WorldWideScience

Sample records for voltage electronic apparatus

  1. APPARATUS FOR ELECTRON BEAM HEATING CONTROL

    Science.gov (United States)

    Jones, W.H.; Reece, J.B.

    1962-09-18

    An improved electron beam welding or melting apparatus is designed which utilizes a high voltage rectifier operating below its temperature saturation region to decrease variations in electron beam current which normally result from the gas generated in such apparatus. (AEC)

  2. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  3. Methods, systems and apparatus for adjusting modulation index to improve linearity of phase voltage commands

    Science.gov (United States)

    Gallegos-Lopez, Gabriel; Perisic, Milun; Kinoshita, Michael H.

    2017-03-14

    Embodiments of the present invention relate to methods, systems and apparatus for controlling operation of a multi-phase machine in a motor drive system. The disclosed embodiments provide a mechanism for adjusting modulation index of voltage commands to improve linearity of the voltage commands.

  4. The supply voltage apparatus of the CUORE experiment

    Energy Technology Data Exchange (ETDEWEB)

    Arnaboldi, C.; Baú, A.; Carniti, P.; Cassina, L.; Giachero, A.; Gotti, C.; Maino, M.; Passerini, A. [INFN, Sezione di Milano Bicocca - Istituto Nazionale di Fisica Nucleare, Piazza della Scienza 3 Milano (Italy); Università di Milano Bicocca - Dipartimento di Fisica, Piazza della Scienza 3 Milano (Italy); Pessina, G., E-mail: Pessina@mib.infn.it [INFN, Sezione di Milano Bicocca - Istituto Nazionale di Fisica Nucleare, Piazza della Scienza 3 Milano (Italy); Università di Milano Bicocca - Dipartimento di Fisica, Piazza della Scienza 3 Milano (Italy)

    2016-07-11

    The Electronics system of experiments for the study of rare decays, such as the neutrino-less double beta decay, must be very stable over very long expected runs. We introduce our solution for the power supply of such an experiment, CUORE. In this case the power supply chain consists of a series of ACDCs, followed by DCDCs and then Linear Regulators. We emphasize here our approach to the DCDC regulation system that was designed with a complete rejection of the switching noise, across 100 MHz bandwidth. In the experimental layout the DCDC will be located far from the very front-end, with long connecting cables (10 m). We introduced our very simple and safe solution to prevent huge over-voltages, due to the energy stored in the inductance of the cables, generated after the release of accidental short circuits, so avoiding destructive effects. Some micro-controllers are present on every board and take care of the DCDC operation. These micro-controllers are managed from the control room, via CAN BUS protocol coupled via optical fibres. CUORE is an array of 1000 cryogenic detectors that will need 30 of our DCDCs.

  5. Methods and apparatus for cooling electronics

    Science.gov (United States)

    Hall, Shawn Anthony; Kopcsay, Gerard Vincent

    2014-12-02

    Methods and apparatus are provided for choosing an energy-efficient coolant temperature for electronics by considering the temperature dependence of the electronics' power dissipation. This dependence is explicitly considered in selecting the coolant temperature T.sub.0 that is sent to the equipment. To minimize power consumption P.sub.Total for the entire system, where P.sub.Total=P.sub.0+P.sub.Cool is the sum of the electronic equipment's power consumption P.sub.0 plus the cooling equipment's power consumption P.sub.Cool, P.sub.Total is obtained experimentally, by measuring P.sub.0 and P.sub.Cool, as a function of three parameters: coolant temperature T.sub.0; weather-related temperature T.sub.3 that affects the performance of free-cooling equipment; and computational state C of the electronic equipment, which affects the temperature dependence of its power consumption. This experiment provides, for each possible combination of T.sub.3 and C, the value T.sub.0* of T.sub.0 that minimizes P.sub.Total. During operation, for any combination of T.sub.3 and C that occurs, the corresponding optimal coolant temperature T.sub.0* is selected, and the cooling equipment is commanded to produce it.

  6. A Study on Gas Insulation Characteristics for Design Optimization of High Voltage Power Apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, I. S.; Kim, M. K.; Seo, K. S.; Moon, I. W.; Choi, C. K. [Korea Electrotechnology Research Institute (Korea, Republic of)

    1996-12-01

    This study aim of obtaining the basic data for gas insulation in the high voltage apparatus and for investigating the breakdown characteristics in uniform field and non-uniform which the geometric construction in the practical power apparatus. In this study, the research results on the insulation technology published earlier are reviewed and the basic data for an optimum design of a high voltage apparatus are obtained thorough the experiment and computer simulation by using a uniform field. The main result are summarized as follows: (A) Investigation on the insulation technology in a large-capacity power apparatus. (B) Investigation on the breakdown characteristics in particle contaminated condition. (C) Investigation on the design in computer simulation. (D) Investigation on the simulation technology of breakdown characteristics. (E) Investigation on breakdown characteristics in the nonuniform field and experiment. (author). refs., figs., tabs.

  7. Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron

    2016-01-26

    A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.

  8. Electronic Voltage and Current Transformers Testing Device

    Directory of Open Access Journals (Sweden)

    Yong Xiao

    2012-01-01

    Full Text Available A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz. The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.

  9. Electronic voltage and current transformers testing device.

    Science.gov (United States)

    Pan, Feng; Chen, Ruimin; Xiao, Yong; Sun, Weiming

    2012-01-01

    A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs) with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz). The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.

  10. Study on the lightning impulse breakdown characteristics of gaseous insulation media for the design of a high voltage superconducting apparatus

    Science.gov (United States)

    Kang, H.; Na, J. B.; Ahn, M. C.; Bae, D. K.; Kim, Y. H.; Ko, T. K.

    2010-11-01

    In general, the current leads of high voltage superconducting apparatuses cooled by liquid nitrogen are exposed to gaseous insulation media. Therefore, the investigation on the electrical breakdown characteristics of gaseous insulation media should be performed to develop electrically reliable high voltage superconducting power apparatuses. In this study, the lightning impulse breakdown tests on gaseous insulation media are conducted by using sphere-to-plane electrode systems made of stainless steel. Also, the lightning impulse breakdown voltage tests on gaseous insulation media according to various pressures are performed. The experimental results show that the electrical breakdown characteristics under lightning impulse voltage are affected by the gap length between electrode systems, the size of electrodes, and the field utilization factors. From these results, the electrical insulation design criteria to estimate the electrical breakdown voltage are established. The results are expected to be applicable to the design of current leads for high voltage superconducting apparatuses.

  11. Methods, systems and apparatus for controlling third harmonic voltage when operating a multi-space machine in an overmodulation region

    Science.gov (United States)

    Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel

    2014-06-03

    Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.

  12. Geometrical calibration of the NBS electron scattering apparatus. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Penner, S.; Fivozinsky, S.P.; Lightbody, J.W. Jr.; Cardman, L.S.; Trower, W.P.

    1975-06-01

    A comprehensive calibration of the geometry of the NBS electron scattering apparatus is described. A complete set of measured parameters is tabulated in this report. Combining these parameters with observed values of certain variables as described herein permits the accurate determination of the solid angle, scattering angle, and target angle for each cross section measurement made with the apparatus. The uncertainty in cross section measurement due to the imprecision of the geometry calibrations is less than one part in 1,000. (GRA)

  13. THREE-DIMENSIONAL OBSERVATIONS ON THICK BIOLOGICAL SPECIMENS BY HIGH VOLTAGE ELECTRON MICROSCOPY

    Directory of Open Access Journals (Sweden)

    Tetsuji Nagata

    2011-05-01

    Full Text Available Thick biological specimens prepared as whole mount cultured cells or thick sections from embedded tissues were stained with histochemical reactions, such as thiamine pyrophosphatase, glucose-6-phosphatase, cytochrome oxidase, acid phosphatase, DAB reactions and radioautography, to observe 3-D ultrastructures of cell organelles producing stereo-pairs by high voltage electron microscopy at accerelating voltages of 400-1000 kV. The organelles demonstrated were Golgi apparatus, endoplasmic reticulum, mitochondria, lysosomes, peroxisomes, pinocytotic vesicles and incorporations of radioactive compounds. As the results, those cell organelles were observed 3- dimensionally and the relative relationships between these organelles were demonstrated.

  14. Light Emitting, Photovoltaic or Other Electronic Apparatus and System

    Science.gov (United States)

    Ray, William Johnstone (Inventor); Lowenthal, Mark D. (Inventor); Shotton, Neil O. (Inventor); Blanchard, Richard A. (Inventor); Lewandowski, Mark Allan (Inventor); Fuller, Kirk A. (Inventor); Frazier, Donald Odell (Inventor)

    2016-01-01

    The present invention provides an electronic apparatus, such as a lighting device comprised of light emitting diodes (LEDs) or a power generating apparatus comprising photovoltaic diodes, which may be created through a printing process, using a semiconductor or other substrate particle ink or suspension and using a lens particle ink or suspension. An exemplary apparatus comprises a base; at least one first conductor; a plurality of diodes coupled to the at least one first conductor; at least one second conductor coupled to the plurality of diodes; and a plurality of lenses suspended in a polymer deposited or attached over the diodes. The lenses and the suspending polymer have different indices of refraction. In some embodiments, the lenses and diodes are substantially spherical, and have a ratio of mean diameters or lengths between about 10:1 and 2:1. The diodes may be LEDs or photovoltaic diodes, and in some embodiments, have a junction formed at least partially as a hemispherical shell or cap.

  15. Golgi apparatus analyzed by cryo-electron microscopy.

    Science.gov (United States)

    Han, Hong-Mei; Bouchet-Marquis, Cedric; Huebinger, Jan; Grabenbauer, Markus

    2013-10-01

    In 1898, the Golgi apparatus was discovered by light microscopy, and since the 1950s, the ultrastructure composition is known by electron microscopic investigation. The complex three-dimensional morphology fascinated researchers and was sometimes even the driving force to develop novel visualization techniques. However, the highly dynamic membrane systems of Golgi apparatus are delicate and prone to fixation artifacts. Therefore, the understanding of Golgi morphology and its function has been improved significantly with the development of better preparation methods. Nowadays, cryo-fixation is the method of choice to arrest instantly all dynamic and physiological processes inside cells, tissues, and small organisms. Embedded in amorphous ice, such samples can be further processed by freeze substitution or directly analyzed in their fully hydrated state by cryo-electron microscopy and tomography. Even though the overall morphology of vitrified Golgi stacks is comparable to well-prepared and resin-embedded samples, previously unknown structural details can be observed solely based on their native density. At this point, any further improvement of sample preparation would gain novel insights, perhaps not in terms of general morphology, but on fine structural details of this dynamic organelle.

  16. Choice of operating voltage for a transmission electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Egerton, R.F., E-mail: regerton@ualberta.ca

    2014-10-15

    An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

  17. The voltage distortion in low-voltage networks caused by compact fluorescent lamps with electronic gear

    Energy Technology Data Exchange (ETDEWEB)

    Radakovic, Zoran; Kostic, Miomir [School of Electrical Engineering, University of Belgrade, Bul. Kralja Aleksandra 73, 11000 Belgrade (Serbia and Montenegro); Topalis, Frangiskos V. [School of Electrical and Computer Engineering, Laboratory of Photometry, National Technical University of Athens, 9 Iroon Politechniou Street, 15780 Zografou, Athens (Greece)

    2005-02-01

    Commonly used compact fluorescent lamps (CFLs) with electronic gear are characterized by extremely distorted current, with total harmonic distortion (THD) usually exceeding 100%. That is why they cause a significant voltage distortion in electrical installations. The principal goal of this research was to determine their maximum permissible share in the total load installed for commercial customers, at which voltage distortion is still acceptable (according to international standards). An analysis regarding a low-voltage electrical installation of a hotel, representing a typical commercial customer, showed that maximum permissible share should not exceed 10%. As this maximum permissible share could restrict the installment of the intended quantity of CFLs, the costs of two possible solutions for this problem - the use of filters or a new generation of CFLs with a high power factor - are compared.

  18. Electronic Current Transducer (ECT) for high voltage dc lines

    Science.gov (United States)

    Houston, J. M.; Peters, P. H., Jr.; Summerayes, H. R., Jr.; Carlson, G. J.; Itani, A. M.

    1980-02-01

    The development of a bipolar electronic current transducer (ECT) for measuring the current in a high voltage dc (HVDC) power line at line potential is discussed. The design and construction of a free standing ECT for use on a 400 kV line having a nominal line current of 2000 A is described. Line current is measured by a 0.0001 ohm shunt whose voltage output is sampled by a 14 bit digital data link. The high voltage interface between line and ground is traversed by optical fibers which carry digital light signals as far as 300 m to a control room where the digital signal is converted back to an analog representation of the shunt voltage. Two redundant electronic and optical data links are used in the prototype. Power to operate digital and optical electronics and temperature controlling heaters at the line is supplied by a resistively and capacitively graded 10 stage cascade of ferrite core transformers located inside the hollow, SF6 filled, porcelain support insulator. The cascade is driven by a silicon controlled rectifier inverter which supplies about 100 W of power at 30 kHz.

  19. Evolution of graphene nanoribbons under low-voltage electron irradiation

    KAUST Repository

    Zhu, Wenpeng

    2012-01-01

    Though the all-semiconducting nature of ultrathin graphene nanoribbons (GNRs) has been demonstrated in field-effect transistors operated at room temperature with ∼105 on-off current ratios, the borderline for the potential of GNRs is still untouched. There remains a great challenge in fabricating even thinner GNRs with precise width, known edge configurations and specified crystallographic orientations. Unparalleled to other methods, low-voltage electron irradiation leads to a continuous reduction in width to a sub-nanometer range until the occurrence of structural instability. The underlying mechanisms have been investigated by the molecular dynamics method herein, combined with in situ aberration-corrected transmission electron microscopy and density functional theory calculations. The structural evolution reveals that the zigzag edges are dynamically more stable than the chiral ones. Preferential bond breaking induces atomic rings and dangling bonds as the initial defects. The defects grow, combine and reconstruct to complex edge structures. Dynamic recovery is enhanced by thermal activation, especially in cooperation with electron irradiation. Roughness develops under irradiation and reaches a plateau less than 1 nm for all edge configurations after longtime exposure. These features render low-voltage electron irradiation an attractive technique in the fabrication of ultrathin GNRs for exploring the ultimate electronic properties. © 2012 The Royal Society of Chemistry.

  20. Survey of high voltage electron microscopy worldwide in 1998.

    Energy Technology Data Exchange (ETDEWEB)

    Allen, C. W.

    1998-03-05

    High voltage TEMs were introduced commercially thirty years ago, with the installations of 500 kV Hitachi instruments at the Universities of Nagoya and Tokyo. Since that time 53 commercial instruments, having maximum accelerating potentials of 0.5-3.5 MV, will have been delivered by the end of 1998. Table 1 summarizes the sites and some information regarding those HVEMS which are available in 1998. This corrects, updates and expands an earlier report of this sort [2]. There have been three commercial HVEM manufacturers: AEI (UK), Hitachi and JEOL (Japan). The proportion of the total number of HVEMS produced by each manufacturer is similar to that reflected in Table 1: AEI and Kratos/AEI (12), Hitachi (20) and JEOL (21). The term Kratos/AEI refers to instruments delivered after the takeover of AEI by Grates in the late 1970's. In Table 1 only maximum accelerating potentials are listed, which is generally also the design value for which the resolution for imaging was optimized. It is important to realize that in many applications, especially those studying irradiation effects, much lower voltages may be employed somewhat routinely to minimize atom displacements by the incident electron beam during analysis. These minimum values range from 100 kV for the AEI and Kratos/AEI instruments to typically 400 kV for the current generation of atomic resolution instruments, the latter being well above the thresholds for displacement in light elements such as Al and Si and for displacement of anions in many ceramic materials such as the high Tc superconductors, for example. An additional potential problem is electron-induced sputtering and differential sputtering (unequal sputtering rates in multicomponent materials), especially when accurate elemental microanalysis is being attempted. These same issues may arise for intermediate voltage TEMs as well, of course.

  1. A Low-Voltage Electronically Tunable MOSFET-C Voltage-Mode First-Order All-Pass Filter Design

    OpenAIRE

    Metin, B.; N. Herencsar; O. Cicekoglu

    2013-01-01

    This paper presents a simple electronically tunable voltage-mode first-order all-pass filter realization with MOSFET-C technique. In comparison to the classical MOSFET-C filter circuits that employ active elements including large number of transistors the proposed circuit is only composed of a single two n-channel MOSFET-based inverting voltage buffer, three passive components, and one NMOS-based voltage-controlled resistor, which is with advantage used to electronically control the pole freq...

  2. Novel scanning electron microscopy methods for analyzing the 3D structure of the Golgi apparatus.

    Science.gov (United States)

    Koga, Daisuke; Ushiki, Tatsuo; Watanabe, Tsuyoshi

    2017-01-01

    The structure of the Golgi apparatus has been extensively examined by light and electron microscopy, but details of its three-dimensional (3D) structure have remained unclear because of the technical limitations of conventional microscopy techniques. To overcome this problem, we have developed several novel scanning electron microscopy (SEM) methods for observing the 3D structure of subcellular organelles including the Golgi apparatus: (1) an osmium maceration method that facilitates SEM observation of membranous organelles, including the Golgi apparatus, by selectively removing soluble cytoplasmic proteins, (2) an osmium impregnation/maceration method that combines an osmium impregnation method with the osmium maceration method to determine the polarity of the Golgi apparatus by SEM, (3) a correlative light and SEM method that combines a cryosectioning technique with the osmium maceration method to enable correlation of the immunocytochemical distribution of molecules with the 3D ultrastructure of the Golgi apparatus, and (4) array tomography based on the systematic collection and integration of SEM images of serial ultrathin sections on glass slides for revealing the 3D ultrastructure of the entire Golgi apparatus. Together, the novel SEM techniques listed above can reveal the complete 3D structure of the Golgi apparatus in different cell types.

  3. Ultrahigh Voltage Electron Microscopy Links Neuroanatomy and Neuroscience/Neuroendocrinology

    Directory of Open Access Journals (Sweden)

    Hirotaka Sakamoto

    2012-01-01

    Full Text Available The three-dimensional (3D analysis of anatomical ultrastructures is extremely important in most fields of biological research. Although it is very difficult to perform 3D image analysis on exact serial sets of ultrathin sections, 3D reconstruction from serial ultrathin sections can generally be used to obtain 3D information. However, this technique can only be applied to small areas of a specimen because of technical and physical difficulties. We used ultrahigh voltage electron microscopy (UHVEM to overcome these difficulties and to study the chemical neuroanatomy of 3D ultrastructures. This methodology, which links UHVEM and light microscopy, is a useful and powerful tool for studying molecular and/or chemical neuroanatomy at the ultrastructural level.

  4. A Low-Voltage Electronically Tunable MOSFET-C Voltage-Mode First-Order All-Pass Filter Design

    Directory of Open Access Journals (Sweden)

    B. Metin

    2013-12-01

    Full Text Available This paper presents a simple electronically tunable voltage-mode first-order all-pass filter realization with MOSFET-C technique. In comparison to the classical MOSFET-C filter circuits that employ active elements including large number of transistors the proposed circuit is only composed of a single two n-channel MOSFET-based inverting voltage buffer, three passive components, and one NMOS-based voltage-controlled resistor, which is with advantage used to electronically control the pole frequency of the filter in range 103 kHz to 18.3 MHz. The proposed filter is also very suitable for low-voltage operation, since between its supply rails it uses only two MOSFETs. In the paper the effect of load is investigated. In addition, in order to suppress the effect of non-zero output resistance of the inverting voltage buffer, two compensation techniques are also introduced. The theoretical results are verified by SPICE simulations using PTM 90 nm level-7 CMOS process BSIM3v3 parameters, where +/- 0.45 V supply voltages are used. Moreover, the behavior of the proposed filter was also experimentally measured using readily available array transistors CD4007UB by Texas Instruments.

  5. Apparatus for measurement of electronic-ionization cross sections of metal atoms

    Energy Technology Data Exchange (ETDEWEB)

    Golovach, D.G.; Rakhovskii, V.I.; Shustryakov, V.M.

    1987-06-01

    Automated apparatus is described for measurement of the absolute cross section of multiple and total electronic of metal atoms. Intersecting electron and modulated atomic beams with time separation of the processes of ionization and ion extraction are used. The results of measurements of the dependences of ..gamma../sub +/, ..gamma../sup +/, and ..gamma../sup + +/ of Pb and Ba on electron energy are given and compared with the data in the literature.

  6. Apparatus and methods for controlling electron microscope stages

    Science.gov (United States)

    Duden, Thomas

    2015-08-11

    Methods and apparatus for generating an image of a specimen with a microscope (e.g., TEM) are disclosed. In one aspect, the microscope may generally include a beam generator, a stage, a detector, and an image generator. A plurality of crystal parameters, which describe a plurality of properties of a crystal sample, are received. In a display associated with the microscope, an interactive control sphere based at least in part on the received crystal parameters and that is rotatable by a user to different sphere orientations is presented. The sphere includes a plurality of stage coordinates that correspond to a plurality of positions of the stage and a plurality of crystallographic pole coordinates that correspond to a plurality of polar orientations of the crystal sample. Movement of the sphere causes movement of the stage, wherein the stage coordinates move in conjunction with the crystallographic coordinates represented by pole positions so as to show a relationship between stage positions and the pole positions.

  7. Electron-beam-induced-current and active secondary-electron voltage-contrast with aberration-corrected electron probes

    Energy Technology Data Exchange (ETDEWEB)

    Han, Myung-Geun, E-mail: mghan@bnl.gov [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Garlow, Joseph A. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Materials Science and Engineering Department, Stony Brook University, Stony Brook, NY 11794 (United States); Marshall, Matthew S.J.; Tiano, Amanda L. [Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Wong, Stanislaus S. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Cheong, Sang-Wook [Department of Physics and Astronomy, Rutgers Center for Emergent Materials, Rutgers University, Piscataway, NJ 08854 (United States); Walker, Frederick J.; Ahn, Charles H. [Department of Applied Physics and Center for Research on Interface Structures and Phenomena, Yale University, New Haven, CT 06520 (United States); Department of Mechanical Engineering and Materials Science, Yale University, New Haven, CT 06520 (United States); Zhu, Yimei [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States)

    2017-05-15

    Highlights: • Electron-beam-induced-current (EBIC) and active secondary-electron voltage-contrast (SE-VC) are demonstrated in STEM mode combined with in situ electrical biasing in a TEM. • Electrostatic potential maps in ferroelectric thin films, multiferroic nanowires, and single crystals obtained by off-axis electron holography were compared with EBIC and SE-VC data. • Simultaneous EBIC and active SE-VC performed with atomic resolution STEM are demonstrated. - Abstract: The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fields and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.

  8. Development of high voltage lead wires using electron beam irradiation

    Science.gov (United States)

    Hun-Jai, Bae; Ho-Soung, Sohn; Dong-Jung, Choi

    1995-09-01

    It is known to those skilled to the art that the electric wires used in high voltage operating electric equipments such as TV sets, microwave ovens, duplicators and etc., have such a structure that a conductor is coated with an insulating layer which is encapsulated with a protecting jacket layer. The electric wire specification such as UL and CSA requires superior cut-through property and flame-retardant property of the wire for utilization safety. The cut-through property of insulation material, for example, high density polyethylene, can be increased by crosslinking of the polymer. Also the flame-retardant property of jacket material which protects the flammable inner insulation can be raised by flame-retardant formulating of the material. In the wire and cable industry, crosslinking by electron beam processing is more effective than that by chemical processing in the viewpoint of through-put rate of the products. The jacket layer of the wire plays the role of protecting the insulation material from burning. The protecting ability of the jacket is related to its inherent flammability and formability of swollen carbonated layer when burned. Crosslinking of the material gives a good formability of swollen carbonated layer, and it protects the insulation material from direct flame. In formulating the flame-retardant jacket material, a crosslinking system must be considered with base polymers and other flame-retardant additives.

  9. Analog IC techniques for low-voltage low-power electronics

    NARCIS (Netherlands)

    Serdijn, W.A.; Verhoeven, C.J.M.; Van Roermund, A.H.M.

    1995-01-01

    Analog IC Techniques lor Low-Voltage Low Power Electronics addresses many very important, but recent, techniques which enable electronics to operate at a low supply voltage and consume a minimum amount of power. Apart from investigations at the device, circuit and system levels, the book provides a

  10. Particle flows to shape and voltage surface discontinuities in the electron sheath surrounding a high voltage solar array in LEO

    Science.gov (United States)

    Metz, Roger N.

    1991-01-01

    This paper discusses the numerical modeling of electron flows from the sheath surrounding high positively biased objects in LEO (Low Earth Orbit) to regions of voltage or shape discontinuity on the biased surfaces. The sheath equations are derived from the Two-fluid, Warm Plasma Model. An equipotential corner and a plane containing strips of alternating voltage bias are treated in two dimensions. A self-consistent field solution of the sheath equations is outlined and is pursued through one cycle. The electron density field is determined by numerical solution of Poisson's equation for the electrostatic potential in the sheath using the NASCAP-LEO relation between electrostatic potential and charge density. Electron flows are calculated numerically from the electron continuity equation. Magnetic field effects are not treated.

  11. Accurate determination of the voltage of a transmission electron ...

    Indian Academy of Sciences (India)

    The positions of the HOLZ lines depend not only on the lattice parameter, but also on the operating voltage of the microscope. It is essential to know the actual voltage of the microscope. In the present work, (1 0 0) GaAs crystal has been used as a standard. Cross-sectional TEM specimens were prepared by argon ion beam ...

  12. Voltage-driven electronic transport and shot noise in armchair graphene nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Jian-Hui, E-mail: jianhui831110@163.com [School of Physics, Huazhong University of Science and Technology, Wuhan 430074 (China); Cheng, Ze; Zhang, Jian-Jun; Zeng, Qi-Jun; Zhang, Jun-Pei [School of Physics, Huazhong University of Science and Technology, Wuhan 430074 (China)

    2011-07-04

    We study theoretically shot noise and minimal conductivity of electrons by evanescent states penetrating through clean graphene nanoribbons (GNRs). With increasing of the barrier voltage, we find that the minimum conductivity will increase to 4e{sup 2}/πh and the maximum Fano factor will increase to 1/3. More interestingly, quantum oscillations can be tuned by the gate voltage and separated by tuning the barrier voltage -- Highlights: → This manuscript reports that 'voltage-driven electronic transport in armchair grapheme nanoribbons'. This is new and interesting topic. → The conductivity minimum can change by tuning the voltage. → Quantum oscillations can be tuned by the gate voltage and separated by tuning the barrier voltage.

  13. An electronic apparatus for early detection of changes in red cell ...

    African Journals Online (AJOL)

    An electronic apparatus was developed for anaesthetists to use to detect changes in red cell concentration during surgery. The mechanism is based on the relationship between the red cell content and the electrical conductivity of blood. In a pilot study of 170 blood samples, a correlation coefficient of 0,9806 was obtained ...

  14. Scanning electron microscopy of the oral apparatus and buccopharyngeal cavity of Atelognathus salai larvae (Anura, Neobatrachia

    Directory of Open Access Journals (Sweden)

    Dinorah D. Echeverría

    2006-09-01

    Full Text Available The aim of this study is to describe the horny structures of the buccal apparatus and buccopharyngeal cavity of A. salai by means ofscanning electron microscopy (SEM, and to compare them to those of the other known species of Atelognathus and related genera.

  15. iDEEAA: A novel, versatile apparatus for electron spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lupulescu, C., E-mail: cosmin.lupulescu@helmholtz-berlin.de [Technische Universität Berlin, Institut für Optik und Atomare Physik, Straße des 17. Juni 135, 10623 Berlin (Germany); Arion, T. [Centre for Free-Electron Laser Science (DESY), Notkestrasse 85, 22607 Hamburg (Germany); Institut für Experimentalphysik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Hergenhahn, U. [Max-Planck-Institut für Plasmaphysik, EURATOM Association, Teilinstitut Greifswald, Wendelsteinstr. 1, 17491 Greifswald (Germany); Ovsyannikov, R. [Helmholtz-Zentrum Berlin, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Förstel, M. [Max-Planck-Institut für Plasmaphysik, EURATOM Association, Teilinstitut Greifswald, Wendelsteinstr. 1, 17491 Greifswald (Germany); Gavrila, G. [Technische Universität Chemnitz, Fakultät Elektrotechnik und Informationstechnik, Reichenhainer Str. 70, 09126 Chemnitz (Germany); Eberhardt, W. [Technische Universität Berlin, Institut für Optik und Atomare Physik, Straße des 17. Juni 135, 10623 Berlin (Germany); Centre for Free-Electron Laser Science (DESY), Notkestrasse 85, 22607 Hamburg (Germany)

    2013-12-15

    Highlights: •We developed an experimental end station for time- and angle-resolved X-ray electron spectroscopy. •The instrument can operate in combination with synchrotron radiation, VUV Helium discharge source or table-top high-harmonic laser sources. •Band mapping in solids is possible with unprecedented rapidity. •Electron–electron coincidence spectroscopy is performed at higher data collection rate (due to improved transmission) and with improved energy resolution. -- Abstract: We report the development and present status of the iDEEAA (Instrument for Direct Electron Energy and Angular Analysis) experimental end station for time- and angle-resolved X-ray photoelectron spectroscopy. The setup is based on multidimensional detection of photoelectrons by means of both time-of-flight (TOF) and/or electrostatic analyzers. The instrument offers the possibility to record simultaneously and independently photoelectron and Auger electron spectra. Samples can be either gases or solids. The system can operate with multiple photon sources, such as laboratory-based table-top laser extreme ultraviolet (EUV) sources, monochromatic Helium discharge lamp and soft X-ray synchrotron pulses. We demonstrate the performance of the setup by carrying out electron–electron coincidence experiments on CH{sub 4} and by mapping the band structure of Bi{sub 2}Se{sub 3} using photons of the BESSY II electron storage ring.

  16. Three-dimensional shape of the Golgi apparatus in different cell types: serial section scanning electron microscopy of the osmium-impregnated Golgi apparatus.

    Science.gov (United States)

    Koga, Daisuke; Kusumi, Satoshi; Ushiki, Tatsuo

    2016-04-01

    Although many studies of the Golgi apparatus structure have been performed by light and electron microscopy, the full shape of the Golgi apparatus remained unclear due to the technical limitations of the previously applied microscopy techniques. In this study, we used serial section scanning electron microscopy (SEM) for the morphological study of the Golgi apparatus. This method is useful for three-dimensional (3D) reconstruction of cellular structures without requiring specialized instruments, unlike focused ion beam SEM (FIB-SEM) and serial block face SEM (SBF-SEM). Using the serial section SEM method developed by our laboratory, we investigate the 3D shape of the osmium-impregnated Golgi apparatus in rat epididymal cells, pancreatic acinar cells and gonadotropes. The combination of serial section SEM and a 3D reconstruction technique enabled us to elucidate the entire shape of the Golgi apparatus in these cells. The full shape of the Golgi apparatus in epididymal cells formed a basket-like structure with oval-shaped cisterns, while the Golgi apparatus in an acinar cell from the pancreas was composed of elongated ribbon-like structures that were connected to each other, making a coarse network. The overall image of the Golgi apparatus cisterns from a gonadotrope looked like a spherical cage. This study has clearly shown that entire 3D shape of the Golgi apparatus varies depending on the cell type and that the Golgi cisterns network appears as a single mass located in the large region of the cytoplasm. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Apparatus for maintaining alignment of a shrinking weld joint in an electron-beam welding operation

    Science.gov (United States)

    Trent, Jett B.; Murphy, Jimmy L.

    1981-01-01

    The present invention is directed to an apparatus for automatically maintaining a shrinking weld joint in alignment with an electron beam during an electron-beam multipass-welding operation. The apparatus utilizes a biasing device for continually urging a workpiece-supporting face plate away from a carriage mounted base that rotatably supports the face plate. The extent of displacement of the face plate away from the base is indicative of the shrinkage occuring in the weld joint area. This displacement is measured and is used to move the base on the carriage a distance equal to one-half the displacement for aligning the weld joint with the electron beam during each welding pass.

  18. Irradiation apparatus

    Science.gov (United States)

    Goldie, C.H.; Fernald, R.A.

    1974-01-29

    An apparatus for introducing ionizing radiation into compressed gas insulation systems, such as high-voltage generators or transmission lines to smooth out electrical discontinuities, particularly those caused by foreign particulates that produce high gradients, and to increase the voltage holding capability of the system is described. The apparatus of the invention may also be used to regulate and stabilize the voltage of the system by varying the amount of applied load. A corona discharge device may also be used in conjunction with the invention. (Official Gazette)

  19. Abrupt variation in ion current with biased disk voltage in the electron cyclotron resonance ion source

    NARCIS (Netherlands)

    Taki, GS; Sarma, PR; Chakraborty, DK; Lhandari, RK; Ray, PK; Drentje, AG; Bhandari, R.K.

    The performance of the biased disk in the 6.4 GHz electron cyclotron resonance ion source at VECC, Kolkata was studied at a pressure of similar to 1 X 10(-7) Torr. We observed an abrupt variation of beam current with bias voltage. For low negative bias voltages (from 0 to -5 V) the beam current

  20. Advanced power electronics converters PWM converters processing AC voltages

    CERN Document Server

    dos Santos, Euzeli

    2014-01-01

    This book covers power electronics, in depth, by presenting the basic principles and application details, which can be used both as a textbook and reference book.  Introduces a new method to present power electronics converters called Power Blocks Geometry. Applicable for courses focusing on power electronics, power electronics converters, and advanced power converters. Offers a comprehensive set of simulation results to help understand the circuits presented throughout the book

  1. A scanning drift tube apparatus for spatiotemporal mapping of electron swarms

    Energy Technology Data Exchange (ETDEWEB)

    Korolov, I.; Vass, M.; Donkó, Z., E-mail: donko.zoltan@wigner.mta.hu [Institute for Solid State Physics and Optics, Wigner Research Centre for Physics, Hungarian Academy of Sciences, P.O. Box 49, H-1525 Budapest (Hungary); Bastykova, N. Kh. [Institute of Experimental and Theoretical Physics, al-Farabi Kazakh National University, 96a Tole Bi, Almaty 050012 (Kazakhstan)

    2016-06-15

    A “scanning” drift tube apparatus, capable of mapping of the spatiotemporal evolution of electron swarms, developing between two plane electrodes under the effect of a homogeneous electric field, is presented. The electron swarms are initiated by photoelectron pulses and the temporal distributions of the electron flux are recorded while the electrode gap length (at a fixed electric field strength) is varied. Operation of the system is tested and verified with argon gas; the measured data are used for the evaluation of the electron bulk drift velocity. The experimental results for the space-time maps of the electron swarms — presented here for the first time — also allow clear observation of deviations from hydrodynamic transport. The swarm maps are also reproduced by particle simulations.

  2. Accurate determination of the voltage of a transmission electron micro

    Indian Academy of Sciences (India)

    Unknown

    ted disc of CBED patterns are very sensitive to the lattice parameter, and can therefore be used to estimate changes in the ...... J C 1987 Appl. Phys. Lett. 50 574. Service Manual for Philips EM430T TEM 1987 Electronics. (Netherlands: Philips) 9432 060 09001 422. Spence J C H and Zuo J M 1992 Electron microdiffraction.

