), pulse-on-time (Ton) and tool material. The surface roughness parameter like average roughness (Ra), maximum height of the profile (Rt) and average height of the profile (Rz) are measured using surface roughness measuring instrument (Talysurf). To reduce the number of experiments, design of experiment (DOE) approach like Taguchi’s L27 orthogonal array has been chosen. The surface properties of the EDM specimen are optimized by desirability function approach and the best parametric setting is reported for the EDM process. Type of tool happens to be the most significant parameter followed by interaction of tool type and duty cycle, duty cycle, discharge current and voltage. Better surface finish of EDMed specimen can be obtained with low value of voltage (V), discharge current (Ip), duty cycle (τ) and pulse on time (Ton) along with the use of AlSiMg RP electrode.
Energy Technology Data Exchange (ETDEWEB)
Miyazaki, I; Iseki, S; Kobayashi, T [OYO Corp., Tokyo (Japan)
1997-10-22
This paper describes field test results of electric survey using capacitive electrodes. When two metal plates are approached without contacting with the ground and voltage is applied between the plates, current flows in the ground. The metal plates and the ground work as a capacitor. Charges are stored between them. These metal plates having insulation with the ground are called capacitive electrodes. When ac voltage is applied between a pair of capacitors, current flows continuously in the ground without saturating the capacitors. Resistivity of the ground can be determined by measuring the level of current flowing in the ground and the level of potential. As a result of the field tests, it was found that the present method is superior to the conventional method in around ten times. However, to obtain high quality data, water spraying, reduced towing speed at the low resistivity ground such as clay and soil, and grass mowing are required. 3 refs., 5 figs., 1 tab.
The high voltage system for the novel MPGD-based photon detectors of COMPASS RICH-1
Dalla Torre, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Chatterjee, C.; Ciliberti, P.; Dasgupta, S.; Gobbo, B.; Gregori, M.; Hamar, G.; Levorato, S.; Martin, A.; Menon, G.; Tessarotto, F.; Zhao, Y.
2018-01-01
The architecture of the novel MPGD-based photon detectors of COMPASS RICH-1 consists in a large-size hybrid MPGD multilayer layout combining two layers of Thick-GEMs and a bulk resistive MICROMEGAS. Concerning biasing voltage, the Thick-GEMs are segmented in order to reduce the energy released in case of occasional discharges, while the MICROMEGAS anode is segmented in pads individually biased at positive voltage, while the micromesh is grounded. In total, there are ten different electrode types and more than 20000 electrodes supplied by more than 100 HV channels. Commercial power supply units are used. The original elements of the power supply system are the architecture of the voltage distribution net, the compensation, by voltage adjustment, of the effects of pressure and temperature variation affecting the detector gain and a sophisticated control software, which allows to protect the detectors against errors by the operator, to monitor and log voltages and current at 1 Hz rate and to automatically react ...
Energy Technology Data Exchange (ETDEWEB)
Johnson, Michael J. [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Go, David B., E-mail: dgo@nd.edu [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Department of Chemical and Biomolecular Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States)
2015-12-28
To generate a gas discharge (plasma) in atmospheric air requires an electric field that exceeds the breakdown threshold of ∼30 kV/cm. Because of safety, size, or cost constraints, the large applied voltages required to generate such fields are often prohibitive for portable applications. In this work, piezoelectric transformers are used to amplify a low input applied voltage (<30 V) to generate breakdown in air without the need for conventional high-voltage electrical equipment. Piezoelectric transformers (PTs) use their inherent electromechanical resonance to produce a voltage amplification, such that the surface of the piezoelectric exhibits a large surface voltage that can generate corona-like discharges on its corners or on adjacent electrodes. In the proper configuration, these discharges can be used to generate a bulk air flow called an ionic wind. In this work, PT-driven discharges are characterized by measuring the discharge current and the velocity of the induced ionic wind with ionic winds generated using input voltages as low as 7 V. The characteristics of the discharge change as the input voltage increases; this modifies the resonance of the system and subsequent required operating parameters.
Carrier accumulation and depletion in point-contact capacitance-voltage measurements
Naitou, Yuichi
2017-11-01
Scanning capacitance microscopy (SCM) is a variation of atomic force microscopy in which a conductive probe tip detects the bias modulated capacitance for the purpose of measuring the nanoscale semiconductor carrier concentration. SCM can be regarded as a point-contact capacitance-voltage system, and its capacitance-voltage properties are different from those of a conventional parallel-plate capacitor. In this study, the charge accumulation and depletion behavior of a semiconductor sample were closely investigated by SCM. By analyzing the tip-sample approach curve, the effective probe tip area and charge depletion depth could be quantitatively determined.
International Nuclear Information System (INIS)
Ku, Heekwon; Lim, Dongseok; Cho, Jaeseon
2013-01-01
The result of ECP measurement of piping material in nuclear power plant at low temperature using the developed iridium (SSRE) reference electrode is approximately -0.370V. Based on the various results of this study, the developed iridium (SSRE) reference electrode can be applied to the water chemistry environments of nuclear power plant. Various metallic materials used in a nuclear power plant have been exposed to a variety of water chemistry environments and the corrosion of metallic materials occurs due to the reactions between metal structures and water chemistry environments. Therefore, the management of the water chemistry factors is needed to prevent corrosion. The chemical factors affecting the corrosion are pH and Electrochemical Corrosion Potential (ECP). The world-wide studies suggest that ECP and pH are effective indicators for preventing the material damage from water chemistry condition. ECP and pH should be measured as the reference electrodes, and should show stable potential characteristics with fast responses. In this study, the iridium reference electrodes using a solid-state metal oxide electrode has been developed to measure effective indicators such as ECP and pH. The iridium (SSRE) reference electrode for the ECP measurement in water chemistry environment of nuclear power plants has been developed. A calibration for water chemistry measurement was performed by potential measurement of iridium (SSRE) reference electrode with Ag/AgCl (SSRE) reference electrode. The result exhibited a stable potential for 117 hours and a super-Nernst ian response with 63.12mV/p H. In this study, the iridium (SSRE) reference electrode shows super-Nernst ian characteristic and it may be caused by the property of electrolytically coated iridium oxide. Considering the long-term stability of the developed electrode, it is possible to apply as a reference electrode through calibration procedure
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, K; Tamura, T [Osaka City Univ., Osaka (Japan). Faculty of Science; Morikawa, T [Osaka Prefectural Government, Osaka (Japan)
1997-05-27
A simplified electrical resistivity measuring device has been developed as a trial for field and laboratory uses, and some measurements were conducted. For this device, four probe electrodes are penetrated in the clay specimen, to calculate the resistivity from the voltage between both ends of the reference resistance connected with current electrodes in a series and the voltage between intermediate two voltage electrodes. It can be used in the field measurements. For the measurements, specimens of marine and lacustrine clayey sediments with clear stratigraphic levels in southern Osaka Group were used. In the laboratory, in addition to basic physical tests, diatom analysis and measurements of conductivity of clay suspension were also conducted. As a result of the experiments, the electric resistivity of marine clay obtained at the outcrop was lower than lacustrine clay as expected. The value of the former was a half of that of the latter. The frequency dependence in the high frequency region above 1 MHz was the reverse. The difference in electrical resistivity values between non-agitated specimens was about four times. The electrical resistivity of clay suspensions varied in two orders. 3 refs., 9 figs.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Cermet insert high voltage holdoff for ceramic/metal vacuum devices
Ierna, William F.
1987-01-01
An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.
Low-Cost Open-Source Voltage and Current Monitor for Gas Metal Arc Weld 3D Printing
Directory of Open Access Journals (Sweden)
A. Pinar
2015-01-01
Full Text Available Arduino open-source microcontrollers are well known in sensor applications for scientific equipment and for controlling RepRap 3D printers. Recently low-cost open-source gas metal arc weld (GMAW RepRap 3D printers have been developed. The entry-level welders used have minimal controls and therefore lack any real-time measurement of welder voltage or current. The preliminary work on process optimization of GMAW 3D printers requires a low-cost sensor and data logger system to measure welder current and voltage. This paper reports on the development of a low-cost open-source power measurement sensor system based on Arduino architecture. The sensor system was designed, built, and tested with two entry-level MIG welders. The full bill of materials and open source designs are provided. Voltage and current were measured while making stepwise adjustments to the manual voltage setting on the welder. Three conditions were tested while welding with steel and aluminum wire on steel substrates to assess the role of electrode material, shield gas, and welding velocity. The results showed that the open source sensor circuit performed as designed and could be constructed for <$100 in components representing a significant potential value through lateral scaling and replication in the 3D printing community.
HVDC Ground Electrodes - a Source of Geophysical Data
Freire, P. F.; Pereira, S. Y.
2015-12-01
The HVDC electrode is a component of a High Voltage Direct Current energy transmission system, and is designed to inject into the ground continuous currents up to 3500 A. The typical HVDC ground electrode is a ring of vertical conductors, 1 km wide, buried a few tens of meters.The design of a HVDC electrode is based on extensive geological, geotechnical and geophysical surveys. Geophysical data are usually electrical (VES) and electromagnetic (TEM/MT) acquisitions, for the modeling of the shallow, near-surface and deep layers of the crust. This survey aims, first, the electrode site selection, and then, at the selected site, this data is combined into a single apparent resistivity curve, which is inverted, allowing for the determination of the layered geoelectric crust model. The injection of electrical continuous current in the electrode is then simulated, with the geoelectric crust model, for the determination of the soil surface potential profile (which is usually asymmetric for different directions, due to non-1D geoelectric models).For the commissioning of a HVDC electrode, field measurements are done, such as electrode grounding resistance, soil surface potentials and metal-to-soil potentials at specific structures (buried pipelines, for instance).The geophysical data acquired during the design phase is a set of data completely independent from the electrical data acquired during the electrode commissioning phase, and both are correlated by the geoelectric model. It happens, therefore, that the geoelectric model can be calibrated based on the electrical data, with the correction of static shifts and other adjustments.This paper suggests that the commissioning of HVDC systems should be associated to a research & development program, with a university or foundation. The idea is to enjoy the opportunity of a more complete field survey, with the acquisition of a wide set of data for a better geological characterization of the area where the electrode was built.
Zheng, Chuan-Tao; Ma, Chun-Sheng; Yan, Xin; Wang, Xian-Yin; Zhang, Da-Ming
2008-07-01
Structural model and design technique are proposed for a polymer directional coupler electro-optic switch with rib waveguides and push-pull electrodes, of which the electric field distribution is analyzed by the conformal transforming method and image method. In order to get the minimum mode loss and the minimum switching voltage, the parameters of the waveguide and electrode are optimized, such as the core with, core thickness, buffer layer between the core and the electrode, coupling gap between the waveguides, electrode thickness, electrode width and electrode gap. Switching Characteristics are analyzed, which include the output power, insertion loss, and crosstalk. To realize normal switching function, the fabrication error, spectrum shift, and coupling loss between a single mode fiber (SMF) and the waveguide are discussed. Simulation results show that the coupling length is 3082 μm, push-pull switching voltage is 2.14 V, insertion loss is less than 1.17 dB, and crosstalk is less than -30 dB for the designed device.
Directory of Open Access Journals (Sweden)
Hyewon Lee
2015-04-01
Full Text Available This paper describes the design, evaluation, and implementation of a compensation scheme for a measurement voltage transformer (VT using the hysteresis characteristics of the core. The error of a VT is caused by the primary winding voltage and secondary winding voltage. The latter depends on the secondary current, whereas the former depends on the primary current, which is an aggregate of the exciting and secondary currents. The secondary current is obtained directly from the secondary voltage and is used to obtain the voltage across the secondary winding. For the primary current, the exciting current is decomposed into two components: core-loss and magnetizing currents. The magnetizing current is obtained by the flux-magnetizing current curve instead of the hysteresis loop to minimize the required loops for compensation. The core-loss current is obtained by dividing the primary induced voltage by the core-loss resistance. Finally, the estimated voltages across the primary and secondary windings are added to the measured secondary voltage for compensation. The scheme can significantly improve the accuracy of a VT. The results of the performance of compensator are shown in the experimental test. The accuracy of the measurement VT improves from 1.0C class to 0.1C class. The scheme can help to significantly reduce the required core cross section of a measurement VT in an electrical energy system.
Electrical design requirements for electrode boilers for nuclear plants
International Nuclear Information System (INIS)
Kempker, M.J.
1979-01-01
Medium-voltage steam electrode boilers, in the 20- to 50-MW range, have become an attractive alternative to comparable fossil-fueled boilers as a source of auxiliary steam during the startup and normal shutdown of nuclear power plants. The electrode boiler represents a favorable option because of environmental, fire protection, and licensing considerations. However, this electrical option brings some difficult design problems for which solutions are required in order to integrate the electrode boiler into the plant low resistance grounded power system. These considerations include the effects of an unbalanced electrode boiler on the performance of polyphase induction motors, boiler grounding for personnel safety, boiler neutral grounding, and ground relaying
High voltage load resistor array
Lehmann, Monty Ray [Smithfield, VA
2005-01-18
A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.
International Nuclear Information System (INIS)
Leinonen, Matti; Hakula, Harri; Hyvönen, Nuutti
2014-01-01
The aim of electrical impedance tomography is to determine the internal conductivity distribution of some physical body from boundary measurements of current and voltage. The most accurate forward model for impedance tomography is the complete electrode model, which consists of the conductivity equation coupled with boundary conditions that take into account the electrode shapes and the contact resistances at the corresponding interfaces. If the reconstruction task of impedance tomography is recast as a Bayesian inference problem, it is essential to be able to solve the complete electrode model forward problem with the conductivity and the contact resistances treated as a random field and random variables, respectively. In this work, we apply a stochastic Galerkin finite element method to the ensuing elliptic stochastic boundary value problem and compare the results with Monte Carlo simulations
THE EFFECT OF VOLTAGE ON ELECTROCHEMICAL DEGRADATION OF TRICHLOROETHYLENE
This study investigates electrochemical degradation of Trichloroethylene (TCE) using granular graphite as electrodes in a flow-through reactor system. The experiments were conducted to obtain information on the effect of voltage and flow rates on the degradation rates of TCE. The...
Optimization of Contact Force and Pull-in Voltage for Series based MEMS Switch
Directory of Open Access Journals (Sweden)
Abhijeet KSHIRSAGAR
2010-04-01
Full Text Available Cantilever based metal-to-metal contact type MEMS series switch has many applications namely in RF MEMS, Power MEMS etc. A typical MEMS switch consists of a cantilever as actuating element to make the contact between the two metal terminals of the switch. The cantilever is pulled down by applying a pull-in voltage to the control electrode that is located below the middle portion of the cantilever while only the tip portion of the cantilever makes contact between the two terminals. Detailed analysis of bending of the cantilever for different pull-in voltages reveals some interesting facts. At low pull-in voltage the cantilever tip barely touches the two terminals, thus resulting in very less contact area. To increase contact area a very high pull-in voltage is applied, but it lifts the tip from the free end due to concave curving of the cantilever in the middle region of the cantilever where the electrode is located. Again it results in less contact area. Furthermore, the high pull-in voltage produces large stress at the base of the cantilever close to the anchor. Therefore, an optimum, pull-in voltage must exist at which the concave curving is eliminated and contact area is maximum. In this paper authors report the finding of optimum contact force and pull-in voltage.
Voltage measurements at the vacuum post-hole convolute of the Z pulsed-power accelerator
Directory of Open Access Journals (Sweden)
E. M. Waisman
2014-12-01
Full Text Available Presented are voltage measurements taken near the load region on the Z pulsed-power accelerator using an inductive voltage monitor (IVM. Specifically, the IVM was connected to, and thus monitored the voltage at, the bottom level of the accelerator’s vacuum double post-hole convolute. Additional voltage and current measurements were taken at the accelerator’s vacuum-insulator stack (at a radius of 1.6 m by using standard D-dot and B-dot probes, respectively. During postprocessing, the measurements taken at the stack were translated to the location of the IVM measurements by using a lossless propagation model of the Z accelerator’s magnetically insulated transmission lines (MITLs and a lumped inductor model of the vacuum post-hole convolute. Across a wide variety of experiments conducted on the Z accelerator, the voltage histories obtained from the IVM and the lossless propagation technique agree well in overall shape and magnitude. However, large-amplitude, high-frequency oscillations are more pronounced in the IVM records. It is unclear whether these larger oscillations represent true voltage oscillations at the convolute or if they are due to noise pickup and/or transit-time effects and other resonant modes in the IVM. Results using a transit-time-correction technique and Fourier analysis support the latter. Regardless of which interpretation is correct, both true voltage oscillations and the excitement of resonant modes could be the result of transient electrical breakdowns in the post-hole convolute, though more information is required to determine definitively if such breakdowns occurred. Despite the larger oscillations in the IVM records, the general agreement found between the lossless propagation results and the results of the IVM shows that large voltages are transmitted efficiently through the MITLs on Z. These results are complementary to previous studies [R. D. McBride et al., Phys. Rev. ST Accel. Beams 13, 120401 (2010
Linear particle accelerator with seal structure between electrodes and insulators
Broadhurst, John H.
1989-01-01
An electrostatic linear accelerator includes an electrode stack comprised of primary electrodes formed or Kovar and supported by annular glass insulators having the same thermal expansion rate as the electrodes. Each glass insulator is provided with a pair of fused-in Kovar ring inserts which are bonded to the electrodes. Each electrode is designed to define a concavo-convex particle trap so that secondary charged particles generated within the accelerated beam area cannot reach the inner surface of an insulator. Each insulator has a generated inner surface profile which is so configured that the electrical field at this surface contains no significant tangential component. A spark gap trigger assembly is provided, which energizes spark gaps protecting the electrodes affected by over voltage to prevent excessive energy dissipation in the electrode stack.
The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma
International Nuclear Information System (INIS)
Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.
2006-01-01
The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)
Frequency-domain analysis of intrinsic neuronal properties using high-resistant electrodes
Directory of Open Access Journals (Sweden)
Christian Rössert
2009-08-01
Full Text Available Intrinsic cellular properties of neurons in culture or slices are usually studied by the whole cell clamp method using low-resistant patch pipettes. These electrodes allow detailed analyses with standard electrophysiological methods such as current- or voltage-clamp. However, in these preparations large parts of the network and dendritic structures may be removed, thus preventing an adequate study of synaptic signal processing. Therefore, intact in vivo preparations or isolated in vitro whole brains have been used in which intracellular recordings are usually made with sharp, high-resistant electrodes to optimize the impalement of neurons. The general non-linear resistance properties of these electrodes, however, severely limit accurate quantitative studies of membrane dynamics especially needed for precise modelling. Therefore, we have developed a frequency-domain analysis of membrane properties that uses a Piece-wise Non-linear Electrode Compensation (PNEC method. The technique was tested in second-order vestibular neurons and abducens motoneurons of isolated frog whole brain preparations using sharp potassium chloride- or potassium acetate-filled electrodes. All recordings were performed without online electrode compensation. The properties of each electrode were determined separately after the neuronal recordings and were used in the frequency-domain analysis of the combined measurement of electrode and cell. This allowed detailed analysis of membrane properties in the frequency-domain with high-resistant electrodes and provided quantitative data that can be further used to model channel kinetics. Thus, sharp electrodes can be used for the characterization of intrinsic properties and synaptic inputs of neurons in intact brains.
Thaller, Lawrence H.; Quinzio, Michael V.
1997-01-01
The investigation of an aberrant cell voltage during the filling of a large lithium thionyl chloride cell summary is at: an aberrant voltage trace was noted during the review of cell filling data; incident was traced to an interruption during filling; experimentation suggested oxidizable sites within the carbon electrode were responsible for the drop in voltage; the voltage anomaly could be reproduced by interrupting the filling of similar cells; and anomalous voltage dip was not due to a short.
Improved electrode positions for local impedance measurements in the lung-a simulation study.
Orschulik, Jakob; Petkau, Rudolf; Wartzek, Tobias; Hochhausen, Nadine; Czaplik, Michael; Leonhardt, Steffen; Teichmann, Daniel
2016-12-01
Impedance spectroscopy can be used to analyze the dielectric properties of various materials. In the biomedical domain, it is used as bioimpedance spectroscopy (BIS) to analyze the composition of body tissue. Being a non-invasive, real-time capable technique, it is a promising modality, especially in the field of lung monitoring. Unfortunately, up to now, BIS does not provide any regional lung information as the electrodes are usually placed in hand-to-hand or transthoracic configurations. Even though transthoracic electrode configurations are in general capable of monitoring the lung, no focusing to specific regions is achieved. In order to resolve this issue, we use a finite element model (FEM) of the human body to study the effect of different electrode configurations on measured BIS data. We present evaluation results and show suitable electrode configurations for eight lung regions. We show that, using these optimized configurations, BIS measurements can be focused to desired regions allowing local lung analysis.
Rocha, Paulo R F; Schlett, Paul; Kintzel, Ulrike; Mailänder, Volker; Vandamme, Lode K J; Zeck, Gunther; Gomes, Henrique L; Biscarini, Fabio; de Leeuw, Dago M
2016-10-06
Microelectrode arrays (MEA) record extracellular local field potentials of cells adhered to the electrodes. A disadvantage is the limited signal-to-noise ratio. The state-of-the-art background noise level is about 10 μVpp. Furthermore, in MEAs low frequency events are filtered out. Here, we quantitatively analyze Au electrode/electrolyte interfaces with impedance spectroscopy and noise measurements. The equivalent circuit is the charge transfer resistance in parallel with a constant phase element that describes the double layer capacitance, in series with a spreading resistance. This equivalent circuit leads to a Maxwell-Wagner relaxation frequency, the value of which is determined as a function of electrode area and molarity of an aqueous KCl electrolyte solution. The electrochemical voltage and current noise is measured as a function of electrode area and frequency and follow unambiguously from the measured impedance. By using large area electrodes the noise floor can be as low as 0.3 μVpp. The resulting high sensitivity is demonstrated by the extracellular detection of C6 glioma cell populations. Their minute electrical activity can be clearly detected at a frequency below about 10 Hz, which shows that the methodology can be used to monitor slow cooperative biological signals in cell populations.
Characteristics of a corona discharge with a hot corona electrode
International Nuclear Information System (INIS)
Kulumbaev, E. B.; Lelevkin, V. M.; Niyazaliev, I. A.; Tokarev, A. V.
2011-01-01
The effect of the temperature of the corona electrode on the electrical characteristics of a corona discharge was studied experimentally. A modified Townsend formula for the current-voltage characteristic of a one-dimensional corona is proposed. Gasdynamic and thermal characteristics of a positive corona discharge in a coaxial electrode system are calculated. The calculated results are compared with the experimental data.
Heart rate detection from single-foot plantar bioimpedance measurements in a weighing scale.
Diaz, Delia H; Casas, Oscar; Pallas-Areny, Ramon
2010-01-01
Electronic bathroom scales are an easy-to-use, affordable mean to measure physiological parameters in addition to body weight. They have been proposed to obtain the ballistocardiogram (BCG) and derive from it the heart rate, cardiac output and systolic blood pressure. Therefore, weighing scales may suit intermittent monitoring in e-health and patient screening. Scales intended for bioelectrical impedance analysis (BIA) have also been proposed to estimate the heart rate by amplifying the pulsatile impedance component superimposed on the basal impedance. However, electronic weighing scales cannot easily obtain the BCG from people that have a single leg neither are bioimpedance measurements between both feet recommended for people wearing a pacemaker or other electronic implants, neither for pregnant women. We propose a method to detect the heart rate (HR) from bioimpedance measured in a single foot while standing on an bathroom weighting scale intended for BIA. The electrodes built in the weighing scale are used to apply a 50 kHz voltage between the outer electrode pair and to measure the drop in voltage across the inner electrode pair. The agreement with the HR simultaneously obtained from the ECG is excellent. We have also compared the drop in voltage across the waist and the thorax with that obtained when measuring bioimpedance between both feet to compare the possible risk of the proposed method to that of existing BIA scales.
Energy Technology Data Exchange (ETDEWEB)
Osswald, F.; Roumie, M.; Frick, G.; Heusch, B.
1994-11-01
Calculations have been made to increase the high voltage performance of some components and to explain electrical failures of the Vivitron. These involve simulations of static stresses and transient over voltages, especially on insulating boards and electrodes occurring before or during breakdowns. Developments made to the structure of the machine over the last years and new ideas to improve the static and dynamic behaviour are presented. The application of this study and HV tests led recently to a nominal potential near 20 MV without sparks. (author). 49 refs., 25 figs., 2 tabs.
International Nuclear Information System (INIS)
Osswald, F.; Roumie, M.; Frick, G.; Heusch, B.
1994-11-01
Calculations have been made to increase the high voltage performance of some components and to explain electrical failures of the Vivitron. These involve simulations of static stresses and transient over voltages, especially on insulating boards and electrodes occurring before or during breakdowns. Developments made to the structure of the machine over the last years and new ideas to improve the static and dynamic behaviour are presented. The application of this study and HV tests led recently to a nominal potential near 20 MV without sparks. (author). 49 refs., 25 figs., 2 tabs
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
Scanning nanoscale multiprobes for conductivity measurements
DEFF Research Database (Denmark)
Bøggild, Peter; Hansen, Torben Mikael; Kuhn, Oliver
2000-01-01
We report fabrication and measurements with two- and four-point probes with nanoscale dimensions, for high spatial resolution conductivity measurements on surfaces and thin films. By combination of conventional microfabrication and additive three-dimensional nanolithography, we have obtained...... electrode spacings down to 200 nm. At the tips of four silicon oxide microcantilevers, narrow carbon tips are grown in converging directions and subsequently coated with a conducting layer. The probe is placed in contact with a conducting surface, whereby the electrode resistance can be determined....... The nanoelectrodes withstand considerable contact force before breaking. The probe offers a unique possibility to position the voltage sensors, as well as the source and drain electrodes in areas of nanoscale dimensions. ©2000 American Institute of Physics....
Improved design of a high-voltage vacuum-insulator interface
Directory of Open Access Journals (Sweden)
W. A. Stygar
2005-05-01
Full Text Available We have conducted a series of experiments designed to measure the flashover strength of various azimuthally symmetric 45° vacuum-insulator configurations. The principal objective of the experiments was to identify a configuration with a flashover strength greater than that of the standard design, which consists of a 45° polymethyl-methacrylate (PMMA insulator between flat electrodes. The thickness d and circumference C of the insulators tested were held constant at 4.318 and 95.74 cm, respectively. The peak voltage applied to the insulators ranged from 0.8 to 2.2 MV. The rise time of the voltage pulse was 40–60 ns; the effective pulse width [as defined in Phys. Rev. ST Accel. Beams 7, 070401 (2004PRABFM1098-440210.1103/PhysRevSTAB.7.070401] was on the order of 10 ns. Experiments conducted with flat aluminum electrodes demonstrate that the flashover strength of a crosslinked polystyrene (Rexolite insulator is (18±7% higher than that of PMMA. Experiments conducted with a Rexolite insulator and an anode plug, i.e., an extension of the anode into the insulator, demonstrate that a plug can increase the flashover strength by an additional (44±11%. The results are consistent with the Anderson model of anode-initiated flashover, and confirm previous measurements. It appears that a Rexolite insulator with an anode plug can, in principle, increase the peak electromagnetic power that can be transmitted across a vacuum interface by a factor of [(1.18(1.44]^{2}=2.9 over that which can be achieved with the standard design.
International Nuclear Information System (INIS)
Fu, Jiale; Mu, Daobin; Wu, Borong; Bi, Jiaying; Liu, Xiaojiang; Peng, Yiyuan; Li, Yiqing; Wu, Feng
2017-01-01
Highlights: •The electrochemical properties of the LiNi 0.6 Co 0.2 Mn 0.2 O 2 cathode are investigated at high voltage of 4.6 V. •The Li 2 SiO 3 suppresses the decomposition of LiPF 6 and carbonate solvents. •Li 2 SiO 3 helpfully retards the transition metal dissolution by consuming HF. •The enhanced electrochemical properties of the LiNi 0.6 Co 0.2 Mn 0.2 O 2 cathode mixed with Li 2 SiO 3 . -- Abstract: Developing high-voltage Li ion batteries (LIBs) is an important trend to meet the requirement of high energy density battery. However, high voltage will cause a series of problems harming the cycle performance of LIBs at the same time. This work is to investigate the effect of inorganic substance Li 2 SiO 3 on the electrochemical performance of LiNi 0.6 Co 0.2 Mn 0.2 O 2 (NCM622) cathode at high cutoff voltage of 4.6 V. XRD result shows that the structure of NCM622 cathode material is not affected by mixing Li 2 SiO 3 . However, XPS and EIS tests indicate that Li 2 SiO 3 has an evident influence on suppressing the decomposition of LiPF 6 and carbonate solvents at high voltage, reducing interfacial solid film impedance and modifying electrode/electrolyte interface. In addition, Li 2 SiO 3 retards the transition metal dissolution by consuming HF. Therefore, it enhances the electrochemical properties of the NCM622 cathode significantly. The highest discharge capacity increases to 191.7 mA h g -1 by mixing Li 2 SiO 3 , compared with the value of 180 mA h g -1 in the case of NCM622 cathode. The NCM622 electrode mixed with Li 2 SiO 3 also exhibits a better capacity retention of 73.4% after 200 cycles and a high rate capability at 20C with the value of 89 mA h g -1 , in contrast with 62.2% and 31 mA h g -1 attained in the NCM622 cathode.
Effect of Anode Floating Voltage and its Applications in Characterizing Silicon Drift Detectors
International Nuclear Information System (INIS)
Guang-Guo, Wu; Hong-Ri, Li; Kun, Liang; Ru, Yang; De-Jun, Han; Xue-Lei, Cao; Huan-Yu, Wang; Jun-Ming, An; Xiong-Wei, Hu
2009-01-01
Anode Boating voltage is predicted and investigated for silicon drift detectors (SDDs) with an active area of 5 mm 2 fabricated by a double-side parallel technology. It is demonstrated that the anode Boating voltage increases with the increasing inner ring voltage, and is almost unchanged with the external ring voltage. The anode Boating voltage will not be affected by the back electrode biased voltage until it reaches the full-depleted voltage (−50 V) of the SDD. Theoretical analysis and experimental results show that the anode Boating voltage is equal to the sum of the inner ring voltage and the built-in potential between the p + inner ring and the n + anode. A fast checking method before detector encapsulation is proposed by employing the anode Boating voltage along with checking the leakage current, potential distribution and drift properties
Energy Technology Data Exchange (ETDEWEB)
Guinovart, Tomàs [Departament de Química Orgànica i Química Analítica, Universitat Rovira i Virgili, Carrer Marcellí Domingo s/n 43007 Tarragona (Spain); Crespo, Gastón A. [Department of Inorganic and Analytical Chemistry, University of Geneva, Quai Ernest-Ansermet 30, CH-1211 Geneva (Switzerland); Rius, F. Xavier [Departament de Química Orgànica i Química Analítica, Universitat Rovira i Virgili, Carrer Marcellí Domingo s/n 43007 Tarragona (Spain); Andrade, Francisco J., E-mail: franciscojavier.andrade@urv.cat [Departament de Química Orgànica i Química Analítica, Universitat Rovira i Virgili, Carrer Marcellí Domingo s/n 43007 Tarragona (Spain)
2014-04-01
Highlights: • A disposable solid-contact reference electrode for potentiometry is presented. • The device shows unsensitivity to most ions, redox potential and light. • Low-cost and good stability, ideal to build disposable potentiometric sensors. • Nanopores formed in the membrane control the flux of ions with the solution. Abstract: A new solid-state reference electrode using a polymeric membrane of polyvinyl butyral (PVB), Ag/AgCl and NaCl to be used in decentralized chemical measurements is presented. The electrode is made by drop-casting the membrane cocktail onto a glassy carbon (GC) substrate. A stable potential (less than 1 mV dec⁻¹ over a wide range of concentrations for the several chemical species tested is obtained. No significant influence to changes in redox potential, light and pH are observed. The response of this novel electrode shows good correlation when compared with a conventional double-junction reference electrode. Also good long-term stability (90 ± 33 μV/h) and a lifetime of approximately 4 months are obtained. Aspects related to the working mechanisms are discussed. Atomic Force Microscopy (AFM) studies reveal the presence of nanopores and channels on the surface, and electrochemical impedance spectroscopy (EIS) of optimized electrodes show low bulk resistances, usually in the kΩ range, suggesting that a nanoporous polymeric structure is formed in the interface with the solution. Future applications of this electrode as a disposable device for decentralized measurements are discussed. Examples of the utilization on wearable substrates (tattoos, fabrics, etc) are provided.
International Nuclear Information System (INIS)
Guinovart, Tomàs; Crespo, Gastón A.; Rius, F. Xavier; Andrade, Francisco J.
2014-01-01
Highlights: • A disposable solid-contact reference electrode for potentiometry is presented. • The device shows unsensitivity to most ions, redox potential and light. • Low-cost and good stability, ideal to build disposable potentiometric sensors. • Nanopores formed in the membrane control the flux of ions with the solution. - Abstract: A new solid-state reference electrode using a polymeric membrane of polyvinyl butyral (PVB), Ag/AgCl and NaCl to be used in decentralized chemical measurements is presented. The electrode is made by drop-casting the membrane cocktail onto a glassy carbon (GC) substrate. A stable potential (less than 1 mV dec −1 ) over a wide range of concentrations for the several chemical species tested is obtained. No significant influence to changes in redox potential, light and pH are observed. The response of this novel electrode shows good correlation when compared with a conventional double-junction reference electrode. Also good long-term stability (90 ± 33 μV/h) and a lifetime of approximately 4 months are obtained. Aspects related to the working mechanisms are discussed. Atomic Force Microscopy (AFM) studies reveal the presence of nanopores and channels on the surface, and electrochemical impedance spectroscopy (EIS) of optimized electrodes show low bulk resistances, usually in the kΩ range, suggesting that a nanoporous polymeric structure is formed in the interface with the solution. Future applications of this electrode as a disposable device for decentralized measurements are discussed. Examples of the utilization on wearable substrates (tattoos, fabrics, etc) are provided
Electrical properties of graphene film for counter electrode in dye sensitized solar cells
Khalifa, Ali; Shafie, S.; Hasan, W. Z. W.; Lim, H. N.; Rusop, M.; Samaila, Buda
2018-05-01
A graphene counter electrode for dye-sensitized solar cell was prepared simply by drop casting method on a conducting FTO glass at room temperature. Raman spectroscopy was used to study the defection in the graphene films. The sheet resistance was also measured and recoded minimum value of 7.04 Ω/□ at 22.19µm thickness. The casted films show good adhesion to substrates with low defects. A DSSC based on graphene counter electrode demonstrates reasonable conversion efficiency of 2.78% with short circuit current of 7.60mA, open circuit voltage of 0.69V and fill factor of 0.52. The high conductivity and low defects render the prepared graphene dispersion for DSSCs' CE application.