  3. Sub-Angstrom Low Voltage Performance of a Monochromated, Aberration-Corrected Transmission Electron Microscope

    Science.gov (United States)

    Bell, David C.; Russo, Christopher J.; Benner, Gerd

    2011-01-01

    Lowering the electron energy in the transmission electron microscope allows for a significant improvement in contrast of light elements, and reduces knock-on damage for most materials. If low-voltage electron microscopes are defined as those with accelerating voltages below 100 kV, the introduction of aberration correctors and monochromators to the electron microscope column enables Ångstrom-level resolution, which was previously reserved for higher voltage instruments. Decreasing electron energy has three important advantages: 1) knock-on damage is lower, which is critically important for sensitive materials such as graphene and carbon nanotubes; 2) cross sections for electron-energy-loss spectroscopy increase, improving signal-to-noise for chemical analysis; 3) elastic scattering cross sections increase, improving contrast in high-resolution, zero-loss images. The results presented indicate that decreasing the acceleration voltage from 200 kV to 80 kV in a monochromated, aberration-corrected microscope enhances the contrast while retaining sub-angstrom resolution. These improvements in low-voltage performance are expected to produce many new results and enable a wealth of new experiments in materials science. PMID:20598206

  4. A Sepic-Type Single-Stage Electronic Ballast for High Line Voltage Applications

    Science.gov (United States)

    Shen, Chih-Lung; Chen, Kuo-Kuang

    In this paper, a sepic-type single-stage electronic ballast (STSSEB) is proposed, which is derived from the combination of a sepic converter and a half-bridge inverter. The ballast can not only step down input voltage directly but achieve high power factor, reduce voltage stress, improve efficiency and lower cost. Since component stress is reduced significantly, the presented ballast can be applied to high voltage mains. Derivation of the STSSEB is first presented. Then, analysis, design and practical consideration for the STSSEB are discussed. A 347Vac 60W prototype has been simulated and implemented. Simulations and experimental results have verified the feasibility of the proposed STSSEB.

  5. Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

    Science.gov (United States)

    Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

    2017-10-01

    Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. High voltage threshold for stable operation in a dc electron gun

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Masahiro, E-mail: masahiro@post.kek.jp [High Energy Accelerator Research Organization (KEK), Oho, Tsukuba, Ibaraki 305-0801 (Japan); Nishimori, Nobuyuki, E-mail: n-nishim@tagen.tohoku.ac.jp [National Institutes for Quantum and Radiological Science and Technology (QST), Tokai, Naka, Ibaraki 319-1195 (Japan)

    2016-07-04

    We report clear observation of a high voltage (HV) threshold for stable operation in a dc electron gun. The HV hold-off time without any discharge is longer than many hours for operation below the threshold, while it is roughly 10 min above the threshold. The HV threshold corresponds to the minimum voltage where discharge ceases. The threshold increases with the number of discharges during HV conditioning of the gun. Above the threshold, the amount of gas desorption per discharge increases linearly with the voltage difference from the threshold. The present experimental observations can be explained by an avalanche discharge model based on the interplay between electron stimulated desorption (ESD) from the anode surface and subsequent secondary electron emission from the cathode by the impact of ionic components of the ESD molecules or atoms.

  7. Subnanosecond breakdown development in high-voltage pulse discharge: Effect of secondary electron emission

    Science.gov (United States)

    Alexandrov, A. L.; Schweigert, I. V.; Zakrevskiy, Dm. E.; Bokhan, P. A.; Gugin, P.; Lavrukhin, M.

    2017-10-01

    A subnanosecond breakdown in high-voltage pulse discharge may be a key tool for superfast commutation of high power devices. The breakdown in high-voltage open discharge at mid-high pressure in helium was studied in experiment and in kinetic simulations. The kinetic model of electron avalanche development was constructed, based on PIC-MCC simulations, including dynamics of electrons, ions and fast helium atoms, produced by ions scattering. Special attention was paid to electron emission processes from cathode, such as: photoemission by Doppler-shifted resonant photons, produced in excitation processes involving fast atoms; electron emission by ions and fast atoms bombardment of cathode; the secondary electron emission (SEE) by hot electrons from bulk plasma. The simulations show that the fast atoms accumulation is the main reason of emission growth at the early stage of breakdown, but at the final stage, when the voltage on plasma gap diminishes, namely the SEE is responsible for subnanosecond rate of current growth. It was shown that the characteristic time of the current growth can be controlled by the SEE yield. The influence of SEE yield for three types of cathode material (titanium, SiC, and CuAlMg-alloy) was tested. By changing the pulse voltage amplitude and gas pressure, the area of existence of subnanosecond breakdown is identified. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time value as small as τs = 0.4 ns, for the pulse voltage amplitude of 5÷12 kV. An increase of gas pressure from 15 Torr to 30 Torr essentially decreases the time of of current front growth, whereas the pulse voltage variation weakly affects the results.

  8. Successful application of Low Voltage Electron Microscopy to practical materials problems

    Energy Technology Data Exchange (ETDEWEB)

    Bell, David C., E-mail: dcb@seas.harvard.edu [School of Engineering and Applied Sciences, Harvard University, Cambridge, MA (United States); Center for Nanoscale Systems, Harvard University, Cambridge, MA (United States); Mankin, Max; Day, Robert W. [Department of Chemistry and Chemical Biology, Harvard University, Cambridge, MA (United States); Erdman, Natasha [JEOL USA Inc. Peabody, MA (United States)

    2014-10-15

    Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely

  9. Apparatus and Method for Compensating for Process, Voltage, and Temperature Variation of the Time Delay of a Digital Delay Line

    Science.gov (United States)

    Seefeldt, James (Inventor); Feng, Xiaoxin (Inventor); Roper, Weston (Inventor)

    2013-01-01

    A process, voltage, and temperature (PVT) compensation circuit and a method of continuously generating a delay measure are provided. The compensation circuit includes two delay lines, each delay line providing a delay output. The two delay lines may each include a number of delay elements, which in turn may include one or more current-starved inverters. The number of delay lines may differ between the two delay lines. The delay outputs are provided to a combining circuit that determines an offset pulse based on the two delay outputs and then averages the voltage of the offset pulse to determine a delay measure. The delay measure may be one or more currents or voltages indicating an amount of PVT compensation to apply to input or output signals of an application circuit, such as a memory-bus driver, dynamic random access memory (DRAM), a synchronous DRAM, a processor or other clocked circuit.

  10. Method of Manufacturing a Light Emitting, Photovoltaic or Other Electronic Apparatus and System

    Science.gov (United States)

    Ray, William Johnstone (Inventor); Lowenthal, Mark D. (Inventor); Shotton, Neil O. (Inventor); Blanchard, Richard A. (Inventor); Lewandowski, Mark Allan (Inventor); Fuller, Kirk A. (Inventor); Frazier, Donald Odell (Inventor)

    2013-01-01

    The present invention provides a method of manufacturing an electronic apparatus, such as a lighting device having light emitting diodes (LEDs) or a power generating device having photovoltaic diodes. The exemplary method includes forming at least one first conductor coupled to a base; coupling a plurality of substrate particles to the at least one first conductor; converting the plurality of substrate particles into a plurality of diodes; forming at least one second conductor coupled to the plurality of spherical diodes; and depositing or attaching a plurality of substantially spherical lenses suspended in a first polymer, with the lenses and the suspending polymer having different indices of refraction. In some embodiments, the lenses and diodes have a ratio of mean diameters or lengths between about 10:1 and 2:1. In various embodiments, the forming, coupling and converting steps are performed by or through a printing process.

  11. High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

    Science.gov (United States)

    Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

    2017-09-01

    The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

  12. Effect of secondary electron emission on subnanosecond breakdown in high-voltage pulse discharge

    Science.gov (United States)

    Schweigert, I. V.; Alexandrov, A. L.; Gugin, P.; Lavrukhin, M.; Bokhan, P. A.; Zakrevsky, Dm E.

    2017-11-01

    The subnanosecond breakdown in open discharge may be applied for producing superfast high power switches. Such fast breakdown in high-voltage pulse discharge in helium was explored both in experiment and in kinetic simulations. The kinetic model of electron avalanche development was developed using PIC-MCC technique. The model simulates motion of electrons, ions and fast helium atoms, appearing due to ions scattering. It was shown that the mechanism responsible for ultra-fast breakdown development is the electron emission from cathode. The photoemission and emission by ions or fast atoms impact is the main reason of current growth at the early stage of breakdown, but at the final stage, when the voltage on discharge gap drops, the secondary electron emission (SEE) is responsible for subnanosecond time scale of current growth. It was also found that the characteristic time of the current growth τS depends on the SEE yield of the cathode material. Three types of cathode material (titanium, SiC, and CuAlMg-alloy) were tested. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time as small as τS = 0.4 ns, for the pulse voltage amplitude of 5- 12 kV..

  13. The effect of voltage droop on the output of an electrostatic accelerator free electron laser

    CERN Document Server

    Wright, C C; Lucas, J; Stuart, R A

    2000-01-01

    Electrostatic accelerator FEL oscillators when operated with energy recovery offer the prospect of long pulse, single-mode operation with very narrow linewidth at high-power levels. However, special care with wiggler construction, electron beam steering, and collector design is necessary to reduce the fraction of the electron beam lost before depressed collection to a sufficiently small value to stop the output hopping from one longitudinal mode of the cavity to another due to the droop of the terminal accelerating voltage. We are investigating what minimum recovery fraction is required both experimentally and theoretically. We have constructed a pulsed microwave FEM oscillator having an accelerating voltage of 65 kV supplied by a source, which is a capacitor, charged by a low-current, high-voltage supply. By changing the capacitor value, it is easily possible to achieve a range of voltage droop rates. Furthermore, because the gain bandwidth of the FEM is small, only 1 or 2 longitudinal modes are capable of b...

  14. Design and power management of an offshore medium voltage DC microgrid realized through high voltage power electronics technologies and control

    Science.gov (United States)

    Grainger, Brandon Michael

    The growth in the electric power industry's portfolio of Direct Current (DC) based generation and loads have captured the attention of many leading research institutions. Opportunities for using DC based systems have been explored in electric ship design and have been a proven, reliable solution for transmitting bulk power onshore and offshore. To integrate many of the renewable resources into our existing AC grid, a number of power conversions through power electronics are required to condition the equipment for direct connection. Within the power conversion stages, there is always a requirement to convert to or from DC. The AC microgrid is a conceptual solution proposed for integrating various types of renewable generation resources. The fundamental microgrid requirements include the capability of operating in islanding mode and/or grid connected modes. The technical challenges associated with microgrids include (1) operation modes and transitions that comply with IEEE1547 without extensive custom engineering and (2) control architecture and communication. The Medium Voltage DC (MVDC) architecture, explored by the University of Pittsburgh, can be visualized as a special type of DC microgrid. This dissertation is multi-faceted, focused on many design aspects of an offshore DC microgrid. The focal points of the discussion are focused on optimized high power, high frequency magnetic material performance in electric machines, transformers, and DC/DC power converters---all components found within offshore, power system architectures. A new controller design based upon model reference control is proposed and shown to stabilize the electric motor drives (modeled as constant power loads), which serve as the largest power consuming entities in the microgrid. The design and simulation of a state-of-the-art multilevel converter for High Voltage DC (HVDC) is discussed and a component sensitivity analysis on fault current peaks is explored. A power management routine is

  15. An Inexpensive Source of High Voltage

    Science.gov (United States)

    Saraiva, Carlos

    2012-01-01

    As a physics teacher I like recycling old apparatus and using them for demonstrations in my classes. In physics laboratories in schools, sources of high voltage include induction coils or electronic systems that can be bought from companies that sell lab equipment. But these sources can be very expensive. In this article, I will explain how you…

  16. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  17. Ion Back-Bombardment of GaAs Photocathodes Inside DC High Voltage Electron Guns

    CERN Document Server

    Grames, Joseph M; Brittian, Joshua; Charles, Daniel; Clark, Jim; Hansknecht, John; Lynn Stutzman, Marcy; Poelker, Matthew; Surles-Law, Kenneth E

    2005-01-01

    The primary limitation for sustained high quantum efficiency operation of GaAs photocathodes inside DC high voltage electron guns is ion back-bombardment of the photocathode. This process results from ionization of residual gas within the cathode/anode gap by the extracted electron beam, which is subsequently accelerated backwards to the photocathode. The damage mechanism is believed to be either destruction of the negative electron affinity condition at the surface of the photocathode or damage to the crystal structure by implantation of the bombarding ions. This work characterizes ion formation within the anode/cathode gap for gas species typical of UHV vacuum chambers (i.e., hydrogen, carbon monoxide and methane). Calculations and simulations are performed to determine the ion trajectories and stopping distance within the photocathode material. The results of the simulations are compared with test results obtained using a 100 keV DC high voltage GaAs photoemission gun and beamline at currents up to 10 mA D...

  18. Electronics drivers for high voltage dielectric electro active polymer (DEAP) applications

    Science.gov (United States)

    Zhang, Zhe; Andersen, Michael A. E.

    2015-04-01

    Dielectric electro active polymer (DEAP) can be used in actuation, sensing and energy harvesting applications, but driving the DEAP based actuators and generators has three main challenges from a power electronics standpoint, i.e. high voltage (around 2.5 kV), nonlinearity, and capacitive behavior. In this paper, electronics divers for heating valves, loud speakers, incremental motors, and energy harvesting are reviewed, studied and developed in accordance with their corresponding specifications. Due to the simplicity and low power capacity (below 10W), the reversible Fly-back converters with both magnetic and piezoelectric transformers are employed for the heating valve and incremental motor application, where only ON/OFF regulation is adopted for energy saving; as for DEAP based energy harvesting, the noisolated Buck/Boost converter is used, due to the system high power capacity (above 100W), but the voltage balancing across the series-connected high voltage IGBTs is a critical issue and accordingly a novel gate driver circuitry is proposed and equipped; due to the requirements of the audio products, such as low distortion and noise, the multi-level Buck converter based Class-D amplifier, because of its high control linearity, is implemented for the loud speaker applications. A synthesis among those converter topologies and control techniques is given; therefore, for those DEAP based applications, their diversity and similarity of electronics drivers, as well as the key technologies employed are analyzed. Therefore a whole picture of how to choose the proper topologies can be revealed. Finally, the design guidelines in order to achieve high efficiency and reliability are discussed.

  19. Calibration of Electrochemical Capacitance-voltage Method on Pyramid Texture Surface Using Scanning Electron Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Komatsu, Y.; Cesar, I. [ECN Solar Energy, P.O.Box 1, 1755ZG Petten (Netherlands); Harata, D. [Department of Electronic Science and Engineering, Kyoto University, Nishikyo-ku, Kyoto 615-8530 (Japan); Schuring, E.W. [ECN Environment and Energy Engineering, P.O.Box 1, 1755ZG Petten (Netherlands); Vlooswijk, A.H.G.; Venema, P.R. [Tempress Systems BV, Radeweg 31, 8171MD Vaassen (Netherlands); Katori, S.; Fujita, S. [Photonics and Electronics Science and Engineering Center, Kyoto University, Nishikyo-ku, Kyoto 615-8530 (Japan)

    2013-07-01

    The electrochemical capacitance-voltage (ECV) technique can practically profile carrier concentrations on textured surfaces, but reliable calibration of the surface area is strongly demanded since it plays a decisive role in calculating both the carrier concentration and the profiling depth. In this work, we calibrate the area factor of pyramidally textured surfaces by comparing ECV profiles with cross-sectional scanning electron microscopy image, and found out it is 1.66, and not 1.73 which was formerly assumed. Furthermore, the calibrated area factor was applied to POCl3 and BBr3 diffusions which resulted in comparable diffusion profiles for both textured and polished surfaces.

  20. X-ray microanalysis of biological specimens by high voltage electron microscopy.

    Science.gov (United States)

    Nagata, Tetsuji

    2004-01-01

    For the purpose of analyzing and imaging chemical components of cells and tissues at the electron microscopic level, 3 fundamental methods are available, chemical, physical and biological. Among the physical methods, two methods qualifying and quantifying the elements in the structural components are very often employed. The first method is radioautography which can demonstrate the localization of radiolabeled compounds which were incorporated into cells and tissues after the administration of radiolabeled compounds. The second method is X-ray microanalysis which can qualitatively analyze and quantify the total amounts of elements present in cells and tissues. We have developed the two methodologies in combination with intermediate high or high voltage transmission electron microscopy (200-400 kV) and applied them to various kinds of organic and inorganic compounds present in biological materials. As for the first method, radioautography, I had already contributed a chapter to PHC (37/2). To the contrary, this review deals with another method, X-ray microanalysis, using semi-thin sections and intermediate high voltage electron microscopy developed in our laboratory. X-ray microanalysis is a useful method to qualify and quantify basic elements in biological specimens. We first quantified the end-products of histochemical reactions such as Ag in radioautographs, Ce in phosphatase reaction and Au in colloidal gold immunostaining using semithin sections and quantified the reaction products observing by intermediate high voltage transmission electron microscopy at accelerating voltages from 100 to 400 kV. The P/B ratios of all the end products Ag, Ce and Au increased with the increase of the accelerating voltages from 100 to 400 kV. Then we analyzed various trace elements such as Zn, Ca, S and Cl which originally existed in cytoplasmic matrix or cell organelles of various cells, or such elements as Al which was absorbed into cells and tissues after oral administration

  1. Tunable Radiation Response in Hybrid Organic-Inorganic Gate Dielectrics for Low-Voltage Graphene Electronics.

    Science.gov (United States)

    Arnold, Heather N; Cress, Cory D; McMorrow, Julian J; Schmucker, Scott W; Sangwan, Vinod K; Jaber-Ansari, Laila; Kumar, Rajan; Puntambekar, Kanan P; Luck, Kyle A; Marks, Tobin J; Hersam, Mark C

    2016-03-02

    Solution-processed semiconductor and dielectric materials are attractive for future lightweight, low-voltage, flexible electronics, but their response to ionizing radiation environments is not well understood. Here, we investigate the radiation response of graphene field-effect transistors employing multilayer, solution-processed zirconia self-assembled nanodielectrics (Zr-SANDs) with ZrOx as a control. Total ionizing dose (TID) testing is carried out in situ using a vacuum ultraviolet source to a total radiant exposure (RE) of 23.1 μJ/cm(2). The data reveal competing charge density accumulation within and between the individual dielectric layers. Additional measurements of a modified Zr-SAND show that varying individual layer thicknesses within the gate dielectric tuned the TID response. This study thus establishes that the radiation response of graphene electronics can be tailored to achieve a desired radiation sensitivity by incorporating hybrid organic-inorganic gate dielectrics.

  2. Electronics drivers for high voltage dielectric electro active polymer (DEAP) applications

    DEFF Research Database (Denmark)

    Zhang, Zhe; Andersen, Michael A. E.

    2015-01-01

    Dielectric electro active polymer (DEAP) can be used in actuation, sensing and energy harvesting applications, but driving the DEAP based actuators and generators has three main challenges from a power electronics standpoint, i.e. high voltage ( around 2.5 kV), nonlinearity, and capacitive behavior...... magnetic and piezoelectric transformers are employed for the heating valve and incremental motor application, where only ON/OFF regulation is adopted fo r energy saving; as for DEAP based energy harvesting, the no - isolated Buck/Boost converter is used, due to the system high power capacity (above 100W......, because of its high control linearity, is implemented for the loud speaker application s . A synthesis among those converter topologies and control techniques is given; therefore, for those DEAP based applications, their diversity and similarity of electronics drivers, as well as the key technologies...

  3. Power electronic solutions for interfacing offshore wind turbine generators to medium voltage DC collection grids

    Science.gov (United States)

    Daniel, Michael T.

    Here in the early 21st century humanity is continuing to seek improved quality of life for citizens throughout the world. This global advancement is providing more people than ever with access to state-of-the-art services in areas such as transportation, entertainment, computing, communication, and so on. Providing these services to an ever-growing population while considering the constraints levied by continuing climate change will require new frontiers of clean energy to be developed. At the time of this writing, offshore wind has been proven as both a politically and economically agreeable source of clean, sustainable energy by northern European nations with many wind farms deployed in the North, Baltic, and Irish Seas. Modern offshore wind farms are equipped with an electrical system within the farm itself to aggregate the energy from all turbines in the farm before it is transmitted to shore. This collection grid is traditionally a 3-phase medium voltage alternating current (MVAC) system. Due to reactive power and other practical constraints, it is preferable to use a medium voltage direct current (MVDC) collection grid when siting farms >150 km from shore. To date, no offshore wind farm features an MVDC collection grid. However, MVDC collection grids are expected to be deployed with future offshore wind farms as they are sited further out to sea. In this work it is assumed that many future offshore wind farms may utilize an MVDC collection grid to aggregate electrical energy generated by individual wind turbines. As such, this work presents both per-phase and per-pole power electronic converter systems suitable for interfacing individual wind turbines to such an MVDC collection grid. Both interfaces are shown to provide high input power factor at the wind turbine while providing DC output current to the MVDC grid. Common mode voltage stress and circulating currents are investigated, and mitigation strategies are provided for both interfaces. A power sharing

  4. Angle selective backscattered electron contrast in the low-voltage scanning electron microscope: Simulation and experiment for polymers

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Q., E-mail: qwan2@sheffield.ac.uk [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Masters, R.C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Lidzey, D. [Department of Physics and Astronomy, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Abrams, K.J. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Dapor, M. [European Centre for Theoretical Studies in Nuclear Physics and Related Areas (ECT-FBK) and Trento Institute for Fundamental Physics and Applications (TIFPA-INFN), via Sommarive 18, I-38123 Trento (Italy); Plenderleith, R.A. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Rimmer, S. [Department of Chemistry, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Claeyssens, F.; Rodenburg, C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom)

    2016-12-15

    Recently developed detectors can deliver high resolution and high contrast images of nanostructured carbon based materials in low voltage scanning electron microscopes (LVSEM) with beam deceleration. Monte Carlo Simulations are also used to predict under which exact imaging conditions purely compositional contrast can be obtained and optimised. This allows the prediction of the electron signal intensity in angle selective conditions for back-scattered electron (BSE) imaging in LVSEM and compares it to experimental signals. Angle selective detection with a concentric back scattered (CBS) detector is considered in the model in the absence and presence of a deceleration field, respectively. The validity of the model prediction for both cases was tested experimentally for amorphous C and Cu and applied to complex nanostructured carbon based materials, namely a Poly(N-isopropylacrylamide)/Poly(ethylene glycol) Diacrylate (PNIPAM/PEGDA) semi-interpenetration network (IPN) and a Poly(3-hexylthiophene-2,5-diyl) (P3HT) film, to map nano-scale composition and crystallinity distribution by avoiding experimental imaging conditions that lead to a mixed topographical and compositional contrast - Highlights: • An optimised model for nano-scale analysis of beam sensitive materials by LVSEM. • Simulation and separation of composition and topography in a CBS detector. • Selective angle backscattered electron collection for mapping of polymers.

  5. CHARACTERIZATION OF Pro-Beam LOW VOLTAGE ELECTRON BEAM WELDING MACHINE

    Energy Technology Data Exchange (ETDEWEB)

    Burgardt, Paul [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Pierce, Stanley W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-18

    The purpose of this paper is to present and discuss data related to the performance of a newly acquired low voltage electron beam welding machine. The machine was made by Pro-Beam AG &Co. KGaA of Germany. This machine was recently installed at LANL in building SM -39; a companion machine was installed in the production facility. The PB machine is substantially different than the EBW machines typically used at LANL and therefore, it is important to understand its characteristics as well as possible. Our basic purpose in this paper is to present basic machine performance data and to compare those with similar results from the existing EBW machines. It is hoped that this data will provide a historical record of this machine’s characteristics as well as possibly being helpful for transferring welding processes from the old EBW machines to the PB machine or comparable machines that may be purchased in the future.

  6. Protonic/electronic hybrid oxide transistor gated by chitosan and its full-swing low voltage inverter applications

    Energy Technology Data Exchange (ETDEWEB)

    Chao, Jin Yu [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zhu, Li Qiang, E-mail: lqzhu@nimte.ac.cn; Xiao, Hui [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Yuan, Zhi Guo, E-mail: ncityzg@163.com [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China)

    2015-12-21

    Modulation of charge carrier density in condensed materials based on ionic/electronic interaction has attracted much attention. Here, protonic/electronic hybrid indium-zinc-oxide (IZO) transistors gated by chitosan based electrolyte were obtained. The chitosan-based electrolyte illustrates a high proton conductivity and an extremely strong proton gating behavior. The transistor illustrates good electrical performances at a low operating voltage of ∼1.0 V such as on/off ratio of ∼3 × 10{sup 7}, subthreshold swing of ∼65 mV/dec, threshold voltage of ∼0.3 V, and mobility of ∼7 cm{sup 2}/V s. Good positive gate bias stress stabilities are obtained. Furthermore, a low voltage driven resistor-loaded inverter was built by using an IZO transistor in series with a load resistor, exhibiting a linear relationship between the voltage gain and the supplied voltage. The inverter is also used for decreasing noises of input signals. The protonic/electronic hybrid IZO transistors have potential applications in biochemical sensors and portable electronics.

  7. The G0 experiment: Apparatus for parity-violating electron scattering measurements at forward and backward angles

    Energy Technology Data Exchange (ETDEWEB)

    Androic, D. [Department of Physics, University of Zagreb, Zagreb HR-41001 (Croatia); Armstrong, D.S. [Department of Physics, College of William and Mary, Williamsburg, VA 23187 (United States); Arvieux, J. [Institut de Physique Nucleaire d' Orsay, F-91406 ORSAY-Cedex (France); Asaturyan, R. [Yerevan Physics Institute, Alikhanian Brothers 2, Yerevan 375036 (Armenia); Averett, T.D.; Bailey, S.L. [Department of Physics, College of William and Mary, Williamsburg, VA 23187 (United States); Batigne, G. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Grenoble (France); Beck, D.H., E-mail: dhbeck@illinois.edu [Loomis Laboratory of Physics, University of Illinois, 1110 West Green Street, Urbana, IL 61801 (United States); Beise, E.J. [Department of Physics, University of Maryland, College Park, MD 20472 (United States); Benesch, J. [Thomas Jefferson National Accelerator Facility, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Benmokhtar, F. [Department of Physics, Carnegie Mellon University, Pittsburgh, PA 15213 (United States); Department of Physics, University of Maryland, College Park, MD 20472 (United States); Bimbot, L. [Institut de Physique Nucleaire d' Orsay, F-91406 ORSAY-Cedex (France); Birchall, J. [Department of Physics, University of Manitoba, Winnipeg, Manitoba, Canada R3T 2N2 (Canada); Biselli, A. [Department of Physics, Carnegie Mellon University, Pittsburgh, PA 15213 (United States); Bosted, P. [Thomas Jefferson National Accelerator Facility, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Breuer, H. [Department of Physics, University of Maryland, College Park, MD 20472 (United States); Brindza, P. [Thomas Jefferson National Accelerator Facility, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Capuano, C.L. [Department of Physics, College of William and Mary, Williamsburg, VA 23187 (United States)

    2011-08-01

    In the G0 experiment, performed at Jefferson Lab, the parity-violating elastic scattering of electrons from protons and quasi-elastic scattering from deuterons is measured in order to determine the neutral weak currents of the nucleon. Asymmetries as small as 1 part-per-million in the scattering of a polarized electron beam are determined using a dedicated apparatus. It consists of specialized beam monitoring and control systems, a cryogenic hydrogen (or deuterium) target, and a superconducting, toroidal magnetic spectrometer equipped with plastic scintillation and aerogel Cherenkov detectors, as well as fast readout electronics for the measurement of individual events. The overall design and performance of this experimental system is discussed.

  8. The G0 Experiment: Apparatus for Parity-Violating Electron Scattering Measurements at Forward and Backward Angles

    CERN Document Server

    Androic, D; Arvieux, J; Asaturyan, R; Averett, T D; Bailey, S L; Batigne, G; Beck, D H; Beise, E J; Benesch, J; Benmokhtar, F; Bimbot, L; Birchall, J; Biselli, A; Bosted, P; Breuer, H; Brindza, P; Capuano, C L; Carlini, R D; Carr, R; Chant, N; Chao, Y -C; Clark, R; Coppens, A; Covrig, S D; Cowley, A; Dale, D; Davis, C A; Ellis, C; Falk, W R; Fenker, H; Finn, J M; Forest, T; Franklin, G; Frascaria, R; Furget, C; Gaskell, D; Gericke, M T W; Grames, J; Griffioen, K A; Grimm, K; Guillard, G; Guillon, B; Guler, H; Gustafsson, K; Hannelius, L; Hansknecht, J; Hasty, R D; Allen, A M Hawthorne; Horn, T; Ito, T M; Johnston, K; Jones, M; Kammel, P; Kazimi, R; King, P M; Kolarkar, A; Korkmaz, E; Korsch, W; Kox, S; Kuhn, J; Lachniet, J; Laszewski, R; Lee, L; Lenoble, J; Liatard, E; Liu, J; Lung, A; MacLachlan, G A; Mammei, J; Marchand, D; Martin, J W; Mack, D J; McFarlane, K W; McKee, D W; McKeown, R D; Merchez, F; Mihovilovic, M; Micherdzinska, A; Mkrtchyan, H; Moffit, B; Morlet, M; Muether, M; Musson, J; Nakahara, K; Neveling, R; Niccolai, S; Nilsson, D; Ong, S; Page, S A; Papavassiliou, V; Pate, S F; Phillips, S K; Pillot, P; Pitt, M L; Poelker, M; Porcelli, T A; Quemener, G; Quinn, B P; Ramsay, W D; Rauf, A W; Real, J -S; Ries, T; Roos, J Roche P; Rutledge, G A; Schaub, J; Secrest, J; Seva, T; Simicevic, N; Smith, G R; Spayde, D T; Stepanyan, S; Stutzman, M; Suleiman, R; Tadevosyan, V; Tieulent, R; van de Wiele, J; van Oers, W T H; Versteegen, M; Voutier, E; Vulcan, W F; Wells, S P; Warren, G; Williamson, S E; Woo, R J; Wood, S A; Yan, C; Yun, J; Zeps, V

    2011-01-01

    In the G0 experiment, performed at Jefferson Lab, the parity-violating elastic scattering of electrons from protons and quasi-elastic scattering from deuterons is measured in order to determine the neutral weak currents of the nucleon. Asymmetries as small as 1 part per million in the scattering of a polarized electron beam are determined using a dedicated apparatus. It consists of specialized beam-monitoring and control systems, a cryogenic hydrogen (or deuterium) target, and a superconducting, toroidal magnetic spectrometer equipped with plastic scintillation and aerogel Cerenkov detectors, as well as fast readout electronics for the measurement of individual events. The overall design and performance of this experimental system is discussed.

  9. Modulation of the Dirac point voltage of graphene by ion-gel dielectrics and its application to soft electronic devices.

    Science.gov (United States)

    Kim, Un Jeong; Kim, Tae Geun; Shim, Youngseon; Park, Yeonsang; Lee, Chang-Won; Kim, Tae-Ho; Lee, Hyo Sug; Chung, Dae-Young; Kihm, Jineun; Roh, Young-Geun; Lee, Jaesoong; Son, Hyungbin; Kim, Sangsig; Hur, Jaehyun; Hwang, Sung Woo

    2015-01-27

    We investigated systematic modulation of the Dirac point voltage of graphene transistors by changing the type of ionic liquid used as a main gate dielectric component. Ion gels were formed from ionic liquids and a non-triblock-copolymer-based binder involving UV irradiation. With a fixed cation (anion), the Dirac point voltage shifted to a higher voltage as the size of anion (cation) increased. Mechanisms for modulation of the Dirac point voltage of graphene transistors by designing ionic liquids were fully understood using molecular dynamics simulations, which excellently matched our experimental results. It was found that the ion sizes and molecular structures play an essential role in the modulation of the Dirac point voltage of the graphene. Through control of the position of their Dirac point voltages on the basis of our findings, complementary metal-oxide-semiconductor (CMOS)-like graphene-based inverters using two different ionic liquids worked perfectly even at a very low source voltage (V(DD) = 1 mV), which was not possible for previous works. These results can be broadly applied in the development of low-power-consumption, flexible/stretchable, CMOS-like graphene-based electronic devices in the future.

  10. Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Murata, Kazuyoshi, E-mail: kazum@nips.ac.jp [National Institute for Physiological Sciences, Okazaki, Aichi 444-8585 (Japan); Esaki, Masatoshi; Ogura, Teru [Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811 (Japan); Arai, Shigeo; Yamamoto, Yuta; Tanaka, Nobuo [Ecotopia Science Institute, Nagoya University, Nagoya, Aichi 464-8603 (Japan)

    2014-11-15

    Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ∼3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. - Highlights: • High voltage TEM and STEM tomography were compared to visualize whole yeast cells. • 1-MeV STEM-BF tomography had significant improvements in image contrast and SNR. • 1-MeV STEM tomography showed less specimen shrinkage than the TEM tomography. • KMnO{sub 4} post-treatment permitted segmenting the major cellular components.

  11. Electron emission of cathode holder of vacuum diode of an intense electron-beam accelerator and its effect on the output voltage

    Directory of Open Access Journals (Sweden)

    Xin-Bing Cheng

    2011-04-01

    Full Text Available The vacuum diode which is used to generate relativistic electron beams is one of the most important parts of a pulsed-power modulator. In this paper, the electron emission of cathode holder of a vacuum diode and its effect on the output voltage is investigated by experiments on an intense electron-beam accelerator with 180 ns full width at half maximum and 200–500 kV output voltage. First, the field emission is analyzed and the electric field of the vacuum chamber is calculated. Then, the flatness of the output voltage is discussed before and after adding an insulation plate when a water load is used. It is found that the electron emission at the edges of the cathode holder is the main reason to cause the change of the flatness. Last, a piece of polyester film is used as a target to further show the electron emission of the cathode holder. This analysis shows that decreasing the electron emission of the cathode holder in such a pulse power modulator could be a good way to improve the quality of the output voltage.

  12. Brassinosteroids accelerate recovery of photosynthetic apparatus from cold stress by balancing the electron partitioning, carboxylation and redox homeostasis in cucumber.

    Science.gov (United States)

    Jiang, Yu-Ping; Huang, Li-Feng; Cheng, Fei; Zhou, Yan-Hong; Xia, Xiao-Jian; Mao, Wei-Hua; Shi, Kai; Yu, Jing-Quan

    2013-05-01

    The aim of this study was to examine the role of brassinosteroids (BRs) in protecting the photosynthetic apparatus from cold-induced damage in cucumber (Cucumis sativus) plants. Recovery at both high light (HL) and low light (LL) after a cooling at 10/7°C induced irreversible inhibition of CO2 assimilation, photoinhibition at photosystem I (PSI) and inhibition of enzyme activities of Calvin cycle and ascorbate (AsA)-reduced glutathione (GSH) cycle, followed by accumulation of H2 O2 and malondialdehyde. However, cold-induced photoinhibition at PSII was fully recovered at LL but not at HL. Meanwhile, recovery at HL increased electron flux to O2 -dependent alternative pathway [Ja(O2 -dependent)]. Foliar application of 24-epibrassinolide (EBR) accelerated recovery from photoinhibition of PSII but not of PSI. EBR also significantly increased CO2 assimilation, activity of Calvin cycle enzymes and electron flux to carbon reduction [Je(PCR)], with a concomitant decrease in Ja(O2 -dependent); meanwhile EBR increased the activity of enzymes in AsA-GSH cycle and cellular redox states. However, the positive effect of EBR on plant recovery was observed only at HL, but not LL. These results indicate that BR accelerates the recovery of photosynthetic apparatus at HL by activation of enzymes in Calvin cycle and increasing the antioxidant capacity, which in turn mitigate the photooxidative stress and the inhibition of plant growth during the recovery. Copyright © Physiologia Plantarum 2012.