Energetic high-voltage breakdowns in vacuum over a large gap for ITER neutral beam accelerator
Energy Technology Data Exchange (ETDEWEB)
Villecroze, F., E-mail: Frederic.villecroze@cea.fr [CEA, IRFM, F-13108 Saint-Paul-Lez-Durance (France); Christin, L.; Esch, H.P.L. de; Simonin, A. [CEA, IRFM, F-13108 Saint-Paul-Lez-Durance (France); Schunke, B.; Svensson, L.; Hemsworth, R.; Boilson, D. [ITER Organization, Route de Vinon sur Verdon, 13115 Saint Paul Lez Durance (France)
2013-10-15
Highlights: ► We performed energetic high voltage breakdowns up to 370 kV with a stored energy of 1 kJ. ► No breakdowns at 200 kV could be produced over a gap of 85 mm using 100 cm{sup 2} copper electrodes. ► Electrodes damage was visible after the experiment. ► The number of arcs impacts is orders of magnitude above the number of breakdowns. -- Abstract: CEA has undertaken tests to study the resilience of copper electrodes in vacuum against energetic high-voltage breakdowns using external capacitors to provide the energy. Earlier tests succeeded in dissipating a maximum of 150 J in a 30 mm gap, limited by the equivalent series resistance (ESR) in the external capacitors. Using new ones with an ESR that is a factor of 10 lower it was unsuccessfully tried to produce breakdowns at 200 kV over the 85 mm gap, despite the use of a UV flash lamp and a “field enhancement ring” (FER) that locally increased the electric field on the cathode by 50%. Consequently, the breakdowns had to be produced by raising the voltage to 300–350 kV while maintaining the gap at 85 mm. During these tests, single breakdowns dissipated up to 1140 J in the 85 mm vacuum gap. Inspection of the electrodes revealed that substantial amounts of copper appear have been evaporated from the anode and deposited on to the cathode. Also electrode deconditioning occurred.
DEFF Research Database (Denmark)
Lin, Rong; Stokbro, Kurt; Madsen, Dorte Nørgaard
2005-01-01
potential of the film induced dark (light-absorbing) rings, which spread out from the anode on a time scale of seconds. The rate of expansion of the rings as well as the final diameter depended on the bias voltage. Using two micro four-point probes simultaneously, we measured with one probe the conductance......We present measurements of microscale electrochromic switching of poly(3,4-ethylenedioxy)thiophene doped with poly(4-styrene sulfonate), thin film using microfabricated multi-point probe electrodes. After treatment with a dilute hydrochloric acid, a voltage bias above 3 V with respect to the ground...... of the film outside, near and inside a dark ring induced by a voltage applied to another probe and found the resistivity to be directly related to the observed absorbance of the film. The standard electrochromic mechanism of ion insertion was used to explain the observations. We anticipate this experimental...
Cermet insert high voltage holdoff improvement for ceramic/metal vacuum devices
Ierna, W.F.
1986-03-11
An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.
International Nuclear Information System (INIS)
Wild, R; Schumann, T; Stollenwerk, L
2014-01-01
In this contribution, we present a possibility to actively control emerging patterns in laterally extended barrier discharges. One of the barriers is a high-ohmic semiconductive GaAs electrode. As the electrode is illuminated from its plasma-far side, the voltage inside the plasma gap is increased. If the gap voltage becomes higher than the ignition voltage of the gas, a discharge is started. A corresponding electrical model is given. The lateral resolution of control for a laterally homogeneous discharge is investigated. It is found that the luminescence of the discharge is controlled by both a variation of illumination power density and a variation of the applied voltage. However, during an increase in the applied voltage, the discharge may become larger than the area of illumination. Further, an investigation of the patterned discharge control shows that the number of current spots depends on the illumination power density and the area of illumination. The behaviour of current spot appearance suggests an inhibitory influence, preventing a discharge in its immediate surrounding and limiting the total number of current spots. (paper)
Transient analysis of the output short-circuit fault of high power and high voltage DC power supply
International Nuclear Information System (INIS)
Yang Zhigang; Zhang Jian; Huang Yiyun; Hao Xu; Sun Haozhang; Guo Fei
2014-01-01
The transient conditions of output short-circuit fault of high voltage DC power supply was introduced, and the energy of power supply injecting into klystron during the protection process of three-electrode gas switch were analyzed and calculated in detail when klystron load happening electrode arc faults. The results of calculation and simulation are consistent with the results of the experiment. When the output short-circuit fault of high voltage power supply occurs, switch can be shut off in the microsecond, and the short circuit current can be controlled in 200 A. It has verified the rapidity and reliability of the three-electrode gas switch protection, and it has engineering application value. (authors)
International Nuclear Information System (INIS)
Arai, Takahiro; Furuya, Masahiro; Kanai, Taizo
2010-01-01
High-density multipoint electrode method was developed to measure a liquid film thickness transient on a curved surface. The devised method allows us to measure spatial distribution of liquid film with its conductance between electrodes. The sensor was designed and fabricated as a multilayer print circuit board, where electrode pairs were distributed in reticular pattern with narrow interval. In order to measure a lot of electrode pairs at a high sampling rate, signal-processing method used by the wire mesh sensor measurement system was applied. An electrochemical impedance spectrometry concludes that the sampling rate of 1000 slices/s is feasible without signal distortion by electric double layer. The method was validated with two experimental campaigns: (1) a droplet impingement on a flat film and (2) a jet impingement on a rod-shape sensor surface. In the former experiment, a water droplet having 4 mm in diameter impinged onto the 1 mm thick film layer. A visual observation study with high-speed video camera shows after the liquid impingement, the water layer thinning process was clearly demonstrated with the sensor. For the latter experiment, the flexible circuit board was bended to form a cylindrical shape to measure water film on a simulated fuel rod in bundle geometry. A water jet having 3 mm in diameter impinged onto the rod-shape sensor surface. The process of wetting area enlargement on the rod surface was demonstrated in the same manner that the video-frames showed. (author)
Analysis of NSTX TF Joint Voltage Measurements
International Nuclear Information System (INIS)
Woolley R
2005-01-01
This report presents findings of analyses of recorded current and voltage data associated with 72 electrical joints operating at high current and high mechanical stress. The analysis goal was to characterize the mechanical behavior of each joint and thus evaluate its mechanical supports. The joints are part of the toroidal field (TF) magnet system of the National Spherical Torus Experiment (NSTX) pulsed plasma device operating at the Princeton Plasma Physics Laboratory (PPPL). Since there is not sufficient space near the joints for much traditional mechanical instrumentation, small voltage probes were installed on each joint and their voltage monitoring waveforms have been recorded on sampling digitizers during each NSTX ''shot''
International Nuclear Information System (INIS)
Peschmann, Kristian.
1982-01-01
A radiation detector suitable for use in computer tomography device has an ionization chamber which comprises a high voltage electrode, a collector electrode, a high voltage source having two terminals, one connected to the high voltage electrode, current measuring means having two terminals, one connected to the high voltage source and the other to the collector electrode, and an auxilliary electrode near and parallel to the entrance window of the device, having one adjacent to the high voltage electrode and the other adjacent but not connected to the collector electrode. The auxilliary electrode is connected to the high voltage source. In this way the electric field between the high voltage and collector electrodes is made homogeneous in the vicinity of the auxilliary electrode, improving the measuring speed of the detector
International Nuclear Information System (INIS)
Kim, S.H.; Choi, S.G.; Choi, W.K.; Yang, B.Y.; Lee, E.S.
2014-01-01
Highlights: • Invar alloy was electrochemically polished and then subjected to PECM (Pulse Electro Chemical Machining) in a mixture of NaCl, glycerin, and distilled water. • Optical microscopic/SEM and non-contact 3D measurement study of Invar surface analyses. • Analysis result shows that applied voltage and electrode shape are factors that affect the surface conditions. - Abstract: In this study, Invar alloy (Fe 63.5%, Ni 36.5%) was electrochemically polished by PECM (Pulse Electro Chemical Machining) in a mixture of NaCl, glycerin, and distilled water. A series of PECM experiments were carried out with different voltages and different electrode shapes, and then the surfaces of polished Invar alloy were investigated. The polished Invar alloy surfaces were investigated by optical microscope, scanning electron microscope (SEM), and non-contact 3D measurement (white light microscopes) and it was found that different applied voltages produced different surface characteristics on the Invar alloy surface because of the locally concentrated applied voltage on the Invar alloy surface. Moreover, we found that the shapes of electrode also have an effect on the surface characteristics on Invar alloy surface by influencing the applied voltage. These experimental findings provide fundamental knowledge for PECM of Invar alloy by surface analysis
Cu2Sb thin film electrodes prepared by pulsed laser deposition f or lithium batteries
Energy Technology Data Exchange (ETDEWEB)
Song, Seung-Wan; Reade, Ronald P.; Cairns, Elton J.; Vaughey, Jack T.; Thackeray, Michael M.; Striebel, Kathryn A.
2003-08-01
Thin films of Cu2Sb, prepared on stainless steel and copper substrates with a pulsed laser deposition technique at room temperature, have been evaluated as electrodes in lithium cells. The electrodes operate by a lithium insertion/copper extrusion reaction mechanism, the reversibility of which is superior when copper substrates are used, particularly when electrochemical cycling is restricted to the voltage range 0.65-1.4 V vs. Li/Li+. The superior performance of Cu2Sb films on copper is attributed to the more active participation of the extruded copper in the functioning of the electrode. The continual and extensive extrusion of copper on cycling the cells leads to the isolation of Li3Sb particles and a consequent formation of Sb. Improved cycling stability of both types of electrodes was obtained when cells were cycled between 0.65 and 1.4 V. A low-capacity lithium-ion cell with Cu2Sb and LiNi0.8Co0.15Al0.05O2 electrodes, laminated from powders, shows excellent cycling stability over the voltage range 3.15 - 2.2 V, the potential difference corresponding to approximately 0.65-1.4 V for the Cu2Sb electrode vs. Li/Li+. Chemical self-discharge of lithiated Cu2Sb electrodes by reaction with the electrolyte was severe when cells were allowed to relax on open circuit after reaching a lower voltage limit of 0.1 V. The solid electrolyte interphase (SEI) layer formed on Cu2Sb electrodes after cells had been cycled between 1.4 and 0.65 V vs. Li/Li+ was characterized by Fourier-transform infrared spectroscopy; the SEI layer contributes to the large irreversible capacity loss on the initial cycle of these cells. The data contribute to a better understanding of the electrochemical behavior of intermetallic electrodes in rechargeable lithium batteries.
The transfer voltage standard for calibration outside of a laboratory
Directory of Open Access Journals (Sweden)
Urekar Marjan
2017-01-01
Full Text Available The transfer voltage standard is designed for transferring the analog voltage from a calibrator to the process control workstation for multi-electrode electrolysis process in a plating plant. Transfer voltage standard is based on polypropylene capacitors and operational amplifiers with tera-ohm range input resistance needed for capacitor self-discharging effect cancellation. Dielectric absorption effect is described. An instrument for comparison of reference and control voltages is devised, based on precise window comparator. Detailed description of the main task is given, including constraints, theoretical and practical solutions. Procedure for usage of the standard outside of a laboratory conditions is explained. Comparison of expected and realized standard characteristics is given. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR-32019
Current-voltage characteristics of dendrimer light-emitting diodes
International Nuclear Information System (INIS)
Stevenson, S G; Samuel, I D W; Staton, S V; Knights, K A; Burn, P L; Williams, J H T; Walker, Alison B
2010-01-01
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Current-voltage characteristics of dendrimer light-emitting diodes
Stevenson, S. G.; Samuel, I. D. W.; Staton, S. V.; Knights, K. A.; Burn, P. L.; Williams, J. H. T.; Walker, Alison B.
2010-09-01
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Current-voltage characteristics of dendrimer light-emitting diodes
Energy Technology Data Exchange (ETDEWEB)
Stevenson, S G; Samuel, I D W [Organic Semiconductor Centre, SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, Fife, KY16 9SS (United Kingdom); Staton, S V; Knights, K A; Burn, P L [Department of Chemistry, Chemistry Research Laboratory, 12 Mansfield Road, Oxford, OX1 3TA (United Kingdom); Williams, J H T; Walker, Alison B, E-mail: a.b.walker@bath.ac.u [Department of Physics, University of Bath, Bath, BA2 7AY (United Kingdom)
2010-09-29
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Directory of Open Access Journals (Sweden)
Sule Erten-Ela
2014-01-01
Full Text Available Metal-free organic sensitizer consisting of donor, electron conducting, and anchoring anhydride groups was engineered at molecular level and synthesized. Dye sensitized solar cells based on conjugated naphthalene dye were fabricated using nanoporous electrode. Photoelectrodes with a 7 μm thick nanoporous layer and a 5 μm thick light-scattering layer were used to fabricate dye sensitized solar cells. DSSCs were fabricated in a FTO/nc-TiO2/organic dye/I-/I3-/Pt/FTO device geometry. Dye sensitized solar cell was characterized by current density-voltage (J-V measurement. All current-voltage (I-V measurements were done under 100 mW/cm2 light intensity and AM 1.5 conditions. The photovoltaic data revealed a short circuit photocurrent density of 1.86 mA/cm2, an open circuit voltage of 430 mV, and a fill factor of 0.63, corresponding to an overall conversion efficiency of 0.53%.
Kim, Bongkyu; Chang, In Seop
2018-08-01
Voltage reversal (VR) in series connection of multiple membrane electrode assembly installed microbial fuel cells (mMEA-MFC) is eliminated by manipulating the resistor control. Discharge test results collected from two mMEA-MFCs initially operated (designated as P1 and P2) confirm that the performance of P2 exceeds that of P1. Thus, driving P1 and P2 as serially stacked MFCs generate the VR in P1. Controlling the inserted resistor adjust the current production of P2 to maintain balance with P1, and the VR in P1 is eliminated in the operation of stacking mode. Thus, manipulating the internal resistance provide an applicable approach to suppress VR in the stacking of mMEA-MFCs system. Copyright © 2018 Elsevier Ltd. All rights reserved.
The Effect of Image Potential on the Current-Voltage Characteristics of a Ferritin-layer
Directory of Open Access Journals (Sweden)
Eunjung Bang
2010-11-01
Full Text Available Considering for the concept of power storage systems, such as those used to supply power to microelectronic devices, ferritins have aroused a lot of interests for applications in bioelectrochemical devices. And electron transfer rates from the proteins to electrode surface are key determinants of overall performance and efficiency of the ferritin-based devices. Here we have investigated the electron transport mechanism of ferritin layer which was immobilized on an Au electrode. The current-voltage (I-V curves are obtained by a conductive atomic force microscope (c-AFM as a function of contact area between AFM tip and the ferritin layer. In the low voltage region, I-V curves are affected by both Fowler-Nordheim tunneling and image force. On the other hand, the experimental results are consistent with a Simmons model in a high voltage region, indicating that, as the voltage increases, the image potential has a dominant effect on the electron transport mechanism. These results are attributed to the film-like character of the ferritin layer, which generates an image potential to lower the barrier height in proportion to the voltage increment.
High-Capacity Cathode Material with High Voltage for Li-Ion Batteries.
Shi, Ji-Lei; Xiao, Dong-Dong; Ge, Mingyuan; Yu, Xiqian; Chu, Yong; Huang, Xiaojing; Zhang, Xu-Dong; Yin, Ya-Xia; Yang, Xiao-Qing; Guo, Yu-Guo; Gu, Lin; Wan, Li-Jun
2018-03-01
Electrochemical energy storage devices with a high energy density are an important technology in modern society, especially for electric vehicles. The most effective approach to improve the energy density of batteries is to search for high-capacity electrode materials. According to the concept of energy quality, a high-voltage battery delivers a highly useful energy, thus providing a new insight to improve energy density. Based on this concept, a novel and successful strategy to increase the energy density and energy quality by increasing the discharge voltage of cathode materials and preserving high capacity is proposed. The proposal is realized in high-capacity Li-rich cathode materials. The average discharge voltage is increased from 3.5 to 3.8 V by increasing the nickel content and applying a simple after-treatment, and the specific energy is improved from 912 to 1033 Wh kg -1 . The current work provides an insightful universal principle for developing, designing, and screening electrode materials for high energy density and energy quality. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Apparatus for measuring the concentration of a gas
International Nuclear Information System (INIS)
Manin, Ange.
1974-01-01
The apparatus described for measuring the concentration of a gas in an atmosphere is of the kind which has an ionization chamber with an internal radioactive source and associated electronics enabling the ionization current crossing the chamber to be measured. It includes at least one cylindrical metal grid forming an electrode brought to a high voltage in relation to a cylindrical collection electrode fitted to the axis of the grid coated with a radioactive deposit and, around this grid, a screen acting as a protective envelope. The radioactive deposit is tritiated titanium [fr
The development of high-voltage repetitive low-jitter corona stabilized triggered switch
Geng, Jiuyuan; Yang, Jianhua; Cheng, Xinbing; Yang, Xiao; Chen, Rong
2018-04-01
The high-power switch plays an important part in a pulse power system. With the trend of pulse power technology toward modularization, miniaturization, and accuracy control, higher requirements on electrical trigger and jitter of the switch have been put forward. A high-power low-jitter corona-stabilized triggered switch (CSTS) is designed in this paper. This kind of CSTS is based on corona stabilized mechanism, and it can be used as a main switch of an intense electron-beam accelerator (IEBA). Its main feature was the use of an annular trigger electrode instead of a traditional needle-like trigger electrode, taking main and side trigger rings to fix the discharging channels and using SF6/N2 gas mixture as its operation gas. In this paper, the strength of the local field enhancement was changed by a trigger electrode protrusion length Dp. The differences of self-breakdown voltage and its stability, delay time jitter, trigger requirements, and operation range of the switch were compared. Then the effect of different SF6/N2 mixture ratio on switch performance was explored. The experimental results show that when the SF6 is 15% with the pressure of 0.2 MPa, the hold-off voltage of the switch is 551 kV, the operating range is 46.4%-93.5% of the self-breakdown voltage, the jitter is 0.57 ns, and the minimum trigger voltage requirement is 55.8% of the peak. At present, the CSTS has been successfully applied to an IEBA for long time operation.
Chidambaram, Nachiappan; Mazzalai, Andrea; Muralt, Paul
2012-08-01
Interdigitated electrode (IDE) systems with lead zirconate titanate (PZT) thin films play an increasingly important role for two reasons: first, such a configuration generates higher voltages than parallel plate capacitor-type electrode (PPE) structures, and second, the application of an electric field leads to a compressive stress component in addition to the overall stress state, unlike a PPE structure, which results in tensile stress component. Because ceramics tend to crack at relatively moderate tensile stresses, this means that IDEs have a lower risk of cracking than PPEs. For these reasons, IDE systems are ideal for energy harvesting of vibration energy, and for actuators. Systematic investigations of PZT films with IDE systems have not yet been undertaken. In this work, we present results on the evaluation of the in-plane piezoelectric coefficients with IDE systems. Additionally, we also propose a simple and measurable figure of merit (FOM) to analyze and evaluate the relevant piezoelectric parameter for harvesting efficiency without the need to fabricate the energy harvesting device. Idealized effective coefficients e(IDE) and h(IDE) are derived, showing its composite nature with about one-third contribution of the transverse effect, and about two-thirds contribution of the longitudinal effect in the case of a PZT film deposited on a (100)-oriented silicon wafer with the in-plane electric field along one of the Si directions. Randomly oriented 1-μm-thick PZT 53/47 film deposited by a sol-gel technique, was evaluated and yielded an effective coefficient e(IDE) of 15 C·m(-2). Our FOM is the product between effective e and h coefficient representing twice the electrical energy density stored in the piezoelectric film per unit strain deformation (both for IDE and PPE systems). Assuming homogeneous fields between the fingers, and neglecting the contribution from below the electrode fingers, the FOM for IDE structures with larger electrode gap is derived to be
1972-01-01
Electrocardiographic and vectorcardiographic bioinstrumentation work centered on the development of a new electrode system harness for Project Skylab. Evaluation of several silver electrode configurations proved superior impedance voltage performance for silver/silver chloride electrodes mounted flush by using a paste adhesive. A portable ECG processor has been designed and a breadboard unit has been built to sample ECG input data at a rate of 500 samples per second for arrhythmia detection. A small real time display driver program has been developed for statistical analysis on selected QPS features. Engineering work on a sleep monitoring cap assembly continued.
Electrical measurements in µ-EDM
International Nuclear Information System (INIS)
Ferri, Carlo; Ivanov, Atanas; Petrelli, Antoine
2008-01-01
The phenomena occurring between the electrodes in electric discharge machining when manufacturing features on the micro-metre scale (µ-EDM) is not fully understood. Poor quantitative knowledge of the sources of variability affecting this process hinders the identification of its natural tolerance limits. Moreover, improvements in measuring systems contribute to the acquisition of new information that often conflicts with existent theoretical models of this process. The prime objective of this paper is to advance the experimental knowledge of µ-EDM by providing a measurement framework for the electrical discharges. The effects of the electrodes metallic materials (Ag, Ni, Ti, W) on the electrical measurements defined in the proposed framework are analysed. Linear mixed-effects models are fitted to the experimental data using the restricted maximum likelihood method (REML). The main conclusion drawn is that the discharge current and voltage as defined and measured in this framework do significantly depend on the electrode material even when keeping all the other machining conditions unchanged
Richey, Francis W; Dyatkin, Boris; Gogotsi, Yury; Elabd, Yossef A
2013-08-28
Electrochemical double layer capacitors (EDLCs), or supercapacitors, rely on electrosorption of ions by porous carbon electrodes and offer a higher power and a longer cyclic lifetime compared to batteries. Ionic liquid (IL) electrolytes can broaden the operating voltage window and increase the energy density of EDLCs. Herein, we present direct measurements of the ion dynamics of 1-ethyl-3-methylimidazolium bis((trifluoromethyl)sulfonyl)imide in an operating EDLC with electrodes composed of porous nanosized carbide-derived carbons (CDCs) and nonporous onion-like carbons (OLCs) with the use of in situ infrared spectroelectrochemistry. For CDC electrodes, IL ions (both cations and anions) were directly observed entering and exiting CDC nanopores during charging and discharging of the EDLC. Conversely, for OLC electrodes, IL ions were observed in close proximity to the OLC surface without any change in the bulk electrolyte concentration during charging and discharging of the EDLC. This provides experimental evidence that charge is stored on the surface of OLCs in OLC EDLCs without long-range ion transport through the bulk electrode. In addition, for CDC EDLCs with mixed electrolytes of IL and propylene carbonate (PC), the IL ions were observed entering and exiting CDC nanopores, while PC entrance into the nanopores was IL concentration dependent. This work provides direct experimental confirmation of EDLC charging mechanisms that previously were restricted to computational simulations and theories. The experimental measurements presented here also provide deep insights into the molecular level transport of IL ions in EDLC electrodes that will impact the design of the electrode materials' structure for electrical energy storage.
Energy Technology Data Exchange (ETDEWEB)
Mohebbi, Razie; Seyed-Yazdi, Jamileh, E-mail: j.seyedyazdi@vru.ac.ir
2016-06-01
In this paper we have investigated the electronic transmission of systems electrode–benzene–electrode using the Landauer approach. The effect of different electrodes made of metal (Au) and semiconductors (Si, TiO{sub 2}) is investigated. These three electrodes are compared between them and the results show that the electronic transmission of benzene junctions, when using semiconductor electrodes, is associated to a gap in transmission which is due to the electrodes band gap. As a consequence, a threshold voltage is necessary to obtain conducting channels.
Current distribution measurements inside an electromagnetic plasma gun operated in a gas-puff mode.
Poehlmann, Flavio R; Cappelli, Mark A; Rieker, Gregory B
2010-12-01
Measurements are presented of the time-dependent current distribution inside a coaxial electromagnetic plasma gun. The measurements are carried out using an array of six axially distributed dual-Rogowski coils in a balanced circuit configuration. The radial current distributions indicate that operation in the gas-puff mode, i.e., the mode in which the electrode voltage is applied before injection of the gas, results in a stationary ionization front consistent with the presence of a plasma deflagration. The effects of varying the bank capacitance, transmission line inductance, and applied electrode voltage were studied over the range from 14 to 112 μF, 50 to 200 nH, and 1 to 3 kV, respectively.
Directory of Open Access Journals (Sweden)
Jie Zou
2015-07-01
Full Text Available Here we report on a new architecture for potentiometric NO2 sensors that features thin 8YSZ electrolytes sandwiched between two porous (La0.8Sr0.20.95MnO3 (LSM95 layers—one thick and the other thin—fabricated by the tape casting and co-firing techniques. Measurements of their sensing characteristics show that reducing the porosity of the supporting LSM95 reference electrodes can increase the response voltages. In the meanwhile, thin LSM95 layers perform better than Pt as the sensing electrode since the former can provide higher response voltages and better linear relationship between the sensitivities and the NO2 concentrations over 40–1000 ppm. The best linear coefficient can be as high as 0.99 with a sensitivity value of 52 mV/decade as obtained at 500 °C. Analysis of the sensing mechanism suggests that the gas phase reactions within the porous LSM95 layers are critically important in determining the response voltages.
Origin of the transition voltage in gold–vacuum–gold atomic junctions
Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin
2012-01-01
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode
Novel Plasma Reactor with Rotary Helix Electrode Used in Coupling of CH4 at Atmospheric Pressure
International Nuclear Information System (INIS)
Wang Dawang; Ma Tengcai
2006-01-01
At the ambient temperature and pressure a glow discharge plasma was used as a new approach for the coupling of methane with the newly-developed rotary multidentate helix electrode. In the presence of hydrogen, the effects of the input peak voltages and gas flow rates on methane conversion, C 2 single pass yield and selectivity were investigated, and then the results were compared with those from the three-disc multidentate electrode. This demonstrated, on an experimental scale, that the rotary multidentate helix electrode was better than the multidentate three-disc electrode as there was little accumulation of coke, and the C 2 yield per pass was 69.85% and C 2 selectivity over 99.14% with 70.46% methane conversion at an input peak voltage of 2300 V and 60 ml/min gas flow rate
Zoom system without moving element by using two liquid crystal lenses with spherical electrode
Yang, Ren-Kai; Lin, Chia-Ping; Su, Guo-Dung J.
2017-08-01
A traditional zoom system is composed of several elements moving relatively toward other components to achieve zooming. Unlike tradition system, an electrically control zoom system with liquid crystal (LC) lenses is demonstrated in this paper. To achieve zooming, we apply two LC lenses whose optical power is controlled by voltage to replace two moving lenses in traditional zoom system. The mechanism of zoom system is to use two LC lenses to form a simple zoom system. We found that with such spherical electrodes, we could operate LC lens at voltage range from 31V to 53 V for 3X tunability in optical power. For each LC lens, we use concave spherical electrode which provide lower operating voltage and great tunability in optical power, respectively. For such operating voltage and compact size, this zoom system with zoom ratio approximate 3:1 could be applied to mobile phone, camera and other applications.
Energy Technology Data Exchange (ETDEWEB)
Wiater, Jaroslaw [Bialystok Technical University (Poland). Electrical Dept.], E-mail: jaroslawwiater@we.pb.edu.pl
2007-07-01
This paper will present a ground potential rise (GPR) measurement results. All measurements were made during normal work of the real high voltage substation and according a special procedure developed for this occasion. This procedure does not influence on the protection relays and ensures a proper work of the substation even for 6 kV surges. During measurements current and voltage surges were produced by the impulse generator - UCS 500M6B. Measurement results are compared to simulation results performed in CDEGS software for the same initial conditions. (author)
Dioxythiophene-based polymer electrodes for supercapacitor modules.
Liu, David Y; Reynolds, John R
2010-12-01
We report on the electrochemical and capacitive behaviors of poly(2,2-dimethyl-3,4-propylene-dioxythipohene) (PProDOT-Me2) films as polymeric electrodes in Type I electrochemical supercapacitors. The supercapacitor device displays robust capacitive charging/discharging behaviors with specific capacitance of 55 F/g, based on 60 μg of PProDOT-Me2 per electrode, that retains over 85% of its storage capacity after 32 000 redox cycles at 78% depth of discharge. Moreover, an appreciable average energy density of 6 Wh/kg has been calculated for the device, along with well-behaved and rapid capacitive responses to 1.0 V between 5 to 500 mV s(-1). Tandem electrochemical supercapacitors were assembled in series, in parallel, and in combinations of the two to widen the operating voltage window and to increase the capacitive currents. Four supercapacitors coupled in series exhibited a 4.0 V charging/discharging window, whereas assembly in parallel displayed a 4-fold increase in capacitance. Combinations of both serial and parallel assembly with six supercapacitors resulted in the extension of voltage to 3 V and a 2-fold increase in capacitive currents. Utilization of bipolar electrodes facilitated the encapsulation of tandem supercapacitors as individual, flexible, and lightweight supercapacitor modules.
BEHAVIOUR OF BACKFILL MATERIALS FOR ELECTRICAL GROUNDING SYSTEMS UNDER HIGH VOLTAGE CONDITIONS
Directory of Open Access Journals (Sweden)
S. C. LIM
2015-06-01
Full Text Available Backfill materials like Bentonite and cement are effective in lowering grounding resistance of electrodes for a considerable period. During lightning, switching impulses and earth fault occurrences in medium and high voltage networks, the grounding system needs to handle extremely high currents either for a short duration or prolonged period respectively. This paper investigates the behaviour of bentonite, cement and sand under impulse and alternating high voltage (50Hz conditions. Fulguritic-formation was observed in all materials under alternating high voltage. The findings reveal that performance of grounding systems under high voltage conditions may significantly change from the outcomes anticipated at design stage.
Dual-electrode biasing experiments in KT-5C device
International Nuclear Information System (INIS)
Yu Yi; Lu Ronghua; Wang Chen; Pan Geshen; Wen Yizhi; Yu Changxuan; Ma Jinxiu; Wan Shude; Liu Wandong
2005-01-01
Based on the single biasing electrode experiments to optimize the confinement of plasma in the device of KT-5C tokamak, dual-biasing electrodes were inserted into the KT5C plasma for the first time to explore the enhancement of the effects of biasing and the mechanisms of the biasing. By means of applying different combinations of biasing voltages to the dual electrodes, the changes in E r , which is the key factor for boosting up the Er x B flow shear, were observed. The time evolution showed the inner electrode played a major role in dual-biasing, for it always drew a larger current than the outer one. The outer electrode made little influence. It turned out that the dual-biasing electrodes were as effective as a single one, in improving plasma confinement, for the mechanism of biasing was essentially an edge effect. (author)
The Coefficient of the Voltage Induced Frequency Shift Measurement on a Quartz Tuning Fork
Directory of Open Access Journals (Sweden)
Yubin Hou
2014-11-01
Full Text Available We have measured the coefficient of the voltage induced frequency shift (VIFS of a 32.768 KHz quartz tuning fork. Three vibration modes were studied: one prong oscillating, two prongs oscillating in the same direction, and two prongs oscillating in opposite directions. They all showed a parabolic dependence of the eigen-frequency shift on the bias voltage applied across the fork, due to the voltage-induced internal stress, which varies as the fork oscillates. The average coefficient of the VIFS effect is as low as several hundred nano-Hz per millivolt, implying that fast-response voltage-controlled oscillators and phase-locked loops with nano-Hz resolution can be built.
Fluoride Removal From Drinking Water by Electrocoagulation Using Iron and Aluminum Electrodes
Takdastan; Emami Tabar; Neisi; Eslami
2014-01-01
Background Existence of fluoride in drinking water above the permissible level causes human skeletal fluorosis. Objectives Electrocoagulation by iron and aluminum electrodes was proposed for removing fluoride from drinking water. Materials and Methods Effects of different operating conditions such as treatment time, initial pH, applied voltage, type and number of electrodes, the sp...
Noninvasive measurement of physiological signals on a modified home bathroom scale.
Inan, O T; Dookun Park; Giovangrandi, L; Kovacs, G T A
2012-08-01
A commercial bathroom scale with both handlebar and footpad electrodes was modified to enable measurement of four physiological signals: the ballistocardiogram (BCG), electrocardiogram (ECG), lower body impedance plethysmogram (IPG), and lower body electromyogram (EMG). The BCG, which describes the reaction of the body to cardiac ejection of blood, was measured using the strain gauges in the scale. The ECG was detected using handlebar electrodes with a two-electrode amplifier. For the lower body IPG, the two electrodes under the subject's toes were driven with an ac current stimulus, and the resulting differential voltage across the heels was measured and demodulated synchronously with the source. The voltage signal from the same two footpad electrodes under the heels was passed through a passive low-pass filter network into another amplifier, and the output was the lower body EMG signal. The signals were measured from nine healthy subjects, and the average signal-to-noise ratio (SNR) while the subjects were standing still was estimated for the four signals as follows: BCG, 7.6 dB; ECG, 15.8 dB; IPG, 10.7 dB. During periods of motion, the decrease in SNR for the BCG signal was found to be correlated to the increase in rms power for the lower body EMG (r = 0.89, p <; 0.01). The EMG could, thus, be used to flag noise-corrupted segments of the BCG, increasing the measurement robustness. This setup could be used for monitoring the cardiovascular health of patients at home.
A novel reactor combining a flame-deposited nanostructured titanium dioxide film and a set of embedded ceramic electrodes was designed, developed and tested for degradation of methyl tert-butyl ether (MTBE) in water. On applying a voltage to the ceramic electrodes, a surface coro...
Investigation of Vacuum Arc Voltage Characteristics Under Different Axial Magnetic Field Profiles
International Nuclear Information System (INIS)
Jia Shenli; Song Xiaochuan; Huo Xintao; Shi Zongqian; Wang Lijun
2010-01-01
Characteristics of the arc voltage under different profiles of axial magnetic field were investigated experimentally in a detachable vacuum chamber with five pairs of specially designed electrodes generating both bell-shaped and saddle-shaped magnetic field profile. The arc column and cathode spot images were photographed by a high speed digital camera. The dependence of the arc voltage on arcing evolution is analyzed. It is indicated that the axial magnetic field profile could affect the arc behaviors significantly, and the arc voltage is closely related to the arc light intensity.