  13. LOW-VOLTAGE FIELD-EMISSION SCANNING ELECTRON-MICROSCOPY OF NON-COATED GUINEA-PIG HAIR CELL STEREOCILIA

    NARCIS (Netherlands)

    DUNNEBIER, EA; SEGENHOUT, JM; KALICHARAN, D; JONGEBLOED, WL; WIT, HP; ALBERS, FWJ

    1995-01-01

    The stereociliar structures of the guinea-pig cochlear organ of Corti were studied at low-voltage (1-5 kV) with field-emission scanning electron microscope (SEM) using various pre- and post-fixation methods, such as OTOTO (OsO4/thiocarbohydrazide/OsO4/thiocarbohydrazide/OsO4) and TAO (tannic

  14. Experimental Evaluation and Comparison of Thermal Conductivity of High-Voltage Insulation Materials for Vacuum Electronic Devices

    Science.gov (United States)

    Suresh, C.; Srikrishna, P.

    2017-07-01

    Vacuum electronic devices operate with very high voltage differences between their sub-assemblies which are separated by very small distances. These devices also emit large amounts of heat that needs to be dissipated. Hence, there exists a requirement for high-voltage insulators with good thermal conductivity for voltage isolation and efficient heat dissipation. However, these voltage insulators are generally poor conductors of heat. In the present work, an effort has been made to obtain good high-voltage insulation materials with substantial improvement in their thermal conductivity. New mixtures of composites were formed by blending varying percentages (by volumes) of aluminum nitride powders with that of neat room-temperature vulcanizing (RTV) silicone elastomer compound. In this work, a thermal conductivity test setup has been devised for the quantification of the thermal conductivity of the insulators. The thermal conductivities and high-voltage isolation capabilities of various blended composites were quantified and were compared with that of neat RTV to evaluate the relative improvement.

  15. Operation Manual of the high voltage generator of the Pelletron electron accelerator; Manual de operacion del generador de alto voltaje del acelerador de electrones Pelletron

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez M, V.; Lopez V, H.; Alba P, U

    1988-04-15

    The first version of a manual to operate the generator of high voltage generator of the Pelletron electron accelerator built in the ININ is presented. Since this generator has several components and/or elements, the one manual present has the purpose that the armed one or maintenance of anyone on its parts, is carried out in an orderly and efficient way. (Author)

  16. Estimation of visibility of phase contrast with extraction voltages for field emission gun electron microscopes

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Xing, E-mail: xmeng101@gmail.com

    2017-02-15

    Estimation was made for visibility of phase contrast with varying extraction voltages. The resulting decay rates of visibility show that images with low image contrast from cryo EM will be seriously impacted with high extraction voltages. - Highlights: • Cryo EM • Phase contrast • Extraction votage.

  17. Biasing Voltage Dependence of Sensitivity of Electron Beam Evaporated SnO2 Thin Film CO Sensor

    Directory of Open Access Journals (Sweden)

    Sardar M. Ayub Durrani

    2006-09-01

    Full Text Available Thin films of tin oxide were deposited by electron beam evaporation. The effectsof the sensor biasing voltage and film thickness on the CO-sensing of tin oxide thin filmswere investigated. The films were characterized using X-ray diffraction and X-rayphotoelectron spectroscopy All the films were found to be amorphous. The current-voltagecharacteristic of the sensor in air has shown that semiconductor-metal interface formsSchottky barrier. It was found that the CO-sensing properties depend on the sensor biasingvoltage and film thickness. For lower biasing voltages the sensitivity was much higher thanfor the higher voltages. It was found that the sensitivity of the films to CO increased withthe film thickness.

  18. Method and apparatus for a high-resolution three dimensional confocal scanning transmission electron microscope

    Science.gov (United States)

    de Jonge, Niels [Oak Ridge, TN

    2010-08-17

    A confocal scanning transmission electron microscope which includes an electron illumination device providing an incident electron beam propagating in a direction defining a propagation axis, and a precision specimen scanning stage positioned along the propagation axis and movable in at least one direction transverse to the propagation axis. The precision specimen scanning stage is configured for positioning a specimen relative to the incident electron beam. A projector lens receives a transmitted electron beam transmitted through at least part of the specimen and focuses this transmitted beam onto an image plane, where the transmitted beam results from the specimen being illuminated by the incident electron beam. A detection system is placed approximately in the image plane.

  19. Improving the output voltage waveform of an intense electron-beam accelerator based on helical type Blumlein pulse forming line

    Directory of Open Access Journals (Sweden)

    Xin-Bing Cheng

    2010-07-01

    Full Text Available The Blumlein pulse forming line (BPFL consisting of an inner coaxial pulse forming line (PFL and an outer coaxial PFL is widely used in the field of pulsed power, especially for intense electron-beam accelerators (IEBA. The output voltage waveform determines the quality and characteristics of the output beam current of the IEBA. Comparing with the conventional BPFL, an IEBA based on a helical type BPFL can increase the duration of the output voltage in the same geometrical volume. However, for the helical type BPFL, the voltage waveform on a matched load may be distorted which influences the electron-beam quality. In this paper, an IEBA based on helical type BPFL is studied theoretically. Based on telegrapher equations of the BPFL, a formula for the output voltage of IEBA is obtained when the transition section is taken into account, where the transition section is between the middle cylinder of BPFL and the load. From the theoretical analysis, it is found that the wave impedance and transit time of the transition section influence considerably the main pulse voltage waveform at the load, a step is formed in front of the main pulse, and a sharp spike is also formed at the end of the main pulse. In order to get a well-shaped square waveform at the load and to improve the electron-beam quality of such an accelerator, the wave impedance of the transition section should be equal to that of the inner PFL of helical type BPFL and the transit time of the transition section should be designed as short as possible. Experiments performed on an IEBA with the helical type BPFL show reasonable agreement with theoretical analysis.

  20. Modeling of high composition AlGaN channel high electron mobility transistors with large threshold voltage

    Energy Technology Data Exchange (ETDEWEB)

    Bajaj, Sanyam, E-mail: bajaj.10@osu.edu; Hung, Ting-Hsiang; Akyol, Fatih; Nath, Digbijoy; Rajan, Siddharth [Department of Electrical and Computer Engineering, The Ohio State University, Columbus, Ohio 43210 (United States)

    2014-12-29

    We report on the potential of high electron mobility transistors (HEMTs) consisting of high composition AlGaN channel and barrier layers for power switching applications. Detailed two-dimensional (2D) simulations show that threshold voltages in excess of 3 V can be achieved through the use of AlGaN channel layers. We also calculate the 2D electron gas mobility in AlGaN channel HEMTs and evaluate their power figures of merit as a function of device operating temperature and Al mole fraction in the channel. Our models show that power switching transistors with AlGaN channels would have comparable on-resistance to GaN-channel based transistors for the same operation voltage. The modeling in this paper shows the potential of high composition AlGaN as a channel material for future high threshold enhancement mode transistors.

  1. An improved control method of power electronic converters in low voltage micro-grid

    DEFF Research Database (Denmark)

    Xiaofeng, Sun; Qingqiu, Lv; Yanjun, Tian

    2011-01-01

    With the increasing acceptance, micro-grid, combined with distributed generation (DG), may be operated in two modes: grid-connected mode and island mode. In grid connected mode, energy management is the control objective. While in island mode, the control of Voltage and frequency will take...... the place. The conventional droop control can perform the energy management in grid-connected mode, but may not so effective when micro-grid transferring between grid-connected mode and island mode. The paper analysis the micro-grid in different modes (Conventional droop control, Voltage reference...... compensation, Constant power output mode, Phase adjustment mode), and then proposes an overall control strategy for the micro-grid. The voltage reference compensation would minimize the steady-state error on the nominated operation point; the coordinate control of voltage and frequency with a feed forward...

  2. Electron Transport in Graphene Nanoribbon Field-Effect Transistor under Bias and Gate Voltages: Isochemical Potential Approach.

    Science.gov (United States)

    Yun, Jeonghun; Lee, Geunsik; Kim, Kwang S

    2016-07-07

    Zigzag graphene nanoribbon (zGNR) of narrow width has a moderate energy gap in its antiferromagnetic ground state. So far, first-principles electron transport calculations have been performed using nonequilibrium Green function (NEGF) method combined with density functional theory (DFT). However, the commonly practiced bottom-gate control has not been studied computationally due to the need to simulate an electron reservoir that fixes the chemical potential of electrons in the zGNR and electrodes. Here, we present the isochemical potential scheme to describe the top/back-gate effect using external potential. Then, we examine the change in electronic state under the modulation of chemical potential and the subsequent electron transport phenomena in zGNR transistor under substantial top-/back-gate and bias voltages. The gate potential can activate the device states resulting in a boosted current. This gate-controlled current-boosting could be utilized for designing novel zGNR field effect transistors (FETs).

  3. Development of multi-channel apparatus for electron-atom Compton scattering to study the momentum distribution of atoms in a molecule.

    Science.gov (United States)

    Yamazaki, Masakazu; Hosono, Masaki; Tang, Yaguo; Takahashi, Masahiko

    2017-06-01

    We have developed multi-channel apparatus for electron-atom Compton scattering to study the momentum distribution of atoms in a molecule. It combines the features of both a spherical electron energy analyzer and a large-area position sensitive detector, thereby having an ability to cover almost completely the azimuthal angle range available for quasi-elastic electron Rutherford backscattering at an angle of 135°. Details and performance of the apparatus are reported, together with experimental results measured for Xe and CH4 at an incident electron energy of 2 keV. In particular, it is shown that the instrumental sensitivity is remarkably high, which has increased the signal count rate by nearly three orders of magnitude compared to existing setups. This technical progress would be useful for advancing atomic momentum spectroscopy studies.

  4. Reliability Analysis of a Low Voltage Power Supply Design for the Front-End Electronics of the Atlas Tile Calorimeter

    CERN Document Server

    Drake, G; The ATLAS collaboration; Gopalakrishnan, A; Mahadik, S; Mellado, B; Proudfoot, J

    2012-01-01

    –We present a reliability study on a new low voltage power supply design for the front-end electronics of the ATLAS Tile Calorimeter. Using the reliability data from the manufacturers of the components, we derive an estimate of the expected number of failures per year during the normal operating lifetime of the power supply bricks. This may be useful for other power supply designs or front-end electronics designs where high reliability is required. We discuss the factors in the design that limit reliability, and present conclusions for improvements to the power distribution system for the LHC Phase 2 upgrade.

  5. Reliability Analysis of a Low Voltage Power Supply Design for the Front-End Electronics of the ATLAS Tile Calorimeter

    CERN Document Server

    Senthilkumaran, A; The ATLAS collaboration; Gopalakrishnan, A; Mahadik, S; Drake, G; Proudfoot, J

    2012-01-01

    We present a reliability study on a new low voltage power supply design for the front-end electronics of the ATLAS Tile Calorimeter. Using the reliability data from the manufacturers of the components, we derive an estimate of the expected number of failures per year during the normal operating lifetime of the power supply bricks. We will illustrate the technique, which may be useful for other power supply designs or front-end electronics designs where high reliability is required. We discuss the factors in the design that limit reliability, and present our preliminary design work for improvements in the power distribution system for the LHC Phase 2 upgrade.

  6. Method of automatic measurement and focus of an electron beam and apparatus therefor

    Science.gov (United States)

    Giedt, Warren H.; Campiotti, Richard

    1996-01-01

    An electron beam focusing system, including a plural slit-type Faraday beam trap, for measuring the diameter of an electron beam and automatically focusing the beam for welding. Beam size is determined from profiles of the current measured as the beam is swept over at least two narrow slits of the beam trap. An automated procedure changes the focus coil current until the focal point location is just below a workpiece surface. A parabolic equation is fitted to the calculated beam sizes from which optimal focus coil current and optimal beam diameter are determined.

  7. Method of automatic measurement and focus of an electron beam and apparatus therefore

    Science.gov (United States)

    Giedt, W.H.; Campiotti, R.

    1996-01-09

    An electron beam focusing system, including a plural slit-type Faraday beam trap, for measuring the diameter of an electron beam and automatically focusing the beam for welding is disclosed. Beam size is determined from profiles of the current measured as the beam is swept over at least two narrow slits of the beam trap. An automated procedure changes the focus coil current until the focal point location is just below a workpiece surface. A parabolic equation is fitted to the calculated beam sizes from which optimal focus coil current and optimal beam diameter are determined. 12 figs.

  8. Apparent wavelengths of the Oslo electron diffraction apparatus according to diffraction patterns from gaseous benzene

    Science.gov (United States)

    Gundersen, Snefrid; Strand, Tor G.; Volden, Hans Vidar

    1995-02-01

    The electron wavelength of the short camera distance electron diffraction diagrams of benzene was calibrated against the CC distance of the molecule. This wavelength, when applied to the long camera distance data, repeatedly gives a CC distance about 0.3% longer than the applied calibration distance. The effect is demonstrated by the analysis of benzene data from eight plates recorded at each of the two applied camera distances. Our presently applied photometer procedures and numerical data reduction, which includes digital Fourier filtering of the photometer data, are described. A new variant of the autocorrelation power spectrum is illustrated for the benzene data.

  9. Light shielding apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Richard Dean; Thom, Robert Anthony

    2017-10-10

    A light shielding apparatus for blocking light from reaching an electronic device, the light shielding apparatus including left and right support assemblies, a cross member, and an opaque shroud. The support assemblies each include primary support structure, a mounting element for removably connecting the apparatus to the electronic device, and a support member depending from the primary support structure for retaining the apparatus in an upright orientation. The cross member couples the left and right support assemblies together and spaces them apart according to the size and shape of the electronic device. The shroud may be removably and adjustably connectable to the left and right support assemblies and configured to take a cylindrical dome shape so as to form a central space covered from above. The opaque shroud prevents light from entering the central space and contacting sensitive elements of the electronic device.

  10. Modeling and Analysis of the Common Mode Voltage in a Cascaded H-Bridge Electronic Power Transformer

    Directory of Open Access Journals (Sweden)

    Yun Yang

    2017-09-01

    Full Text Available Electronic power transformers (EPTs have been identified as emerging intelligent electronic devices in the future smart grid, e.g., the Energy Internet, especially in the application of renewable energy conversion and management. Considering that the EPT is directly connected to the medium-voltage grid, e.g., a10 kV distribution system, and its cascaded H-bridges structure, the common mode voltage (CMV issue will be more complex and severe. The CMV will threaten the insulation of the entire EPT device and even produce common mode current. This paper investigates the generated mechanism and characteristics of the CMV in a cascaded H-bridge EPT (CHB-EPT under both balanced and fault grid conditions. First, the CHB-EPT system is introduced. Then, a three-phase simplified circuit model of the high-voltage side of the EPT system is presented. Combined with a unipolar modulation strategy and carrier phase shifting technology by rigorous mathematical analysis and derivation, the EPT internal CMV and its characteristics are obtained. Moreover, the influence of the sinusoidal pulse width modulation dead time is considered and discussed based on analytical calculation. Finally, the simulation results are provided to verify the validity of the aforementioned model and the analysis results. The proposed theoretical analysis method is also suitable for other similar cascaded converters and can provide a useful theoretical guide for structural design and power density optimization.

  11. Investigation of voltages and electric fields in silicon semi 3D radiation detectors using Silvaco/ATLAS simulation tool and a scanning electron microscope

    CERN Document Server

    Palviainen, T; Tuuva, T; Eranen, S; Härkönen, J; Luukka, P; Tuovinen, E

    2006-01-01

    The structure of silicon semi three-dimensional radiation detector is simulated on purpose to find out its electrical characteristics such as the depletion voltage and electric field. Two-dimensional simulation results are compared to voltage and electric field measurements done by a scanning electron microscope.

  12. Physical Kinetics of Electrons in a High-Voltage Pulsed High-Pressure Discharge with Cylindrical Geometry

    Science.gov (United States)

    Kozhevnikov, V. Yu.; Kozyrev, A. V.; Semeniuk, N. S.

    2017-12-01

    Results of theoretical modeling of the phenomenon of a high-voltage discharge in nitrogen at atmospheric pressure are presented, based on a consistent kinetic theory of the electrons. A mathematical model of a nonstationary high-pressure discharge has been constructed for the first time, based on a description of the electron component from first principles. The physical kinetics of the electrons are described with the help of the Boltzmann kinematic equation for the electron distribution function over momenta with only ionization and elastic collisions taken into account. A detailed spatiotemporal picture of a nonstationary discharge with runaway electrons under conditions of coaxial geometry of the gas diode is presented. The model describes in a self-consistent way both the process of formation of the runaway electron flux in the discharge and the influence of this flux on the rate of ionization processes in the gas. Total energy spectra of the electron flux incident on the anode are calculated. The obtained parameters of the current pulse of the beam of fast electrons correlate well with the known experimental data.

  13. Microstructure of Monoplacophora (Mollusca) shell examined by low-voltage field emission scanning electron and atomic force microscopy.

    Science.gov (United States)

    Cruz, Renato; Weissmüller, Gilberto; Farina, Marcos

    2003-01-01

    The shell of Micropilina arntzi (Mollusca: Monoplacophora), a primitive molluscan class, was examined by using field emission scanning electron microscopy (FESEM) at low voltage and atomic force microscopy (AFM). The use of these two techniques allowed the observation of fine details of Micropilina arntzi shell and contributed to bring new features concerning the study of molluscan shell microtexture. Imaging with low-voltage FESEM provided well-defined edge contours of shell structures, while analyzing the sample with AFM gave information about the step height of stacked internal structures as well as the dimension of the particles present in their surface at a nanometric level. The shell microstructure of Monoplacophora species presents different patterns and may be a taxonomic implication in the systematic studies of the group.

  14. Negative ion beam injection apparatus with magnetic shield and electron removal means

    Science.gov (United States)

    Anderson, Oscar A.; Chan, Chun F.; Leung, Ka-Ngo

    1994-01-01

    A negative ion source is constructed to produce H.sup.- ions without using Cesium. A high percentage of secondary electrons that typically accompany the extracted H.sup.- are trapped and eliminated from the beam by permanent magnets in the initial stage of acceleration. Penetration of the magnetic field from the permanent magnets into the ion source is minimized. This reduces the destructive effect the magnetic field could have on negative ion production and extraction from the source. A beam expansion section in the extractor results in a strongly converged final beam.

  15. Correlative Light-Electron Microscopy Reveals the Tubular-Saccular Ultrastructure of Carriers Operating between Golgi Apparatus and Plasma Membrane

    Science.gov (United States)

    Polishchuk, Roman S.; Polishchuk, Elena V.; Marra, Pierfrancesco; Alberti, Saverio; Buccione, Roberto; Luini, Alberto; Mironov, Alexander A.

    2000-01-01

    Transport intermediates (TIs) have a central role in intracellular traffic, and much effort has been directed towards defining their molecular organization. Unfortunately, major uncertainties remain regarding their true structure in living cells. To address this question, we have developed an approach based on the combination of the green fluorescent protein technology and correlative light-electron microscopy, by which it is possible to monitor an individual carrier in vivo and then take a picture of its ultrastructure at any moment of its lifecycle. We have applied this technique to define the structure of TIs operating from the Golgi apparatus to the plasma membrane, whose in vivo dynamics have been characterized recently by light microscopy. We find that these carriers are large (ranging from 0.3–1.7 μm in maximum diameter, nearly half the size of a Golgi cisterna), comprise almost exclusively tubular-saccular structures, and fuse directly with the plasma membrane, sometimes minutes after docking to the fusion site. PMID:10629217

  16. Effect of pulsed voltage on electrochemical migration of tin in electronics

    DEFF Research Database (Denmark)

    Verdingovas, Vadimas; Jellesen, Morten Stendahl; Ambat, Rajan

    2015-01-01

    respectively at 10 and 5 V, while the duty cycle and the pulse width were varied in the range of ms. The results showed that varying of pulse width at fixed duty cycle has a minor effect under investigated conditions, whereas increasing duty cycle significantly reduces the time to short due to dendrite...... formation and increases the charge transferred between the electrodes over time. With increase of duty cycle, increases the anodic dissolution of tin, which was visualized using a tin ion indicator applied on the components prior to applying the voltage. The anodic dissolution of tin significantly...... influences the dendritic growth, although a tendency for more hydroxide precipitation was observed for lower duty cycles. The precipitation of tin hydroxides was identified as influencing factor for the reduction of charge transfer under pulsed voltage with low duty cycles, therefore resulting...

  17. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers.

    Science.gov (United States)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-07-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.

  18. Electron Channeling Contrast Imaging (ECCI) and Electron Backscatter Diffraction (EBSD) Study of Forsterite Olivine Deformed in the D-DIA Apparatus

    Science.gov (United States)

    Kaboli, S.; Burnley, P. C.

    2016-12-01

    Understanding the rheology of Earth's interior requires a detailed study of microstructure and crystallographic texture on a micro- and nanoscale. Quantitative microstructure characterization of geological materials is commonly performed on thin foils using a transmission electron microscope (TEM). The main drawbacks of TEM include time consuming and destructive thin foil preparation, limited field of view and statistically unreliable results in the case of heterogeneous microstructures which are common in geological materials. Electron channeling contrast imaging (ECCI) is a complementary technique to electron backscatter diffraction (EBSD) for quantitative microstructure characterization of bulk samples in a field emission scanning electron microscope (FE-SEM). The main application of ECCI is in characterization of deformed materials since it allows the warping of the lattice to be imaged based on the electron channeling contrast. In comparison to TEM, the main advantages of using ECCI in SEM include non-destructive bulk sample preparation and statistically reliable results from a large field of view. In this study, in-situ synchrotron x-ray diffraction deformation experiments were conducted on forsterite olivine at a variety of pressures (2-7 GPa) in the D-DIA apparatus. A suitable sample preparation procedure was established using vibratory polishing in conjunction with chemical etching prior to performing ECCI in SEM. ECCI was performed at 5 keV electron beam energy and 8 mm working distance in a JEOL JSM-6700 FE-SEM. The work hardening of forsterite olivine original grains, recrystallization and grain growth were classified based on electron channeling contrast observations in each sample. EBSD crystal orientation mapping was performed on regions of interest to quantify crystallographic texture and identify various microstructure substructures for each experiment. In addition, ECCI and EBSD were performed on the alumina piston in order to examine spatial

  19. Effects of accelerating voltage and specimen thickness on the spatial resolution of transmission electron backscatter diffraction in Cu

    Energy Technology Data Exchange (ETDEWEB)

    Shih, Jhih-Wun; Kuo, Ka-Wei [Department of Materials Science and Engineering, National Cheng Kung University, Tainan 701, Taiwan, ROC (China); Kuo, Jui-Chao, E-mail: jckuo@mail.ncku.edu.tw [Department of Materials Science and Engineering, National Cheng Kung University, Tainan 701, Taiwan, ROC (China); Kuo, Tsung-Yuan [Department of Mechanical Engineering, Southern Taiwan University of Technology, Tainan 71005, Taiwan, ROC (China)

    2017-06-15

    Highlights: • A quantitative approach is proposed to measure spatial resolutions of t-EBSD. • Increasing accelerating voltage enhances the lateral and longitudinal resolutions. • Decreasing thickness improves the lateral and longitudinal resolutions. • The depth resolution is 34.4 nm for a 100 nm sample thickness at 25 kV. - Abstract: A quantitative approach was proposed to determine the spatial resolution of transmission electron backscatter diffraction (t-EBSD) and to understand the limits of spatial resolution of t-EBSD. In this approach, Cu bicrystals and digital image correlation were employed. The effects of accelerating voltage and specimen thickness on the spatial resolution of t-EBSD were also investigated. t-EBSD specimens with 8 μm × 10 μm dimensions and different thicknesses were prepared using focused ion beam milling. The optimized quality of Kikuchi pattern was achieved at a working distance of 12 mm and a tilting angle of 20°. The optimum depth resolution of 34.4 nm was observed in the lower surface of a 100 nm thick sample at 25 kV. Thus, the penetration depth from the upper surface is 65.6 nm. The optimum lateral and longitudinal resolutions obtained from a 100 nm thick sample at 30 kV are 25.2 and 43.4 nm, respectively. The spatial resolution of t-EBSD can be enhanced by increasing the accelerating voltage and decreasing the sample thickness.

  20. Monitoring the metering performance of an electronic voltage transformer on-line based on cyber-physics correlation analysis

    Science.gov (United States)

    Zhang, Zhu; Li, Hongbin; Tang, Dengping; Hu, Chen; Jiao, Yang

    2017-10-01

    Metering performance is the key parameter of an electronic voltage transformer (EVT), and it requires high accuracy. The conventional off-line calibration method using a standard voltage transformer is not suitable for the key equipment in a smart substation, which needs on-line monitoring. In this article, we propose a method for monitoring the metering performance of an EVT on-line based on cyber-physics correlation analysis. By the electrical and physical properties of a substation running in three-phase symmetry, the principal component analysis method is used to separate the metering deviation caused by the primary fluctuation and the EVT anomaly. The characteristic statistics of the measured data during operation are extracted, and the metering performance of the EVT is evaluated by analyzing the change in statistics. The experimental results show that the method successfully monitors the metering deviation of a Class 0.2 EVT accurately. The method demonstrates the accurate evaluation of on-line monitoring of the metering performance on an EVT without a standard voltage transformer.

  1. Backscattered electron image of osmium-impregnated/macerated tissues as a novel technique for identifying the cis-face of the Golgi apparatus by high-resolution scanning electron microscopy.

    Science.gov (United States)

    Koga, D; Bochimoto, H; Watanabe, T; Ushiki, T

    2016-07-01

    The osmium maceration method with scanning electron microscopy (SEM) enabled to demonstrate directly the three-dimensional (3D) structure of membranous cell organelles. However, the polarity of the Golgi apparatus (that is, the cis-trans axis) can hardly be determined by SEM alone, because there is no appropriate immunocytochemical method for specific labelling of its cis- or trans-faces. In the present study, we used the osmium impregnation method, which forms deposits of reduced osmium exclusively in the cis-Golgi elements, for preparation of specimens for SEM. The newly developed procedure combining osmium impregnation with subsequent osmium maceration specifically visualised the cis-elements of the Golgi apparatus, with osmium deposits that were clearly detected by backscattered electron-mode SEM. Prolonged osmication by osmium impregnation (2% OsO4 solution at 40°C for 40 h) and osmium maceration (0.1% OsO4 solution at 20°C for 24 h) did not significantly impair the 3D ultrastructure of the membranous cell organelles, including the Golgi apparatus. This novel preparation method enabled us to determine the polarity of the Golgi apparatus with enough information about the surrounding 3D ultrastructure by SEM, and will contribute to our understanding of the global organisation of the entire Golgi apparatus in various differentiated cells. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.

  2. Spatial resolution and cathodoluminescence intensity dependence on acceleration voltage in electron beam excitation assisted optical microscopy using Y2O3:Eu3+ film.

    Science.gov (United States)

    Masuda, Yu; Kamiya, Masashi; Sugita, Atsushi; Inami, Wataru; Kawata, Yoshimasa; Kominami, Hiroko; Nakanishi, Yoichiro

    2017-11-01

    This study presents relationship between acceleration voltage and spatial resolution of electron-beam assisted (EXA) optical microscope. The nanometric illumination light sources of the present EXA microscope was red-emitting cathodoluminescence (CL) in the Y2O3:Eu3+ thin film excited by focused electron beam. Our experimental results demonstrated that the spatial resolutions of the EXA microscope were higher as the acceleration voltage was higher. We managed to make images of the scattered gold particles with approximately 90 nm-resolutions at the voltages higher than 20 kV. The dependence of the spatial resolution on the acceleration voltage was explained by the distribution of simulated electron scattering trajectories in the luminescent thin film. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Optimization design on breakdown voltage of AlGaN/GaN high-electron mobility transistor

    Science.gov (United States)

    Yang, Liu; Changchun, Chai; Chunlei, Shi; Qingyang, Fan; Yuqian, Liu

    2016-12-01

    Simulations are carried out to explore the possibility of achieving high breakdown voltage of GaN HEMT (high-electron mobility transistor). GaN cap layers with gradual increase in the doping concentration from 2 × 1016 to 5 × 1019 cm-3 of N-type and P-type cap are investigated, respectively. Simulation results show that HEMT with P-doped GaN cap layer shows more potential to achieve higher breakdown voltage than N-doped GaN cap layer under the same doping concentration. This is because the ionized net negative space charges in P-GaN cap layer could modulate the surface electric field which makes more contribution to RESURF effect. Furthermore, a novel GaN/AlGaN/GaN HEMT with P-doped GaN buried layer in GaN buffer between gate and drain electrode is proposed. It shows enhanced performance. The breakdown voltage of the proposed structure is 640 V which is increased by 12% in comparison to UID (un-intentionally doped) GaN/AlGaN/GaN HEMT. We calculated and analyzed the distribution of electrons' density. It is found that the depleted region is wider and electric field maximum value is induced at the left edge of buried layer. So the novel structure with P-doped GaN buried layer embedded in GaN buffer has the better improving characteristics of the power devices. Project supported by the National Basic Research Program of China (No. 2014CB339900) and the Open Fund of Key Laboratory of Complex Electromagnetic Environment Science and Technology, China Academy of Engineering Physics (No. 2015-0214.XY.K).

  4. Analysis of the possibility of performing microminiature low-voltage electron devices for vacuum millimeter-wavelength integral circuit

    Science.gov (United States)

    Gulyaev, Yuri V.; Nefyodov, I. S.; Nechaev, A. V.; Sinitsyn, Nickolay I.; Torgashov, Gennadii V.; Zakharchenko, Yu. F.; Zhbanov, A. I.

    1994-08-01

    The output characteristics of a strip distributed microwave (MW) power amplifier tuned by voltage in a wide frequency range analyzed. New energy collector designs are proposed to be employed in the amplifier in the form of a periodically nonuniform strip line and electron optical system comprising an electron gun with the multi-edge field emitter array current modulator. Their electrodynamic and current parameters have been calculated by rigorous methods. The analysis of the output amplitude-frequency characteristics of the amplifier was performed. It is shown that, unlike the previously reported amplifier design, it can allow for a higher gain in the short-wavelength region of centimeter band, including the millimeter band, or operate at substantially lower beam currents.

  5. Quantum-well charge and voltage distribution in a metal–insulator–semiconductor structure upon resonant electron Tunneling

    Energy Technology Data Exchange (ETDEWEB)

    Vexler, M. I., E-mail: vexler@mail.ioffe.ru; Illarionov, Yu. Yu.; Grekhov, I. V. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation)

    2017-04-15

    The prerequisites for electron storage in the quantum well of a metal–oxide–p{sup +}-Si resonant-tunneling structure and the effect of the stored charge on the voltage distribution are theoretically investigated. Systems with SiO{sub 2}, HfO{sub 2}, and TiO{sub 2} insulators are studied. It is demonstrated that the occurrence of a charge in the well in the case of resonant transport can be expected in structures on substrates with an acceptor concentration from (5–6) × 10{sup 18} to (2–3) × 10{sup 19} cm{sup –3} in the range of oxide thicknesses dependent on this concentration. In particular, the oxide layer thickness in the structures with SiO{sub 2}/p{sup +}-Si(10{sup 19} cm{sup –3}) should exceed ~3 nm. The electron density in the well can reach ~10{sup 12} cm{sup –2} and higher. However, the effect of this charge on the electrostatics of the structure becomes noticeable only at relatively high voltages far above the activation of resonant transport through the first subband.

  6. Low-voltage organic electronics based on a gate-tunable injection barrier in vertical graphene-organic semiconductor heterostructures.

    Science.gov (United States)

    Hlaing, Htay; Kim, Chang-Hyun; Carta, Fabio; Nam, Chang-Yong; Barton, Rob A; Petrone, Nicholas; Hone, James; Kymissis, Ioannis

    2015-01-14

    The vertical integration of graphene with inorganic semiconductors, oxide semiconductors, and newly emerging layered materials has recently been demonstrated as a promising route toward novel electronic and optoelectronic devices. Here, we report organic thin film transistors based on vertical heterojunctions of graphene and organic semiconductors. In these thin heterostructure devices, current modulation is accomplished by tuning of the injection barriers at the semiconductor/graphene interface with the application of a gate voltage. N-channel devices fabricated with a thin layer of C60 show a room temperature on/off ratio >10(4) and current density of up to 44 mAcm(-2). Because of the ultrashort channel intrinsic to the vertical structure, the device is fully operational at a driving voltage of 200 mV. A complementary p-channel device is also investigated, and a logic inverter based on two complementary transistors is demonstrated. The vertical integration of graphene with organic semiconductors via simple, scalable, and low-temperature fabrication processes opens up new opportunities to realize flexible, transparent organic electronic, and optoelectronic devices.

  7. High-Voltage, High-Power Gaseous Electronics Switch For Electric Grid Power Conversion

    Science.gov (United States)

    Sommerer, Timothy J.

    2014-05-01

    We are developing a high-voltage, high-power gas switch for use in low-cost power conversion terminals on the electric power grid. Direct-current (dc) power transmission has many advantages over alternating current (ac) transmission, but at present the high cost of ac-dc power interconversion limits the use of dc. The gas switch we are developing conducts current through a magnetized cold cathode plasma in hydrogen or helium to reach practical current densities > 1 A/cm2. Thermal and sputter damage of the cathode by the incident ion flux is a major technical risk, and is being addressed through use of a ``self-healing'' liquid metal cathode (eg, gallium). Plasma conditions and cathode sputtering loss are estimated by analyzing plasma spectral emission. A particle-in-cell plasma model is used to understand various aspects of switch operation, including the conduction phase (where plasma densities can exceed 1013 cm-3), the switch-open phase (where the high-voltage must be held against gas breakdown on the left side of Paschen's curve), and the switching transitions (especially the opening process, which is initiated by forming an ion-matrix sheath adjacent to a control grid). The information, data, or work presented herein was funded in part by the Advanced Research Projects Agency-Energy (ARPA-E), U.S. Department of Energy, under Award Number DE-AR0000298.