International Nuclear Information System (INIS)
Kim, Keun Su; Park, Jin Myung; Choi, Sooseok; Kim, Jongin; Hong, Sang Hee
2008-01-01
Thermal flow characteristics of air plasma jets generated by a non-transferred plasma torch with hollow electrodes are experimentally and numerically investigated in order to provide more reliable scientific and technical information, which has been insufficient for their practical applications to material and environmental industries. In this work, a thermal plasma torch of hollow electrode type is first designed and fabricated, and similarity criteria for predicting operational conditions for the scale-up to high-power torches are derived from the arc voltage characteristics measured with various operating and geometry conditions of the torch. The thermal flow characteristics of air plasma jets ejected from the torch are measured by enthalpy probe diagnostics and turn out to have relatively low temperatures of around 3000-7000 K, but show features of other unique properties, such as high energy flux, broad high temperature region and long plasma jet with moderate axial velocity, which are promising for their applications to material syntheses and hazardous waste treatments. Such high enthalpy at a relatively low temperature of air thermal plasma compared with the argon one is due to the high thermal energy residing in the vibrational and rotational states and oxygen dissociation, besides the translational states in monatomic gases such as argon. It is expected that this high specific enthalpy of the air plasma will enable material and environmental industries to treat a large amount of precursors and waste materials effectively at a lower temperature for a longer residence time by the low plasma velocity. It is also found from the measurements that the turbulence intensity influenced by the size of the electrode diameter has a significant effect on the axial and radial profiles of plasma jet properties and that a longer plasma jet is more readily achievable with a larger electrode diameter reducing the turbulence intensity in the external region of the torch. In
An Implantable Versatile Electrode-Driving ASIC for Chronic Epidural Stimulation in Rats.
Giagka, Vasiliki; Eder, Clemens; Donaldson, Nick; Demosthenous, Andreas
2015-06-01
This paper presents the design and testing of an electrode driving application specific integrated circuit (ASIC) intended for epidural spinal cord electrical stimulation in rats. The ASIC can deliver up to 1 mA fully programmable monophasic or biphasic stimulus current pulses, to 13 electrodes selected in any possible configuration. It also supports interleaved stimulation. Communication is achieved via only 3 wires. The current source and the control of the stimulation timing were kept off-chip to reduce the heat dissipation close to the spinal cord. The ASIC was designed in a 0.18- μm high voltage CMOS process. Its output voltage compliance can be up to 25 V. It features a small core area (ASIC was developed to be suitable for integration on the epidural electrode array, and two different versions were fabricated and electrically tested. Results from both versions were almost indistinguishable. The performance of the system was verified for different loads and stimulation parameters. Its suitability to drive a passive epidural 12-electrode array in saline has also been demonstrated.
A Grid Voltage Measurement Method for Wind Power Systems during Grid Fault Conditions
Directory of Open Access Journals (Sweden)
Cheol-Hee Yoo
2014-11-01
Full Text Available Grid codes in many countries require low-voltage ride-through (LVRT capability to maintain power system stability and reliability during grid fault conditions. To meet the LVRT requirement, wind power systems must stay connected to the grid and also supply reactive currents to the grid to support the recovery from fault voltages. This paper presents a new fault detection method and inverter control scheme to improve the LVRT capability for full-scale permanent magnet synchronous generator (PMSG wind power systems. Fast fault detection can help the wind power systems maintain the DC-link voltage in a safe region. The proposed fault detection method is based on on-line adaptive parameter estimation. The performance of the proposed method is verified in comparison to the conventional voltage measurement method defined in the IEC 61400-21 standard.
Low-energy plasma-cathode electron gun with a perforated emission electrode
Burdovitsin, Victor; Kazakov, Andrey; Medovnik, Alexander; Oks, Efim; Tyunkov, Andrey
2017-11-01
We describe research of influence of the geometric parameters of perforated electrode on emission parameters of a plasma cathode electron gun generating continuous electron beams at gas pressure 5-6 Pa. It is shown, that the emission current increases with increasing the hole diameters and decreasing the thickness of the perforated emission electrode. Plasma-cathode gun with perforated electron can provide electron extraction with an efficiency of up to 72 %. It is shown, that the current-voltage characteristic of the electron gun with a perforated emission electrode differs from that of similar guns with fine mesh grid electrode. The plasma-cathode electron gun with perforated emission electrode is used for electron beam welding and sintering.
Surface effects of electrode-dependent switching behavior of resistive random-access memory
Ke, Jr Jian
2016-09-26
The surface effects of ZnO-based resistive random-access memory (ReRAM) were investigated using various electrodes. Pt electrodes were found to have better performance in terms of the device\\'s switching functionality. A thermodynamic model of the oxygen chemisorption process was proposed to explain this electrode-dependent switching behavior. The temperature-dependent switching voltage demonstrates that the ReRAM devices fabricated with Pt electrodes have a lower activation energy for the chemisorption process, resulting in a better resistive switching performance. These findings provide an in-depth understanding of electrode-dependent switching behaviors and can serve as design guidelines for future ReRAM devices.
Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe
2017-11-01
Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rouxinol, Francisco; Hao, Hugo; Lahaye, Matt
2015-03-01
Quantum electromechanical systems incorporating superconducting qubits have received extensive interest in recent years due to their promising prospects for studying fundamental topics of quantum mechanics such as quantum measurement, entanglement and decoherence in new macroscopic limits, also for their potential as elements in technological applications in quantum information network and weak force detector, to name a few. In this presentation we will discuss ours efforts toward to devise an electromechanical circuit to strongly couple a nanomechanical resonator to a superconductor qubit, where a high voltage dc-bias is required, to study quantum behavior of a mechanical resonator. Preliminary results of our latest generation of devices integrating a superconductor qubit into a high-Q voltage biased microwave cavities are presented. Developments in the circuit design to couple a mechanical resonator to a qubit in the high-Q voltage bias CPW cavity is discussed as well prospects of achieving single-phonon measurement resolution. National Science Foundation under Grant No. DMR-1056423 and Grant No. DMR-1312421.
DEFF Research Database (Denmark)
Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob
2014-01-01
This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...
Zou, Jie; Zheng, Yangong; Li, Junliang; Zhan, Zhongliang; Jian, Jiawen
2015-01-01
Here we report on a new architecture for potentiometric NO2 sensors that features thin 8YSZ electrolytes sandwiched between two porous (La0.8Sr0.2)0.95MnO3 (LSM95) layers—one thick and the other thin—fabricated by the tape casting and co-firing techniques. Measurements of their sensing characteristics show that reducing the porosity of the supporting LSM95 reference electrodes can increase the response voltages. In the meanwhile, thin LSM95 layers perform better than Pt as the sensing electrode since the former can provide higher response voltages and better linear relationship between the sensitivities and the NO2 concentrations over 40–1000 ppm. The best linear coefficient can be as high as 0.99 with a sensitivity value of 52 mV/decade as obtained at 500 °C. Analysis of the sensing mechanism suggests that the gas phase reactions within the porous LSM95 layers are critically important in determining the response voltages. PMID:26205270
Temporary over voltages in the high voltage networks
International Nuclear Information System (INIS)
Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto
2001-01-01
The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)
Tully, Katherine C.; Whitacre, Jay F.; Litster, Shawn
2014-02-01
This paper presents in-situ spatiotemporal measurements of the electrolyte phase potential within an electric double layer capacitor (EDLC) negative electrode as envisaged for use in an aqueous hybrid battery for grid-scale energy storage. The ultra-thick electrodes used in these batteries to reduce non-functional material costs require sufficiently fast through-plane mass and charge transport to attain suitable charging and discharging rates. To better evaluate the through-plane transport, we have developed an electrode scaffold (ES) for making in situ electrolyte potential distribution measurements at discrete known distances across the thickness of an uninterrupted EDLC negative electrode. Using finite difference methods, we calculate local current, volumetric charging current and charge storage distributions from the spatiotemporal electrolyte potential measurements. These potential distributions provide insight into complex phenomena that cannot be directly observed using other existing methods. Herein, we use the distributions to identify areas of the electrode that are underutilized, assess the effects of various parameters on the cumulative charge storage distribution, and evaluate an effectiveness factor for charge storage in EDLC electrodes.
International Nuclear Information System (INIS)
Saito, Yasuyuki; Sugimura, Yoshiro; Sugihara, Michiyuki
1993-01-01
The fabrication process of high current arsenic (As) ion implanted polysilicon (Si) gate and source drain (SD) electrode Si n-channel metal oxide-semiconductor field effect transistor (MOSFET) was examined. Poly Si film n-type doping was performed by using high current (typical current: 2mA) and relatively low acceleration voltage (40keV) As ion implantation technique (Lintott series 3). It was observed that high dose As implanted poly Si films as is show refractoriness against radical fluorine excited by microwave. Using GCA MANN4800 (m/c ID No.2, resist: OFPR) mask pattern printing technique, the high current As ion implantation technique and radical fluorine gas phase etching (Chemical dry etching: CDE) technique, the n-channel Poly Si gate (ρs = ≅100Ω/□) enhancement MQSFETs(ρs source drain = ≅50Ω/□, SiO 2 gate=380 angstrom) with off-leak-less were obtained on 3 inch Czochralski grown 2Ωcm boron doped p type wafers (Osaka titanium). By the same process, a 8 bit single chip μ-processor with 26MHz full operation was performed
International Nuclear Information System (INIS)
Almeida, N A; Cunha, M D; Benilov, M S
2017-01-01
Numerical modelling of near-anode layers in arc discharges in several gases (Ar, Xe and Hg) is performed in a wide range of current densities, anode surface temperatures, and plasma pressures. It is shown that the density of energy flux to the anode is only weakly affected by the anode surface temperature and varies linearly with the current density. This allows one to interpret the results in terms of anode heating voltage (volt equivalent of the heat flux to the anode). The computed data may be useful in different ways. An example considered in this work concerns the evaluation of thermal regime of anodes in the shape of a thin rod operating in the diffuse mode. Invoking the model of nonlinear surface heating for cathodes, one obtains a simple and free of empirical parameters model of thin rod electrodes applicable to dc and ac high-pressure arcs provided that no anode spots are present. The model is applied to a variety of experiments reported in the literature and a good agreement with the experimental data found. (paper)
Measurement of microchannel fluidic resistance with a standard voltage meter.
Godwin, Leah A; Deal, Kennon S; Hoepfner, Lauren D; Jackson, Louis A; Easley, Christopher J
2013-01-03
A simplified method for measuring the fluidic resistance (R(fluidic)) of microfluidic channels is presented, in which the electrical resistance (R(elec)) of a channel filled with a conductivity standard solution can be measured and directly correlated to R(fluidic) using a simple equation. Although a slight correction factor could be applied in this system to improve accuracy, results showed that a standard voltage meter could be used without calibration to determine R(fluidic) to within 12% error. Results accurate to within 2% were obtained when a geometric correction factor was applied using these particular channels. When compared to standard flow rate measurements, such as meniscus tracking in outlet tubing, this approach provided a more straightforward alternative and resulted in lower measurement error. The method was validated using 9 different fluidic resistance values (from ∼40 to 600kPa smm(-3)) and over 30 separately fabricated microfluidic devices. Furthermore, since the method is analogous to resistance measurements with a voltage meter in electrical circuits, dynamic R(fluidic) measurements were possible in more complex microfluidic designs. Microchannel R(elec) was shown to dynamically mimic pressure waveforms applied to a membrane in a variable microfluidic resistor. The variable resistor was then used to dynamically control aqueous-in-oil droplet sizes and spacing, providing a unique and convenient control system for droplet-generating devices. This conductivity-based method for fluidic resistance measurement is thus a useful tool for static or real-time characterization of microfluidic systems. Copyright © 2012 Elsevier B.V. All rights reserved.
Forward voltage short-pulse technique for measuring high power laser array junction temperature
Meadows, Byron L. (Inventor); Amzajerdian, Frazin (Inventor); Barnes, Bruce W. (Inventor); Baker, Nathaniel R. (Inventor)
2012-01-01
The present invention relates to a method of measuring the temperature of the P-N junction within the light-emitting region of a quasi-continuous-wave or pulsed semiconductor laser diode device. A series of relatively short and low current monitor pulses are applied to the laser diode in the period between the main drive current pulses necessary to cause the semiconductor to lase. At the sufficiently low current level of the monitor pulses, the laser diode device does not lase and behaves similar to an electronic diode. The voltage across the laser diode resulting from each of these low current monitor pulses is measured with a high degree of precision. The junction temperature is then determined from the measured junction voltage using their known linear relationship.
Asymmetric Electrodes Constructed with PAN-Based Activated Carbon Fiber in Capacitive Deionization
Directory of Open Access Journals (Sweden)
Mingzhe Li
2014-01-01
Full Text Available Capacitive deionization (CDI method has drawn much attention for its low energy consumption, low pollution, and convenient manipulation. Activated carbon fibers (ACFs possess high adsorption ability and can be used as CDI electrode material. Herein, two kinds of PAN-based ACFs with different specific surface area (SSA were used for the CDI electrodes. The CDI performance was investigated; especially asymmetric electrodes’ effect was evaluated. The results demonstrated that PAN-based ACFs showed a high electrosorption rate (complete electrosorption in less than half an hour and moderate electrosorption capacity (up to 0.2 mmol/g. CDI experiments with asymmetric electrodes displayed a variation in electrosorption capacity between forward voltage and reverse voltage. It can be attributed to the electrical double layer (EDL overlap effect and inner pore potential; thus the ions with smaller hydrated ionic radius can be adsorbed more easily.
Setiawan, T.; Subekti, W. Y.; Nur'Adya, S. S.; Ilmiah, K.; Ulfa, S. M.
2018-01-01
The DSSC prototype using activated carbon (AC) and natural dye from Robusta coffee bean peels have been investigated. The natural dye obtained from the extraction of Robusta coffee bean peels is identified as anthocyanin by UV-Vis spectrophotometer at maximum wavelength 219.5 nm and 720.0 nm in methanol. From the FT-IR analysis, the vibration of O-H observed at 3385 cm-1, C=O at 1618 cm-1, and C-O-C at 1065 cm-1. The counter electrode prepared by calcined the peels at 300°C. Surface analyser of AC showed the larger surface area compared prior activation. The DSSC prototype was prepared using FTO glass (2x2 cm) coated with carbon paste in various thickness. The working electrode is coated with the TiO2 paste. The optimum voltage measured was 395mV (300 μL of CA), 334 mV (200 μL AC), and 254 mV (100 μL AC). From this result, we understand that the thickness of counter electrode influent the voltage of the DSSC.
Vail, III, William B.
1989-01-01
Methods and apparatus are disclosed which allow measurement of the resistivity of a geological formation through borehole casing which may be surrounded by brine saturated cement. A.C. current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. The A.C. voltage difference is measured between two additional vertically disposed electrodes on the interior of the casing which provides a measure of the resistivity of the geological formation. A calibration and nulling procedure is presented which minimizes the influence of variations in the thickness of the casing. The procedure also minimizes the influence of inaccurate placements of the additional vertically disposed electrodes.
Energy Technology Data Exchange (ETDEWEB)
Yang, Qing, E-mail: yangqing@cqu.edu.cn; Yu, Fei; Sima, Wenxia [State Key Laboratory of Power Transmission Equipment & System Security and New Technology, Chongqing University, Shapingba District, Chongqing, 400044 (China); Zahn, Markus [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)
2015-09-15
Transformer oil-based nanofluids (NFs) with 0.03 g/L Fe{sub 3}O{sub 4} nanoparticle content exhibit 11.2% higher positive impulse breakdown voltage levels than pure transformer oils. To study the effects of the Fe{sub 3}O{sub 4} nanoparticles on the space charge in transformer oil and to explain why the nano-modified transformer oil exhibits improved impulse breakdown voltage characteristics, the traditional Kerr electro-optic field mapping technique is improved by increasing the length of the parallel-plate electrodes and by using a photodetector array as a high light sensitivity device. The space charge distributions of pure transformer oil and of NFs containing Fe{sub 3}O{sub 4} nanoparticles can be measured using the improved Kerr electro-optic field mapping technique. Test results indicate a significant reduction in space charge density in the transformer oil-based NFs with the Fe{sub 3}O{sub 4} nanoparticles. The fast electrons are captured by the nanoparticles and are converted into slow-charged particles in the NFs, which then reduce the space charge density and result in a more uniform electric field distribution. Streamer propagation in the NFs is also obstructed, and the breakdown strengths of the NFs under impulse voltage conditions are also improved.
International Nuclear Information System (INIS)
Yang Dezheng; Wang Wenchun; Jia Li; Nie Dongxia; Shi Hengchao
2011-01-01
In this paper, a bidirectional high pulse voltage with 20 ns rising time is employed to generate an atmospheric pressure diffuse dielectric barrier discharge using the array needles-plate electrode configuration. Both double needle and multiple needle electrode configurations nanosecond pulsed dielectric barrier discharges are investigated. It is found that a diffuse discharge plasma with low gas temperature can be obtained, and the plasma volume increases with the increase of the pulse peak voltage, but remains almost constant with the increase of the pulse repetition rate. In addition to showing the potential application on a topographically nonuniform surface treatment of the discharge, the multiple needle-plate electrode configuration with different needle-plate electrode gaps are also employed to generate diffuse discharge plasma.