  8. Local resistivity and the current-voltage characteristics of hot electron bolometer mixers

    NARCIS (Netherlands)

    Hajenius, M; Barends, R; Gao, [No Value; Klapwijk, TM; Baselmans, JJA; Baryshev, A; Voronov, B; Gol'tsman, G

    Hot-electron bolometer devices, used successfully in low noise heterodyne mixing at frequencies up to 2.5 THz, have been analyzed. A distributed temperature numerical model of the NbN bridge, based on a local electron and a phonon temperature, is used to model pumped IV curves and understand the

  9. Instrument electronic transformers for medium voltage systems; Transformadores eletronicos de instrumentos para sistemas de media tensao

    Energy Technology Data Exchange (ETDEWEB)

    Javora, Radek; Stefanka, Martin; Mahonen, Pentti; Niemi, Tapio; Rintamaki, Olli [ABB, Helsinki (Finland); ABB, Prague (Czech Republic)

    2010-02-15

    This paper compares the conventional technologies and the electronic of instrument transformers, and highlights the advantages, discoveries and principles of electronic models. Such equipment are essentially indicated for using with as micro processed relays at the substations, and also projected for connection to the IEDs, and the future digital communication (author)

  10. Beam Normal Single Spin Asymmetry in Forward Angle Inelastic Electron-Proton Scattering using the Q-Weak Apparatus

    Energy Technology Data Exchange (ETDEWEB)

    ., Nuruzzaman [Hampton Univ., Hampton, VA (United States)

    2014-12-01

    The Q-weak experiment in Hall-C at the Thomas Jefferson National Accelerator Facility has made the first direct measurement of the weak charge of the proton through the precision measurement of the parity-violating asymmetry in elastic electron-proton scattering at low momentum transfer. There is also a parity conserving Beam Normal Single Spin Asymmetry or transverse asymmetry (B_n) on H_2 with a sin(phi)-like dependence due to two-photon exchange. If the size of elastic B_n is a few ppm, then a few percent residual transverse polarization in the beam, combined with small broken azimuthal symmetries in the detector, would require a few ppb correction to the Q-weak data. As part of a program of B_n background studies, we made the first measurement of B_n in the N-to-Delta(1232) transition using the Q-weak apparatus. The final transverse asymmetry, corrected for backgrounds and beam polarization, was found to be B_n = 42.82 ± 2.45 (stat) ± 16.07 (sys) ppm at beam energy E_beam = 1.155 GeV, scattering angle theta = 8.3 deg, and missing mass W = 1.2 GeV. B_n from electron-nucleon scattering is a unique tool to study the gamma^* Delta Delta form factors, and this measurement will help to improve the theoretical models on beam normal single spin asymmetry and thereby our understanding of the doubly virtual Compton scattering process. To help correct false asymmetries from beam noise, a beam modulation system was implemented to induce small position, angle, and energy changes at the target to characterize detector response to the beam jitter. Two air-core dipoles separated by ~10 m were pulsed at a time to produce position and angle changes at the target, for virtually any tune of the beamline. The beam energy was modulated using an SRF cavity. The hardware and associated control instrumentation will be described in this dissertation. Preliminary detector sensitivities were extracted which helped to reduce the width of the measured asymmetry. The beam modulation system

  11. Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

    KAUST Repository

    Graham, Kenneth

    2013-07-30

    The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Power conversion apparatus and method

    Science.gov (United States)

    Su, Gui-Jia [Knoxville, TN

    2012-02-07

    A power conversion apparatus includes an interfacing circuit that enables a current source inverter to operate from a voltage energy storage device (voltage source), such as a battery, ultracapacitor or fuel cell. The interfacing circuit, also referred to as a voltage-to-current converter, transforms the voltage source into a current source that feeds a DC current to a current source inverter. The voltage-to-current converter also provides means for controlling and maintaining a constant DC bus current that supplies the current source inverter. The voltage-to-current converter also enables the current source inverter to charge the voltage energy storage device, such as during dynamic braking of a hybrid electric vehicle, without the need of reversing the direction of the DC bus current.

  13. Low Voltage Electron Beam Processing Final Report CRADA No. TC-645-93-A

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wakalopulos, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-10-16

    This CRADA project was established to develop a small, inexpensive sealed-tube electron beam processing system having immediate applications in industrial, high speed manufacturing processes, and in the Department of Energy (DOE) waste treatment/cleanup operations. The technical work involved the development and demonstration of a compact, sealed, 50-75 kilovolt (kV) EB generator prototype, including controls and power supply. The specific goals of this project were to develop a low cost vacuum tube capable of shooting an electron beam several inches into the air, and to demonstrate that wide area materials processing is feasible by stacking the tubes to produce continuous beams. During the project, we successfully demonstrated the producibility of a low cost electron beam system and several material processing operations of interest to US industry, DOE and, since September 11, 2001, the Homeland Security.

  14. Power Electronic Loads with Negative Differential Impedance in a Low Voltage Distribution System

    NARCIS (Netherlands)

    Heskes, P.J.M.; Myrzik, J.M.A.; Kling, W.L.

    2009-01-01

    Today's domestic appliances are more and more adapted and controlled by power electronics and processors, and their number is growing. This development can bring both advantages and disadvantages for the power quality in local grids. An advantage for example is the growing number of power supplies

  15. Maximum usable thickness revisited: Imaging dislocations in Si by modern high-voltage scanning transmission electron microscopy

    Science.gov (United States)

    Sato, Kazuhisa; Yamashita, Yuki; Yasuda, Hidehiro; Mori, Hirotaro

    2017-10-01

    We have quantitatively evaluated the usable thickness of specimens in scanning transmission electron microscopy (STEM) at 1 MV using a wedge-shaped Si(110) single crystal including artificially introduced high-density dislocations. The width of dislocation images was employed as a criterion for the quantitative evaluation of usable thickness. Superior usable thickness in STEM than in TEM was found; the obtained results were 14.7 µm for STEM and 5.8 µm for TEM. In particular, in STEM, dislocations can be observed as thin lines with 10-15 nm width in the thickness range up to 10 µm. The latest high-voltage STEM is useful for imaging crystal defects in thick semiconductors.

  16. The effect of gas mixing and biased disc voltage on the preglow transient of electron cyclotron resonance ion source.

    Science.gov (United States)

    Tarvainen, O; Toivanen, V; Komppula, J; Kalvas, T; Koivisto, H

    2012-02-01

    The effect of gas mixing and biased disc voltage on the preglow of electron cyclotron resonance ion source plasma has been studied with the AECR-U type 14 GHz ion source. It was found that gas mixing has a significant effect on the preglow. The extracted transient beam currents and efficiency of the heavier species increase, while the currents and efficiency of the lighter species decrease when gas mixing is applied. The effect of the biased disc was found to be pronounced in continuous operation mode in comparison to preglow. The data provide information on the time scales of the plasma processes explaining the effects of gas mixing and biased disc. The results also have implications on production of radioactive ion beams in preglow mode for the proposed Beta Beam neutrino factory.

  17. Fluctuation in Interface and Electronic Structure of Single-Molecule Junctions Investigated by Current versus Bias Voltage Characteristics.

    Science.gov (United States)

    Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

    2018-02-22

    Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contains fundamental science of the single-molecule transport and implication for manipulability of the transport properties in the electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage (I-V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I-V approach provides a correlated statistical description of both, the degree of electronic coupling across the metal-molecule interface, and the molecular orbital-energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C60). We demonstrate that molecular dependent fluctuation of σ-, π-, and π-plane- type interface can be captured by analyzing molecular orbital-energy (MO) level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C60 features unique distance dependence and molecular dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrary, the MO level of C60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular dependent fluctuation in the

  18. Voltage profile, structural prediction, and electronic calculations for MgxMo6S8

    CSIR Research Space (South Africa)

    Kganyago, KR

    2003-03-01

    Full Text Available suggests a maximum uptake formally of two Mg ions into the electron-de?cient Mo6 cluster, which leaves us with two possible vacant sites: the inner Li1 site ~substituted by MgA) close to the unit-cell origin with the atom coordinates (0.598,0.359,0.381:b52... be de?ned with Mg0 being the origin. The vector from Mg0 to Mg1 is the c lattice parameter and the vectors from Mg0 to Mg2 and Mg0 to Mg3 are the a lattice parameters. K. R. KGANYAGO, P. E. NGOEPE, AND C. R. A. CATLOW PHYSICAL REVIEW B 67, 104103 ~2003...

  19. Microstructural and Electronic Origins of Open-Circuit Voltage Tuning in Organic Solar Cells Based on Ternary Blends

    KAUST Repository

    Mollinger, Sonya A.

    2015-09-22

    © 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. Organic ternary heterojunction photovoltaic blends are sometimes observed to undergo a gradual evolution in open-circuit voltage (Voc) with increasing amounts of a second donor or an acceptor. The Voc is strongly correlated with the energy of the charge transfer state in the blend, but this value depends on both local and mesoscopic orders. In this work, the behavior of Voc in the presence of a wide range of interfacial electronic states is investigated. The key charge transfer state interfaces responsible for Voc in several model systems with varying morphology are identified. Systems consisting of one donor with two fullerene molecules and of one acceptor with a donor polymer of varying regio-regularity are used. The effects from the changing energetic disorder in the material and from the variation due to a law of simple mixtures are quantified. It has been found that populating the higher-energy charge transfer states is not responsible for the observed change in Voc upon the addition of a third component. Aggregating polymers and miscible fullerenes are compared, and it has been concluded that in both cases charge delocalization, aggregation, and local polarization effects shift the lowest-energy charge transfer state distribution. The open-circuit voltage evolution and charge transfer state interfaces in ternary organic photovoltaic blends are investigated using several model systems. The changes in subgap spectra from energetic disorder and increased population of higher energy states are analyzed and the lowest charge transfer state distribution is observed to shift due to local aggregation and delocalization effects.

  20. Fast auto-acquisition tomography tilt series by using HD video camera in ultra-high voltage electron microscope.

    Science.gov (United States)

    Nishi, Ryuji; Cao, Meng; Kanaji, Atsuko; Nishida, Tomoki; Yoshida, Kiyokazu; Isakozawa, Shigeto

    2014-11-01

    The ultra-high voltage electron microscope (UHVEM) H-3000 with the world highest acceleration voltage of 3 MV can observe remarkable three dimensional microstructures of microns-thick samples[1]. Acquiring a tilt series of electron tomography is laborious work and thus an automatic technique is highly desired. We proposed the Auto-Focus system using image Sharpness (AFS)[2,3] for UHVEM tomography tilt series acquisition. In the method, five images with different defocus values are firstly acquired and the image sharpness are calculated. The sharpness are then fitted to a quasi-Gaussian function to decide the best focus value[3]. Defocused images acquired by the slow scan CCD (SS-CCD) camera (Hitachi F486BK) are of high quality but one minute is taken for acquisition of five defocused images.In this study, we introduce a high-definition video camera (HD video camera; Hamamatsu Photonics K. K. C9721S) for fast acquisition of images[4]. It is an analog camera but the camera image is captured by a PC and the effective image resolution is 1280×1023 pixels. This resolution is lower than that of the SS-CCD camera of 4096×4096 pixels. However, the HD video camera captures one image for only 1/30 second. In exchange for the faster acquisition the S/N of images are low. To improve the S/N, 22 captured frames are integrated so that each image sharpness is enough to become lower fitting error. As countermeasure against low resolution, we selected a large defocus step, which is typically five times of the manual defocus step, to discriminate different defocused images.By using HD video camera for autofocus process, the time consumption for each autofocus procedure was reduced to about six seconds. It took one second for correction of an image position and the total correction time was seven seconds, which was shorter by one order than that using SS-CCD camera. When we used SS-CCD camera for final image capture, it took 30 seconds to record one tilt image. We can obtain a tilt

  1. Golgi apparatus dis- and reorganizations studied with the aid of 2-deoxy-D-glucose and visualized by 3D-electron tomography.

    Science.gov (United States)

    Ranftler, Carmen; Meisslitzer-Ruppitsch, Claudia; Neumüller, Josef; Ellinger, Adolf; Pavelka, Margit

    2017-04-01

    We studied Golgi apparatus disorganizations and reorganizations in human HepG2 hepatoblastoma cells by using the nonmetabolizable glucose analogue 2-deoxy-D-glucose (2DG) and analyzing the changes in Golgi stack architectures by 3D-electron tomography. Golgi stacks remodel in response to 2DG-treatment and are replaced by tubulo-glomerular Golgi bodies, from which mini-Golgi stacks emerge again after removal of 2DG. The Golgi stack changes correlate with the measured ATP-values. Our findings indicate that the classic Golgi stack architecture is impeded, while cells are under the influence of 2DG at constantly low ATP-levels, but the Golgi apparatus is maintained in forms of the Golgi bodies and Golgi stacks can be rebuilt as soon as 2DG is removed. The 3D-electron microscopic results highlight connecting regions that interlink membrane compartments in all phases of Golgi stack reorganizations and show that the compact Golgi bodies mainly consist of continuous intertwined tubules. Connections and continuities point to possible new transport pathways that could substitute for other modes of traffic. The changing architectures visualized in this work reflect Golgi stack dynamics that may be essential for basic cell physiologic and pathologic processes and help to learn, how cells respond to conditions of stress.

  2. Structural variability and complexity of the giant Pithovirus sibericum particle revealed by high-voltage electron cryo-tomography and energy-filtered electron cryo-microscopy.

    Science.gov (United States)

    Okamoto, Kenta; Miyazaki, Naoyuki; Song, Chihong; Maia, Filipe R N C; Reddy, Hemanth K N; Abergel, Chantal; Claverie, Jean-Michel; Hajdu, Janos; Svenda, Martin; Murata, Kazuyoshi

    2017-10-16

    The Pithoviridae giant virus family exhibits the largest viral particle known so far, a prolate spheroid up to 2.5 μm in length and 0.9 μm in diameter. These particles show significant variations in size. Little is known about the structure of the intact virion due to technical limitations with conventional electron cryo-microscopy (cryo-EM) when imaging thick specimens. Here we present the intact structure of the giant Pithovirus sibericum particle at near native conditions using high-voltage electron cryo-tomography (cryo-ET) and energy-filtered cryo-EM. We detected a previously undescribed low-density outer layer covering the tegument and a periodical structuring of the fibres in the striated apical cork. Energy-filtered Zernike phase-contrast cryo-EM images show distinct substructures inside the particles, implicating an internal compartmentalisation. The density of the interior volume of Pithovirus particles is three quarters lower than that of the Mimivirus. However, it is remarkably high given that the 600 kbp Pithovirus genome is only half the size of the Mimivirus genome and is packaged in a volume up to 100 times larger. These observations suggest that the interior is densely packed with macromolecules in addition to the genomic nucleic acid.

  3. A Manufacturing Cost and Supply Chain Analysis of SiC Power Electronics Applicable to Medium-Voltage Motor Drives

    Energy Technology Data Exchange (ETDEWEB)

    Horowitz, Kelsey [National Renewable Energy Lab. (NREL), Golden, CO (United States); Remo, Timothy [National Renewable Energy Lab. (NREL), Golden, CO (United States); Reese, Samantha [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2017-03-24

    Wide bandgap (WBG) semiconductor devices are increasingly being considered for use in certain power electronics applications, where they can improve efficiency, performance, footprint, and, potentially, total system cost compared to systems using traditional silicon (Si) devices. Silicon carbide (SiC) devices in particular -- which are currently more mature than other WBG devices -- are poised for growth in the coming years. Today, the manufacturing of SiC wafers is concentrated in the United States, and chip production is split roughly equally between the United States, Japan, and Europe. Established contract manufacturers located throughout Asia typically carry out manufacturing of WBG power modules. We seek to understand how global manufacturing of SiC components may evolve over time by illustrating the regional cost drivers along the supply chain and providing an overview of other factors that influence where manufacturing is sited. We conduct this analysis for a particular case study where SiC devices are used in a medium-voltage motor drive.

  4. Best use of high-voltage, high-powered electron beams: a new approach to contract irradiation services

    Science.gov (United States)

    Watanabe, T.

    2000-03-01

    Japan's first high-voltage, high-powered electron beam processing center is scheduled to come on-line during the first half of 1999. The center explores both challenges and opportunities of how best to use the 200 kW 10 MeV unit and its 5 MeV X-ray line. In particular, Nuclear Fuel Industries, Ltd. (NFI) has expanded the traditional model of a contract irradiation facility to include a much broader scope of services such as door-to-door transport, storage, and direct distribution to its customer's end-users. The new business scope not only finds new value-added components in a competitive marketplace, but serves to provide a viable mechanism to take advantage of the processing logistics of high throughput irradiation units. As such, the center features a high-capacity warehousing system, monitored by a newly developed PCMS (plant control management system), which has been comprehensively integrated into the irradiation unit's handling system, and will require only minimal human resources for its high rate of material handling. The identification and development of initial markets for this first unit will be discussed, concluding with how this same operational philosophy can help break open new irradiation segments in medical devices, consumer goods, animal feed, and food markets and NFI's other efforts in these same areas.

  5. Module Nine: Relationships of Current, Counter EMF, and Voltage in LR Circuits; Basic Electricity and Electronics Individualized Learning System.

    Science.gov (United States)

    Bureau of Naval Personnel, Washington, DC.

    The student will study the ways that inductance affects voltage and current in Direct Current (DC) and Alternating Current (AC) circuits and why and how inductors cause these actions. The module is divided into six lessons: rise and decay of current and voltage, LR (inductive-resistive) time constant, using the universal TC (time constant) chart,…

  6. TRANSFORMER APPARATUS

    Science.gov (United States)

    Wolfgang, F.; Nicol, J.

    1962-11-01

    Transformer apparatus is designed for measuring the amount of a paramagnetic substance dissolved or suspended in a diamagnetic liquid. The apparatus consists of a cluster of tubes, some of which are closed and have sealed within the diamagnetic substance without any of the paramagnetic material. The remaining tubes are open to flow of the mix- ture. Primary and secondary conductors are wrapped around the tubes in such a way as to cancel noise components and also to produce a differential signal on the secondaries based upon variations of the content of the paramagnetic material. (AEC)

  7. MOLDING APPARATUS

    Science.gov (United States)

    Fleming, P.G.

    1963-10-01

    Molding apparatus capable of coating multiple elements each molding cycle is described. The apparatus comprises a centrally disposed reservoir penetrated by a plurality of circumferentially arranged and radially extending passageways. These passageways, in turn, communicate with passages in a separable annular member that retains selectively configured molds and mold seating arrangements. Each mold, which is readily removable from its respective seat, is adapted to retain an element therein in spaced relation to the interior of the mold by utilizing element positioning means within the mold seat and the mold so that coating material may flow about the entire outer surface of the element. (AEC)

  8. A high voltage asymmetric waveform generator for FAIMS.

    Science.gov (United States)

    Canterbury, Jesse D; Gladden, James; Buck, Lon; Olund, Roy; MacCoss, Michael J

    2010-07-01

    High field asymmetric waveform ion mobility spectrometry (FAIMS) has been used increasingly in recent years as an additional method of ion separation and selection before mass spectrometry. The FAIMS electrodes are relatively simple to design and fabricate for laboratories wishing to implement their own FAIMS designs. However, construction of the electronics apparatus needed to produce the required high magnitude asymmetric electric field oscillating at a frequency of several hundred kilohertz is not trivial. Here we present an entirely custom-built electronics setup capable of supplying the required waveforms and voltages. The apparatus is relatively simple and inexpensive to implement. We also present data acquired on this system demonstrating the use of FAIMS as a gas-phase ion filter interface to an ion trap mass spectrometer. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  9. Developing a Magnetic Circular Dichroism Apparatus Equipped with Neodymium Magnet for Students to Investigate the Electronic Structures of Transition Metals and Lanthanoids

    Science.gov (United States)

    Yakubu, Abdallah; Suzuki, Takayoshi; Kita, Masakazu

    2017-01-01

    This paper describes the development of a simple magnetic circular dichroism (MCD) apparatus from a wood base and neodymium magnets and its configuration in the Faraday alignment. The applicability and effectiveness of the apparatus for MCD spectra measurements have been examined. The apparatus was used by undergraduate students to conduct MCD…

  10. Developing a Magnetic Circular Dichroism Apparatus Equipped with Neodymium Magnet for Students to Investigate the Electronic Structures of Transition Metals and Lanthanoids

    Science.gov (United States)

    Yakubu, Abdallah; Suzuki, Takayoshi; Kita, Masakazu

    This paper describes the development of a simple magnetic circular dichroism (MCD) apparatus from a wood base and neodymium magnets and its configuration in the Faraday alignment. The applicability and effectiveness of the apparatus for MCD spectra measurements have been examined. The apparatus was used by undergraduate students to conduct MCD…

  11. Addition of Lithium 8-Quinolate into Polyethylenimine Electron-Injection Layer in OLEDs: Not Only Reducing Driving Voltage but Also Improving Device Lifetime.

    Science.gov (United States)

    Chiba, Takayuki; Pu, Yong-Jin; Ide, Takahumi; Ohisa, Satoru; Fukuda, Hitoshi; Hikichi, Tatsuya; Takashima, Dai; Takahashi, Tatsuya; Kawata, So; Kido, Junji

    2017-05-31

    Solution-processed electron injection layers (EILs) comprising lithium 8-quinolate (Liq) and polyethylenimine ethoxylated (PEIE) are highly effective for enhancing electron injection from ZnO to organic layers and improving device lifetime in organic light-emitting devices (OLEDs). Doping of Liq into PEIE further reduces the work function of zinc oxide (ZnO) by enhancing dipole formation. The intermolecular interaction between Liq and PEIE was elucidated by UV-vis absorption measurement and quantum chemical calculation. The OLEDs with ZnO covered with PEIE:Liq mixture exhibited lower driving voltage than that of the device without Liq. Furthermore, as doping concentration of Liq into PEIE increased, the device lifetime and voltage stability during constant current operation was successively improved.

  12. Apparatuses And Systems For Embedded Thermoelectric Generators

    KAUST Repository

    Hussain, Muhammad M.

    2013-08-08

    An apparatus and a system for embedded thermoelectric generators are disclosed. In one embodiment, the apparatus is embedded in an interface where the ambient temperatures on two sides of the interface are different. In one embodiment, the apparatus is fabricated with the interface in integrity as a unitary piece. In one embodiment, the apparatus includes a first thermoelectric material embedded through the interface. The apparatus further includes a second thermoelectric material embedded through the interface. The first thermoelectric material is electrically coupled to the second thermoelectric material. In one embodiment, the apparatus further includes an output structure coupled to the first thermoelectric material and the second thermoelectric material and configured to output a voltage.

  13. Prehensile apparatus

    Science.gov (United States)

    Smith, C.M.

    1993-10-12

    The present invention relates to an apparatus for handling a workpiece comprising a vessel that is longitudinally extensible and pressurizable, and a nonextensible and laterally flexible member on the vessel. The member constrains one side of the vessel to be nonextensible, causing the vessel to bend in the direction of the nonextensible member when pressurized. 8 figures.

  14. Thermoforming apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Perryman, L.M.

    1984-07-31

    Thermoforming apparatus having a heating station and a forming station provided with upper and lower heaters for softening the thermoplastics sheet material. One of the heaters is movable between the heating and forming stations and is arranged to convey heated sheets from the heating station of the forming station.

  15. Effect of temperature and discharge voltage on the properties of Co-doped ZnO thin films deposited by pulsed electron beam ablation

    Science.gov (United States)

    Ali, Asghar; Henda, Redhouane; Fagerberg, Ragnar

    2017-11-01

    Cobalt-doped ZnO (CZO) thin films have been deposited from CoxZn1-xO (x = 0.20) target on Si (100) substrate by pulsed electron beam ablation (PEBA). The effects of process temperature (350 °C-800 °C) and electron beam acceleration voltage (15 kV, 16 kV) on the deposited films have been assessed. The films have been prepared at constant beam pulse frequency (2 Hz) and Argon background pressure (∼3 mTorr). The structure and surface morphology of CZO films have been investigated by scanning electron microscopy (SEM) and atomic force microscopy (AFM). As per SEM data, the results show that the films consist of Co rich nano-sized globules (∼20 nm-300 nm). Energy dispersive x-ray (EDX) measurements reveal that Co content in the films seems to be unaffected by accelerating voltage while it increases with temperature in the range 350 °C-450 °C. At higher deposition temperatures (600 °C & 800 °C), the films exhibit faceted particles and are relatively rough. The films deposited at 800 °C consist of a predominantly Co phase. X-ray photoelectron spectroscopy (XPS) data confirm the presence of metallic cobalt in the films, whose content increases with temperature but is practically unaffected by beam voltage. X-ray diffraction (XRD) analysis confirms the presence of herxagonal close-packed (hcp) metallic cobalt in the films.

  16. PIC-MCC analysis of electron multiplication in a cold-cathode Penning ion generator and its application to identify ignition voltage

    Science.gov (United States)

    Noori, H.; Ranjbar, A. H.; Mahjour-Shafiei, M.

    2017-11-01

    A cold-cathode Penning ion generator (PIG) has been developed in our laboratory to study the interaction of charged particles with matter. The ignition voltage was measured in the presence of the axial magnetic field in the range of 460-580 G. The performed measurements with stainless steel cathodes were in argon gas at pressure of 4 × 10-2 mbar. A PIC-MCC (particle-in-cell, Monte Carlo collision) technique has been used to calculate the electron multiplication coefficient M for various strength of axial magnetic field and applied voltage. An approach based on the coefficient M and the experimental values of the secondary electron emission coefficient γ, was proposed to determine the ignition voltages, theoretically. Applying the values of secondary coefficient γ leads to the average value of γM(V, B) to be = 1.05 ± 0.03 at the ignition of the PIG which satisfies the proposed ignition criterion. Thus, the ion-induced secondary electrons emitted from the cathode have dominant contribution to self-sustaining of the discharge process in a PIG.

  17. ESD Test Apparatus for Soldering Irons

    Science.gov (United States)

    Sancho, Jose; Esser, Robert

    2013-01-01

    ESDA (Electrostatic Discharge Association) ESD STM 13.1-2000 requires frequent testing of the voltage leakage from the tip of a soldering iron and the resistance from the tip of the soldering iron to the common point ground. Without this test apparatus, the process is time-consuming and requires several wires, alligator clips, or test probes, as well as additional equipment. Soldering iron tips must be tested for electrostatic discharge risks frequently, and this typically takes a lot of time in setup and testing. This device enables the operator to execute the full test in one minute or less. This innovation is a simple apparatus that plugs into a digital multimeter (DMM) and the Common Point Ground (CPG) reference. It enables the user to perform two of the electrostatic discharge tests required in ESD STM 13.1-2000. The device consists of a small black box with two prongs sticking out of one end, two inputs on the opposite end (one of the inputs is used to connect the reference CPG to the DMM), and a metal tab on one side. Inside the box are wires, several washers of various materials, and assembly hardware (nuts and screws/bolts). The device is a passive electronic component that is plugged into a DMM. The operator sets the DMM to read voltage. The operator places the heated tip of the soldering iron onto the metal tab with a small amount of solder to ensure a complete connection. The voltage is read and recorded. The operator switches the DMM to read resistance. The operator places the heated tip of the soldering iron onto the metal tab with a small amount of solder to ensure a complete connection. The resistance is recorded. If the recorded voltage and resistance are below a number stated in ESDA ESD STM 13.1-2000, the test is considered to pass. The device includes all the necessary wiring internal to its body so the operator does not need to do any independent wiring, except for grounding. It uses a stack of high-thermal-resistance washers to minimize the

  18. CASTING APPARATUS

    Science.gov (United States)

    Gray, C.F.; Thompson, R.H.

    1958-09-23

    An apparatus is described for casting small quantities of uranlum. It consists of a crucible having a hole in the bottom with a mold positioned below. A vertical rcd passes through the hole in the crucible and has at its upper end a piercing head adapted to break the oxide skin encasing a molten uranium body. An air tight cylinder surrounds the crucible and mold, and is arranged to be evacuated.

  19. A compact control system to achieve stable voltage and low jitter trigger for repetitive intense electron-beam accelerator based on resonant charging

    Directory of Open Access Journals (Sweden)

    Yongfeng Qiu

    2017-08-01

    Full Text Available A compact control system based on Delphi and Field Programmable Gate Array(FPGA is developed for a repetitive intense electron-beam accelerator(IEBA, whose output power is 10GW and pulse duration is 160ns. The system uses both hardware and software solutions. It comprises a host computer, a communication module and a main control unit. A device independent applications programming interface, devised using Delphi, is installed on the host computer. Stability theory of voltage in repetitive mode is analyzed and a detailed overview of the hardware and software configuration is presented. High voltage experiment showed that the control system fulfilled the requests of remote operation and data-acquisition. The control system based on a time-sequence control method is used to keep constant of the voltage of the primary capacitor in every shot, which ensured the stable and reliable operation of the electron beam accelerator in the repetitive mode during the experiment. Compared with the former control system based on Labview and PIC micro-controller developed in our laboratory, the present one is more compact, and with higher precision in the time dimension. It is particularly useful for automatic control of IEBA in the high power microwave effects research experiments where pulse-to-pulse reproducibility is required.

  20. A compact control system to achieve stable voltage and low jitter trigger for repetitive intense electron-beam accelerator based on resonant charging

    Science.gov (United States)

    Qiu, Yongfeng; Liu, Jinliang; Yang, Jianhua; Cheng, Xinbing; Yang, Xiao

    2017-08-01

    A compact control system based on Delphi and Field Programmable Gate Array(FPGA) is developed for a repetitive intense electron-beam accelerator(IEBA), whose output power is 10GW and pulse duration is 160ns. The system uses both hardware and software solutions. It comprises a host computer, a communication module and a main control unit. A device independent applications programming interface, devised using Delphi, is installed on the host computer. Stability theory of voltage in repetitive mode is analyzed and a detailed overview of the hardware and software configuration is presented. High voltage experiment showed that the control system fulfilled the requests of remote operation and data-acquisition. The control system based on a time-sequence control method is used to keep constant of the voltage of the primary capacitor in every shot, which ensured the stable and reliable operation of the electron beam accelerator in the repetitive mode during the experiment. Compared with the former control system based on Labview and PIC micro-controller developed in our laboratory, the present one is more compact, and with higher precision in the time dimension. It is particularly useful for automatic control of IEBA in the high power microwave effects research experiments where pulse-to-pulse reproducibility is required.

  1. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    . The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...

  2. High Voltage-Cylinder Sector Analyzer 300/15: a cylindrical sector analyzer for electron kinetic energies up to 15 keV.

    Science.gov (United States)

    Rubio-Zuazo, J; Escher, M; Merkel, M; Castro, G R

    2010-04-01

    We have developed an energy analyzer, High Voltage-Cylinder Sector Analyzer 300/15, for electron kinetic energies up to 15 keV. It is especially suited for hard x-ray photoelectron spectroscopy, but also for ultraviolet and soft x-ray photoelectron spectroscopy (ultraviolet photoemission spectroscopy, x-ray photoemission spectroscopy), Auger electron spectroscopy, and reflection high energy electron spectroscopy. The analyzer is based on a cylinder sector with 90 degrees deflection, 300 mm slit-to-slit distance, and a four-element pre-retarding lens system with 50 mm sample-to-lens distance. The result is a very compact design of the analyzer that is easily integrated into a multipurpose experiment with different techniques. A low noise/low drift electronics is capable of continuous energy scans from 0 to 15 keV using nonlinear lens curves. The first analyzer is allocated at the Spanish CRG SpLine beamline at the ESRF at an end station where simultaneous surface x-ray diffraction is possible. The analyzer is operated routinely since 2006 up to 15 keV electron kinetic energy, expanding the achievable electron kinetic energy range compared to other commercial analyzers. In this work we present a detailed description of the developed electron analyzer. The analyzer capabilities, in terms of energy resolution and transmission, are shown by using an electron gun, an ultraviolet-discharge lamp, and hard x-ray synchrotron radiation as excitation sources.

  3. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...

  4. A Measurement of the Weak Charge of the Proton through Parity Violating Electron Scattering using the Qweak Apparatus: A 21% Result

    Energy Technology Data Exchange (ETDEWEB)

    Beminiwattha, Rakitha [Ohio Univ., Athens, OH (United States)

    2013-08-01

    After a decade of preparations, the Qweak experiment at Jefferson Lab is making the first direct measurement of the weak charge of the proton, Q^p_W. This quantity is suppressed in the Standard Model making a good candidate for search for new physics beyond the SM at the TeV scale. Operationally, we measure a small (about -0.200 ppm) parity-violating asymmetry in elastic electron-proton scattering in integrating mode while flipping the helicity of the electrons 1000 times per second. Commissioning took place Fall 2010, and we finished taking data in early summer 2012. This dissertation is based on the data taken on an initial two weeks period (Wien0). It will provide an overview of the Qweak apparatus, description of the data acquisition and analysis software systems, and final analysis and results from the Wien0 data set. The result is a 16% measurement of the parity violating electron-proton scattering asymmetry, A = -0.2788 +/- 0.0348 (stat.) +/- 0.0290 (syst.) ppm at Q^2 = 0.0250 +/- 0.0006 (GeV)^2. From this a 21% measurement of the weak charge of the proton, Q_w^p(msr)= +0.0952 +/- 0.0155 (stat.) +/- 0.0131 (syst.) +/- 0.0015 (theory) is extracted. From this a 2% measurement of the weak mixing angle, sin^2theta_W(msr)= +0.2328 +/- 0.0039 (stat.) +/- 0.0033 (syst.) +/- 0.0004 (theory) and improved constraints on isoscalar/isovector effective coupling constants of the weak neutral hadronic currents are extracted. These results deviate from the Standard Model by one standard deviation. The Wien0 results are a proof of principle of the Qweak data analysis and a highlight of the road ahead for obtaining full results.

  5. Evaluation of the Electronic Structure of Single-Molecule Junctions Based on Current-Voltage and Thermopower Measurements: Application to C60Single-Molecule Junction.

    Science.gov (United States)

    Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

    2017-02-16

    The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Apparatuses and methods for generating electric fields

    Science.gov (United States)

    Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L

    2013-08-06

    Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.

  7. About the contrast of δ' precipitates in bulk Al-Cu-Li alloys in reflection mode with a field-emission scanning electron microscope at low accelerating voltage.

    Science.gov (United States)

    Brodusch, Nicolas; Voisard, Frédéric; Gauvin, Raynald

    2017-11-01

    Characterising the impact of lithium additions in the precipitation sequence in Al-Li-Cu alloys is important to control the strengthening of the final material. Since now, transmission electron microscopy (TEM) at high beam voltage has been the technique of choice to monitor the size and spatial distribution of δ' precipitates (Al3 Li). Here we report on the imaging of the δ' phase in such alloys using backscattered electrons (BSE) and low accelerating voltage in a high-resolution field-emission scanning electron microscope. By applying low-energy Ar+ ion milling to the surface after mechanical polishing (MP), the MP-induced corroded layers were efficiently removed and permitted the δ's to be visible with a limited impact on the observed microstructure. The resulting BSE contrast between the δ's and the Al matrix was compared with that obtained using Monte Carlo modelling. The artefacts possibly resulting from the sample preparation procedure were reviewed and discussed and permitted to confirm that these precipitates were effectively the metastable δ's. The method described in this report necessitates less intensive sample preparation than that required for TEM and provides a much larger field of view and an easily interpretable contrast compared to the transmission techniques. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

  8. Three-dimensional visualization of multiple synapses in thick sections using high-voltage electron microscopy in the rat spinal cord

    Directory of Open Access Journals (Sweden)

    Keita Satoh

    2015-09-01

    Full Text Available This data article contains complementary figure and movies (Supplementary Movies 1–3 related to the research article entitled, “Effective synaptome analysis of itch-mediating neurons in the spinal cord: a novel immunohistochemical methodology using high-voltage electron microscopy” [7]. It is important to show the synaptic connections at the ultrastructural level to understand the neural circuit, which requires the three-dimensional (3-D analyses in the electron microscopy. Here, we applied a new sample preparation method, a high-contrast en bloc staining according to the protocol of the National Center for Microscopy and Imaging Research (NCMIR, University of California, San Diego, CA, USA to high-voltage electron microscopy (HVEM tomography in order to examine the 3-D chemical neuroanatomy of the rat spinal cord. Pre-embedding immunoelectron microscopy was used in this study. HVEM has an excellent potential to directly visualize the ultrastructures in semi-thin sections (~5 μm thick, and we have successfully visualized many itch-mediating synaptic connections and neural networks in the spinal cord using “HVEM tomography”. Moreover, the methodology used in this study is simple and can be applied in multiple ways. This is an important contribution to ultrastructural investigations of the central nervous system in the present post-genomic age.