Williams, Steven E; Linton, Nick; O'Neill, Louisa; Harrison, James; Whitaker, John; Mukherjee, Rahul; Rinaldi, Christopher A; Gill, Jaswinder; Niederer, Steven; Wright, Matthew; O'Neill, Mark
2017-09-01
Bipolar voltage is used during electroanatomic mapping to define abnormal myocardium, but the effect of activation rate on bipolar voltage is not known. We hypothesized that bipolar voltage may change in response to activation rate. By examining corresponding unipolar signals we sought to determine the mechanisms of such changes. LA extrastimulus mapping was performed during CS pacing in 10 patients undergoing first time paroxysmal atrial fibrillation ablation. Bipolar and unipolar electrograms were recorded using a PentaRay catheter (4-4-4 spacing) and indifferent IVC electrode, respectively. An S1S2 pacing protocol was delivered with extrastimulus coupling interval reducing from 350 to 200 milliseconds. At each recording site (119 ± 37 per LA), bipolar peak-to-peak voltage, unipolar peak to peak voltage and activation delay between unipole pairs was measured. Four patterns of bipolar voltage/extrastimulus coupling interval curves were seen: voltage attenuation with plateau voltage >1 mV (48 ± 15%) or voltage unaffected by coupling interval with plateau voltage >1 mV (17 ± 10%) or voltage attenuation were associated with significantly greater unipolar voltage attenuation at low (25 ± 28 mV/s vs. 9 ± 11 mV/s) and high (23 ± 29 mV/s vs. 6 ± 12 mV/s) plateau voltage sites (P voltage attenuation (P = 0.026). Bipolar electrogram voltage is dependent on activation rate at a significant proportion of sites. Changes in unipolar voltage and timing underlie these effects. These observations have important implications for use of voltage mapping to delineate abnormal atrial substrate. © 2017 The Authors. Journal of Cardiovascular Electrophysiology published by Wiley Periodicals, Inc.
Yoo, Juhyun; Yoon, Kwanghee; Lee, Yongwoo; Suh, Sungjae; Kim, Jongsun; Yoo, Chungsik
2000-05-01
Contour-vibration-mode Pb(Sb1/2Nb1/2)O3-Pb(Zr, Ti)O3 [PSN-PZT] piezoelectric transformers with different ring/dot electrode area ratios were fabricated to the size of 27.5× 27.5× 2.5 mm3 by cold isostatic pressing. The electrical properties and characteristic temperature rises caused by the vibration were measured at various load resistances. Efficiencies above 90% with load resistance were obtained from all the transformers. The voltage step-up ratio appeared to be proportional to the dot electrode area. A 14 W fluorescent lamp, T5, was successfully driven by all of the fabricated transformers. The transformer with ring/dot electrode area ratio of 4.85 exhibited the best properties in terms of output power, efficiency and characteristic temperature rise, 14.88 W, 98% and 5°C, respectively.
Effect of electrode geometry on photovoltaic performance of polymer solar cells
International Nuclear Information System (INIS)
Li, Meng; Ma, Heng; Liu, Hairui; Wu, Dongge; Niu, Heying; Cai, Wenjun
2014-01-01
This paper investigates the impact of electrode geometry on the performance of polymer solar cells (PSCs). The negative electrodes with equal area (0.09 cm 2 ) but different shape (round, oval, square and triangular) are evaluated with respect to short-circuit current density, open-circuit voltage, fill factor and power conversion efficiency of PSCs. The results show that the device with round electrodes gives the best photovoltaic performance; in contrast, the device with triangular electrodes reveals the worst properties. A maximum of almost a 19% increase in power conversion efficiency with a round electrode is obtained in the devices compared with that of the triangular electrode. To conclude, the electrode boundary curvature has a significant impact on the performance of PSCs. The larger curvature, i.e. sharper electrodes edges, perhaps has a negative effect on exciton separation and carrier transport in photoelectric conversion processes. (paper)
Facile synthesis of nanostructured transition metal oxides as electrodes for Li-ion batteries
Opra, Denis P.; Gnedenkov, Sergey V.; Sokolov, Alexander A.; Minaev, Alexander N.; Kuryavyi, Valery G.; Sinebryukhov, Sergey L.
2017-09-01
At all times, energy storage is one of the greatest scientific challenge. Recently, Li-ion batteries are under special attention due to high working voltage, long cycle life, low self-discharge, reliability, no-memory effect. However, commercial LIBs usage in medium- and large-scale energy storage are limited by the capacity of lithiated metal oxide cathode and unsafety of graphite anode at high-rate charge. In this way, new electrode materials with higher electrochemical performance should be designed to satisfy a requirement in both energy and power. As it known, nanostructured transition metal oxides are promising electrode materials because of their elevated specific capacity and high potential vs. Li/Li+. In this work, the perspective of an original facile technique of pulsed high-voltage plasma discharge in synthesis of nanostructured transition metal oxides as electrodes for lithium-ion batteries has been demonstrated.
A Voltage Instability Predictor Using Local Area Measurements. VIP++
Energy Technology Data Exchange (ETDEWEB)
Warland, Leif
2002-07-01
There has been a pressure to operate power systems closer to their security limits. This has partially been due to financial imperatives following the deregulating of markets. Other practical difficulties have been obtaining authorization from regulatory bodies to build power plants and transmission lines. In this situation it is essential to monitor the system and to have tools that can predict the distance to the point of collapse (PoC). Much effort has been put into research of the phenomenon voltage collapse, and many approaches have been explored. Both dynamic and steady-state behavior have been studied thoroughly, though very few protection and control schemes have been implemented. In this dissertation the possibility of an index based on local area measurements have been explored. Voltage stability can be classified as either a transient or a long-term stability problem, and the index proposed in this dissertation is based on long-term dynamics. The VIP algorithm is a method that uses the maximum load ability of a transmission network as the PoC, thus by estimating a Thevenin equivalent the method can track the distance to the PoC as this occurs when the two impedances are equal in absolute value. The problem of the VIP algorithm is that it is based on a system with two equations and four unknowns, thus it is not observable. In order to make it observable the assumption of constant Thevenin equivalent between two sets of measurements is made. When this is not the case the method will estimate a Thevenin impedance of the same size as the measured load impedance, but with a negative sign. Changes in the Thevenin equivalent can be traced to both angle variation in a remote generator area or to variations in load impedances on nearby buses. The problem of angle variations can be mitigated by the selection of an appropriate reference bus. A method to solve the second problem, of variation in load admittances, has been proposed in this dissertation and given the
International Nuclear Information System (INIS)
Kugel, H.W.; Okabayashi, M.; Schweitzer, S.
1990-07-01
The Princeton Beta Experiment-Modified (PBX-M) has a close-fitting conducting, passive plate, stabilizing shell which nearly surrounds highly indented, bean-shaped plasmas. The proximity of this electrically isolated shell to a large fraction of the plasma surface allows measurements similar to previous work on other tokamaks using floating probes and limiters. Measurements were performed to characterize the plasma-induced voltages on the PBX-M passive plate stabilizing shell during high-β plasmas. Voltage differences were measured between the respective passive plate toroidal and poloidal gaps, the respective passive plates and the vessel, and an outer poloidal graphite limiter and its passive plate. The calibration and qualification testing procedures are discussed. The initial measurements found that the largest voltages were observed at plasma start-up and at the plasma current disruption and exhibited characteristics depending on operating conditions. The highest voltages observed have been at disruption and were less than 2 kV. 9 refs., 5 figs
A high-DC-voltage GaAs photoemission gun: Transverse emittance and momentum spread measurements
International Nuclear Information System (INIS)
Engwall, D.; Bohn, C.; Cardman, L.
1997-01-01
We have built a high-DC-voltage photoemission gun and a diagnostic beamline permitting us to measure rms transverse emittance (ε x ) and rms momentum spread (δ) of short-duration electron pulses produced by illuminating the cathode with light from a mode-locked, frequency-doubled Nd:YLF laser. The electron gun is a GaAs photocathode source designed to operate at 500kV. We have measured ε x and δ for conditions ranging from emittance-dominated to space-charge-dominated. We report these measurements as functions of microbunch charge for different beam radii, pulse lengths, and voltages/field gradients at the cathode, and compare them with PARMELA calculations
Energy Technology Data Exchange (ETDEWEB)
Poullain, Gilles, E-mail: gilles.poullain@ensicaen.fr; More-Chevalier, Joris; Cibert, Christophe; Bouregba, Rachid
2017-01-15
Tb{sub x}Dy{sub 1−x}Fe{sub 2}/Pt/Pb(Zr{sub x}, Ti{sub 1−x})O{sub 3} thin films were grown on Pt/TiO{sub 2}/SiO{sub 2}/Si substrate by multi-target sputtering. The magnetoelectric voltage coefficient α{sup Η}{sub ΜΕ} was determined at room temperature using a lock-in amplifier. By adding, in series in the circuit, a capacitor of the same value as that of the device under test, we were able to demonstrate that the magnetoelectric device behaves as a voltage source. Furthermore, a simple way to subtract the stray voltage arising from the flow of eddy currents in the measurement set-up, is proposed. This allows the easy and accurate determination of the true magnetoelectric voltage coefficient. A large α{sup Η}{sub ΜΕ} of 8.3 V/cm. Oe was thus obtained for a Terfenol-D/Pt/PZT thin film device, without DC magnetic field nor mechanical resonance. - Highlights: • Magnetoelectric device behaves as a voltage source. • A simple way to subtract eddy currents during the measurement, is proposed.
Three-electrode pulse electron gun with currents up to 250 A
International Nuclear Information System (INIS)
Grigor'ev, Yu.V.; Shanturin, L.P.
1977-01-01
The design and operating conditions of a pulsed electron gun are described. The electron gun has three electrodes: a cathode, an anode and a control electrode in the form of a grid. The cathode is made from lanthanum hexaboride, which ensures its operation in a low vacuum at a temperature of 1,700 deg C. The control electrode and anode grid are fabricated from sheet tantalum. The anode-grid characteristics of the gun are given. It is shown that at an accelerating voltage of 100 kV, a temperature of 1,700 deg C and a zero control electrode potential the beam current is 250 A
International Nuclear Information System (INIS)
Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M
2010-01-01
This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.
Mason’s equation application for prediction of voltage of oil shale treeing breakdown
Martemyanov, S. M.
2017-05-01
The application of the formula, which is used to calculate the maximum field at the tip of the pin-plane electrode system was proposed to describe the process of electrical treeing and treeing breakdown in an oil shale. An analytical expression for the calculation of the treeing breakdown voltage in the oil shale, as a function of the inter-electrode distance, was taken. A high accuracy of the correspondence of the model to the experimental data in the range of inter-electrode distances from 0.03 to 0.5 m was taken.
Baylam, Isinsu; Balci, Osman; Kakenov, Nurbek; Kocabas, Coskun; Sennaroglu, Alphan
2016-03-01
We report, for the first time to the best of our knowledge, use of a graphene-gold supercapacitor as a voltage controlled fast saturable absorber for femtosecond pulse generation. The unique design involving only one graphene electrode lowers the insertion loss of the device, in comparison with capacitor designs with two graphene electrodes. Furthermore, use of the high-dielectric electrolyte allows reversible, adjustable control of the absorption level up to the visible region with low bias voltages of only a few volts (0-2 V). The fast saturable absorber action of the graphene-gold supercapacitor was demonstrated inside a multipass-cavity Cr:forsterite laser to generate nearly transform-limited, sub-100 fs pulses at a pulse repetition rate of 4.51 MHz at 1.24 μm.
International Nuclear Information System (INIS)
Hyvönen, N; Majander, H; Staboulis, S
2017-01-01
Electrical impedance tomography aims at reconstructing the conductivity inside a physical body from boundary measurements of current and voltage at a finite number of contact electrodes. In many practical applications, the shape of the imaged object is subject to considerable uncertainties that render reconstructing the internal conductivity impossible if they are not taken into account. This work numerically demonstrates that one can compensate for inaccurate modeling of the object boundary in two spatial dimensions by finding compatible locations and sizes for the electrodes as a part of a reconstruction algorithm. The numerical studies, which are based on both simulated and experimental data, are complemented by proving that the employed complete electrode model is approximately conformally invariant, which suggests that the obtained reconstructions in mismodeled domains reflect conformal images of the true targets. The numerical experiments also confirm that a similar approach does not, in general, lead to a functional algorithm in three dimensions. (paper)
Ghosh, Meena; Vijayakumar, Vidyanand; Soni, Roby; Kurungot, Sreekumar
2018-05-10
The maximum capacitive potential window of certain pseudocapacitive materials cannot be accessed in aqueous electrolytes owing to the low dissociation potential of 1.2 V possessed by water molecules. However, the inferior pseudocapacitance exhibited by the commonly used electrode materials when integrated with non-aqueous electrolytes still remains a challenge in the development of supercapacitors (SC). Proper selection of materials for the electrode and a rational design process are indeed important to overcome these practical intricacies so that such systems can perform well with non-aqueous electrolytes. We address this challenge by fabricating a prototype all-solid-state device designed with high-capacitive V2O5 as the electrode material along with a Li-ion conducting organic electrolyte. V2O5 is synthesized on a pre-treated carbon-fibre paper by adopting an electrochemical deposition technique that effects an improved contact resistance. A judicious electrode preparation strategy makes it possible to overcome the constraints of the low ionic and electrical conductivities imposed by the electrolyte and electrode material, respectively. The device, assembled in a symmetrical fashion, achieves a high specific capacitance of 406 F g-1 (at 1 A g-1). The profitable aspect of using an organic electrolyte is also demonstrated with an asymmetric configuration by using activated carbon as the positive and V2O5 as the negative electrode materials, respectively. The asymmetric device displays a wide working-voltage window of 2.8 V and delivers a high energy density of 102.68 W h kg-1 at a power density of 1.49 kW kg-1. Moreover, the low equivalent series resistance of 9.9 Ω and negligible charge transfer resistance are observed in the impedance spectra, which is a key factor that accounts for such an exemplary performance.
Study on Carbon Nano composite Counter electrode for Dye-Sensitized Solar Cells
International Nuclear Information System (INIS)
Chen, Y.; Zhang, H.; Lin, J.
2012-01-01
Carbon nano composite electrodes were prepared by adding carbon nano tubes (CNTs) into carbon black as counter electrodes of dye-sensitized solar cells (DSSCs). The morphology and structure of carbon nano composite electrodes were studied by scanning electron microscopy. The influence of CNTs on the electrochemical performance of carbon nano composite electrodes is investigated by cyclic voltammetry and electrochemical impedance spectroscopy. Carbon nano composite electrodes with CNTs exhibit a highly interconnected network structure with high electrical conductivity and good catalytic activity. The influence of different CNTs content in carbon nano composite electrodes on the open-circuit voltage, short-circuit current, and filling factor of DSSCs is also investigated. DSSCs with 10% CNTs content exhibit the best photovoltaic performance in our experiments.
Directory of Open Access Journals (Sweden)
M. Stewart
2015-02-01
Full Text Available The determination of the piezoelectric coefficient of thin films using interferometry is hindered by bending contributions. Using finite element analysis (FEA simulations, we show that the Lefki and Dormans approximations using either single or double-beam measurements cannot be used with finite top electrode sizes. We introduce a novel method for characterising piezoelectric thin films which uses a differential measurement over the discontinuity at the electrode edge as an internal reference, thereby eliminating bending contributions. This step height is shown to be electrode size and boundary condition independent. An analytical expression is derived which gives good agreement with FEA predictions of the step height.
Voltage-controlled colour-tunable microcavity OLEDs with enhanced colour purity
International Nuclear Information System (INIS)
Choy, Wallace C H; Niu, J H; Li, W L; Chui, P C
2008-01-01
The emission spectrum of single-unit voltage-controlled colour-tunable organic light emitting devices (OLEDs) has been theoretically and experimentally studied. Our results show that by introducing the microcavity structure, the colour purity of not only the destination colour but also the colour-tunable route can be enhanced, while colour purity is still an issue in typical single-unit voltage-controlled colour-tunable OLEDs. With the consideration of the periodical cycling of resonant wavelength and absorption loss of the metal electrodes, the appropriate change in the thickness of the microcavity structure has been utilized to achieve voltage-controlled red-to-green and red-to-blue colour-tunable OLEDs without adding dyes or other organic materials to the OLEDs
HF-voltage testing of accelerating system functional model
International Nuclear Information System (INIS)
Gladkov, A.V.; Stepanov, V.B.
1989-01-01
Owing to ambiguity in interpreting the notion of the electron strength of the operating HF device in an acceleator a technique of measurements and result processing, based on statistical analysis of the data is suggested. Experimental testing on electric strength of structures with HF focusing was carried out using a bench in the form of a cylindrical vacuum container inside which a double H-resonator with HF quadrupole electrodes without surface modulation was installed. The dependences obtained permit to evaluate the bahaviour of the HF device from the viewpoint of electric strength and radiation hazard for the whole range of possible values of voltage on the basis of data on the frequency of breakdowns and radiation situation only in one experimental point. 12 refs.; 8 figs
Electrospinning of aligned fibers with adjustable orientation using auxiliary electrodes
International Nuclear Information System (INIS)
Arras, Matthias M L; Grasl, Christian; Schima, Heinrich; Bergmeister, Helga
2012-01-01
A conventional electrospinning setup was upgraded by two turnable plate-like auxiliary high-voltage electrodes that allowed aligned fiber deposition in adjustable directions. Fiber morphology was analyzed by scanning electron microscopy and attenuated total reflection Fourier transform infrared spectroscopy (FTIR-ATR). The auxiliary electric field constrained the jet bending instability and the fiber deposition became controllable. At target speeds of 0.9 m s −1 90% of the fibers had aligned within 2°, whereas the angular spread was 70° without the use of auxiliary electrodes. It was even possible to orient fibers perpendicular to the rotational direction of the target. The fiber diameter became smaller and its distribution narrower, while according to the FTIR-ATR measurement the molecular orientation of the polymer was unaltered. This study comprehensively documents the feasibility of directed fiber deposition and offers an easy upgrade to existing electrospinning setups. (paper)
Bioelectric Signal Measuring System
Guadarrama-Santana, A.; Pólo-Parada, L.; García-Valenzuela, A.