  9. Three-dimensional visualization of multiple synapses in thick sections using high-voltage electron microscopy in the rat spinal cord.

    Science.gov (United States)

    Satoh, Keita; Takanami, Keiko; Murata, Kazuyoshi; Kawata, Mitsuhiro; Sakamoto, Tatsuya; Sakamoto, Hirotaka

    2015-09-01

    This data article contains complementary figure and movies (Supplementary Movies 1-3) related to the research article entitled, "Effective synaptome analysis of itch-mediating neurons in the spinal cord: a novel immunohistochemical methodology using high-voltage electron microscopy" [7]. It is important to show the synaptic connections at the ultrastructural level to understand the neural circuit, which requires the three-dimensional (3-D) analyses in the electron microscopy. Here, we applied a new sample preparation method, a high-contrast en bloc staining according to the protocol of the National Center for Microscopy and Imaging Research (NCMIR), University of California, San Diego, CA, USA to high-voltage electron microscopy (HVEM) tomography in order to examine the 3-D chemical neuroanatomy of the rat spinal cord. Pre-embedding immunoelectron microscopy was used in this study. HVEM has an excellent potential to directly visualize the ultrastructures in semi-thin sections (~5 μm thick), and we have successfully visualized many itch-mediating synaptic connections and neural networks in the spinal cord using "HVEM tomography". Moreover, the methodology used in this study is simple and can be applied in multiple ways. This is an important contribution to ultrastructural investigations of the central nervous system in the present post-genomic age.

  10. Demonstration of InAlN/AlGaN high electron mobility transistors with an enhanced breakdown voltage by pulsed metal organic chemical vapor deposition

    Energy Technology Data Exchange (ETDEWEB)

    Xue, JunShuai, E-mail: junshuaixue@hotmail.com; Zhang, JinCheng; Hao, Yue [Key Laboratory of Wide Band Gap Semiconductor Materials and Devices, School of Microelectronics, Xidian University, Xi' an 710071 (China)

    2016-01-04

    In this work, InAlN/AlGaN heterostructures employing wider bandgap AlGaN instead of conventional GaN channel were grown on sapphire substrate by pulsed metal organic chemical vapor deposition, where the nominal Al composition in InAlN barrier and AlGaN channel were chosen to be 83% and 5%, respectively, to achieve close lattice-matched condition. An electron mobility of 511 cm{sup 2}/V s along with a sheet carrier density of 1.88 × 10{sup 13 }cm{sup −2} were revealed in the prepared heterostructures, both of which were lower compared with lattice-matched InAlN/GaN due to increased intrinsic alloy disorder scattering resulting from AlGaN channel and compressively piezoelectric polarization in barrier, respectively. While the high electron mobility transistor (HEMT) processed on these structures not only exhibited a sufficiently high drain output current density of 854 mA/mm but also demonstrated a significantly enhanced breakdown voltage of 87 V, which is twice higher than that of reported InAlN/GaN HEMT with the same device dimension, potential characteristics for high-voltage operation of GaN-based electronic devices.

  11. Electromagnetic Compatibility of a Low Voltage Power Supply for the ATLAS Tile Calorimeter Front-End Electronics

    CERN Document Server

    Blanchot, Georges; Hruska, I; Korolkov, I Ya; Palan, B; Pontt, J; Toro, A; Usai, G

    2007-01-01

    The front-end electronics of the ATLAS Tile Calorimeter is powered by DC/DC converters that sit close to it. The performance of the detector electronics is constrained by the conducted noise emissions of its power supply. A compatibility limit is defined for the system. The noise susceptibility of the front-end electronics is evaluated, and different solutions to reduce the front-end electronics noise are discussed and tested.

  12. Thermoforming apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Wallsten, H.I.

    1984-10-16

    Apparatus for manufacturing articles is disclosed in which a preheated sheet of thermoplastic material is intermittently fed to present successive preheated portions of the sheet in a work station having a forming tool for forming articles in each successive sheet portion and a stamping tool for co-operating with the forming tool to stamp the formed articles from the sheet. The forming tool has a plurality of forming dies which are movable successively and cyclically into the work station for forming articles in respective successive sheet portions. After each forming operation the stamping tool is brought into engagement with a resilient counter-surface on the forming die to stamp from the sheet the articles formed by that die.

  13. First direct electron microscopic visualization of a tight spatial coupling between GABAA-receptors and voltage-sensitive calcium channels

    DEFF Research Database (Denmark)

    Hansen, G H; Belhage, B; Schousboe, A

    1992-01-01

    Using cerebellar granule neurons in culture it was demonstrated that exposure of the cells to the GABAA receptor agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) leads to an increase in the number of voltage-gated calcium channels as revealed by quantitative preembedding indirect imm...... of THIP-treated cultures. This suggests that primarily low affinity GABAA-receptors are closely associated with Ca2+ channels and this may be important for the ability of these receptors to mediate an inhibitory action on transmitter release even under extreme depolarizing conditions....

  14. High-Voltage Droplet Dispenser

    Science.gov (United States)

    Eichenberg, Dennis J.

    2003-01-01

    An apparatus that is extremely effective in dispensing a wide range of droplets has been developed. This droplet dispenser is unique in that it utilizes a droplet bias voltage, as well as an ionization pulse, to release a droplet. Apparatuses that deploy individual droplets have been used in many applications, including, notably, study of combustion of liquid fuels. Experiments on isolated droplets are useful in that they enable the study of droplet phenomena under well-controlled and simplified conditions. In this apparatus, a syringe dispenses a known value of liquid, which emerges from, and hangs onto, the outer end of a flat-tipped, stainless steel needle. Somewhat below the needle tip and droplet is a ring electrode. A bias high voltage, followed by a high-voltage pulse, is applied so as to attract the droplet sufficiently to pull it off the needle. The voltages are such that the droplet and needle are negatively charged and the ring electrode is positively charged.

  15. Studies on the radicidation of natural food colorants. Effects of electron energy (accelerating voltages) and dose rate of ionizing radiation on functional properties of beet red colorant

    Energy Technology Data Exchange (ETDEWEB)

    Higashimura, Yutaka; Tada, Mikiro [Okayama Univ. (Japan). Graduate School of Natural Science and Technology; Furuta, Masakazu [Osaka Prefectural Univ., Sakai (Japan). Research Inst. for Advanced Science and Technology

    2003-01-01

    In order to the practical use of radicidation of beet red, natural food colorant with low heat stability and high possibility of microbe contamination, we studied on the energy dependency and dose rate effect for the influence on functional properties of the beet red colorant. For the elucidation of energy dependency, the {gamma}-ray (1.33 MeV) and electron beams with different accelerating voltages (0.75, 1, 2.5, 5 and 10 MeV) were used. The dose rate effect was studied under the different dose rate by using {gamma}-ray (0.723, 1.91 and 4.55 kGy/h) and electron beams with accelerating voltage of 10 MeV (1.0 x 10{sup 3}, 2.6 x 10{sup 3}, 7.0 x 10{sup 3}, 7.0 x 10{sup 3}, 2.0 x 10{sup 4} and 5.0 x 10{sup 4} kGy/h). The results obtained in this study showed that regardness of these energy and dose rate, the functional properties of the beet red colorant were little affected by irradiation less than 25 kGy of ionizing radiations. (author)

  16. AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with reduced leakage current and enhanced breakdown voltage using aluminum ion implantation

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Shichuang [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China); Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Fu, Kai, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn; Yu, Guohao; Zhang, Zhili; Song, Liang; Deng, Xuguang; Li, Shuiming; Sun, Qian; Cai, Yong; Zhang, Baoshun [Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Qi, Zhiqiang; Dai, Jiangnan; Chen, Changqing, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China)

    2016-01-04

    This letter has studied the performance of AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors on silicon substrate with GaN buffer treated by aluminum ion implantation for insulating followed by a channel regrown by metal–organic chemical vapor deposition. For samples with Al ion implantation of multiple energies of 140 keV (dose: 1.4 × 10{sup 14} cm{sup −2}) and 90 keV (dose: 1 × 10{sup 14} cm{sup −2}), the OFF-state leakage current is decreased by more than 3 orders and the breakdown voltage is enhanced by nearly 6 times compared to the samples without Al ion implantation. Besides, little degradation of electrical properties of the 2D electron gas channel is observed where the maximum drain current I{sub DSmax} at a gate voltage of 3 V was 701 mA/mm and the maximum transconductance g{sub mmax} was 83 mS/mm.

  17. Extracellular vesicles of calcifying turkey leg tendon characterized by immunocytochemistry and high voltage electron microscopic tomography and 3-D graphic image reconstruction

    Science.gov (United States)

    Landis, W. J.; Hodgens, K. J.; McKee, M. D.; Nanci, A.; Song, M. J.; Kiyonaga, S.; Arena, J.; McEwen, B.

    1992-01-01

    To gain insight into the structure and possible function of extracellular vesicles in certain calcifying vertebrate tissues, normally mineralizing leg tendons from the domestic turkey, Meleagris gallopavo, have been studied in two separate investigations, one concerning the electron microscopic immunolocalization of the 66 kDa phosphoprotein, osteopontin, and the other detailing the organization and distribution of mineral crystals associated with the vesicles as determined by high voltage microscopic tomography and 3-D graphic image reconstruction. Immunolabeling shows that osteopontin is related to extracellular vesicles of the tendon in the sense that its initial presence appears coincident with the development of mineral associated with the vesicle loci. By high voltage electron microscopy and 3-D imaging techniques, mineral crystals are found to consist of small irregularly shaped particles somewhat randomly oriented throughout individual vesicles sites. Their appearance is different from that found for the mineral observed within calcifying tendon collagen, and their 3-D disposition is not regularly ordered. Possible spatial and temporal relationships of vesicles, osteopontin, mineral, and collagen are being examined further by these approaches.

  18. Low Wind Speed Turbine Project Phase II: The Application of Medium-Voltage Electrical Apparatus to the Class of Variable Speed Multi-Megawatt Low Wind Speed Turbines; 15 June 2004--30 April 2005

    Energy Technology Data Exchange (ETDEWEB)

    Erdman, W.; Behnke, M.

    2005-11-01

    Kilowatt ratings of modern wind turbines have progressed rapidly from 50 kW to 1,800 kW over the past 25 years, with 3.0- to 7.5-MW turbines expected in the next 5 years. The premise of this study is simple: The rapid growth of wind turbine power ratings and the corresponding growth in turbine electrical generation systems and associated controls are quickly making low-voltage (LV) electrical design approaches cost-ineffective. This report provides design detail and compares the cost of energy (COE) between commercial LV-class wind power machines and emerging medium-voltage (MV)-class multi-megawatt wind technology. The key finding is that a 2.5% reduction in the COE can be achieved by moving from LV to MV systems. This is a conservative estimate, with a 3% to 3.5% reduction believed to be attainable once purchase orders to support a 250-turbine/year production level are placed. This evaluation considers capital costs as well as installation, maintenance, and training requirements for wind turbine maintenance personnel. Subsystems investigated include the generator, pendant cables, variable-speed converter, and padmount transformer with switchgear. Both current-source and voltage-source converter/inverter MV topologies are compared against their low-voltage, voltage-source counterparts at the 3.0-, 5.0-, and 7.5-MW levels.

  19. Development of theoretical approach for describing electronic properties of hetero-interface systems under applied bias voltage

    Science.gov (United States)

    Iida, Kenji; Noda, Masashi; Nobusada, Katsuyuki

    2017-02-01

    We have developed a theoretical approach for describing the electronic properties of hetero-interface systems under an applied electrode bias. The finite-temperature density functional theory is employed for controlling the chemical potential in their interfacial region, and thereby the electronic charge of the system is obtained. The electric field generated by the electronic charging is described as a saw-tooth-like electrostatic potential. Because of the continuum approximation of dielectrics sandwiched between electrodes, we treat dielectrics with thicknesses in a wide range from a few nanometers to more than several meters. Furthermore, the approach is implemented in our original computational program named grid-based coupled electron and electromagnetic field dynamics (GCEED), facilitating its application to nanostructures. Thus, the approach is capable of comprehensively revealing electronic structure changes in hetero-interface systems with an applied bias that are practically useful for experimental studies. We calculate the electronic structure of a SiO2-graphene-boron nitride (BN) system in which an electrode bias is applied between the graphene layer and an electrode attached on the SiO2 film. The electronic energy barrier between graphene and BN is varied with an applied bias, and the energy variation depends on the thickness of the BN film. This is because the density of states of graphene is so low that the graphene layer cannot fully screen the electric field generated by the electrodes. We have demonstrated that the electronic properties of hetero-interface systems are well controlled by the combination of the electronic charging and the generated electric field.

  20. Investigation of electron behavior in Nano-TiO2 photocatalysis by using in situ open-circuit voltage and photoconductivity measurements.

    Science.gov (United States)

    Liu, Baoshun; Wang, Xuelei; Wen, Liping; Zhao, Xiujian

    2013-08-05

    The in situ open-circuit voltages (Voc ) and the in situ photoconductivities have been measured to study electron behavior in photocatalysis and its effect on the photocatalytic oxidation of methanol. It was observed that electron injection to the conduction band (CB) of TiO2 under light illumination during photocatalysis includes two sources: from the valence band (VB) of TiO2 and from the methanol molecule. The electron injection from methanol to TiO2 is slower than that directly from the VB, which indicates that the adsorption mode of methanol on the TiO2 surface can change between dark and illuminated states. The electron injection from methanol to the CB of TiO2 leads to the upshift of the Fermi level of electrons in TiO2 , which is the thermodynamic driving force of photocatalytic oxidation. It was also found that the charge state of nano-TiO2 is continuously changing during photocatalysis as electrons are injected from methanol to TiO2 . Combined with the apparent Langmuir-Hinshelwood kinetic model, the relation between photocatalytic kinetics and electrons in the TiO2 CB was developed and verified experimentally. The photocatalytic rate constant is the variation of the Fermi level with time, based on which a new method was developed to calculate the photocatalytic kinetic rate constant by monitoring the change of Voc with time during photocatalysis. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Efficient Planar Perovskite Solar Cells with Reduced Hysteresis and Enhanced Open Circuit Voltage by Using PW12-TiO2 as Electron Transport Layer.

    Science.gov (United States)

    Huang, Chun; Liu, Canjun; Di, Yunxiang; Li, Wenzhang; Liu, Fangyang; Jiang, Liangxing; Li, Jie; Hao, Xiaojing; Huang, Haitao

    2016-04-06

    An electron transport layer is essential for effective operation of planar perovskite solar cells. In this Article, PW12-TiO2 composite was used as the electron transport layer for the planar perovskite solar cell in the device structure of fluorine-doped tin oxide (FTO)-glass/PW12-TiO2/perovskite/spiro-OMeTAD/Au. A proper downward shift of the conduction band minimum (CBM) enhanced electron extraction from the perovskite layer to the PW12-TiO2 composite layer. Consequently, the common hysteresis effect in TiO2-based planar perovskite solar cells was significantly reduced and the open circuit voltage was greatly increased to about 1.1 V. Perovskite solar cells using the PW12-TiO2 compact layer showed an efficiency of 15.45%. This work can contribute to the studies on the electron transport layer and interface engineering for the further development of perovskite solar cells.

  2. Voltage triggered resistance switching in two terminal VO2 nano-junctions fabricated by electron-beam lithography

    Science.gov (United States)

    Gopalakrishnan, Gokul; Ruzmetov, Dmitry; Ko, Changhyun; Narayanamurti, Venkatesh; Ramanathan, Shriram

    2010-03-01

    Vanadium dioxide (VO2) thin films have been shown to undergo an abrupt decrease in resistivity, both in response to increasing temperature as well as an increasing electric field. The ultra-fast electrically triggered transition has made VO2 an exciting platform to explore a range of potential applications, from high speed switches to memory elements. Particularly valuable to such investigation is characterization of the electronic properties of VO2 thin films, in which transport is additionally constrained within nanoscale dimensions along the in-plane directions. In this poster, we describe the results of transport measurements on VO2 nanojunctions grown on a conductive substrate and patterned by electron-beam lithography. We analyze the out-of-plane I-V data and present a detailed discussion on electron transport mechanisms and on the origin behind the electrically triggered conductivity jumps that we observe in these nano-junctions.

  3. [Development of a new type intelligent high potential therapeutic apparatus].

    Science.gov (United States)

    Gao, Tiedan; Wang, Huafeng; Chen, Chaomin

    2013-06-01

    This article presents the development and design of a new type intelligent high potential therapeutic apparatus, by using Atmega1280 as its controller. The circuit transforms voltage from 220 V ac to 110 V ac and constitutes different circuits with relays. In order to get different treatment waveforms, inductance of various values is used in different circuits. The circuit generates appropriate treatment voltage with the transformer booster. Simultaneously, the corresponding control software was composed. Finally the hardware and software designs of the high potential therapeutic apparatus were completed. Result of the experiment showed that the high potential therapeutic apparatus worked steadily and the effect of treatment was satisfactory.

  4. Multiple resolution chirp reflectometry for fault localization and diagnosis in a high voltage cable in automotive electronics

    Science.gov (United States)

    Chang, Seung Jin; Lee, Chun Ku; Shin, Yong-June; Park, Jin Bae

    2016-12-01

    A multiple chirp reflectometry system with a fault estimation process is proposed to obtain multiple resolution and to measure the degree of fault in a target cable. A multiple resolution algorithm has the ability to localize faults, regardless of fault location. The time delay information, which is derived from the normalized cross-correlation between the incident signal and bandpass filtered reflected signals, is converted to a fault location and cable length. The in-phase and quadrature components are obtained by lowpass filtering of the mixed signal of the incident signal and the reflected signal. Based on in-phase and quadrature components, the reflection coefficient is estimated by the proposed fault estimation process including the mixing and filtering procedure. Also, the measurement uncertainty for this experiment is analyzed according to the Guide to the Expression of Uncertainty in Measurement. To verify the performance of the proposed method, we conduct comparative experiments to detect and measure faults under different conditions. Considering the installation environment of the high voltage cable used in an actual vehicle, target cable length and fault position are designed. To simulate the degree of fault, the variety of termination impedance (10 Ω , 30 Ω , 50 Ω , and 1 \\text{k} Ω ) are used and estimated by the proposed method in this experiment. The proposed method demonstrates advantages in that it has multiple resolution to overcome the blind spot problem, and can assess the state of the fault.

  5. Ancillary Services for Minimizing the Impact of Resonances in Low Voltage Grids by Power Electronics based Distributed Generators

    NARCIS (Netherlands)

    Heskes, P.J.M.; Myrzik, J.M.A.; Kling, W.L.

    2011-01-01

    This paper proposes a solution for the minimization of the impact of resonances due to parallel capacitances in the grid. This solution is a combination of two additional (ancillary) services of power electronics converters, namely Virtual Parallel Capacitance Reduction (VPCR) and Virtual Resistive

  6. In situ direct observation of photocorrosion in ZnO crystals in ionic liquid using a laser-equipped high-voltage electron microscope

    Directory of Open Access Journals (Sweden)

    J. Ishioka

    2017-03-01

    Full Text Available ZnO photocatalysts in water react with environmental water molecules and corrode under illumination. ZnO nanorods in water can also grow because of water splitting induced by UV irradiation. To investigate their morphological behavior caused by crystal growth and corrosion, here we developed a new laser-equipped high-voltage electron microscope and observed crystal ZnO nanorods immersed in ionic liquid. Exposing the specimen holder to a laser with a wavelength of 325 nm, we observed the photocorrosion in situ at the atomic scale for the first time. This experiment revealed that Zn and O atoms near the interface between the ZnO nanorods and the ionic liquid tended to dissolve into the liquid. The polarity and facet of the nanorods were strongly related to photocorrosion and crystal growth.

  7. Capacitance-voltage hysteresis of an electrolyte-GaAs Schottky contact associated with field-enhanced trapping of hot electrons

    Science.gov (United States)

    Yamashita, Akiyasu

    1996-09-01

    Electro-optical properties of n-GaAs crystal were studied by using a transparent, electrolyte Schottky contact and the following results were obtained: highly sensitive detection of some critical-point energies in the band structure of GaAs and the Franz-Keldysh shift of the fundamental absorption edge at high electric fields; the observation of a new capacitance-voltage hysteresis effect of the electrolyte-GaAs contact, with a characteristic threshold-field. Details of this hysteresis are presented with related photocapacitance spectra of the contact. In addition, its mechanism is explained by assuming field-enhanced trapping of hot electrons at complex deep-levels and their succeeding charge-state controlled structural transformation.

  8. Electron stripping processes of H⁻ ion beam in the 80 kV high voltage extraction column and low energy beam transport line at LANSCE.

    Science.gov (United States)

    Draganic, I N

    2016-02-01

    Basic vacuum calculations were performed for various operating conditions of the Los Alamos National Neutron Science H(-) Cockcroft-Walton (CW) injector and the Ion Source Test Stand (ISTS). The vacuum pressure was estimated for both the CW and ISTS at five different points: (1) inside the H(-) ion source, (2) in front of the Pierce electrode, (3) at the extraction electrode, (4) at the column electrode, and (5) at the ground electrode. A static vacuum analysis of residual gases and the working hydrogen gas was completed for the normal ion source working regime. Gas density and partial pressure were estimated for the injected hydrogen gas. The attenuation of H(-) beam current and generation of electron current in the high voltage acceleration columns and low energy beam transport lines were calculated. The interaction of H(-) ions on molecular hydrogen (H2) is discussed as a dominant collision process in describing electron stripping rates. These results are used to estimate the observed increase in the ratio of electrons to H(-) ion beam in the ISTS beam transport line.

  9. Tensile-stressed microelectromechanical apparatus and tiltable micromirrors formed therefrom

    Science.gov (United States)

    Fleming, James G.

    2007-01-09

    A microelectromechanical (MEM) apparatus is disclosed which includes a pair of tensile-stressed actuators suspending a platform above a substrate to tilt the platform relative to the substrate. A tensile stress built into the actuators initially tilts the platform when a sacrificial material used in fabrication of the MEM apparatus is removed. Further tilting of the platform can occur with a change in the ambient temperature about the MEM apparatus, or by applying a voltage to one or both of the tensile-stressed actuators. The MEM apparatus can be used to form a tiltable micromirror or an array of such devices, and also has applications for thermal management within satellites.

  10. Current-voltage and kinetic energy flux relations for relativistic field-aligned acceleration of auroral electrons

    Directory of Open Access Journals (Sweden)

    S. W. H. Cowley

    2006-03-01

    Full Text Available Recent spectroscopic observations of Jupiter's "main oval" auroras indicate that the primary auroral electron beam is routinely accelerated to energies of ~100 keV, and sometimes to several hundred keV, thus approaching the relativistic regime. This suggests the need to re-examine the classic non-relativistic theory of auroral electron acceleration by field-aligned electric fields first derived by Knight (1973, and to extend it to cover relativistic situations. In this paper we examine this problem for the case in which the source population is an isotropic Maxwellian, as also assumed by Knight, and derive exact analytic expressions for the field-aligned current density (number flux and kinetic energy flux of the accelerated population, for arbitrary initial electron temperature, acceleration potential, and field strength beneath the acceleration region. We examine the limiting behaviours of these expressions, their regimes of validity, and their implications for auroral acceleration in planetary magnetospheres (and like astrophysical systems. In particular, we show that for relativistic accelerating potentials, the current density increases as the square of the minimum potential, rather than linearly as in the non-relativistic regime, while the kinetic energy flux then increases as the cube of the potential, rather than as the square.

  11. Direct observation of voltage barriers in ZnO varistors

    Science.gov (United States)

    Krivanek, O. L.; Williams, P.; Lin, Y.-C.

    1979-01-01

    Voltage barriers in a ZnO varistor have been imaged by voltage-contrast scanning electron microscopy. They are due to grain boundaries and are capable of supporting voltage differences of up to about 4 V.

  12. Large Rotor Test Apparatus

    Data.gov (United States)

    Federal Laboratory Consortium — This test apparatus, when combined with the National Full-Scale Aerodynamics Complex, produces a thorough, full-scale test capability. The Large Rotor Test Apparatus...

  13. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  14. Pore roller filtration apparatus

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to the field of filtering, more precisely the present invention concerns an apparatus and a method for the separation of dry matter from a medium and the use of said apparatus. One embodiment discloses an apparatus for the separation of dry matter from a medium, comp...

  15. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  16. Military Curricula for Vocational & Technical Education. Basic Electricity and Electronics Individualized Learning System. CANTRAC A-100-0010. Module Nine: Relationships of Current, Counter EMF, and Voltage in LR Circuits. Study Booklet.

    Science.gov (United States)

    Chief of Naval Education and Training Support, Pensacola, FL.

    This individualized learning module on the relationships of current, electromotive force, and voltage in inductive-resistive circuits is one in a series of modules for a course in basic electricity and electronics. The course is one of a number of military-developed curriculum packages selected for adaptation to vocational instructional and…

  17. Methods and apparatus for measurement of the resistivity of geological formations from within cased wells in presence of acoustic and magnetic energy sources

    Science.gov (United States)

    Vail, III, William B.

    1991-01-01

    Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation.

  18. CdTe Nanocrystal Hetero-Junction Solar Cells with High Open Circuit Voltage Based on Sb-doped TiO₂ Electron Acceptor Materials.

    Science.gov (United States)

    Li, Miaozi; Liu, Xinyan; Wen, Shiya; Liu, Songwei; Heng, Jingxuan; Qin, Donghuan; Hou, Lintao; Wu, Hongbin; Xu, Wei; Huang, Wenbo

    2017-05-03

    We propose Sb-doped TiO₂ as electron acceptor material for depleted CdTe nanocrystal (NC) hetero-junction solar cells. Novel devices with the architecture of FTO/ZnO/Sb:TiO₂/CdTe/Au based on CdTe NC and TiO₂ precursor are fabricated by rational ambient solution process. By introducing TiO₂ with dopant concentration, we are able to tailor the optoelectronic properties of NC solar cells. Our novel devices demonstrate a very high open circuit voltage of 0.74 V, which is the highest V oc reported for any CdTe NC based solar cells. The power conversion efficiency (PCE) of solar cells increases with the increase of Sb-doped content from 1% to 3%, then decreases almost linearly with further increase of Sb content due to the recombination effect. The champion device shows J sc , V oc , FF, and PCE of 14.65 mA/cm², 0.70 V, 34.44, and 3.53% respectively, which is prospective for solution processed NC solar cells with high V oc .

  19. Crucial Role of the Electron Transport Layer and UV Light on the Open-Circuit Voltage Loss in Inverted Organic Solar Cells.

    Science.gov (United States)

    Tournebize, Aurélien; Mattana, Giorgio; Gorisse, Thérèse; Bousquet, Antoine; Wantz, Guillaume; Hirsch, Lionel; Chambon, Sylvain

    2017-10-04

    Understanding the degradation mechanisms in organic photovoltaics is crucial in order to develop stable organic semiconductors and robust device architectures. The rapid loss of efficiency, referred to as burn-in, is a major issue to be addressed. This study reports on the influence of the electron transport layer (ETLs) and UV light on the drop of open-circuit voltage (V oc ) for P3HT:PC 60 BM-based devices. The results show that V oc loss is induced by the UV and, more importantly, that the ETL can amplify it, with TiO x yielding a stronger drop than ZnO. Using impedance spectroscopy (IS) and X-ray photoelectron spectroscopy (XPS), different degradation mechanisms were identified according to whether the ETL is TiO x or ZnO. For TiO x -based devices, the formation of an interface dipole was identified, resulting in a loss of the flat-band potential (V fb ) and, thus, of the V oc . For ZnO-based devices, chemical modifications of the metal oxide and active layer at the interface were detected, resulting in a doping of the active layer which impacts the V oc . This study highlights the role of the architecture and, more specifically, of the ETL in the severity of burn-in and degradation pathways.

  20. Correlation of interface states/border traps and threshold voltage shift on AlGaN/GaN metal-insulator-semiconductor high-electron-mobility transistors

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tian-Li, E-mail: Tian-Li.Wu@imec.be; Groeseneken, Guido [imec, Kapeldreef 75, 3001 Leuven (Belgium); Department of Electrical Engineering, KU Leuven, Leuven (Belgium); Marcon, Denis; De Jaeger, Brice; Lin, H. C.; Franco, Jacopo; Stoffels, Steve; Van Hove, Marleen; Decoutere, Stefaan [imec, Kapeldreef 75, 3001 Leuven (Belgium); Bakeroot, Benoit [imec, Kapeldreef 75, 3001 Leuven (Belgium); Centre for Microsystems Technology, Ghent University, 9052 Gent (Belgium); Roelofs, Robin [ASM, Kapeldreef 75, 3001 Leuven (Belgium)

    2015-08-31

    In this paper, three electrical techniques (frequency dependent conductance analysis, AC transconductance (AC-g{sub m}), and positive gate bias stress) were used to evaluate three different gate dielectrics (Plasma-Enhanced Atomic Layer Deposition Si{sub 3}N{sub 4}, Rapid Thermal Chemical Vapor Deposition Si{sub 3}N{sub 4}, and Atomic Layer Deposition (ALD) Al{sub 2}O{sub 3}) for AlGaN/GaN Metal-Insulator-Semiconductor High-Electron-Mobility Transistors. From these measurements, the interface state density (D{sub it}), the amount of border traps, and the threshold voltage (V{sub TH}) shift during a positive gate bias stress can be obtained. The results show that the V{sub TH} shift during a positive gate bias stress is highly correlated to not only interface states but also border traps in the dielectric. A physical model is proposed describing that electrons can be trapped by both interface states and border traps. Therefore, in order to minimize the V{sub TH} shift during a positive gate bias stress, the gate dielectric needs to have a lower interface state density and less border traps. However, the results also show that the commonly used frequency dependent conductance analysis technique to extract D{sub it} needs to be cautiously used since the resulting value might be influenced by the border traps and, vice versa, i.e., the g{sub m} dispersion commonly attributed to border traps might be influenced by interface states.

  1. A novel electromagnetic apparatus for rapid multiplex single molecule force spectroscopy.

    Science.gov (United States)

    Shen, Yi; Czajkowsky, Daniel M; Li, Xiaowei; Sun, Jielin; Hu, Jun; Shao, Zhifeng

    2013-02-01

    Single-molecule force spectroscopy has revolutionized our ability to probe the details of molecular structures and interactions, but the numbers of individual measurements required for achieving a statistically reliable result can sometimes prove daunting. To overcome this problem, a number of instruments have recently been developed that are capable of monitoring the behavior of tens of individual biomolecules simultaneously. In this work, we have constructed a novel electromagnetic apparatus for multiplex single molecule force measurements utilizing magnetic microspheres. In this system, the magnetic field is generated with an electron-lens of an electron microscope mated with a high voltage flash light circuit to rapidly attain a stable magnetic field. We show that this instrument can generate a uniform magnetic force of up to -20 pN within 5 ms, over a region spanning 1 mm. The successful application of this apparatus to the force-dependent extension of dsDNA fully validates this approach. Furthermore, the lens-like design of the pole piece is fully compatible with optical imaging, thus allowing for the integration of single molecule fluorescence capabilities that should make this system a particularly powerful apparatus for multi-dimensional characterization of fast processes within interacting single molecules.

  2. Low Voltage Scanning Electron Microscopy

    Science.gov (United States)

    1988-10-01

    2 0-27 0.4 i 0.2 L3: 3 1-0 1-0 .... L4: 4 0-27 0.4 20/LaB 6 1.0 Beam current (I b ) = 1 x 10 - 2 A (IpA) except S1 (Ib lOpA ) (with A - 1), based on...PW) = 2A/cm /Sr/V nV=2.5eV, IxO - 1 1 A ( lOpA ) STD SEP S2: as #1 (both tungsten 2 (IDA) Lhermionic gun) f lxIO- 1 A (IpA) E ’o L I : L V S E M 1 5 1 C

  3. Low Voltage Electron Beam Lithography

    Science.gov (United States)

    1994-01-01

    also known the flux density), uig Mu’s pogriam MI 1. Decause of the symmer y theo rns, we sned only solve over the ngon AY2D; this region is shown in...which is superior to the N2 growth for a full Monte Carlo simulation. Another possibility is the "Fast" Monte Carlo technique developed by Jansen [49...be much quicker than numerical my tracing. Jansen claims a speedup factor of 10 to 100 times for his method. The assumption about small deviations is

  4. 46 CFR 167.40-20 - Deep-sea sounding apparatus.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Deep-sea sounding apparatus. 167.40-20 Section 167.40-20... SHIPS Certain Equipment Requirements § 167.40-20 Deep-sea sounding apparatus. Nautical school ships shall be equipped with an efficient or electronic deep-sea sounding apparatus. The electronic deep-sea...

  5. Radiative Gasification Apparatus

    Data.gov (United States)

    Federal Laboratory Consortium — This apparatus, developed at EL, determines gasification rate (mass loss rate) of a horizontally oriented specimen exposed in a nitrogen environment to a controlled...

  6. Over-voltage protection system and method

    Science.gov (United States)

    Chi, Song; Dong, Dong; Lai, Rixin

    2017-05-02

    An over-voltage protection system includes an electronic valve connected across two terminals of a circuit and an over-voltage detection circuit connected across one of the plurality of semiconductor devices for detecting an over-voltage across the circuit. The electronic valve includes a plurality of semiconductor devices connected in series. The over-voltage detection circuit includes a voltage divider circuit connected to a break-over diode in a way to provide a representative low voltage to the break-over diode and an optocoupler configured to receive a current from the break-over diode when the representative low voltage exceeds a threshold voltage of the break-over diode indicating an over-voltage condition. The representative low voltage provided to the break-over diode represents a voltage across the one semiconductor device. A plurality of self-powered gate drive circuits are connected to the plurality of semiconductor devices, wherein the plurality of self-powered gate drive circuits receive over-voltage triggering pulses from the optocoupler during the over-voltage condition and switch on the plurality of semiconductor devices to bypass the circuit.

  7. Inspection apparatus and replaceable door for a vacuum chamber of such an inspection apparatus and a method for operating an inspection apparatus

    NARCIS (Netherlands)

    Kruit, P.; Hoogenboom, J.P.; Zonnevylle, A.C.

    2012-01-01

    An inspection apparatus is provided comprising in combination at least an optical microscope and an ion- or electron microscope equipped with a source for emitting a primary beam of radiation to a sample in a sample holder. The apparatus may comprise a detector for detection of secondary radiation

  8. A photoelectron-photoion coincidence imaging apparatus for femtosecond time-resolved molecular dynamics with electron time-of-flight resolution of sigma=18 ps and energy resolution Delta E/E=3.5%.