2015-01-01
We describe a low noise measuring system based on interdigitated electrodes for sensing bioelectrical signals. The system registers differential voltage measurements in order of microvolts. The base noise during measurements was in nanovolts and thus, the sensing signals presented a very good signal to noise ratio. An excitation voltage of 1Vrms with 10 KHz frequency was applied to an interdigitated capacitive sensor without a material under test and to a mirror device simultaneously. The output signals of both devices was then subtracted in order to obtain an initial reference value near cero volts and reduce parasitic capacitances due to the electronics, wiring and system hardware as well. The response of the measuring system was characterized by monitoring temporal bioelectrical signals in real time of biological materials such as embryo chicken heart cells and bovine suprarenal gland cells.
Flexible powder electroluminescent device on silver nanowire electrode
International Nuclear Information System (INIS)
Park, K.W.; Jeong, H.S.; Park, J.H.; Deressa, G.; Jeong, Y.T.; Lim, K.T.; Park, J.H.; Lee, S.H.; Kim, J.S.
2015-01-01
We have demonstrated the flexible AC powder electroluminescent device based on Ag nanowire electrode. The Ag nanowire electrode showed the nanowire morphology of 20 nm in diameter and 15 μm in length, the transmittance of 87%, and the sheet resistance of 50 Ω/sq, and the higher flexibility than the conventional ITO substrate. The electroluminescence spectra of the Ag nanowire-based device in all frequency and voltage ranges were almost similar with the ITO-based device. In comparison with the ITO-based device, the luminous efficiency of the Ag nanowire-based device was almost same as 1.53 lm/W. - Highlights: • Flexibility of Ag NW substrate was higher than ITO substrate. • EL intensity of Ag NW-based EL device was almost similar with ITO-based EL device. • Charge density and turn-on voltage of Ag NW-based EL device were a little larger than ITO-based EL device
Flexible powder electroluminescent device on silver nanowire electrode
Energy Technology Data Exchange (ETDEWEB)
Park, K.W.; Jeong, H.S.; Park, J.H.; Deressa, G.; Jeong, Y.T.; Lim, K.T. [Department of Display Science and Engineering, Pukyong National University, Busan 608-737 (Korea, Republic of); Park, J.H. [AIDEN company, Cheongju-si 361-911 (Korea, Republic of); Lee, S.H. [R& D Business Lab, Hyosung Corporation, Anyang 431-080 (Korea, Republic of); Kim, J.S., E-mail: jsukim@pknu.ac.kr [Department of Display Science and Engineering, Pukyong National University, Busan 608-737 (Korea, Republic of)
2015-09-15
We have demonstrated the flexible AC powder electroluminescent device based on Ag nanowire electrode. The Ag nanowire electrode showed the nanowire morphology of 20 nm in diameter and 15 μm in length, the transmittance of 87%, and the sheet resistance of 50 Ω/sq, and the higher flexibility than the conventional ITO substrate. The electroluminescence spectra of the Ag nanowire-based device in all frequency and voltage ranges were almost similar with the ITO-based device. In comparison with the ITO-based device, the luminous efficiency of the Ag nanowire-based device was almost same as 1.53 lm/W. - Highlights: • Flexibility of Ag NW substrate was higher than ITO substrate. • EL intensity of Ag NW-based EL device was almost similar with ITO-based EL device. • Charge density and turn-on voltage of Ag NW-based EL device were a little larger than ITO-based EL device.
Bias voltage induced resistance switching effect in single-molecule magnets’ tunneling junction
Zhang, Zhengzhong; Jiang, Liang
2014-09-01
An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be ‘read out’ by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.
Bias voltage induced resistance switching effect in single-molecule magnets' tunneling junction.
Zhang, Zhengzhong; Jiang, Liang
2014-09-12
An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be 'read out' by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Low-profile high-voltage compact gas switch
International Nuclear Information System (INIS)
Goerz, D.A.; Wilson, M.J.; Speer, R.D.
1997-01-01
This paper discusses the development and testing of a low-profile, high-voltage, spark-gap switch designed to be closely coupled with other components into an integrated high-energy pulsed-power source. The switch is designed to operate at 100 kV using SF6 gas pressurized to less than 0.7 MPa. The volume of the switch cavity region is less than 1.5 cm3, and the field stress along the gas-dielectric interface is as high as 130 kV/cm. The dielectric switch body has a low profile that is only I -cm tall at its greatest extent and nominally 2-mm thick over most of its area. This design achieves a very low inductance of less than 5 nH, but results in field stresses exceeding 500 kV/cm in the dielectric material. Field modeling was done to determine the appropriate shape for the highly stressed insulator and electrodes, and special manufacturing techniques were employed to mitigate the usual mechanisms that induce breakdown and failure in solid dielectrics. Static breakdown tests verified that the switch operates satisfactorily at 100 kV levels. The unit has been characterized with different shaped electrodes having nominal gap spacings of 2.0, 2.5, and 3.0 mm. The relationship between self-break voltage and operating pressure agrees well with published data on gas properties, accounting for the field enhancements of the electrode shapes being used. Capacitor discharge tests in a low inductance test fixture exhibited peak currents up to 25 kA with characteristic frequencies of the ringdown circuit ranging from 10 to 20 MHz. The ringdown waveforms and scaling of measured parameters agree well with circuit modeling of the switch and test fixture. Repetitive operation has been demonstrated at moderate rep-rates up to 15 Hz, limited by the power supply being used. Preliminary tests to evaluate lifetime of the compact switch assembly have been encouraging. In one case, after more than 7,000 high-current ringdown tests with approximately 30 C of total charge transferred, the
Munteshari, Obaidallah; Lau, Jonathan; Krishnan, Atindra; Dunn, Bruce; Pilon, Laurent
2018-01-01
Heat generation in electric double layer capacitors (EDLCs) may lead to temperature rise and reduce their lifetime and performance. This study aims to measure the time-dependent heat generation rate in individual carbon electrode of EDLCs under various charging conditions. First, the design, fabrication, and validation of an isothermal calorimeter are presented. The calorimeter consisted of two thermoelectric heat flux sensors connected to a data acquisition system, two identical and cold plates fed with a circulating coolant, and an electrochemical test section connected to a potentiostat/galvanostat system. The EDLC cells consisted of two identical activated carbon electrodes and a separator immersed in an electrolyte. Measurements were performed on three cells with different electrolytes under galvanostatic cycling for different current density and polarity. The measured time-averaged irreversible heat generation rate was in excellent agreement with predictions for Joule heating. The reversible heat generation rate in the positive electrode was exothermic during charging and endothermic during discharging. By contrast, the negative electrode featured both exothermic and endothermic heat generation during both charging and discharging. The results of this study can be used to validate existing thermal models, to develop thermal management strategies, and to gain insight into physicochemical phenomena taking place during operation.
Zhang, Y. A.; Lin, C. F.; Lin, J. P.; Zeng, X. Y.; Yan, Q.; Zhou, X. T.; Guo, T. L.
2018-04-01
Electric-field-driven liquid crystal (ELC) lens with tunable focal length and their depth of field has been extensively applied in 3D display and imaging systems. In this work, a dual-layer electrode-driven liquid crystal (DELC) lens with electrically tunable focal length and controllable focal plane is demonstrated. ITO-SiO2-AZO electrodes with the dual-layer staggered structure on the top substrate are used as driven electrodes within a LC cell, which permits the establishment of an alternative controllability. The focal length of the DELC lens can be adjusted from 1.41 cm to 0.29 cm when the operating voltage changes from 15 V to 40 V. Furthermore, the focal plane of the DELC lens can selectively move by changing the driving method of the applied voltage to the next driven electrodes. This work demonstrates that the DELC lens has potential applications in imaging systems because of electrically tunable focal length and controllable focal plane.
Experimental study on the influence of radiation on high-voltage insulation gases
International Nuclear Information System (INIS)
Fujiwara, Yukio; Inoue, Takashi; Miyamoto, Kenji; Miyamoto, Naoki; Ohara, Yoshihiro; Okumura, Yoshikazu; Watanabe, Kazuhiro
1999-12-01
In a neutral beam injection (NBI) system for next generation tokamaks such as International Thermonuclear Experimental Reactor (ITER), insulation gas around a beam source will be irradiated with neutrons and gamma rays from the reactor. It is necessary to evaluate the influence of the radiation on the insulation gas for the engineering design of the ITER-NBI system. In the present paper, the influence of the 60 Co gamma rays on air, SF 6 , C 2 F 6 , CO 2 , and mixing gas of air and SF 6 was studied. Ionization current and voltage-holding characteristics of the gases were measured for an absorbed dose rate of 0.45 Gy/s using parallel disk electrodes whose diameter is 130 mm. Saturation current proved to increase linearly with a gap length between the electrodes, gas pressure, an absorbed dose rate, and molecular weight of the gases. Voltage-holding capability was degraded by about 10 %; the degree of the degradation did not depend on the absorbed dose rate. Dissociative products of SF 6 by the irradiation were also analyzed with a quadrupole mass spectrometer. News peaks that did not exist before irradiation appeared at the m/e of 48, 64, 67, 83, 86, 102, and 105 after irradiation. The amount of the dissociative products turned out to be saturated at a higher absorbed dose. (author)
Directory of Open Access Journals (Sweden)
M. I. Baranov
2017-06-01
Full Text Available Purpose. To obtain new calculation correlations, determining approximate energy dissipation and electric erosion of massive basic metallic electrodes in the high-voltage high-current air switchboard (HVCAS of atmospheric pressure, in-use in the bit chain of the high-voltage electrophysics setting (HVES with the powerful capacity store of energy (CSE. Methodology. Electrophysics bases of technique of high-voltage and large impulsive currents (LIC, scientific and technical bases of development and planning of high-voltage heavy-current impulsive electro-devices, including HVES and powerful CSE, and also methods of measuring in their bit chains of LIC of the microsecond temporal range. Results. On the basis of new engineering approach the results of calculation estimation of excretions energy and electric erosion of massive basic metallic electrodes are resulted in probed HVCAS. New correlations are obtained for the approximate calculation of thermal energy, selected in an impulsive air spark and on the workings surfaces of anode and cathode of HVCAS. It is entered and a new electrophysics concept, touching equivalent active resistance of impulsive air spark, is mathematically certain. New formulas are obtained for the approximate calculation of most depth of single round crater of destruction on the workings surfaces of basic metallic electrodes of HVCAS, and also mass of metal, thrown out magnetic pressure from this crater of destruction on the electrodes of switch for one electric discharge through them powerful CSE HVES. It is shown that the radius of the indicated single crater of destruction is approximately equal to the maximal radius of plasma channel of a spark discharge between a cathode and anode of HVCAS. The executed high-current experiments in the bit chain of HVES with powerful CSE validated row of the got and in-use calculation correlations for the estimation of energy dissipation and electric erosion of metallic electrodes in
International Nuclear Information System (INIS)
Sise, O.; Martínez, G.; Madesis, I.; Laoutaris, A.; Dimitriou, A.; Fernández-Martín, M.; Zouros, T.J.M.
2016-01-01
Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics
Energy Technology Data Exchange (ETDEWEB)
Sise, O., E-mail: omersise@sdu.edu.tr [Department of Science Education, Faculty of Education, Suleyman Demirel University, 32260 Isparta (Turkey); Martínez, G. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Madesis, I. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Laoutaris, A. [Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Department of Applied Physics, National Technical University of Athens, GR, 15780 Athens (Greece); Dimitriou, A. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Fernández-Martín, M. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Zouros, T.J.M. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece)
2016-08-15
Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics
Quantitative nanoscale surface voltage measurement on organic semiconductor blends
International Nuclear Information System (INIS)
Cuenat, Alexandre; Muñiz-Piniella, Andrés; Muñoz-Rojo, Miguel; Murphy, Craig E; Tsoi, Wing C
2012-01-01
We report on the validation of a method based on Kelvin probe force microscopy (KPFM) able to measure the different phases and the relative work function of polymer blend heterojunctions at the nanoscale. The method does not necessitate complex ultra-high vacuum setup. The quantitative information that can be extracted from the topography and the Kelvin probe measurements is critically analysed. Surface voltage difference can be observed at the nanoscale on poly(3-hexyl-thiophene):[6,6]-phenyl-C61-butyric acid methyl ester (P3HT:PCBM) blends and dependence on the annealing condition and the regio-regularity of P3HT is observed. (paper)
Bonvicini, V; D'Acunto, L; Franck, D; Gregorio, A; Pihet, P; Rashevsky, A; Vacchi, A; Vinogradov, L I; Zampa, N
2000-01-01
A silicon drift detector (SDD) prototype where the drift electrode also plays the role of a high-voltage divider has been realised and characterised for spectroscopic applications at near-room temperatures. Among the advantages of this design, is the absence of metal on the sensitive surface which makes this detector interesting for soft X-rays. The detector prototype has a large sensitive area (2x130 mm sup 2) and the charge is collected by two anodes (butterfly-like detector). The energy resolution of a such a detector has been investigated at near-room temperatures using a commercial, hybrid, low-noise charge-sensitive preamplifier. The results obtained for the X-ray lines from sup 5 sup 5 Fe and sup 2 sup 4 sup 1 Am are presented.
Heat dissipation computations of a HVDC ground electrode using a supercomputer
International Nuclear Information System (INIS)
Greiss, H.; Mukhedkar, D.; Lagace, P.J.
1990-01-01
This paper reports on the temperature, of soil surrounding a High Voltage Direct Current (HVDC) toroidal ground electrode of practical dimensions, in both homogeneous and non-homogeneous soils that was computed at incremental points in time using finite difference methods on a supercomputer. Curves of the response were computed and plotted at several locations within the soil in the vicinity of the ground electrode for various values of the soil parameters
An, Yanbin; Shekhawat, Aniruddh; Behnam, Ashkan; Pop, Eric; Ural, Ant
2016-11-01
Metal-oxide-semiconductor (MOS) devices with graphene as the metal gate electrode, silicon dioxide with thicknesses ranging from 5 to 20 nm as the dielectric, and p-type silicon as the semiconductor are fabricated and characterized. It is found that Fowler-Nordheim (F-N) tunneling dominates the gate tunneling current in these devices for oxide thicknesses of 10 nm and larger, whereas for devices with 5 nm oxide, direct tunneling starts to play a role in determining the total gate current. Furthermore, the temperature dependences of the F-N tunneling current for the 10 nm devices are characterized in the temperature range 77-300 K. The F-N coefficients and the effective tunneling barrier height are extracted as a function of temperature. It is found that the effective barrier height decreases with increasing temperature, which is in agreement with the results previously reported for conventional MOS devices with polysilicon or metal gate electrodes. In addition, high frequency capacitance-voltage measurements of these MOS devices are performed, which depict a local capacitance minimum under accumulation for thin oxides. By analyzing the data using numerical calculations based on the modified density of states of graphene in the presence of charged impurities, it is shown that this local minimum is due to the contribution of the quantum capacitance of graphene. Finally, the workfunction of the graphene gate electrode is extracted by determining the flat-band voltage as a function of oxide thickness. These results show that graphene is a promising candidate as the gate electrode in metal-oxide-semiconductor devices.
Water-activated graphite felt as a high-performance electrode for vanadium redox flow batteries
Kabtamu, Daniel Manaye; Chen, Jian-Yu; Chang, Yu-Chung; Wang, Chen-Hao
2017-02-01
A simple, green, novel, time-efficient, and potentially cost-effective water activation method was employed to enhance the electrochemical activity of graphite felt (GF) electrodes for vanadium redox flow batteries (VRFBs). The GF electrode prepared with a water vapor injection time of 5 min at 700 °C exhibits the highest electrochemical activity for the VO2+/VO2+ couple among all the tested electrodes. This is attributed to the small, controlled amount of water vapor that was introduced producing high contents of oxygen-containing functional groups, such as sbnd OH groups, on the surface of the GF fibers, which are known to be electrochemically active sites for vanadium redox reactions. Charge-discharge tests further confirm that only 5 min of GF water activation is required to improve the efficiency of the VRFB cell. The average coulombic efficiency, voltage efficiency, and energy efficiency are 95.06%, 87.42%, and 83.10%, respectively, at a current density of 50 mA cm-2. These voltage and energy efficiencies are determined to be considerably higher than those of VRFB cells assembled using heat-treated GF electrodes without water activation and pristine GF electrodes.
Li, Mengya; Westover, Andrew S; Carter, Rachel; Oakes, Landon; Muralidharan, Nitin; Boire, Timothy C; Sung, Hak-Joon; Pint, Cary L
2016-08-03
A key parameter in the operation of an electrochemical double-layer capacitor is the voltage window, which dictates the device energy density and power density. Here we demonstrate experimental evidence that π-π stacking at a carbon-ionic liquid interface can modify the operation voltage of a supercapacitor device by up to 30%, and this can be recovered by steric hindrance at the electrode-electrolyte interface introduced by poly(ethylene oxide) polymer electrolyte additives. This observation is supported by Raman spectroscopy, electrochemical impedance spectroscopy, and differential scanning calorimetry that each independently elucidates the signature of π-π stacking between imidazole groups in the ionic liquid and the carbon surface and the role this plays to lower the energy barrier for charge transfer at the electrode-electrolyte interface. This effect is further observed universally across two separate ionic liquid electrolyte systems and is validated by control experiments showing an invariant electrochemical window in the absence of a carbon-ionic liquid electrode-electrolyte interface. As interfacial or noncovalent interactions are usually neglected in the mechanistic picture of double-layer capacitors, this work highlights the importance of understanding chemical properties at supercapacitor interfaces to engineer voltage and energy capability.