    Science.gov (United States)

    Vredenborg, Arno; Roeterdink, Wim G; Janssen, Maurice H M

    2008-06-01

    We report on the construction and performance of a novel photoelectron-photoion coincidence machine in our laboratory in Amsterdam to measure the full three-dimensional momentum distribution of correlated electrons and ions in femtosecond time-resolved molecular beam experiments. We implemented sets of open electron and ion lenses to time stretch and velocity map the charged particles. Time switched voltages are operated on the particle lenses to enable optimal electric field strengths for velocity map focusing conditions of electrons and ions separately. The position and time sensitive detectors employ microchannel plates (MCPs) in front of delay line detectors. A special effort was made to obtain the time-of-flight (TOF) of the electrons at high temporal resolution using small pore (5 microm) MCPs and implementing fast timing electronics. We measured the TOF distribution of the electrons under our typical coincidence field strengths with a temporal resolution down to sigma=18 ps. We observed that our electron coincidence detector has a timing resolution better than sigma=16 ps, which is mainly determined by the residual transit time spread of the MCPs. The typical electron energy resolution appears to be nearly laser bandwidth limited with a relative resolution of DeltaE(FWHM)/E=3.5% for electrons with kinetic energy near 2 eV. The mass resolution of the ion detector for ions measured in coincidence with electrons is about Deltam(FWHM)/m=14150. The velocity map focusing of our extended source volume of particles, due to the overlap of the molecular beam with the laser beams, results in a parent ion spot on our detector focused down to sigma=115 microm.

  9. Aerosol distribution apparatus

    Science.gov (United States)

    Hanson, W.D.

    An apparatus for uniformly distributing an aerosol to a plurality of filters mounted in a plenum, wherein the aerosol and air are forced through a manifold system by means of a jet pump and released into the plenum through orifices in the manifold. The apparatus allows for the simultaneous aerosol-testing of all the filters in the plenum.

  10. Advanced stability control of multi-machine power system by vips apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, A. [Tokyo Univ., Tokyo (Japan). Dept. of Electrical Engineering; Sekine, Y. [Science Univ. of Tokyo, Tokyo (Japan). Dept. of Electrical Engineering

    1994-12-31

    New technology such as synchronized switching and power electronics will make it possible to change the configuration of transmission network, the impedances of transmission lines and the phase angles of voltage in the future power systems. This paper presents a comprehensive power system damping control by power electronics based variable impedance apparatus such as variable series capacitor and high speed phase shifter and also shows a novel switching-over control of transmission lines by synchronized switching for the first awing stability and damping enhancement. The control scheme discussed in this paper is based on an energy function of multi-machine power system and its time derivative. Its effectiveness is demonstrated by digital simulations and eigenvalue analysis in multi-machine test systems. It is demonstrated that multiple switching of transmission lines improves damping in the post-fault conditions. (author) 13 refs., 24 figs., 5 tabs.

  11. Nuclear reactor apparatus

    Science.gov (United States)

    Wade, Elman E.

    1978-01-01

    A lifting, rotating and sealing apparatus for nuclear reactors utilizing rotating plugs above the nuclear reactor core. This apparatus permits rotation of the plugs to provide under the plug refueling of a nuclear core. It also provides a means by which positive top core holddown can be utilized. Both of these operations are accomplished by means of the apparatus lifting the top core holddown structure off the nuclear core while stationary, and maintaining this structure in its elevated position during plug rotation. During both of these operations, the interface between the rotating member and its supporting member is sealingly maintained.

  12. IMAGING APPARATUS AND METHOD

    NARCIS (Netherlands)

    Manohar, Srirang; van Leeuwen, A.G.J.M.

    2008-01-01

    A thermoacoustic imaging apparatus comprises an electromagnetic radiation source configured to irradiate a sample area and an acoustic signal detection probe arrangement for detecting acoustic signals. A radiation responsive acoustic signal generator is added outside the sample area. The detection

  13. Imaging Apparatus And Method

    NARCIS (Netherlands)

    Manohar, Srirang; van Leeuwen, A.G.J.M.

    2010-01-01

    A thermoacoustic imaging apparatus comprises an electromagnetic radiation source configured to irradiate a sample area and an acoustic signal detection probe arrangement for detecting acoustic signals. A radiation responsive acoustic signal generator is added outside the sample area. The detection

  14. NMR logging apparatus

    Science.gov (United States)

    Walsh, David O; Turner, Peter

    2014-05-27

    Technologies including NMR logging apparatus and methods are disclosed. Example NMR logging apparatus may include surface instrumentation and one or more downhole probes configured to fit within an earth borehole. The surface instrumentation may comprise a power amplifier, which may be coupled to the downhole probes via one or more transmission lines, and a controller configured to cause the power amplifier to generate a NMR activating pulse or sequence of pulses. Impedance matching means may be configured to match an output impedance of the power amplifier through a transmission line to a load impedance of a downhole probe. Methods may include deploying the various elements of disclosed NMR logging apparatus and using the apparatus to perform NMR measurements.

  15. Thermal Acoustic Fatigue Apparatus

    Data.gov (United States)

    Federal Laboratory Consortium — The Thermal Acoustic Fatigue Apparatus (TAFA) is a progressive wave tube test facility that is used to test structures for dynamic response and sonic fatigue due to...

  16. Apparatus for drying sugar cubes

    NARCIS (Netherlands)

    Derckx, H.A.J.; Torringa, H.M.

    1999-01-01

    Device for drying sugar cubes containing a heating apparatus for heating and dehumidifying the sugar cubes, a conditioning apparatus for cooling off and possibly further dehumidifying the sugar cubes and a conveying apparatus for conveying the sugar cubes through the heating apparatus and the

  17. Spin coating apparatus

    Science.gov (United States)

    Torczynski, John R.

    2000-01-01

    A spin coating apparatus requires less cleanroom air flow than prior spin coating apparatus to minimize cleanroom contamination. A shaped exhaust duct from the spin coater maintains process quality while requiring reduced cleanroom air flow. The exhaust duct can decrease in cross section as it extends from the wafer, minimizing eddy formation. The exhaust duct can conform to entrainment streamlines to minimize eddy formation and reduce interprocess contamination at minimal cleanroom air flow rates.

  18. The High-Voltage System of Calet Apparatus

    Directory of Open Access Journals (Sweden)

    Petroni Francesco

    2017-01-01

    This paper presents the experience gained in the implementation of the CALET HV system: the system design requirements and the technical solutions adopted, the two system sections block schemes and the main characteristics of the DC/DC converters that guarantee the CALET HV system technical performance.

  19. VCSEL fault location apparatus and method

    Science.gov (United States)

    Keeler, Gordon A [Albuquerque, NM; Serkland, Darwin K [Albuquerque, NM

    2007-05-15

    An apparatus for locating a fault within an optical fiber is disclosed. The apparatus, which can be formed as a part of a fiber-optic transmitter or as a stand-alone instrument, utilizes a vertical-cavity surface-emitting laser (VCSEL) to generate a test pulse of light which is coupled into an optical fiber under test. The VCSEL is subsequently reconfigured by changing a bias voltage thereto and is used as a resonant-cavity photodetector (RCPD) to detect a portion of the test light pulse which is reflected or scattered from any fault within the optical fiber. A time interval .DELTA.t between an instant in time when the test light pulse is generated and the time the reflected or scattered portion is detected can then be used to determine the location of the fault within the optical fiber.

  20. Advances in high voltage insulation and arc interruption in SF6 and vacuum

    CERN Document Server

    Maller, V N

    1982-01-01

    Advances in High Voltage Insulation and Arc Interruption in SF6 and Vacuum deals with high voltage breakdown and arc extinction in sulfur hexafluoride (SF6) and high vacuum, with special emphasis on the application of these insulating media in high voltage power apparatus and devices. The design and developmental aspects of various high voltage power apparatus using SF6 and high vacuum are highlighted. This book is comprised of eight chapters and opens with a discussion on electrical discharges in SF6 and high vacuum, along with the properties and handling of SF6 gas. The following chapters fo

  1. Methods and apparatus for controlling rotary machines

    Science.gov (United States)

    Bagepalli, Bharat Sampathkumaran [Niskayuna, NY; Jansen, Patrick Lee [Scotia, NY; Barnes, Gary R [Delanson, NY; Fric, Thomas Frank [Greer, SC; Lyons, James Patrick Francis [Niskayuna, NY; Pierce, Kirk Gee [Simpsonville, SC; Holley, William Edwin [Greer, SC; Barbu, Corneliu [Guilderland, NY

    2009-09-01

    A control system for a rotary machine is provided. The rotary machine has at least one rotating member and at least one substantially stationary member positioned such that a clearance gap is defined between a portion of the rotating member and a portion of the substantially stationary member. The control system includes at least one clearance gap dimension measurement apparatus and at least one clearance gap adjustment assembly. The adjustment assembly is coupled in electronic data communication with the measurement apparatus. The control system is configured to process a clearance gap dimension signal and modulate the clearance gap dimension.

  2. SCANNING ELECTRON MICROSCOPY OF “ROSA” FILTER ELEMENTS FROM HEMOFENIX APPARATUS, AND OF BLOOD IN MEMBRANE PLASMAPHERESIS AND LASER IRRADIATION

    Directory of Open Access Journals (Sweden)

    I. M. Baybekov

    2013-01-01

    Full Text Available Aim. To study with scanning electron microscopy an interaction between structural elements of “Rosa” filters (a component of HEMOFENIХ with erythrocytes during membrane plasmapheresis and under the effect of la- ser irradiation performed during plasmapheresis. Materials and methods. Using scanning electron microscopy and morphometry, blood cells and plasma-filter components were studied in patients with myasthenia gravis. Results. It has been revealed that the percentage of pathologic forms of erythrocytes increased in peripheral blood of patients with myasthenia gravis. Plasmapheresis leads to an increase in the number of pathologic forms of erythrocytes in peripheral blood as well as on plasma-filter components. Conclusion. Laser irradiation, in turn, promotes the significant reduction of pathological forms of erythrocytes number in peripheral blood and on plasma-filter components. 

  3. A Voltage Gain-Controlled Modified CFOA And Its Application in Electronically Tunable Four-Mode All-Pass Filter Design

    Directory of Open Access Journals (Sweden)

    Norbert Herencsar

    2012-07-01

    Full Text Available This paper presents a new active building block (ABB called voltage gain-controlled modified current feedback amplifier (VGC-MCFOA based on bipolar junction transistor technology. The versatility of the new ABB is demonstrated in new first-order all-pass filter structure design employing single VGC-MCFOA, single grounded capacitor, and three resistors. Introduced circuit provides all four possible transfer functions at the same configuration, namely current-mode, transimpedance-mode, transadmittance-mode, and voltage-mode. The pole frequency of the circuit can be easily tuned by means of DC bias currents. The theoretical results are verified by SPICE simulations based on bipolar transistor arrays AT&T ALA400-CBIC-R process parameters.

  4. Breakdown voltage enhancement of AlGaN/GaN high electron mobility transistors by polyimide/chromium composite thin film passivation

    Science.gov (United States)

    Futong, Chu; Chao, Chen; Xingzhao, Liu

    2014-03-01

    A novel AlGaN/GaN high electric mobility transistor (HEMT) with polyimide (PI)/chromium (Cr) as the passivation layer is proposed for enhancing breakdown voltage and its DC performance is also investigated. The Cr nanoparticles firstly introduced in PI thin films by the co-evaporation can be used to increase the permittivity of PI film. The high-permittivity PI/Cr passivation acting as field plate can suppress the fringing electric field peak at the drain-side edge of the gate electrode. This mechanism is demonstrated in accord with measured results. The experimental results show that in comparison with the AlGaN/GaN HEMTs without passivation, the breakdown voltage of HEMTs with the PI/Cr composite thin films can be significantly improved, from 122 to 248 V.

  5. Analog graphic display method and apparatus

    Science.gov (United States)

    Kronberg, J.W.

    1991-08-13

    Disclosed are an apparatus and method for using an output device such as an LED to show the approximate analog level of a variable electrical signal wherein a modulating AC waveform is superimposed either on the signal or a reference voltage, both of which are then fed to a comparator which drives the output device. Said device flashes at a constant perceptible rate with a duty cycle which varies in response to variations in the level of the input signal. The human eye perceives these variations in duty cycle as analogous to variations in the level of the input signal. 21 figures.

  6. A Voltage Gain-Controlled Modified CFOA And Its Application in Electronically Tunable Four-Mode All-Pass Filter Design

    OpenAIRE

    Norbert Herencsar; Jaroslav Koton; Abhirup Lahiri; Bilgin Metin; Kamil Vrba

    2012-01-01

    This paper presents a new active building block (ABB) called voltage gain-controlled modified current feedback amplifier (VGC-MCFOA) based on bipolar junction transistor technology. The versatility of the new ABB is demonstrated in new first-order all-pass filter structure design employing single VGC-MCFOA, single grounded capacitor, and three resistors. Introduced circuit provides all four possible transfer functions at the same configuration, namely current-mode, transimpedance-mode, transa...

  7. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  8. Electro-optical voltage transformer

    Science.gov (United States)

    Xu, Yan; Ye, Miaoyuan; Cui, Ying

    1999-02-01

    The work introduces an optical fiber voltage transformer based on the Pockels effect. The transformer is different from a conventional electric-magnetic voltage transformer. A crystal BGO is used as sensor that is sealed in SF6 gas container; the measured signal is transferred by optical fiber in the Electro-Optical Voltage Transformer (EOVT). The principles and composition of EOVT is described here. The system consists of three parts: capacitive divider, optical sensor and electronics module. According to the analysis of factors that influence on the accuracy of measurement, the main ones, temperature and pressure of SF6, are corrected by means of signal digital process. The performances of 110kV EOVT were tested. The results show that the accuracy of EOVT could achieve 0.5 percent. Compared to a conventional electric-magnetic voltage transformer, the advantages of 110kV EOVT are higher accuracy, low cost, small volume, excellent dynamic characteristics and immunity from electromagnetic interference. In particular the low voltage is effectively isolated from the high voltage by means of the optical fiber.

  9. High-voltage engineering and testing

    CERN Document Server

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  10. Thermal energy test apparatus

    Science.gov (United States)

    Audet, N. F.

    1991-10-01

    The Navy Clothing and Textile Research Facility (NCTRF) designed and fabricated a thermal energy test apparatus to permit evaluation of the heat protection provided by crash crew firefighter's proximity clothing materials against radiant and convective heat loads, similar to those found outside the flame zone of aircraft fuel fires. The apparatus employs electrically operated quartz lamp radiant heaters and a hot air convective heater assembly to produce the heat load conditions the materials to be subjected to, and is equipped with heat flux sensors of different sensitivities to measure the incident heat flux on the sample material as well as the heat flux transmitted by the sample. Tests of the apparatus have shown that it can produce radiant heat flux levels equivalent to those estimated to be possible in close proximity to large aircraft fuel fires, and can produce convective heat fluxes equivalent to those measured in close proximity to aircraft fuel fires at upwind and sidewind locations. Work was performed in 1974.

  11. Current measurement apparatus

    Science.gov (United States)

    Umans, Stephen D.

    2008-11-11

    Apparatus and methods are provided for a system for measurement of a current in a conductor such that the conductor current may be momentarily directed to a current measurement element in order to maintain proper current without significantly increasing an amount of power dissipation attributable to the current measurement element or adding resistance to assist in current measurement. The apparatus and methods described herein are useful in superconducting circuits where it is necessary to monitor current carried by the superconducting elements while minimizing the effects of power dissipation attributable to the current measurement element.

  12. Apparatus for the rapid electrolytic preparation of thin metal foils for transmission electron microscopy; Dispositif de polissage electrolytique pour la preparation d'echantillons pour la microscopie electronique par transmission

    Energy Technology Data Exchange (ETDEWEB)

    Le Coadic, Y.; Bourret, A. [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires

    1967-07-01

    By thinning and perforating electrolytically 3 mm discs (the usual diameter of electron microscope holders) 100 {mu} to 200 {mu} thick, we prepare foils of iron and nickel of acceptable quality, i.e. containing enough thin areas to permit transmission electron microscope observations. Previous theories of electrolytic polishing are presented. We then study an electrolytic jet thinning technique in which two jets of electrolyte impinge onto the specimen, the entire system being immersed in a bath of the same electrolyte (electrolyte jet - in - electrolyte). A brief description is given of the construction and use of the apparatus. The basic technique can be modified for specialized applications, namely thicker and other materials (alloys, stainless steels, uranium carbide, copper,...) and low temperature electrolytic thinning. (authors) [French] Partant de pastilles de fer ou de nickel de 3 mm de diametre (diametre usuel des porte-echantillons de microscope electronique) et d'epaisseur comprise entre 100 et 200 {mu} nous obtenons par polissage et percage electrolytique des aires d'epaisseur convenable quant a leur utilisation en microscopie electronique. Apres un rappel des mecanismes du polissage electrolytique, nous etudions le polissage electrolytique par jets d'electrolyte dans l'electrolyte lui-meme, dans lequel 2 jets d'electrolyte aboutissent normalement aux 2 faces de la pastille, l'ensemble etant immerge dans un bain du meme electrolyte. La realisation et l'experimentation sont ensuite decrites de facon succincte. Nous concluons en evoquant les possibilites d'extension du champ des applications du dispositif a des materiaux autres (alliages, aciers, carbure d'uranium, cuivre,...) et d'epaisseur plus importante et au domaine des basses temperatures. (auteurs)

  13. Direct observation and analysis of york-shell materials using low-voltage high-resolution scanning electron microscopy: Nanometal-particles encapsulated in metal-oxide, carbon, and polymer

    Directory of Open Access Journals (Sweden)

    Shunsuke Asahina

    2014-11-01

    Full Text Available Nanometal particles show characteristic features in chemical and physical properties depending on their sizes and shapes. For keeping and further enhancing their features, the particles should be protected from coalescence or degradation. One approach is to encapsulate the nanometal particles inside pores with chemically inert or functional materials, such as carbon, polymer, and metal oxides, which contain mesopores to allow permeation of only chemicals not the nanometal particles. Recently developed low-voltage high-resolution scanning electron microscopy was applied to the study of structural, chemical, and electron state of both nanometal particles and encapsulating materials in york-shell materials of Au@C, Ru/Pt@C, Au@TiO2, and Pt@Polymer. Progresses in the following categories were shown for the york-shell materials: (i resolution of topographic image contrast by secondary electrons, of atomic-number contrast by back-scattered electrons, and of elemental mapping by X-ray energy dispersive spectroscopy; (ii sample preparation for observing internal structures; and (iii X-ray spectroscopy such as soft X-ray emission spectroscopy. Transmission electron microscopy was also used for characterization of Au@C.

  14. Rational Design of High-Performance Wide-Bandgap (≈2 eV) Polymer Semiconductors as Electron Donors in Organic Photovoltaics Exhibiting High Open Circuit Voltages (≈1 V).

    Science.gov (United States)

    Chochos, Christos L; Katsouras, Athanasios; Gasparini, Nicola; Koulogiannis, Chrysanthos; Ameri, Tayebeh; Brabec, Christoph J; Avgeropoulos, Apostolos

    2017-01-01

    Systematic optimization of the chemical structure of wide-bandgap (≈2.0 eV) "donor-acceptor" copolymers consisting of indacenodithiophene or indacenodithieno[3,2-b]thiophene as the electron-rich unit and thieno[3,4-c]pyrrole-4,6-dione as the electron-deficient moiety in terms of alkyl side chain engineering and distance of the electron-rich and electron-deficient monomers within the repeat unit of the polymer chain results in high-performance electron donor materials for organic photovoltaics. Specifically, preliminary results demonstrate extremely high open circuit voltages (V oc s) of ≈1.0 V, reasonable short circuit current density (J sc ) of around 11 mA cm-2 , and moderate fill factors resulting in efficiencies close to 6%. All the devices are fabricated in an inverted architecture with the photoactive layer processed by doctor blade equipment, showing the compatibility with roll-to-roll large-scale manufacturing processes. From the correlation of the chemical structure-optoelectronic properties-photovoltaic performance, a rational guide toward further optimization of the chemical structure in this family of copolymers, has been achieved. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Design of high breakdown voltage vertical GaN p-n diodes with high-K/low-K compound dielectric structure for power electronics applications

    Science.gov (United States)

    Du, Jiangfeng; Li, Zhenchao; Liu, Dong; Bai, Zhiyuan; Liu, Yang; Yu, Qi

    2017-11-01

    In this work, a vertical GaN p-n diode with a high-K/low-K compound dielectric structure (GaN CD-VGD) is proposed and designed to achieve a record high breakdown voltage (BV) with a low specific on-resistance (Ron,sp). By introducing compound dielectric structure, the electric field near the p-n junction interface is suppressed due to the effects of high-K passivation layer, and a new electric field peak is induced into the n-type drift region, because of a discontinuity of electrical field at the interface of high-K and low-K layer. Therefore the distribution of electric field in GaN p-n diode becomes more uniform and an enhancement of breakdown voltage can be achieved. Numerical simulations demonstrate that GaN CD-VGD with a BV of 10650 V and a Ron,sp of 14.3 mΩ cm2, resulting in a record high figure-of-merit of 8 GW/cm2.

  16. Tensile-stressed microelectromechanical apparatus and micromirrors formed therefrom

    Science.gov (United States)

    Fleming, James G [Albuquerque, NM

    2006-05-16

    A microelectromechanical (MEM) apparatus is disclosed which includes one or more tensile-stressed actuators that are coupled through flexures to a stage on a substrate. The tensile-stressed actuators, which can be formed from tensile-stressed tungsten or silicon nitride, initially raise the stage above the substrate without any applied electrical voltage, and can then be used to control the height or tilt angle of the stage. An electrostatic actuator can also be used in combination with each tensile-stressed actuator. The MEM apparatus has applications for forming piston micromirrors or tiltable micromirrors and independently addressable arrays of such devices.

  17. DVR(Dynamic Voltage Restorer)

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. DVR(Dynamic Voltage Restorer). Supply voltage Sag compensation. Supply voltage Swell Compensation. Balancing the Load voltage. Compensation of Supply Voltage Harmonics.

  18. communication method and apparatus

    DEFF Research Database (Denmark)

    2005-01-01

    The present invention relates to a non-lingual communication method and apparatus, wherein a physical or physiological signal consciously created by a first subject (1) is detected and converted into a transmitted output signal presented to a second subject (7) in order to communicate information...

  19. Mobile lighting apparatus

    Science.gov (United States)

    Roe, George Michael; Klebanoff, Leonard Elliott; Rea, Gerald W; Drake, Robert A; Johnson, Terry A; Wingert, Steven John; Damberger, Thomas A; Skradski, Thomas J; Radley, Christopher James; Oros, James M; Schuttinger, Paul G; Grupp, David J; Prey, Stephen Carl

    2013-05-14

    A mobile lighting apparatus includes a portable frame such as a moveable trailer or skid having a light tower thereon. The light tower is moveable from a stowed position to a deployed position. A hydrogen-powered fuel cell is located on the portable frame to provide electrical power to an array of the energy efficient lights located on the light tower.

  20. Radioactive waste processing apparatus

    Science.gov (United States)

    Nelson, R.E.; Ziegler, A.A.; Serino, D.F.; Basnar, P.J.

    1985-08-30

    Apparatus for use in processing radioactive waste materials for shipment and storage in solid form in a container is disclosed. The container includes a top, and an opening in the top which is smaller than the outer circumference of the container. The apparatus includes an enclosure into which the container is placed, solution feed apparatus for adding a solution containing radioactive waste materials into the container through the container opening, and at least one rotatable blade for blending the solution with a fixing agent such as cement or the like as the solution is added into the container. The blade is constructed so that it can pass through the opening in the top of the container. The rotational axis of the blade is displaced from the center of the blade so that after the blade passes through the opening, the blade and container can be adjusted so that one edge of the blade is adjacent the cylindrical wall of the container, to insure thorough mixing. When the blade is inside the container, a substantially sealed chamber is formed to contain vapors created by the chemical action of the waste solution and fixant, and vapors emanating through the opening in the container. The chamber may be formed by placing a removable extension over the top of the container. The extension communicates with the apparatus so that such vapors are contained within the container, extension and solution feed apparatus. A portion of the chamber includes coolant which condenses the vapors. The resulting condensate is returned to the container by the force of gravity.

  1. Experimental apparatus for photon/ion coincidence measurements of dielectronic recombination

    Science.gov (United States)

    Gardner, L. D.; Kohl, J. L.; Lafyatis, G. P.; Young, A. R.; Chutjian, A.

    1986-01-01

    An inclined beams apparatus for the measurement of absolute cross sections for dielectronic recombination between free electrons and singly or multiply charged ions is described. The collision products, a photon and a lower-charge-state ion, are detected in delayed coincidence. Measurements of dielectronic recombination in C(3+) are described to illustrate the use of the apparatus and techniques. Verification of the calibrations and operation of the apparatus is demonstrated through measurements of charge transfer and electron impact excitation.

  2. Evidence for electronic and ionic limitations at the origin of the second voltage plateau in nickel electrodes, as deduced from impedance spectroscopy measurements

    Energy Technology Data Exchange (ETDEWEB)

    Barde, F.; Tarascon, J.M. [Laboratoire de Reactivite et de Chimie des Solides, Universite de Picardie Jules Verne, CNRS UMR 6007, F-80039 Amiens (France); Taberna, P.L. [CIRIMAT, CNRS UMR 5085, Universite Paul Sabatier, F-31062 Toulouse (France); Palacin, M.R. [Institut de Ciencia de Materials de Barcelona (CSIC), Campus UAB, E-08193 Bellaterra, Catalonia (Spain)

    2008-05-01

    The second plateau occurring during the reduction of the nickel oxyhydroxide electrode (NOE) was studied by impedance spectroscopy on a cell with a pasted electrode prepared from commercial undoped {beta}-Ni(OH){sub 2}. Measurements were performed at diverse states of reduction and a large variation of impedance upon the transition from the first to the second plateau was observed. This variation mainly takes place at low frequencies and is hence related to ionic diffusion. We observed that the impedance becomes more capacitive on the second plateau meaning that the proton diffusion is limited. These results would be consistent with the gradual formation of an insulating layer of nickel hydroxide at the interface between the NOE and the electrolyte upon reduction. Once this layer becomes compact the ionic diffusion would be hindered and forced to occur through this layer, which could explain the voltage drop observed. (author)

  3. Archimedes Force on Casimir Apparatus

    CERN Document Server

    Shevchenko, Vladimir

    2016-01-01

    We address a problem of Casimir apparatus in dense medium and weak gravitational field. The falling of the apparatus has to be governed by the equivalence principle, with proper account for contributions to the weight of the apparatus from its material part and from distorted quantum fields. We discuss general expression for the corresponding force in metric with cylindrical symmetry. By way of example we compute explicit expression for Archimedes force, acting on the Casimir apparatus of finite size, immersed into thermal bath of free scalar field. It is shown that besides universal term, proportional to the volume of the apparatus, there are non-universal quantum corrections, depending on the boundary conditions.

  4. SEM technique for imaging and measuring electronic transport in nanocomposites based on electric field induced contrast

    Science.gov (United States)

    Jesse, Stephen [Knoxville, TN; Geohegan, David B [Knoxville, TN; Guillorn, Michael [Brooktondale, NY

    2009-02-17

    Methods and apparatus are described for SEM imaging and measuring electronic transport in nanocomposites based on electric field induced contrast. A method includes mounting a sample onto a sample holder, the sample including a sample material; wire bonding leads from the sample holder onto the sample; placing the sample holder in a vacuum chamber of a scanning electron microscope; connecting leads from the sample holder to a power source located outside the vacuum chamber; controlling secondary electron emission from the sample by applying a predetermined voltage to the sample through the leads; and generating an image of the secondary electron emission from the sample. An apparatus includes a sample holder for a scanning electron microscope having an electrical interconnect and leads on top of the sample holder electrically connected to the electrical interconnect; a power source and a controller connected to the electrical interconnect for applying voltage to the sample holder to control the secondary electron emission from a sample mounted on the sample holder; and a computer coupled to a secondary electron detector to generate images of the secondary electron emission from the sample.

  5. Loop-voltage tomography in tokamaks using transient synchrotron radiation

    Energy Technology Data Exchange (ETDEWEB)

    Fisch, N.J.; Kritz, A.H. (Princeton Univ., NJ (USA). Plasma Physics Lab.; Hunter Coll., New York, NY (USA). Dept. of Physics)

    1989-07-01

    The loop voltage in tokamaks is particularly difficult to measure anywhere but at the plasma periphery. A brief, deliberate, perturbation of hot plasma electrons, however, produces a transient radiation response that is sensitive to this voltage. We investigate how such a radiation response can be used to diagnose the loop voltage. 24 refs., 6 figs.

  6. Electrode voltage fall and total voltage of a transient arc

    Science.gov (United States)

    Valensi, F.; Ratovoson, L.; Razafinimanana, M.; Masquère, M.; Freton, P.; Gleizes, A.

    2016-06-01

    This paper deals with an experimental study of the components of a transient arc total voltage with duration of a few tens of ms and a current peak close to 1000 A. The cathode tip is made of graphite whereas the flat anode is made either of copper or of graphite; the electrodes gap is a few mm. The analysis of the electrical parameters is supported and validated by fast imaging and by two models: the first one is a 2D physical model of the arc allowing to calculate both the plasma temperature field and the arc voltage; the second model is able to estimate the transient heating of the graphite electrode. The main aim of the study was to detect the possible change of the cathode voltage fall (CVF) during the first instants of the arc. Indeed it is expected that during the first ms the graphite cathode is rather cool and the main mechanism of the electron emission should be the field effect emission, whereas after several tens of ms the cathode is strongly heated and thermionic emission should be predominant. We have observed some change in the apparent CVF but we have shown that this apparent change can be attributed to the variation of the solid cathode resistance. On the other hand, the possible change of CVF corresponding to the transition between a ‘cold’ and a ‘hot’ cathode should be weak and could not be characterized considering our measurement uncertainty of about 2 V. The arc column voltage (ACV) was estimated by subtracting the electrode voltage fall from the total arc voltage. The experimental transient evolution of the ACV is in very good agreement with the theoretical variation predicted by the model, showing the good ability of the model to study this kind of transient arc.

  7. The yeast Golgi apparatus.

    Science.gov (United States)

    Suda, Yasuyuki; Nakano, Akihiko

    2012-04-01

    The Golgi apparatus is an organelle that has been extensively studied in the model eukaryote, yeast. Its morphology varies among yeast species; the Golgi exists as a system of dispersed cisternae in the case of the budding yeast Saccharomyces cerevisiae, whereas the Golgi cisternae in Pichia pastoris and Schizosaccharomyces pombe are organized into stacks. In spite of the different organization, the mechanism of trafficking through the Golgi apparatus is believed to be similar, involving cisternal maturation, in which the resident Golgi proteins are transported backwards while secretory cargo proteins can stay in the cisternae. Questions remain regarding the organization of the yeast Golgi, the regulatory mechanisms that underlie cisternal maturation of the Golgi and transport machinery of cargo proteins through this organelle. Studies using different yeast species have provided hints to these mechanisms. © 2011 John Wiley & Sons A/S.

  8. Gas turbine sealing apparatus

    Science.gov (United States)

    Wiebe, David J; Wessell, Brian J; Ebert, Todd; Beeck, Alexander; Liang, George; Marussich, Walter H

    2013-02-19

    A gas turbine includes forward and aft rows of rotatable blades, a row of stationary vanes between the forward and aft rows of rotatable blades, an annular intermediate disc, and a seal housing apparatus. The forward and aft rows of rotatable blades are coupled to respective first and second portions of a disc/rotor assembly. The annular intermediate disc is coupled to the disc/rotor assembly so as to be rotatable with the disc/rotor assembly during operation of the gas turbine. The annular intermediate disc includes a forward side coupled to the first portion of the disc/rotor assembly and an aft side coupled to the second portion of the disc/rotor assembly. The seal housing apparatus is coupled to the annular intermediate disc so as to be rotatable with the annular intermediate disc and the disc/rotor assembly during operation of the gas turbine.

  9. Automatic temperature adjustment apparatus

    Science.gov (United States)

    Chaplin, James E.

    1985-01-01

    An apparatus for increasing the efficiency of a conventional central space heating system is disclosed. The temperature of a fluid heating medium is adjusted based on a measurement of the external temperature, and a system parameter. The system parameter is periodically modified based on a closed loop process that monitors the operation of the heating system. This closed loop process provides a heating medium temperature value that is very near the optimum for energy efficiency.

  10. Dual string apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Ageshin, M.S.; Bol' shakov, V.V.; Grishchenko, S.I.; Litvin, N.A.; Sorokin, V.I.

    1980-03-30

    The designers propose a string apparatus consisting of a reducer, an external tube, a rock-fracturing instrument, and a mechanism for leading the internal tubes. This mechanism consists of a shaft-mounted reducer which interacts with the outside tube by a spiral spring. Operational reliability and core retrieval are enhanced by reducing rotational vibration in the outside tube, and by permitting shifting in the reducer and movable shaft through the work of the spiral spring.

  11. Wave disc engine apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Muller, Norbert; Piechna, Janusz; Sun, Guangwei; Parraga, Pablo-Francisco

    2018-01-02

    A wave disc engine apparatus is provided. A further aspect employs a constricted nozzle in a wave rotor channel. A further aspect provides a sharp bend between an inlet and an outlet in a fluid pathway of a wave rotor, with the bend being spaced away from a peripheral edge of the wave rotor. A radial wave rotor for generating electricity in an automotive vehicle is disclosed in yet another aspect.

  12. Method and apparatus for calibrating a linear variable differential transformer

    Science.gov (United States)

    Pokrywka, Robert J [North Huntingdon, PA

    2005-01-18

    A calibration apparatus for calibrating a linear variable differential transformer (LVDT) having an armature positioned in au LVDT armature orifice, and the armature able to move along an axis of movement. The calibration apparatus includes a heating mechanism with an internal chamber, a temperature measuring mechanism for measuring the temperature of the LVDT, a fixture mechanism with an internal chamber for at least partially accepting the LVDT and for securing the LVDT within the heating mechanism internal chamber, a moving mechanism for moving the armature, a position measurement mechanism for measuring the position of the armature, and an output voltage measurement mechanism. A method for calibrating an LVDT, including the steps of: powering the LVDT; heating the LVDT to a desired temperature; measuring the position of the armature with respect to the armature orifice; and measuring the output voltage of the LVDT.

  13. Electronic Power Transformer Control Strategy in Wind Energy Conversion Systems for Low Voltage Ride-through Capability Enhancement of Directly Driven Wind Turbines with Permanent Magnet Synchronous Generators (D-PMSGs

    Directory of Open Access Journals (Sweden)

    Hui Huang

    2014-11-01

    Full Text Available This paper investigates the use of an Electronic Power Transformer (EPT incorporated with an energy storage system to smooth the wind power fluctuations and enhance the low voltage ride-through (LVRT capability of directly driven wind turbines with permanent magnet synchronous generators (D-PMSGs. The decoupled control schemes of the system, including the grid side converter control scheme, generator side converter control scheme and the control scheme of the energy storage system, are presented in detail. Under normal operating conditions, the energy storage system absorbs the high frequency component of the D-PMSG output power to smooth the wind power fluctuations. Under grid fault conditions, the energy storage system absorbs the redundant power, which could not be transferred to the grid by the EPT, to help the D-PMSG to ride through low voltage conditions. This coordinated control strategy is validated by simulation studies using MATLAB/Simulink. With the proposed control strategy, the output wind power quality is improved and the D-PMSG can ride through severe grid fault conditions.

  14. Temperature responsive cooling apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Weker, M.L.; Stearns, R.M.

    1987-08-11

    A temperature responsive cooling apparatus is described for an air conditioner or refrigeration system in operative association with a reservoir of fluid, the air conditioner or refrigeration system having an air cooled coil and means for producing a current of air for cooling the coil, the temperature responsive cooling apparatus comprising: (a) means for transferring the fluid from the reservoir to the air conditioner temperature responsive cooling apparatus, (b) a fluid control device activated by the current of air for cooling the coil; (c) a temperature activated, nonelectrical device for terminating and initiating the flow of fluid therethrough in an intermittent fashion for enhancing the operability of the compressor associated with the refrigeration system and for reducing the quantity of fluid required to cool the coil of the refrigeration system, (d) a fluid treatment device for preventing, reducing or mitigating the deposition of nonevaporative components on the air cooled coil, and (e) means for dispersing the fluid to the air cooled coil from the fluid control device for cooling the coil and increasing the efficiency of the air conditioner thereby reducing the cost of operating and maintaining the air conditioner without damaging the air conditioner and without the deposition of nonevaporative components thereupon.

  15. Apparatus and method for the electrolysis of water

    Science.gov (United States)

    Greenbaum, Elias

    2015-04-21

    An apparatus for the electrolytic splitting of water into hydrogen and/or oxygen, the apparatus comprising: (i) at least one lithographically-patternable substrate having a surface; (ii) a plurality of microscaled catalytic electrodes embedded in said surface; (iii) at least one counter electrode in proximity to but not on said surface; (iv) means for collecting evolved hydrogen and/or oxygen gas; (v) electrical powering means for applying a voltage across said plurality of microscaled catalytic electrodes and said at least one counter electrode; and (vi) a container for holding an aqueous electrolyte and housing said plurality of microscaled catalytic electrodes and said at least one counter electrode. Electrolytic processes using the above electrolytic apparatus or functional mimics thereof are also described.

  16. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  17. Power electronics as a suitable smart grid solution for electric-powered vehicles and low voltage grids; Leistungselektronik als serientaugliche SmartGrid Loesung fuer Elektrofahrzeuge und Niederspannungsnetze

    Energy Technology Data Exchange (ETDEWEB)

    Piepenbrink, Andreas [E3/DC GmbH, Osnabrueck (Germany); Vetter, Thomas; Speer, Rolf [Aradex AG, Lorch (Germany)

    2010-07-01

    This paper derives the basic model equations and economic functions for energy storage systems in a grid connected photovoltaic system. To maximize the self consumption of households, the charge and discharge strategy of the battery is tested as an optimal mix of net and photovoltaic power with respect to maximum financial output for the customer. A timer series comparison of electrical power for seasonal operation as well as the financial battery return of investment for the next years is derived. An electric car is considered in the simulation model as mobile and backup battery at home and the associated central power electronics architecture is derived. (orig.)

  18. Thermal stir welding apparatus

    Science.gov (United States)

    Ding, R. Jeffrey (Inventor)

    2011-01-01

    A welding method and apparatus are provided for forming a weld joint between first and second elements of a workpiece. The method includes heating the first and second elements to form an interface of material in a plasticized or melted state interface between the elements. The interface material is then allowed to cool to a plasticized state if previously in a melted state. The interface material, while in the plasticized state, is then mixed, for example, using a grinding/extruding process, to remove any dendritic-type weld microstructures introduced into the interface material during the heating process.

  19. The ATHENA antihydrogen apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Amoretti, M.; Amsler, C.; Bonomi, G.; Bouchta, A.; Bowe, P.D.; Carraro, C.; Charlton, M.; Collier, M.J.T.; Doser, M.; Filippini, V.; Fine, K.S.; Fontana, A.; Fujiwara, M.C.; Funakoshi, R.; Genova, P.; Glauser, A.; Groegler, D.; Hangst, J.; Hayano, R.S.; Higaki, H.; Holzscheiter, M.H.; Joffrain, W.; Joergensen, L.V. E-mail: lars.varming.jorgensen@cern.ch; Lagomarsino, V.; Landua, R.; Lenz Cesar, C.; Lindeloef, D.; Lodi-Rizzini, E.; Macri, M.; Madsen, N.; Manuzio, D.; Manuzio, G.; Marchesotti, M.; Montagna, P.; Pruys, H.; Regenfus, C.; Riedler, P.; Rochet, J.; Rotondi, A.; Rouleau, G.; Testera, G.; Werf, D.P. van der; Variola, A.; Watson, T.L.; Yamazaki, T.; Yamazaki, Y

    2004-02-11

    The ATHENA apparatus that recently produced and detected the first cold antihydrogen atoms is described. Its main features, which are described herein, are: an external positron accumulator, making it possible to accumulate large numbers of positrons; a separate antiproton catching trap, optimizing the catching, cooling and handling of antiprotons; a unique high resolution antihydrogen annihilation detector, allowing an clear determination that antihydrogen has been produced; an open, modular design making variations in the experimental approach possible and a ''nested'' Penning trap situated in a cryogenic, 3T magnetic field environment used for the mixing of the antiprotons and positrons.

  20. The ATHENA Antihydrogen Apparatus

    CERN Document Server

    Amoretti, M; Bonomi, G; Bouchta, A; Bowe, P; Carraro, C; Charlton, M; Collier, M; Doser, Michael; Filippini, V; Fine, K S; Fontana, A; Fujiwara, M C; Funakoshi, R; Genova, P; Glauser, A; Grögler, D; Hangst, Jeffrey S; Hayano, R S; Higaki, H; Holzscheiter, Michael H; Joffrain, W; Jørgensen, L V; Lagomarsino, V; Landua, Rolf; Cesar, C L; Lindelöf, D; Lodi-Rizzini, E; Macri, M; Madsen, N; Manuzio, D; Manuzio, G; Marchesotti, M; Montagna, P; Pruys, H S; Regenfus, C; Riedler, P; Rochet, J; Rotondi, A; Rouleau, G; Testera, G; Van der Werf, D P; Variola, A; Watson, T L; Yamazaki, T; Yamazaki, Y

    2004-01-01

    The ATHENA apparatus that recently produced and detected the first cold antihydrogen atoms is described. Its main features, which are described herein, are: an external positron accumulator, making it possible to accumulate large numbers of positrons; a separate antiproton catching trap, optimizing the catching, colling and handling of antiprotons: a unique high resolution antihydrogen annihilation detector, allowing a clear determination that antihydrogen has been produced; an open, modular design making variations in the experimental approach possible and a "nested" Penning trap situated in a cryogenic, 3T magnetic field environment used for the mixing of the antiprotons and positrons.

  1. CRANE POSITIONING APPARATUS

    Science.gov (United States)

    Landsiedel, F.W.; Wolff, H.

    1960-06-28

    An apparatus is described for automatically accomplishing the final accurate horizontal positioning of a crane after the latter has been placed to within 1/8 in. of its selected position. For this purpose there is provided a tiltable member on the crane mast for lowering into contact with a stationary probe. Misalignment of the tiltable member, with respect to the probe as the member is lowered, causes tilting of the latter to actuate appropriate switches that energize motors for bringing the mast into proper position. When properly aligned the member is not tilted and a central switch is actuated to indicate the final alignment of the crane.

  2. Control rod testing apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Gaunt, R.R.; Ashman, C.M.

    1987-06-02

    A control rod testing apparatus is described comprising: a first guide means having a vertical cylindrical opening for grossly guiding a control rod; a second guide means having a vertical cylindrical opening for grossly guiding a control rod. The first and second guide means are supported at axially spaced locations with the openings coaxial; and a substantially cylindrical subassembly having a vertical cylindrical opening therethrough. The subassembly is trapped coaxial with and between the first and second guide means, and the subassembly radially floats with respect to the first and second guide means.

  3. Flow coating apparatus and method of coating

    Science.gov (United States)

    Hanumanthu, Ramasubrahmaniam; Neyman, Patrick; MacDonald, Niles; Brophy, Brenor; Kopczynski, Kevin; Nair, Wood

    2014-03-11

    Disclosed is a flow coating apparatus, comprising a slot that can dispense a coating material in an approximately uniform manner along a distribution blade that increases uniformity by means of surface tension and transfers the uniform flow of coating material onto an inclined substrate such as for example glass, solar panels, windows or part of an electronic display. Also disclosed is a method of flow coating a substrate using the apparatus such that the substrate is positioned correctly relative to the distribution blade, a pre-wetting step is completed where both the blade and substrate are completed wetted with a pre-wet solution prior to dispensing of the coating material onto the distribution blade from the slot and hence onto the substrate. Thereafter the substrate is removed from the distribution blade and allowed to dry, thereby forming a coating.

  4. Spectroscopic Chemical Analysis Methods and Apparatus

    Science.gov (United States)

    Hug, William F. (Inventor); Reid, Ray D. (Inventor); Bhartia, Rohit (Inventor); Lane, Arthur L. (Inventor)

    2017-01-01

    Spectroscopic chemical analysis methods and apparatus are disclosed which employ deep ultraviolet (e.g. in the 200 nm to 300 nm spectral range) electron beam pumped wide bandgap semiconductor lasers, incoherent wide bandgap semiconductor light emitting devices, and hollow cathode metal ion lasers to perform non-contact, non-invasive detection of unknown chemical analytes. These deep ultraviolet sources enable dramatic size, weight and power consumption reductions of chemical analysis instruments. In some embodiments, Raman spectroscopic detection methods and apparatus use ultra-narrow-band angle tuning filters, acousto-optic tuning filters, and temperature tuned filters to enable ultra-miniature analyzers for chemical identification. In some embodiments Raman analysis is conducted along with photoluminescence spectroscopy (i.e. fluorescence and/or phosphorescence spectroscopy) to provide high levels of sensitivity and specificity in the same instrument.

  5. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  6. Heat pump apparatus

    Science.gov (United States)

    Nelson, Paul A.; Horowitz, Jeffrey S.

    1983-01-01

    A heat pump apparatus including a compact arrangement of individual tubular reactors containing hydride-dehydride beds in opposite end sections, each pair of beds in each reactor being operable by sequential and coordinated treatment with a plurality of heat transfer fluids in a plurality of processing stages, and first and second valves located adjacent the reactor end sections with rotatable members having multiple ports and associated portions for separating the hydride beds at each of the end sections into groups and for simultaneously directing a plurality of heat transfer fluids to the different groups. As heat is being generated by a group of beds, others are being regenerated so that heat is continuously available for space heating. As each of the processing stages is completed for a hydride bed or group of beds, each valve member is rotated causing the heat transfer fluid for the heat processing stage to be directed to that bed or group of beds. Each of the end sections are arranged to form a closed perimeter and the valve member may be rotated repeatedly about the perimeter to provide a continuous operation. Both valves are driven by a common motor to provide a coordinated treatment of beds in the same reactors. The heat pump apparatus is particularly suitable for the utilization of thermal energy supplied by solar collectors and concentrators but may be used with any source of heat, including a source of low-grade heat.

  7. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  8. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  9. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  10. Nanopipette Apparatus for Manipulating Cells

    Science.gov (United States)

    Seger, R. Adam (Inventor); Actis, Paolo (Inventor); Vilozny, Boaz (Inventor); Pourmand, Nader (Inventor)

    2017-01-01

    Disclosed herein are methods and systems for controlled ejection of desired material onto surfaces including in single cells using nanopipettes, as well as ejection onto and into cells. Some embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller for depositing a user defined pattern on an arbitrary substrate for the purpose of controlled cell adhesion and growth. Alternate embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller and electronic control of a voltage differential in a bore of the nanopipette electroosmotically injecting material into a cell in a high-throughput manner and with minimal damage to the cell. Yet other embodiments are directed to method and system comprising functionalized nanopipettes combined with scanning ion conductance microscopy for studying molecular interactions and detection of biomolecules inside a single living cell.

  11. Voltage-gated Proton Channels

    Science.gov (United States)

    DeCoursey, Thomas E.

    2014-01-01

    Voltage-gated proton channels, HV1, have vaulted from the realm of the esoteric into the forefront of a central question facing ion channel biophysicists, namely the mechanism by which voltage-dependent gating occurs. This transformation is the result of several factors. Identification of the gene in 2006 revealed that proton channels are homologues of the voltage-sensing domain of most other voltage-gated ion channels. Unique, or at least eccentric, properties of proton channels include dimeric architecture with dual conduction pathways, perfect proton selectivity, a single-channel conductance ~103 smaller than most ion channels, voltage-dependent gating that is strongly modulated by the pH gradient, ΔpH, and potent inhibition by Zn2+ (in many species) but an absence of other potent inhibitors. The recent identification of HV1 in three unicellular marine plankton species has dramatically expanded the phylogenetic family tree. Interest in proton channels in their own right has increased as important physiological roles have been identified in many cells. Proton channels trigger the bioluminescent flash of dinoflagellates, facilitate calcification by coccolithophores, regulate pH-dependent processes in eggs and sperm during fertilization, secrete acid to control the pH of airway fluids, facilitate histamine secretion by basophils, and play a signaling role in facilitating B-cell receptor mediated responses in B lymphocytes. The most elaborate and best-established functions occur in phagocytes, where proton channels optimize the activity of NADPH oxidase, an important producer of reactive oxygen species. Proton efflux mediated by HV1 balances the charge translocated across the membrane by electrons through NADPH oxidase, minimizes changes in cytoplasmic and phagosomal pH, limits osmotic swelling of the phagosome, and provides substrate H+ for the production of H2O2 and HOCl, reactive oxygen species crucial to killing pathogens. PMID:23798303

  12. A prepositioned areal electrofishing apparatus for sampling stream habitats

    Science.gov (United States)

    Fisher, William L.; Brown, Marshall E.

    1993-01-01

    We describe the design, use, and sampling characteristics ofan electrofishing apparatus used to sample fish in stream habitats. The apparatus uses two prepositioned areal electrofishing devices (PAED) of different designs, a bottom parallel electrode PAED and a suspended dropper electrode PAED. To determine the effective immobilization ranges of the PAEDs, we evaluated intensities and shapes of the PAEDs' electrical fields, and the electroshock responses of fish in cages in concrete tanks and in four streams in Alabama with different water conductivities. Electroshock responses indicated that complete immobilization occurred at voltage gradients of 1.0 V/cm or higher (voltage drop, 400 V AC), as far as 35 cm from the PAED electrodes, although some fish were immobilized up to 65 cm away at 0.3 V/cm. We estimated the immobilization (stun) power density threshold to be about 10 μW/cm3. Stream evaluations of the PAEDs revealed that higher voltages were needed to immobilize fish at lower (35 μS/cm) and higher (120 and 125 μS/cm) water conductivities, whereas lower voltages were required at an intermediate conductivity (60 μS/cm). These results conformed with the predictions of power transfer theory and underscored the need to calibrate PAEDs to stream conductivities to standardize the effective sampling range.

  13. Design and Control of a Dynamic Voltage Restorer

    DEFF Research Database (Denmark)

    Nielsen, John Godsk

    of the described events can be a potential problem for sensitiv loads. During the thesis knowledge is gathered about power quality and power electronics for voltage quality improvements. In addition knowledge about the design and control of a DVR either connected at the low voltage or the medium voltage level......This thesis is the main results from a Ph.D. project under the research programme "Local Compensation" at Aalborg University. The main topics in the thesis are the design and control of a Dynamic Voltage Restorer (DVR). The DVR is a series connected device, which primarily can protect sensitive...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...

  14. Understanding and Improving High Voltage Vacuum Insulators for Microsecond Pulses

    Energy Technology Data Exchange (ETDEWEB)

    Javedani, J B; Goerz, D A; Houck, T L; Lauer, E J; Speer, R D; Tully, L K; Vogtlin, G E; White, A D

    2007-03-05

    High voltage insulation is one of the main areas of pulsed power research and development, and dielectric breakdown is usually the limiting factor in attaining the highest possible performance in pulsed power devices. For many applications the delivery of pulsed power into a vacuum region is the most critical aspect of operation. The surface of an insulator exposed to vacuum can fail electrically at an applied field more than an order or magnitude below the bulk dielectric strength of the insulator. This mode of breakdown, called surface flashover, imposes serious limitations on the power flow into a vacuum region. This is especially troublesome for applications where high voltage conditioning of the insulator and electrodes is not practical and for applications where relatively long pulses, on the order of several microseconds, are required. The goal of this project is to establish a sound fundamental understanding of the mechanisms that lead to surface flashover, and then evaluate the most promising techniques to improve vacuum insulators and enable high voltage operation at stress levels near the intrinsic bulk breakdown limits of the material. The approach we proposed and followed was to develop this understanding through a combination of theoretical and computation methods coupled with experiments to validate and quantify expected behaviors. In this report we summarize our modeling and simulation efforts, theoretical studies, and experimental investigations. The computational work began by exploring the limits of commercially available codes and demonstrating methods to examine field enhancements and defect mechanisms at microscopic levels. Plasma simulations with particle codes used in conjunction with circuit models of the experimental apparatus enabled comparisons with experimental measurements. The large scale plasma (LSP) particle-in-cell (PIC) code was run on multiprocessor platforms and used to simulate expanding plasma conditions in vacuum gap regions

  15. Data eye monitor method and apparatus

    Science.gov (United States)

    Gara, Alan G [Mount Kisco, NY; Marcella, James A [Rochester, MN; Ohmacht, Martin [Yorktown Heights, NY

    2012-01-31

    An apparatus and method for providing a data eye monitor. The data eye monitor apparatus utilizes an inverter/latch string circuit and a set of latches to save the data eye for providing an infinite persistent data eye. In operation, incoming read data signals are adjusted in the first stage individually and latched to provide the read data to the requesting unit. The data is also simultaneously fed into a balanced XOR tree to combine the transitions of all incoming read data signals into a single signal. This signal is passed along a delay chain and tapped at constant intervals. The tap points are fed into latches, capturing the transitions at a delay element interval resolution. Using XORs, differences between adjacent taps and therefore transitions are detected. The eye is defined by segments that show no transitions over a series of samples. The eye size and position can be used to readjust the delay of incoming signals and/or to control environment parameters like voltage, clock speed and temperature.

  16. Preferred states of the apparatus

    Indian Academy of Sciences (India)

    Abstract. A simple one-dimensional model for the system–apparatus interaction is analysed. The system is a spin-1/2 particle, and its position and momentum degrees constitute the apparatus. An analysis involving only unitary Schrödinger dynamics illustrates the nature of the correlations established in the ...

  17. Neutron detection apparatus and method

    Energy Technology Data Exchange (ETDEWEB)

    Derzon, Mark S.; Borek, III, Theodore T.

    2017-08-15

    An apparatus for neutron detection is provided. The apparatus comprises a sensor medium in electrical contact with an electrode arrangement conformed to collect radiation-generated charge from the sensor medium. The sensor medium comprises a borazine and/or a borazine-based polymer.

  18. Flexible ultrasonic pipe inspection apparatus

    Science.gov (United States)

    Jenkins, Charles F.; Howard, Boyd D.

    1998-01-01

    A flexible, modular ultrasonic pipe inspection apparatus, comprising a flexible, hollow shaft that carries a plurality of modules, including at least one rotatable ultrasonic transducer, a motor/gear unit, and a position/signal encoder. The modules are connected by flexible knuckle joints that allow each module of the apparatus to change its relative orientation with respect to a neighboring module, while the shaft protects electrical wiring from kinking or buckling while the apparatus moves around a tight corner. The apparatus is moved through a pipe by any suitable means, including a tether or drawstring attached to the nose or tail, differential hydraulic pressure, or a pipe pig. The rotational speed of the ultrasonic transducer and the forward velocity of the apparatus are coordinated so that the beam sweeps out the entire interior surface of the pipe, enabling the operator to accurately assess the condition of the pipe wall and determine whether or not leak-prone corrosion damage is present.

  19. Microelectromechanical acceleration-sensing apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Robb M. (Albuquerque, NM); Shul, Randy J. (Albuquerque, NM); Polosky, Marc A. (Albuquerque, NM); Hoke, Darren A. (Albuquerque, NM); Vernon, George E. (Rio Rancho, NM)

    2006-12-12

    An acceleration-sensing apparatus is disclosed which includes a moveable shuttle (i.e. a suspended mass) and a latch for capturing and holding the shuttle when an acceleration event is sensed above a predetermined threshold level. The acceleration-sensing apparatus provides a switch closure upon sensing the acceleration event and remains latched in place thereafter. Examples of the acceleration-sensing apparatus are provided which are responsive to an acceleration component in a single direction (i.e. a single-sided device) or to two oppositely-directed acceleration components (i.e. a dual-sided device). A two-stage acceleration-sensing apparatus is also disclosed which can sense two acceleration events separated in time. The acceleration-sensing apparatus of the present invention has applications, for example, in an automotive airbag deployment system.

  20. Femtosecond electron diffraction. Next generation electron sources for atomically resolved dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Hirscht, Julian

    2015-08-15

    Three instruments for femtosecond electron diffraction (FED) experiments were erected, partially commissioned and used for first diffraction experiments. The Relativistic Electron Gun for Atomic Exploration (REGAE) was completed by beamline elements including supports, a specimen chamber and dark current or electron beam collimating elements such that the commissioning process, including first diffraction experiments in this context, could be started. The temporal resolution of this machine is simulated to be 25 fs (fwhm) short, while a transverse coherence length of 30 nm (fwhm) is feasible to resolve proteins on this scale. Whether this machine is capable of meeting these predictions or whether the dynamics of the electron beam will stay limited by accelerator components, is not finally determined by the end of this work, because commissioning and improvement of accelerator components is ongoing. Simultaneously, a compact DC electron diffraction apparatus, the E-Gun 300, designed for solid and liquid specimens and a target electron energy of 300 keV, was built. Fundamental design issues of the high potential carrying and beam generating components occurred and are limiting the maximum potential and electron energy to 120 keV. Furthermore, this is limiting the range of possible applications and consequently the design and construction of a brand new instrument began. The Femtosecond Electron Diffraction CAmera for Molecular Movies (FED-CAMM) bridges the performance problems of very high electric potentials and provides optimal operational conditions for all applied electron energies up to 300 keV. The variability of gap spacings and optimized manufacturing of the high voltage electrodes lead to the best possible electron pulse durations obtainable with a compact DC setup, that does not comprise of rf-structures. This third apparatus possesses pulse durations just a few tenth femtoseconds apart from the design limit of the highly relativistic REGAE and combines the

  1. INCREASING THE BREAKDOWN VOLTAGE OF BJT'S AS SWITCHING DEVICES

    Directory of Open Access Journals (Sweden)

    Mustafa SÖNMEZ

    1997-03-01

    Full Text Available The electrical parameters of the transistor must be taken into account in the designing of electronic circuit. One parameter, VCBO, is one of the most important parameter for the designer. Using transistor which has the breakdown voltage of 50 V, it is not possible to obtain 80 V pulse output since the output voltage can not exceed the supply voltage. In this work, a new method is presented to obtain output voltage bigger than supply voltage by using more than one transistor.

  2. INJECTION-MOLDING APPARATUS

    Science.gov (United States)

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  3. FLUID CONTACTOR APPARATUS

    Science.gov (United States)

    Spence, R.; Streeton, R.J.W.

    1956-04-17

    The fluid contactor apparatus comprises a cylindrical column mounted co- axially and adapted to rotate within a cylindrical vessel, for the purpose of extracting a solute from am aqueous solution by means of an organic solvent. The column is particularly designed to control the vortex pattern so as to reduce the height of the vortices while, at the same time, the width of the annular radius in the radial direction between the vessel and column is less than half the radius of the column. A plurality of thin annular fins are spaced apart along the rotor approximately twice the radial dimension of the column such that two contrarotating substantially circular vortices are contained within each pair of fins as the column is rotated.

  4. Cryogenic cooler apparatus

    Science.gov (United States)

    Wheatley, J.C.; Paulson, D.N.; Allen, P.C.

    1983-01-04

    A Malone-type final stage for utilization in a Stirling cycle cryogenic cooler apparatus includes a displacer slidable within a vessel. [sup 4]He, [sup 3]He, or a mixture thereof is made to flow in a pulsating unidirectional manner through a regenerator in the displacer by utilization of check valves in separate fluid channels. Stacked copper screen members extend through the channels and through a second static thermodynamic medium within the displacer to provide efficient lateral heat exchange and enable cooling to temperatures in the range of 3--4 K. Another embodiment utilizes sintered copper particles in the regenerator. Also described is a final stage that has a non-thermally conducting displacer having passages with check valves for directing fluid past a regenerator formed in the surrounding vessel. 10 figs.

  5. Induction melter apparatus

    Science.gov (United States)

    Roach, Jay A [Idaho Falls, ID; Richardson, John G [Idaho Falls, ID; Raivo, Brian D [Idaho Falls, ID; Soelberg, Nicholas R [Idaho Falls, ID

    2008-06-17

    Apparatus and methods of operation are provided for a cold-crucible-induction melter for vitrifying waste wherein a single induction power supply may be used to effect a selected thermal distribution by independently energizing at least two inductors. Also, a bottom drain assembly may be heated by an inductor and may include an electrically resistive heater. The bottom drain assembly may be cooled to solidify molten material passing therethrough to prevent discharge of molten material therefrom. Configurations are provided wherein the induction flux skin depth substantially corresponds with the central longitudinal axis of the crucible. Further, the drain tube may be positioned within the induction flux skin depth in relation to material within the crucible or may be substantially aligned with a direction of flow of molten material within the crucible. An improved head design including four shells forming thermal radiation shields and at least two gas-cooled plenums is also disclosed.

  6. Spine immobilization apparatus

    Science.gov (United States)

    Lambson, K. H.; Vykukal, H. C. (Inventor)

    1981-01-01

    The apparatus makes use of a normally flat, flexible bladder filled with beads or micro-balloons that form a rigid mass when the pressure within the bladder is decreased below ambient through the use of a suction pump so that the bladder can be conformed to the torso of the victim and provide the desired restraint. The bladder is strapped to the victim prior to being rigidified by an arrangement of straps which avoid the stomach area. The bladder is adapted to be secured to a rigid support, i.e., a rescue chair, so as to enable removal of a victim after the bladder has been made rigid. A double sealing connector is used to connect the bladder to the suction pump and a control valve is employed to vary the pressure within the bladder so as to soften and harden the bladder as desired.

  7. Freeze drying apparatus

    Science.gov (United States)

    Coppa, Nicholas V.; Stewart, Paul; Renzi, Ernesto

    2001-01-01

    The present invention provides methods and apparatus for freeze drying in which a solution, which can be a radioactive salt dissolved within an acid, is frozen into a solid on vertical plates provided within a freeze drying chamber. The solid is sublimated into vapor and condensed in a cold condenser positioned above the freeze drying chamber and connected thereto by a conduit. The vertical positioning of the cold condenser relative to the freeze dryer helps to help prevent substances such as radioactive materials separated from the solution from contaminating the cold condenser. Additionally, the system can be charged with an inert gas to produce a down rush of gas into the freeze drying chamber to also help prevent such substances from contaminating the cold condenser.

  8. Voltage verification unit

    Science.gov (United States)

    Martin, Edward J [Virginia Beach, VA

    2008-01-15

    A voltage verification unit and method for determining the absence of potentially dangerous potentials within a power supply enclosure without Mode 2 work is disclosed. With this device and method, a qualified worker, following a relatively simple protocol that involves a function test (hot, cold, hot) of the voltage verification unit before Lock Out/Tag Out and, and once the Lock Out/Tag Out is completed, testing or "trying" by simply reading a display on the voltage verification unit can be accomplished without exposure of the operator to the interior of the voltage supply enclosure. According to a preferred embodiment, the voltage verification unit includes test leads to allow diagnostics with other meters, without the necessity of accessing potentially dangerous bus bars or the like.

  9. Apparatus for temperature-dependent cathodoluminescence characterization of materials

    Science.gov (United States)

    Bok, Jan; Schauer, Petr

    2014-07-01

    An apparatus for characterization of temperature-dependent cathodoluminescence (CL) of solid-state materials is presented. This device excites a specimen using an electron beam and the CL emission is collected from the specimen side opposite the e-beam irradiation. The design of the temperature-controlled specimen holder that enables cooling down to 100 K and heating up to 500 K is described. The desired specimen temperature is automatically stabilized using a PID controller, which is the proportional-integral-derivative control feedback loop. Moreover, the specimen holder provides in situ e-beam current measurement during the specimen excitation. The apparatus allows the measurement of the CL intensity, the CL spectrum, or the CL intensity decay depending on the specimen temperature, or on a variety of excitation conditions, such as excitation energy, electron current (dose), or excitation duration. The apparatus abilities are demonstrated by an example of the CL measurements of the YAG:Ce single-crystal scintillator.

  10. Voltage control in active, intelligent low-voltage distribution networks; Spannungshaltung in aktiven, intelligenten Niederspannungsnetzen

    Energy Technology Data Exchange (ETDEWEB)

    Buelo, Thorsten; Mende, Denis [SMA Solar Technology AG, Niestetal (Germany); Geibel, Dominik [Fraunhofer Institut fuer Windenergie und Energiesystemtechnik (IWES), Kassel (Germany)] [and others

    2012-07-01

    This paper describes approaches for the voltage control in low-voltage distribution networks with a high share of distributed energy resources (DER). Taken into account are devices such as distribution transformers with on-load tap changer (OLTC), photovoltaic-inverters with reactive power capability and electronic voltage controllers (EVC). After a short description regarding voltage control, the devices and selected system concepts as well as the advantages and disadvantages of the different devices are described. Finally, the system-concepts are compared using the example of a real low voltage network, taking into account the possible increase of hosting capacity of the network, curtailing losses and the amount of reactive energy to be provided. (orig.)

  11. Electron-deficient N-alkyloyl derivatives of thieno[3,4-c]pyrrole-4,6-dione yield efficient polymer solar cells with open-circuit voltages > 1 v

    KAUST Repository

    Warnan, Julien

    2014-05-13

    Poly(benzo[1,2-b:4,5-b′]dithiophene-thieno[3,4-c]pyrrole-4,6-dione) (PBDTTPD) polymer donors yield some of the highest open-circuit voltages (V OC, ca. 0.9 V) and fill factors (FF, ca. 70%) in conventional bulk-heterojunction (BHJ) solar cells with PCBM acceptors. Recent work has shown that the incorporation of ring substituents into the side chains of the BDT motifs in PBDTTPD can induce subtle variations in material properties, resulting in an increase of the BHJ device VOC to ∼1 V. In this contribution, we report on the synthesis of N-alkyloyl-substituted TPD motifs (TPD(CO)) and show that the electron-deficient motifs can further lower both the polymer LUMO and HOMO levels, yielding device VOC > 1 V (up to ca. 1.1 V) in BHJ solar cells with PCBM. Despite the high VOC achieved (i.e., low polymer HOMO), BHJ devices cast from TPD(CO)-based polymer donors can reach power conversion efficiencies (PCEs) of up to 6.7%, making these promising systems for use in the high-band-gap cell of tandem solar cells. © 2014 American Chemical Society.

  12. A New Version of an Old Demonstration Experiment Using the Elihu Thomson Jumping Ring Apparatus

    Science.gov (United States)

    Foster, Theodore; Cary, Arthur; Mottmann, John; van Wyngaarden, Willem

    2016-01-01

    The goal of this paper is to make more widely known an eye-catching demonstration experiment in which a hanging conducting can is made to spin when placed near the iron core of an Elihu Thomson "jumping ring" apparatus. An explanation is given based on Faraday's law of induced voltages and the magnetic forces due to the core's fields…

  13. Imaging voltage in neurons

    Science.gov (United States)

    Peterka, Darcy S.; Takahashi, Hiroto; Yuste, Rafael

    2011-01-01

    In the last decades, imaging membrane potential has become a fruitful approach to study neural circuits, especially in invertebrate preparations with large, resilient neurons. At the same time, particularly in mammalian preparations, voltage imaging methods suffer from poor signal to noise and secondary side effects, and they fall short of providing single-cell resolution when imaging of the activity of neuronal populations. As an introduction to these techniques, we briefly review different voltage imaging methods (including organic fluorophores, SHG chromophores, genetic indicators, hybrid, nanoparticles and intrinsic approaches), and illustrate some of their applications to neuronal biophysics and mammalian circuit analysis. We discuss their mechanisms of voltage sensitivity, from reorientation, electrochromic or electro-optical phenomena, to interaction among chromophores or membrane scattering, and highlight their advantages and shortcomings, commenting on the outlook for development of novel voltage imaging methods. PMID:21220095

  14. Low-voltage and high-voltage TEM observations on MWCNTs of rat in vivo.

    Science.gov (United States)

    Sakaguchi, Norihito; Watari, Fumio; Yokoyama, Atsuro; Nodasaka, Yoshinobu; Ichinose, Hideki

    2009-01-01

    In the present study, we focused on the optimal conditions for observation of morphology and atomic structure of carbon nanotube (CNT) in vivo by transmission electron microscopy (TEM). Either low-voltage or high-voltage TEMs was chosen for the high-contrast or high-resolution imaging of subcutaneous tissue and the multi-wall CNT (MWCNT). The morphology and structure of each cell organelle were well recognized using the low-voltage TEM at 75 kV. Individual MWCNTs forming the cluster were also visible by the low-voltage TEM. On the contrary, the high-voltage TEM image at 1250 kV shows poor contrast on both the cell organelles and MWCNTs. However, graphene layers of MWCNT were clearly visible in the HRTEM image using the high-voltage TEM. The influence of the surrounding biological tissue can be disregarded by the high-energy electrons due to their weak scattering/absorption effect in the tissue. It was indicated that the usage of the high-voltage TEM is quite effective to the atomic structure analysis of nano-crystalline materials in vivo.

  15. Increasing Integration of Wind Power in Medium Voltage Grid by Voltage Support of Smart Transformer

    OpenAIRE

    Gao, Xiang; De Carne, Giovanni; Liserre, Marco; Vournas, Costas

    2016-01-01

    The voltage rise during wind energy penetration represents a limit of the wind power integration in the distribution grid. The Smart Transformer (ST), a power electronics-based transformer, can provide additional services to the distribution grids, for instance the voltage support in MV grid by means of reactive power injection. In this paper, this service is applied to increase the hosting capacity of wind power in MV grids.