ELECTROCHEMICAL DECHLORINATION OF TRICHLOROETHYLENE USING GRANULAR-GRAPHITE ELECTRODES
Electrochemical dechlorination of TCE was conducted in a glass column using granular graphite as electrodes. A constant voltage of 15 volt was applied resulting in 60-62 mA of current. Approximately 4-6% of the TCE was dechlorinated. Among the reduced TCE, more than 95% was compl...
International Nuclear Information System (INIS)
Yang, Gui-Fu; Joo, Seung-Ki
2015-01-01
High surface area and a three dimensional NiCrAl alloy foam current collector was used for two kinds of thick lithium iron phosphate electrodes. One kind of electrodes were compressed after the slurry of active material in the metal foam was dried and then annealed at 140 °C for half a day whereas the other kind of electrodes were prepared without pressing. When the addition of carbon black was 4 wt% for the two kinds of electrodes, a charge-discharge test revealed that the capacity of the cell using the pressed electrode faded much more although the voltage-drop was much smaller at the plateau region. For example, the capacity of the pressed electrode exhibited 85 mA h g −1 , while it was 135 mA h g −1 for the unpressed electrode although the voltage-drop at the plateau region was 250 mV higher at 0.5C-rate for the unpressed electrode. The AC impedance analysis showed that the charge transfer resistance of the pressed electrode was only 15 Ω whereas it was 4 times higher for the unpressed electrode. The results illustrated that the effective redox area was much larger for the unpressed electrode since the cell using the unpressed electrode exhibited much higher capacity even at the condition of poor electronic conductivity. To solve the low electronic conductivity issue for the unpressed electrode, the addition of carbon black was further increased to 14 wt% and as a result, there was almost no difference in voltage drop at plateau region or charge transfer resistance between the two kinds of electrodes. Obviously, the capacity of unpressed electrode exhibited much higher at higher current rate due to the larger effective redox area
Song, Seung Min; Park, Jong Kyung; Sul, One Jae; Cho, Byung Jin
2012-08-08
Although the work function of graphene under a given metal electrode is critical information for the realization of high-performance graphene-based electronic devices, relatively little relevant research has been carried out to date. In this work, the work function values of graphene under various metals are accurately measured for the first time through a detailed analysis of the capacitance-voltage (C-V) characteristics of a metal-graphene-oxide-semiconductor (MGOS) capacitor structure. In contrast to the high work function of exposed graphene of 4.89-5.16 eV, the work function of graphene under a metal electrode varies depending on the metal species. With a Cr/Au or Ni contact, the work function of graphene is pinned to that of the contacted metal, whereas with a Pd or Au contact the work function assumes a value of ∼4.62 eV regardless of the work function of the contact metal. A study of the gate voltage dependence on the contact resistance shows that the latter case provides lower contact resistance.
An active electrode for biopotential recording from small localized bio-sources
Directory of Open Access Journals (Sweden)
Pallikarakis Nicolas E
2004-07-01
forearm. The peak-to-peak noise voltage measured at the amplifier output, with input terminals connected to common, was 10 mVp-p, or 2 μVp-p referred to the input. The common-mode rejection ratio of the amplifier was 96 dB at 50 Hz, measured with imbalanced electrodes' impedances. The prototype was also tested practically and sample records were obtained after a low intensity SLB laser stimulation. All measurements showed almost a complete absence of 50 Hz interference, although no electrolyte gel or skin preparation was applied. Conclusion The results showed that the new active electrode presented significantly reduced the electrode-skin impedance, its variation and motion artifact influences. This allowed SLB signals with relatively high quality to be recorded without skin preparation. The design offers low noise and major reduction in parts, size and power consumption. The active electrode specifications were found to be better or at least comparable to those of other existing designs.
Discharge Characteristics of the Nickel Hydroxide Electrode in 30% KOH
International Nuclear Information System (INIS)
Kim, Young Jin
1989-01-01
The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH at 25 .deg. C. Two voltage plateaus are displayed on the discharge curve of C/20. It is shown that the impedance of the nickel hydroxide electrode increases with decrease of the discharge potential. The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH indicating the reduction of the β-NiOOH to the β-Ni(OH) 2 by proton diffusion process and hence the electronic conductivity change of the nickel hydroxide electrode. Furthermore, the γ-NiOOH, produced by prolonged oxidation of the β-NiOOH in 30% KOH, discharges at a slightly lower potential than the β-Ni(OH) 2 that could result in the life-limiting factor of several alkaline electrolyte storage batteries using the nickel hydroxide electrode as the positive plate
International Nuclear Information System (INIS)
Moreau, Eric; Sosa, Roberto; Artana, Guillermo
2008-01-01
Active flow control is a rapidly developing topic because the associated industrial applications are of immense importance, particularly for aeronautics. Among all the flow control methods, such as the use of mechanical flaps or wall jets, plasma-based devices are very promising devices. The main advantages of such systems are their robustness, their simplicity, their low-power consumption and that they allow a real-time control at high frequency. This paper deals with an experimental study about the electric wind produced by a surface discharge based on a three-electrode geometry. This new device is composed of a typical two-electrode surface barrier discharge excited by an AC high voltage, plus a third electrode at which a DC high voltage is applied in order to extend the discharge region and to accelerate the ion drift velocity. In the first part the electrical current of these different surface discharges is presented and discussed. This shows that the current behaviour depends on the DC component polarity. The second part is dedicated to analysing the electric wind characteristics through Schlieren visualizations and to measuring its time-averaged velocity with a Pitot tube sensor. The results show that an excitation of the electrodes with an AC voltage plus a positive DC component can significantly modify the topology of the electric wind produced by a single DBD. In practice, this DC component allows us to increase the value of the maximum induced velocity (up to +150% at a few centimetres downstream of the discharge) and the plasma extension, to enhance the depression occurring above the discharge region and to increase the discharge-induced mass flow rate (up to +100%), without increasing the electrical power consumption
International Nuclear Information System (INIS)
Wang, W.H.; Wang, X.D.
2007-01-01
Porous graphite felts have been used as electrode materials for all-vanadium redox flow batteries due to their wide operating potential range, stability as both an anode and a cathode, and availability in high surface area. In this paper, the carbon felt was modified by pyrolysis of Ir reduced from H 2 IrCl 6 . ac impedance and steady-state polarization measurements showed that the Ir-modified materials have improved activity and lowered overpotential of the desired V(IV)/V(V) redox process. Ir-modification of carbon felt enhanced the electro-conductivity of electrode materials. The Ir-material, when coated on the graphite felt electrode surface, lowered the cell internal resistance. A test cell was assembled with the Ir-modified carbon felt as the activation layer of the positive electrode, the unmodified raw felt as the activation layer of the negative electrode. At an operating current density of 20 mA cm -2 , a voltage efficiency of 87.5% was achieved. The resistance of the cell using Ir-modified felt decreased 25% compared to the cell using non-modified felt
Influence of electrode, buffer gas and control gear on metal halide lamp performance
International Nuclear Information System (INIS)
Lamouri, A; Naruka, A; Sulcs, J; Varanasi, C V; Brumleve, T R
2005-01-01
In this paper the influence of electrode composition, buffer gas fill pressure and control gear on the performance of metal halide lamps is investigated. It is shown that pure tungsten electrodes improve lumen maintenance and reduce voltage rise over lamp life. An optimum buffer gas fill pressure condition is discovered which allows for reduced electrode erosion during lamp starting as well as under normal operating conditions. Use of electronic control gear is shown to improve the performance of metal halide lamps
A high-performance supercapacitor electrode based on N-doped porous graphene
Dai, Shuge; Liu, Zhen; Zhao, Bote; Zeng, Jianhuang; Hu, Hao; Zhang, Qiaobao; Chen, Dongchang; Qu, Chong; Dang, Dai; Liu, Meilin
2018-05-01
The development of high-performance supercapacitors (SCs) often faces some contradictory and competing requirements such as excellent rate capability, long cycling life, and high energy density. One effective strategy is to explore electrode materials of high capacitance, electrode architectures of fast charge and mass transfer, and electrolytes of wide voltage window. Here we report a facile and readily scalable strategy to produce high-performance N-doped graphene with a high specific capacitance (∼390 F g-1). A symmetric SC device with a wide voltage window of 3.5 V is also successfully fabricated based on the N-doped graphene electrode. More importantly, the as-assembled symmetric SC delivers a high energy density of 55 Wh kg-1 at a power density of 1800 W kg-1 while maintaining superior cycling life (retaining 96.6% of the initial capacitance after 20,000 cycles). Even at a power density as high as 8800 W kg-1, it still retains an energy density of 29 Wh kg-1, higher than those of previously reported graphene-based symmetric SCs.
Asymmetric electrochemical supercapacitor, based on polypyrrole coated carbon nanotube electrodes
International Nuclear Information System (INIS)
Su, Y.; Zhitomirsky, I.
2015-01-01
Highlights: • Polypyrrole (PPy) coated multiwalled carbon nanotubes (MWCNT) were prepared. • New method is based on the use of new electrochemically active dopants for PPy. • The dopans provided dispersion of MWCNT and promoted PPy coating formation. • Symmetric PPy–MWCNT supercapacitors showed high capacitance and low resistance. • Asymmetric PPy–MWCNT/VN–MWCNT devices and modules allowed larger voltage window. - Abstract: Conductive polypyrrole (PPy) polymer – multiwalled carbon nanotubes (MWCNT) composites were synthesized using sulfanilic acid azochromotrop (SPADNS) and sulfonazo III sodium salt (CHR-BS) as anionic dopants for chemical polymerization of PPy. The composites were tested for application in electrodes of electrochemical supercapacitors (ES). Sedimentation tests, electrophoretic deposition experiments and Fourier transform infrared spectroscopy (FTIR) investigations showed that strong adsorption of anionic CHR-BS on MWCNT provided MWCNT dispersion. The analysis of scanning and transmission electron microscopy data demonstrated that the use of CHR-BS allowed the formation of PPy coatings on MWCNT. As a result, the composites, prepared using CHR-BS, showed higher capacitance, compared to the composites, prepared using SPADNS. The electrodes, containing MWCNT, coated with PPy showed a capacitance of 179 F g −1 for active mass loading of 10 mg cm −2 , good capacitance retention at scan rates in the range of 2–100 mV s −1 and excellent cyclic stability. Asymmetric ES devices, containing positive PPy–MWCNT electrodes and negative vanadium nitride (VN)–MWCNT electrodes showed significant improvement in energy storage performance, compared to the symmetric ES due to the larger voltage window. The low impedance and high capacitance of the individual cells paved the way to the development of modules with higher voltage, which showed good electrochemical performance
High energy density battery lithium thionyl chloride improved reverse voltage design
Zolla, A. E.
1981-12-01
A test program was conducted to demonstrate safety under voltage reversal conditions of the Altus 1400 AH HEDB cell. Eight cells of an improve Anode Grid Design, all cathode (carbon) limited, were forced discharged for 150% of their normal capacity. Minor design variations were tested at 6 amp, 20 C and 12 amp, 0 C with a lithium reference electrode and separate monitoring of current through the internal reverse voltage current shunt feature. There were no ventings and no appreciable increase in cell temperature or internal pressure.
Pan, Guan-Ting; Chong, Siewhui; Yang, Thomas C-K; Huang, Chao-Ming
2017-03-31
Mesoporous Mn 1.5 Co 1.5 O₄ (MCO) spinel films were prepared directly on a conductive nickel (Ni) foam substrate via electrodeposition and an annealing treatment as supercapacitor electrodes. The electrodeposition time markedly influenced the surface morphological, textural, and supercapacitive properties of MCO/Ni electrodes. The (MCO/Ni)-15 min electrode (electrodeposition time: 15 min) exhibited the highest capacitance among three electrodes (electrodeposition times of 7.5, 15, and 30 min, respectively). Further, an asymmetric supercapacitor that utilizes (MCO/Ni)-15 min as a positive electrode, a plasma-treated activated carbon (PAC)/Ni electrode as a negative electrode, and carboxymethyl cellulose-lithium nitrate (LiNO₃) gel electrolyte (denoted as (PAC/Ni)//(MCO/Ni)-15 min) was fabricated. In a stable operation window of 2.0 V, the device exhibited an energy density of 27.6 Wh·kg -1 and a power density of 1.01 kW·kg -1 at 1 A·g -1 . After 5000 cycles, the specific energy density retention and power density retention were 96% and 92%, respectively, demonstrating exceptional cycling stability. The good supercapacitive performance and excellent stability of the (PAC/Ni)//(MCO/Ni)-15 min device can be ascribed to the hierarchical structure and high surface area of the (MCO/Ni)-15 min electrode, which facilitate lithium ion intercalation and deintercalation at the electrode/electrolyte interface and mitigate volume change during long-term charge/discharge cycling.
Eggen, Per-Odd
2009-01-01
This article describes the construction of an inexpensive, robust, and simple hydrogen electrode, as well as the use of this electrode to measure "standard" potentials. In the experiment described here the students can measure the reduction potentials of metal-metal ion pairs directly, without using a secondary reference electrode. Measurements…
Detection of metal ions by atomic emission spectroscopy from liquid-electrode discharge plasma
International Nuclear Information System (INIS)
Wu Jian; Yu Jing; Li Jun; Wang Jianping; Ying Yibin
2007-01-01
In this paper, the discharge ignited in a capillary connecting two beakers filled with electrolyte solution is investigated. During the experiment, an external electrical voltage is applied through two platinum electrodes dipped in the beakers. A gas bubble forms inside the capillary when the applied voltage is higher than 1000 V. Since the beakers are tilted slightly, after generation, the bubble moves slowly to the uphill outlet of the capillary due to buoyancy. When the bubble reaches the end of the capillary, it cracks and a bright discharge is ignited. The emission spectra of the discharge plasma are related to the metal ions dissolved in the solution and thus can be used for metal ion detection. An application of the system to measurement of water hardness is shown
Nonlinear dynamics of capacitive charging and desalination by porous electrodes
Biesheuvel, P. M.; Bazant, M. Z.
2010-03-01
The rapid and efficient exchange of ions between porous electrodes and aqueous solutions is important in many applications, such as electrical energy storage by supercapacitors, water desalination and purification by capacitive deionization, and capacitive extraction of renewable energy from a salinity difference. Here, we present a unified mean-field theory for capacitive charging and desalination by ideally polarizable porous electrodes (without Faradaic reactions or specific adsorption of ions) valid in the limit of thin double layers (compared to typical pore dimensions). We illustrate the theory for the case of a dilute, symmetric, binary electrolyte using the Gouy-Chapman-Stern (GCS) model of the double layer, for which simple formulae are available for salt adsorption and capacitive charging of the diffuse part of the double layer. We solve the full GCS mean-field theory numerically for realistic parameters in capacitive deionization, and we derive reduced models for two limiting regimes with different time scales: (i) in the “supercapacitor regime” of small voltages and/or early times, the porous electrode acts like a transmission line, governed by a linear diffusion equation for the electrostatic potential, scaled to the RC time of a single pore, and (ii) in the “desalination regime” of large voltages and long times, the porous electrode slowly absorbs counterions, governed by coupled, nonlinear diffusion equations for the pore-averaged potential and salt concentration.
High voltage nanosecond generator with pulse repetition rate of 1,000 p.p.s.
Energy Technology Data Exchange (ETDEWEB)
Gubanov, V P; Korovin, S D; Stepchenko, A S [High Current Electronics Institute, Tomsk (Russian Federation)
1997-12-31
A compact high voltage nanosecond generator is described with a pulse repetition rate up to 1000 p.p.s. The generator includes a 30-Ohm coaxial forming line charged by a built-in Tesla transformer with a high coupling coefficient, and a high voltage (N{sub 2}) gas gap switch with gas blowing between the electrodes. The maximum forming line charge voltage is 450 kV, the pulse duration is about 4 ns, and its amplitude for a matched load is up to 200 kV. (author). 3 figs., 9 refs.
International Nuclear Information System (INIS)
Kobayashi, Fumiaki; Kitawaki, Shinichi; Amamoto, Ippei; Igarashi, Miyuki
1999-02-01
The Ag/ AgCl reference electrode is often used in electrochemical measurements of molten chloride system. By measuring the U/U 3+ equilibrium potential in the cell, U(s) | UCl 3 , LiCl-KCl parallel LiCl-KCl, Ag + | Ag (s), the characterization of the Ag/AgCl reference electrode was made. The behavior of two types of reference electrode having either a mullite or a Pyrex-glass membrane bridge was examined. It was confirmed that the two types of reference electrode can be regarded as almost equivalent. The reproducibility of the reading from the electrodes having the identical construction was showing to be within 0.003 V. (author)
Floating liquid bridge tensile behavior: Electric-field-induced Young's modulus measurements
Teschke, Omar; Mendez Soares, David; Valente Filho, Juracyr Ferraz
2013-12-01
A floating bridge is formed spontaneously when high voltage is applied to polar fluids in two capillary tubes that were in contact and then separated. This bridge bends under its own weight, and its bending profile was used to calculate its Young's modulus. For electric field intensities of ˜106 V/m, water bridges exhibit viscoelastic behavior, with Young's moduli of ˜24 MPa; dimethylsulfoxide (DMSO) bridges exhibited Young's moduli of ˜60 kPa. The scheme devised to measure the voltage drop across the water bridge for high voltages applied between the electrodes shows that the bulk water resistance decreases with increasing voltage.