  16. Thermal Insulation Test Apparatuses

    Science.gov (United States)

    Berman, Brion

    2005-01-01

    The National Aeronautics and Space Administration (NASA) seeks to license its Thermal Insulation Test Apparatuses. Designed by the Cryogenics Test Laboratory at the John F. Kennedy Space Center (KSC) in Florida, these patented technologies (U.S. Patent Numbers: Cryostat 1 - 6,742,926, Cryostat 2 - 6,487,866, and Cryostat 4 - 6,824,306) allow manufacturers to fabricate and test cryogenic insulation at their production and/or laboratory facilities. These new inventions allow for the thermal performance characterization of cylindrical and flat specimens (e.g., bulk-fill, flat-panel, multilayer, or continuously rolled) over the full range of pressures, from high vacuum to no vacuum, and over the full range of temperatures from 77K to 300K. In today's world, efficient, low-maintenance, low-temperature refrigeration is taking a more significant role, from the food industry, transportation, energy, and medical applications to the Space Shuttle. Most countries (including the United States) have laws requiring commercially available insulation materials to be tested and rated by an accepted methodology. The new Cryostat methods go beyond the formal capabilities of the ASTM methods to provide testing for real systems, including full-temperature differences plus full-range vacuum conditions.

  17. Belt conveyor apparatus

    Science.gov (United States)

    Oakley, David J.; Bogart, Rex L.

    1987-01-01

    A belt conveyor apparatus according to this invention defines a conveyance path including a first pulley and at least a second pulley. An endless belt member is adapted for continuous travel about the pulleys and comprises a lower portion which engages the pulleys and an integral upper portion adapted to receive objects therein at a first location on said conveyance path and transport the objects to a second location for discharge. The upper belt portion includes an opposed pair of longitudinally disposed crest-like members, biased towards each other in a substantially abutting relationship. The crest-like members define therebetween a continuous, normally biased closed, channel along the upper belt portion. Means are disposed at the first and second locations and operatively associated with the belt member for urging the normally biased together crest-like members apart in order to provide access to the continuous channel whereby objects can be received into, or discharged from the channel. Motors are in communication with the conveyance path for effecting the travel of the endless belt member about the conveyance path. The conveyance path can be configured to include travel through two or more elevations and one or more directional changes in order to convey objects above, below and/or around existing structures.

  18. Calibration of Voltage Transformers and High- Voltage Capacitors at NIST

    Science.gov (United States)

    Anderson, William E.

    1989-01-01

    The National Institute of Standards and Technology (NIST) calibration service for voltage transformers and high-voltage capacitors is described. The service for voltage transformers provides measurements of ratio correction factors and phase angles at primary voltages up to 170 kV and secondary voltages as low as 10 V at 60 Hz. Calibrations at frequencies from 50–400 Hz are available over a more limited voltage range. The service for high-voltage capacitors provides measurements of capacitance and dissipation factor at applied voltages ranging from 100 V to 170 kV at 60 Hz depending on the nominal capacitance. Calibrations over a reduced voltage range at other frequencies are also available. As in the case with voltage transformers, these voltage constraints are determined by the facilities at NIST. PMID:28053409

  19. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  20. Continuous steel production and apparatus

    Science.gov (United States)

    Peaslee, Kent D [Rolla, MO; Peter, Jorg J [McMinnville, OR; Robertson, David G. C. [Rolla, MO; Thomas, Brian G [Champaign, IL; Zhang, Lifeng [Trondheim, NO

    2009-11-17

    A process for continuous refining of steel via multiple distinct reaction vessels for melting, oxidation, reduction, and refining for delivery of steel continuously to, for example, a tundish of a continuous caster system, and associated apparatus.

  1. Radioactive waste material melter apparatus

    Science.gov (United States)

    Newman, D.F.; Ross, W.A.

    1990-04-24

    An apparatus for preparing metallic radioactive waste material for storage is disclosed. The radioactive waste material is placed in a radiation shielded enclosure. The waste material is then melted with a plasma torch and cast into a plurality of successive horizontal layers in a mold to form a radioactive ingot in the shape of a spent nuclear fuel rod storage canister. The apparatus comprises a radiation shielded enclosure having an opening adapted for receiving a conventional transfer cask within which radioactive waste material is transferred to the apparatus. A plasma torch is mounted within the enclosure. A mold is also received within the enclosure for receiving the melted waste material and cooling it to form an ingot. The enclosure is preferably constructed in at least two parts to enable easy transport of the apparatus from one nuclear site to another. 8 figs.

  2. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  3. 49 CFR 234.205 - Operating characteristics of warning system apparatus.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Operating characteristics of warning system... characteristics of warning system apparatus. Operating characteristics of electromagnetic, electronic, or... limits within which the system is designed to operate. ...

  4. Monolith filter apparatus and membrane apparatus, and method using same

    Science.gov (United States)

    Goldsmith, Robert L [Wayland, MA

    2012-04-03

    A filtration apparatus that separates a liquid feedstock mixed with a gas into filtrate and retentate, the apparatus including at least one filtration device comprised of at least one monolith segment of porous material that defines a plurality of passageways extending longitudinally from a feed face of the structure to a retentate end face. The filtration device contains at least one filtrate conduit within it for carrying filtrate toward a filtrate collection zone, the filtrate conduit providing a path of lower flow resistance than that of alternative flow paths through the porous material of the device. The filtration device can also be utilized as a membrane support for a device for microfiltration, ultrafiltration, nanofiltration, reverse osmosis, or pervaporation. Also disclosed is a method for using such a filtration apparatus.

  5. Flexible ultrasonic pipe inspection apparatus

    Science.gov (United States)

    Jenkins, C.F.; Howard, B.D.

    1998-06-23

    A flexible, modular ultrasonic pipe inspection apparatus, comprises a flexible, hollow shaft that carries a plurality of modules, including at least one rotatable ultrasonic transducer, a motor/gear unit, and a position/signal encoder. The modules are connected by flexible knuckle joints that allow each module of the apparatus to change its relative orientation with respect to a neighboring module, while the shaft protects electrical wiring from kinking or buckling while the apparatus moves around a tight corner. The apparatus is moved through a pipe by any suitable means, including a tether or drawstring attached to the nose or tail, differential hydraulic pressure, or a pipe pig. The rotational speed of the ultrasonic transducer and the forward velocity of the apparatus are coordinated so that the beam sweeps out the entire interior surface of the pipe, enabling the operator to accurately assess the condition of the pipe wall and determine whether or not leak-prone corrosion damage is present. 7 figs.

  6. Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

    KAUST Repository

    Kim, Younggy

    2011-01-01

    Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

  7. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  8. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  9. Bias-voltage-controlled interlayer exchange coupling.

    Energy Technology Data Exchange (ETDEWEB)

    You, C.-Y.

    1999-03-29

    We propose a new system whose magnetization direction can be controlled by an applied bias voltage without an external magnetic field. The system consists of a four layered structure F{sub 1}/S/I/F{sub 2} (F{sub 1}, F{sub 2}: ferromagnets, S: spacer, I: insulator). An analytic expression for bias-voltage-controlled interlayer exchange coupling in this system is developed within a simple free-electron-like, one-dimensional approximation. According to the approach, the magnetic configurations of the two magnetic layers oscillate from antiferromagnetic to ferromagnetic with applied bias voltage. This implies that we can switch/rotate the magnetization direction without an external magnetic field. Possible applications of such a system are also discussed.

  10. A comprehensive review of dynamic voltage restorers

    DEFF Research Database (Denmark)

    Farhadi-Kangarlu, Mohammad; Babaei, Ebrahim; Blaabjerg, Frede

    2017-01-01

    will consider all of the fast voltage compensators, i.e. the devices called Static Series Compensator (SSC), sag corrector, Dynamic Sag Corrector (DySC), and other similar devices are also considered. All of these devices will be called DVR since they operate almost in the same way. Some comparative conclusions......During the last half century the Power Quality (PQ) related problems have become important issues. Many solutions have been proposed to address the PQ problems. The most attractive and flexible way is to use power electronic converter based devices such as Dynamic Voltage Restorer (DVR......), Distribution Static Compensator (DSTATCOM), Unified Power Quality Conditioner (UPQC), Uninterruptible Power Supply (UPS), and other devices usually called custom power devices. Among custom power devices, the DVR is the most economical solution to overcome the voltage-related PQ problems. Intensive research...

  11. High Efficiency Power Converter for Low Voltage High Power Applications

    DEFF Research Database (Denmark)

    Nymand, Morten

    . A detailed analysis of dominant loss factors in high power converters for low voltage applications is presented. The analysis concludes that: • Power transformers for low voltage high power, if properly designed, will have extremely low leakage inductance. • If optimally designed, boost converters......The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, if a converter is properly designed, primary side voltage clamp circuits will not even work in low voltage high power converters. • Very high conversion efficiency can be achieved. Peak efficiency of 98% and worst case minimum efficiency of 96.8% are demonstrated on a 1.5 kW converter. The ability...

  12. High Efficiency Power Converter for Low Voltage High Power Applications

    DEFF Research Database (Denmark)

    Nymand, Morten

    and maximum output power. In chapter 3, a detailed analysis of dominant loss factors in high power converters for low voltage applications is presented. The analysis concludes that: • Power transformers for low voltage high power, if properly designed, will have extremely low leakage inductance......The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based....... • If optimally designed, boost converters will be much more efficient than comparable buck type converters for high power low voltage applications. • The use of voltage clamp circuits to protect primary switches in boost converters is no longer needed for device protection. On the other hand...

  13. Temperature Induced Voltage Offset Drifts in Silicon Carbide Pressure Sensors

    Science.gov (United States)

    Okojie, Robert S.; Lukco, Dorothy; Nguyen, Vu; Savrun, Ender

    2012-01-01

    We report the reduction of transient drifts in the zero pressure offset voltage in silicon carbide (SiC) pressure sensors when operating at 600 C. The previously observed maximum drift of +/- 10 mV of the reference offset voltage at 600 C was reduced to within +/- 5 mV. The offset voltage drifts and bridge resistance changes over time at test temperature are explained in terms of the microstructure and phase changes occurring within the contact metallization, as analyzed by Auger electron spectroscopy and field emission scanning electron microscopy. The results have helped to identify the upper temperature reliable operational limit of this particular metallization scheme to be 605 C.

  14. Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

    KAUST Repository

    Useinov, Arthur

    2011-10-22

    In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.

  15. High voltage testing for the Majorana Demonstrator

    Energy Technology Data Exchange (ETDEWEB)

    Abgrall, N.; Arnquist, Isaac J.; Avignone, F. T.; Barabash, A.; Bertrand, F.; Bradley, A. W.; Brudanin, V.; Busch, Matthew; Buuck, M.; Byram, D.; Caldwell, A. S.; Chan, Yuen-Dat; Christofferson, C. D.; Chu, Pamela M.; Cuesta, C.; Detwiler, Jason A.; Doe, P. J.; Dunagan, C.; Efremenko, Yuri; Ejiri, H.; Elliott, S. R.; Fu, Z.; Galindo-Uribarri, A.; Giovanetti, G. K.; Goett, J.; Green, M. P.; Gruszko, J.; Guinn, I.; Guiseppe, V. E.; Henning, R.; Hoppe, Eric W.; Howard, S.; Howe, M. A.; Jasinski, B. R.; Keeter, K.; Kidd, M. F.; Konovalov, S.; Kouzes, Richard T.; Laferriere, Brian D.; Leon, Jonathan D.; Li, Alexander D.; MacMullin, J.; Martin, R. D.; Massarcyk, R.; Meijer, S. J.; Mertens, S.; Orrell, John L.; O' Shaughnessy, C.; Poon, Alan W.; Radford, D. C.; Rager, J.; Rielage, Keith; Robertson, R. G. H.; Romero Romo, M.; Shanks, B.; Shirchenko, M.; Snyder, N.; Suriano, Anne-Marie E.; Tedeschi, D.; Thompson, Andrew; Ton, K. T.; Trimble, J. E.; Varner, R. L.; Vasilyev, Sergey; Vetter, Kai; Vorren, Kris R.; White, Brandon R.; Wilkerson, J. F.; Wiseman, C.; Xu, W.; Yakushev, E.; Yu, Chang-Hong; Yumatov, V.

    2016-07-01

    The Majorana Collaboration is constructing theMajorana Demonstrator, an ultra-low background, 44-kg modular high-purity Ge (HPGe) detector array to search for neutrinoless double-beta decay in 76Ge. The phenomenon of surface micro-discharge induced by high-voltage has been studied in the context of theMajorana Demonstrator. This effect can damage the front-end electronics or mimic detector signals. To ensure the correct performance, every high-voltage cable and feedthrough must be capable of supplying HPGe detector operating voltages as high as 5 kV without exhibiting discharge. R&D measurements were carried out to understand the testing system and determine the optimum design configuration of the high-voltage path, including different improvements of the cable layout and feedthrough flange model selection. Every cable and feedthrough to be used at the Majorana Demonstrator was characterized and the micro-discharge effects during theMajorana Demonstrator commissioning phase were studied. A stable configuration has been achieved, and the cables and connectors can supply HPGe detector operating voltages without exhibiting discharge.

  16. Waste Water Treatment Apparatus and Methods

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2014-01-01

    An improved draft tube spout fluid bed (DTSFB) mixing, handling, conveying, and treating apparatus and systems, and methods for operating are provided. The apparatus and systems can accept particulate material and pneumatically or hydraulically conveying the material to mix and/or treat the material. In addition to conveying apparatus, a collection and separation apparatus adapted to receive the conveyed particulate material is also provided. The collection apparatus may include an impaction plate against which the conveyed material is directed to improve mixing and/or treatment. The improved apparatus are characterized by means of controlling the operation of the pneumatic or hydraulic transfer to enhance the mixing and/or reacting by controlling the flow of fluids, for example, air, into and out of the apparatus. The disclosed apparatus may be used to mix particulate material, for example, mortar; react fluids with particulate material; coat particulate material, or simply convey particulate material.

  17. Deployment of low-voltage regulator considering existing voltage control in medium-voltage distribution systems

    Directory of Open Access Journals (Sweden)

    Hiroshi Kikusato

    2016-01-01

    Full Text Available Many photovoltaic (PV systems have been installed in distribution systems. This installation complicates the maintenance of all voltages within the appropriate range in all low-voltage distribution systems (LVDSs because the trends in voltage fluctuation differ in each LVDS. The installation of a low-voltage regulator (LVR that can accordingly control the voltage in each LVDS has been studied as a solution to this problem. Voltage control in a medium-voltage distribution system must be considered to study the deployment of LVRs. In this study, we installed LVRs in the LVDSs in which the existing voltage-control scheme cannot prevent voltage deviation and performed a numerical simulation by using a distribution system model with PV to evaluate the deployment of the LVRs.

  18. Apparatus for measuring fluid flow

    Science.gov (United States)

    Smith, J.E.; Thomas, D.G.

    Flow measuring apparatus includes a support loop having strain gages mounted thereon and a drag means which is attached to one end of the support loop and which bends the sides of the support loop and induces strains in the strain gages when a flow stream impacts thereon.

  19. A FILTRATION METHOD AND APPARATUS

    DEFF Research Database (Denmark)

    2003-01-01

    The present invention concerns a method and an apparatus for separating dry matter from liquid, comprising providing an enclosed separation environment capable of being pressure regulated, and in said enclosed separation environment contacting at least one filter with a suspension accumulating dr...

  20. Scanning radiographic apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.D.

    1980-04-01

    Visual display of dental, medical or other radiographic images is realized with an x-ray tube in which an electron beam is scanned through an x-y raster pattern on a broad anode plate, the scanning being synchronized with the x-y sweep signals of a cathode ray tube display and the intensity signal for the display being derived from a small x-ray detector which receives x-rays that have passed through the subject to be imaged. Positioning and support of the detector are provided for by disposing the detector in a probe which may be attached to the x-ray tube at any of a plurality of different locations and by providing a plurality of such probes of different configuration in order to change focal length, to accommodate to different detector placements relative to the subject, to enhance patient comfort and to enable production of both periapical images and wider angle pantomographic images. High image definition with reduced radiation dosage is provided for by a lead glass collimator situated between the x-ray tube and subject and having a large number of spaced-apart minute radiation transmissive passages convergent on the position of the detector. Releasable mounting means enable changes of collimator in conjunction with changes of the probe to change focal length. A control circuit modifies the x-y sweep signals applied to the x-ray tube and modulates electron beam energy and current in order to correct for image distortions and other undesirable effects which can otherwise be present in a scanning x-ray system.

  1. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  2. The quantum X-ray radiology apparatus

    CERN Document Server

    Hilt, B; Prevot, G

    2000-01-01

    The paper entitled 'New Quantum Detection System for Very Low Dose X-ray Radiology', presented at the talk session, discusses the preliminary data obtained using a new quantum X-ray radiology system with a high-efficiency solid-state detector and highly sensitive electronics, making it possible to reduce significantly the dose administered to a patient in X-ray radiology examinations. The present paper focuses more on the technological aspects of the apparatus, such as the integration of the detector with the two Asics, and the computer system. Namely, it is shown how the computer system calibrates the detection system, acquires the data in real time, and controls the scan parameters and image filtering process.

  3. Method and apparatus for charged particle propagation

    Science.gov (United States)

    Hershcovitch, A.

    1996-11-26

    A method and apparatus are provided for propagating charged particles from a vacuum to a higher pressure region. A generator includes an evacuated chamber having a gun for discharging a beam of charged particles such as an electron beam or ion beam. The beam is discharged through a beam exit in the chamber into a higher pressure region. A plasma interface is disposed at the beam exit and includes a plasma channel for bounding a plasma maintainable between a cathode and an anode disposed at opposite ends thereof. The plasma channel is coaxially aligned with the beam exit for propagating the beam from the chamber, through the plasma, and into the higher pressure region. The plasma is effective for pumping down the beam exit for preventing pressure increase in the chamber and provides magnetic focusing of the beam discharged into the higher pressure region 24. 7 figs.

  4. Apparatus for assembly of microelectronic devices

    Science.gov (United States)

    Okandan, Murat; Nielson, Gregory N.; Cruz-Campa, Jose Luis; Lavin, Judith Maria; Resnick, Paul J.

    2017-09-12

    An apparatus including a carrier substrate configured to move a microelectronic device. The apparatus further includes a rotatable body configured to receive the microelectronic device. Additionally, the apparatus includes a second substrate configured to receive the microelectronic device from the rotatable body.

  5. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  6. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  7. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...... has been proposed to estimate the voltage at consumer point of connection (POC) to ensure operation within voltage limits. Finally, the effectiveness of the proposed method is analyzed comprehensively with reference to three different scenarios on a low voltage (LV) feeder (Borup feeder) owned...

  8. A mini-photofragment translational spectrometer with ion velocity map imaging using low voltage acceleration

    Science.gov (United States)

    Qi, Wenke; Jiang, Pan; Lin, Dan; Chi, Xiaoping; Cheng, Min; Du, Yikui; Zhu, Qihe

    2018-01-01

    A mini time-sliced ion velocity map imaging photofragment translational spectrometer using low voltage acceleration has been constructed. The innovation of this apparatus adopts a relative low voltage (30-150 V) to substitute the traditional high voltage (650-4000 V) to accelerate and focus the fragment ions. The overall length of the flight path is merely 12 cm. There are many advantages for this instrument, such as compact structure, less interference, and easy to operate and control. Low voltage acceleration gives a longer turn-around time to the photofragment ions forming a thicker Newton sphere, which provides sufficient time for slicing. Ion trajectory simulation has been performed for determining the structure dimensions and the operating voltages. The photodissociation and multiphoton ionization of O2 at 224.999 nm is used to calibrate the ion images and examine the overall performance of the new spectrometer. The velocity resolution (Δν/ν) of this spectrometer from O2 photodissociation is about 0.8%, which is better than most previous results using high acceleration voltage. For the case of CF3I dissociation at 277.38 nm, many CF3 vibrational states have been resolved, and the anisotropy parameter has been measured. The application of low voltage acceleration has shown its advantages on the ion velocity map imaging (VMI) apparatus. The miniaturization of the VMI instruments can be realized on the premise of high resolution.

  9. Low-voltage polyphasic circuits

    Science.gov (United States)

    Baird, William H.; Jaynes, Michael L.

    2010-05-01

    Experimentation with polyphasic voltages is greatly simplified when microcontrollers are used to generate multiple square waves with fixed phase offsets. Each square wave is sent through a simple second-order Sallen-Key filter to produce an approximately sinusoidal voltage signal. The microcontroller allows the reproduction of split-phase and three-phase voltage relationships, mirroring those commonly distributed on the North American power grid, at safe voltage levels.

  10. High voltage variable diameter insulator

    Science.gov (United States)

    Vanecek, David L.; Pike, Chester D.

    1984-01-01

    A high voltage feedthrough assembly (10) having a tubular insulator (15) extending between the ground plane ring (16) and the high voltage ring (30). The insulator (15) is made of Pyrex and decreases in diameter from the ground plane ring (16) to the high voltage ring (30), producing equipotential lines almost perpendicular to the wall (27) of the insulator (15) to optimize the voltage-holding capability of the feedthrough assembly (10).

  11. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  12. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  13. Electrochemical apparatus comprising modified disposable rectangular cuvette

    Science.gov (United States)

    Dattelbaum, Andrew M; Gupta, Gautam; Morris, David E

    2013-09-10

    Electrochemical apparatus includes a disposable rectangular cuvette modified with at least one hole through a side and/or the bottom. Apparatus may include more than one cuvette, which in practice is a disposable rectangular glass or plastic cuvette modified by drilling the hole(s) through. The apparatus include two plates and some means of fastening one plate to the other. The apparatus may be interfaced with a fiber optic or microscope objective, and a spectrometer for spectroscopic studies. The apparatus are suitable for a variety of electrochemical experiments, including surface electrochemistry, bulk electrolysis, and flow cell experiments.

  14. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  15. Freeze chromatography method and apparatus

    Science.gov (United States)

    Scott, C.D.

    1987-04-16

    A freeze chromatography method and apparatus are provided which enable separation of the solutes contained in a sample. The apparatus includes an annular column construction comprising cylindrical inner and outer surfaces defining an annular passage therebetween. One of the surfaces is heated and the other cooled while passing an eluent through the annular passageway so that the eluent in contact with the cooled surface freezes and forms a frozen eluent layer thereon. A mixture of solutes dissolved in eluent is passed through the annular passageway in contact with the frozen layer so that the sample solutes in the mixture will tend to migrate either toward or away the frozen layer. The rate at which the mixture flows through the annular passageway is controlled so that the distribution of the sample solutes approaches that at equilibrium and thus a separation between the sample solutes occurs. 3 figs.

  16. Micromachined patch-clamp apparatus

    Science.gov (United States)

    Okandan, Murat

    2012-12-04

    A micromachined patch-clamp apparatus is disclosed for holding one or more cells and providing electrical, chemical, or mechanical stimulation to the cells during analysis with the patch-clamp technique for studying ion channels in cell membranes. The apparatus formed on a silicon substrate utilizes a lower chamber formed from silicon nitride using surface micromachining and an upper chamber formed from a molded polymer material. An opening in a common wall between the chambers is used to trap and hold a cell for analysis using the patch-clamp technique with sensing electrodes on each side of the cell. Some embodiments of the present invention utilize one or more electrostatic actuators formed on the substrate to provide mechanical stimulation to the cell being analyzed, or to provide information about mechanical movement of the cell in response to electrical or chemical stimulation.

  17. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    to guide these grid-connected distributed power generation systems. In order to verify the response of such systems for voltage disturbance, mainly for evaluation of voltage sags/dips, a Voltage Sag Generator (VSG) is needed. This paper evaluates such sag test devices according to IEC 61000 in order...... to provide cheaper solutions to test against voltage sags. Simulation and experimental results demonstrate that the shunt impedance based VSG solution is the easiest and cheapest one for laboratory test applications. The back-to-back fully controlled converter based VSG is the most flexible solution......The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  18. Thermoplastic welding apparatus and method

    Science.gov (United States)

    Matsen, Marc R.; Negley, Mark A.; Geren, William Preston; Miller, Robert James

    2017-03-07

    A thermoplastic welding apparatus includes a thermoplastic welding tool, at least one tooling surface in the thermoplastic welding tool, a magnetic induction coil in the thermoplastic welding tool and generally encircling the at least one tooling surface and at least one smart susceptor in the thermoplastic welding tool at the at least one tooling surface. The magnetic induction coil is adapted to generate a magnetic flux field oriented generally parallel to a plane of the at least one smart susceptor.

  19. Coated substrate apparatus and method

    Energy Technology Data Exchange (ETDEWEB)

    Bao, Zhenan; Diao, Ying; Mannsfeld, Stefan Christian Bernhardt; Tee, Chee-Keong; Becerril-Garcia, Hector A.; Zhou, Yan

    2018-01-09

    A coated substrate is formed with aligned objects such as small molecules, macromolecules and nanoscale particulates, such as inorganic, organic or inorganic/organic hybrid materials. In accordance with one or more embodiments, an apparatus or method involves an applicator having at least one surface patterned with protruded or indented features, and a coated substrate including a solution-based layer of objects having features and morphology attributes arranged as a function of the protruded or indented features.

  20. Apparatus for entrained coal pyrolysis

    Science.gov (United States)

    Durai-Swamy, Kandaswamy

    1982-11-16

    This invention discloses a process and apparatus for pyrolyzing particulate coal by heating with a particulate solid heating media in a transport reactor. The invention tends to dampen fluctuations in the flow of heating media upstream of the pyrolysis zone, and by so doing forms a substantially continuous and substantially uniform annular column of heating media flowing downwardly along the inside diameter of the reactor. The invention is particularly useful for bituminous or agglomerative type coals.

  1. Automatic toilet seat lowering apparatus

    Science.gov (United States)

    Guerty, Harold G.

    1994-09-06

    A toilet seat lowering apparatus includes a housing defining an internal cavity for receiving water from the water supply line to the toilet holding tank. A descent delay assembly of the apparatus can include a stationary dam member and a rotating dam member for dividing the internal cavity into an inlet chamber and an outlet chamber and controlling the intake and evacuation of water in a delayed fashion. A descent initiator is activated when the internal cavity is filled with pressurized water and automatically begins the lowering of the toilet seat from its upright position, which lowering is also controlled by the descent delay assembly. In an alternative embodiment, the descent initiator and the descent delay assembly can be combined in a piston linked to the rotating dam member and provided with a water channel for creating a resisting pressure to the advancing piston and thereby slowing the associated descent of the toilet seat. A toilet seat lowering apparatus includes a housing defining an internal cavity for receiving water from the water supply line to the toilet holding tank. A descent delay assembly of the apparatus can include a stationary dam member and a rotating dam member for dividing the internal cavity into an inlet chamber and an outlet chamber and controlling the intake and evacuation of water in a delayed fashion. A descent initiator is activated when the internal cavity is filled with pressurized water and automatically begins the lowering of the toilet seat from its upright position, which lowering is also controlled by the descent delay assembly. In an alternative embodiment, the descent initiator and the descent delay assembly can be combined in a piston linked to the rotating dam member and provided with a water channel for creating a resisting pressure to the advancing piston and thereby slowing the associated descent of the toilet seat.

  2. Methods and apparatus for use with extreme ultraviolet light having contamination protection

    Energy Technology Data Exchange (ETDEWEB)

    Chilese, Francis C.; Torczynski, John R.; Garcia, Rudy; Klebanoff, Leonard E.; Delgado, Gildardo R.; Rader, Daniel J.; Geller, Anthony S.; Gallis, Michail A.

    2016-07-12

    An apparatus for use with extreme ultraviolet (EUV) light comprising A) a duct having a first end opening, a second end opening and an intermediate opening intermediate the first end opening the second end opening, B) an optical component disposed to receive EUV light from the second end opening or to send light through the second end opening, and C) a source of low pressure gas at a first pressure to flow through the duct, the gas having a high transmission of EUV light, fluidly coupled to the intermediate opening. In addition to or rather than gas flow the apparatus may have A) a low pressure gas with a heat control unit thermally coupled to at least one of the duct and the optical component and/or B) a voltage device to generate voltage between a first portion and a second portion of the duet with a grounded insulative portion therebetween.

  3. Multipurpose Thermal Insulation Test Apparatus

    Science.gov (United States)

    Fesmire, James E. (Inventor); Augustynowicz, Stanislaw D. (Inventor)

    2002-01-01

    A multi-purpose thermal insulation test apparatus is used for testing insulation materials, or other components. The test apparatus is a fluid boil-off calorimeter system for calibrated measurement of the apparent thermal conductivity (k-value) of a specimen material at a fixed vacuum level. The apparatus includes an inner vessel for receiving a fluid with a normal boiling point below ambient temperature, such as liquid nitrogen, enclosed within a vacuum chamber. A cold mass assembly, including the inner vessel and thermal guards, is suspended from the top of the vacuum chamber. Handling tools attach to the cold mass assembly for convenient manipulation of the assembly and for the installation or wrapping of insulation test materials. Liquid nitrogen is typically supplied to the inner vessel using a fill tube with funnel. A single port through the top of the vacuum chamber facilitates both filling and venting. Aerogel composite stacks with reflective films are fastened to the top and the bottom of the inner vessel as thermal guards. The comparative k-value of the insulation material is determined by measuring the boil-off flow rate of gas, the temperature differential across the insulation thickness, and the dimensions (length and diameters) of the test specimen.

  4. The Apparatus of Digital Archaeology

    Directory of Open Access Journals (Sweden)

    Jeremy Huggett

    2017-06-01

    Full Text Available Digital Archaeology is predicated upon an ever-changing set of apparatuses – technological, methodological, software, hardware, material, immaterial – which in their own ways and to varying degrees shape the nature of Digital Archaeology. Our attention, however, is perhaps inevitably more closely focused on research questions, choice of data, and the kinds of analyses and outputs. In the process we tend to overlook the effects the tools themselves have on the archaeology we do beyond the immediate consequences of the digital. This article introduces cognitive artefacts as a means of addressing the apparatus more directly within the context of the developing archaeological digital ecosystem. It argues that a critical appreciation of our computational cognitive artefacts is key to understanding their effects on both our own cognition and on the creation of archaeological knowledge. In the process, it defines a form of cognitive digital archaeology in terms of four distinct methods for extracting cognition from the digital apparatus layer by layer.

  5. Compensation Performance for Induction Motor Load of Voltage Dip Compensator

    Science.gov (United States)

    Nagamoto, Takamichi; Takayama, Katsumi; Kai, Takaaki

    The variable speed drives of the power electronics application are the most sensitive to the voltage dip that is caused by power system fault. Variable speed drives are composed by the converter, the voltage source inverter and induction motor. They could fall into operation failure by wrong control in the converter when degree of the voltage dip exceeds 15% and 10ms. Therefore, important loads are equipped with the voltage dip compensation. Since the load characteristic of the converter equals nearly the impedance load, the induction motors connected directly to power supply are more sensitive to the output voltage waveform of the compensator than the converter. Thus, the induction motors are used as the important load (compensated load) on the simulation. The simulations of the compensation performance to the induction motors are carried out by using simulation tool PSCAD/EMTDC. It is confirmed that the goal of the compensation performance is able to be achieved.

  6. Voltage regulator placement in radial distribution system using plant ...

    African Journals Online (AJOL)

    user

    Voltage regulator placement in radial distribution system using plant growth simulation algorithm. P.V.V. Rama Rao1*, S. Sivanaga Raju 2. 1*Department of Electrical & Electronics Engineering, Arjun College of Technology & Science, Hyderabad, INDIA. 2 Department of Electrical & Electronics Engineering, JNTUK College ...

  7. Determination of appropriate DC voltage for switched mode power supply (SMPS) loads

    Science.gov (United States)

    Setiawan, Eko Adhi; Setiawan, Aiman; Purnomo, Andri; Djamal, Muchlishah Hadi

    2017-03-01

    Nowadays, most of modern and efficient household electronic devices operated based on Switched Mode Power Supply (SMPS) technology which convert AC voltage from the grid to DC voltage. Based on theory and experiment, SMPS loads could be supplied by DC voltage. However, the DC voltage rating to energize electronic home appliances is not standardized yet. This paper proposed certain method to determine appropriate DC voltage, and investigated comparison of SMPS power consumption which is supplied from AC and DC voltage. To determine the appropriate DC voltage, lux value of several lamps which have same specification energized by using AC voltage and the results is using as reference. Then, the lamps were supplied by various DC voltage to obtain the trends of the lux value to the applied DC voltage. After that, by using the trends and the reference lux value, the appropriate DC voltage can be determined. Furthermore, the power consumption on home appliances such as mobile phone, laptop and personal computer by using AC voltage and the appropriate DC voltage were conducted. The results show that the total power consumption of AC system is higher than DC system. The total power (apparent power) consumed by the lamp, mobile phone and personal computer which operated in 220 VAC were 6.93 VA, 34.31 VA and 105.85 VA respectively. On the other hand, under 277 VDC the load consumption were 5.83 W, 19.11 W and 74.46 W respectively.

  8. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  9. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... analysis, which is simple for computation and requires moderate automation and communication infrastructure. The proposed method is suitable for a hierarchical control structure where a supervisory controller has the provision to adapt the settings of local PV inverter controllers for overall system...

  10. Alternating current breakdown voltage of ice electret

    Science.gov (United States)

    Oshika, Y.; Tsuchiya, Y.; Okumura, T.; Muramoto, Y.

    2017-09-01

    Ice has low environmental impact. Our research objectives are to study the availability of ice as a dielectric insulating material at cryogenic temperatures. We focus on ferroelectric ice (iceXI) at cryogenic temperatures. The properties of iceXI, including its formation, are not clear. We attempted to obtain the polarized ice that was similar to iceXI under the applied voltage and cooling to 77 K. The polarized ice have a wide range of engineering applications as electronic materials at cryogenic temperatures. This polarized ice is called ice electret. The structural difference between ice electret and normal ice is only the positions of protons. The effects of the proton arrangement on the breakdown voltage of ice electret were shown because electrical properties are influenced by the structure of ice. We observed an alternating current (ac) breakdown voltage of ice electret and normal ice at 77 K. The mean and minimum ac breakdown voltage values of ice electret were higher than those of normal ice. We considered that the electrically weak part of the normal ice was improved by applied a direct electric field.

  11. [From cellular biology to molecular biology: Golgi apparatus from the discovery to nowadays].

    Science.gov (United States)

    Falchetti, Mario; Lupi, Ramona; Ottini, Laura

    2007-01-01

    On April the 9th 1898 Golgi presented the discovery of the Apparato Reticolare Interno or internal reticular apparatus to the Società Medico-Chirurgica in Pavia. The internal reticular apparatus was described as "a fine and elegant network within the cell body" of Purkinje cells. The discovery of this new intracellular structure can be considered a byproduct of Golgi studies devoted to the analysis of the nervous system histology. Golgi and his co-workers detected the internal reticular apparatus in many cell types and described the organelle pleiomorphism due to specific physiological or pathological conditions. However, the real existence of the apparatus was questioned until the organelle was finally identified by electron microscopy in 1954. At this point Golgi apparatus became an actual intracellular structure without any clear function. The involvement in cell secretion processes was verified by using biochemical and molecular investigations from the 1960s. Nowadays, Golgi apparatus is clearly known to be involved in different cell functions as growth, homeostasis and division. The correct execution of these functions lies on the ability to maintain an equilibrated balance between the proteins therein resident. Recently, Golgi apparatus has been involved also in human pathology as mutations in proteins localized in the organelle are linked to some hereditary disorders like the Lowe syndrome. Golgi apparatus has been debated since its discovery. From the Golgi milestones discussed here it is evident that controversies that have arisen were often resolved by information resulting from the application of new technical developments. Indeed the compound dynamic structure and the relevance in cell physiology and in human pathology render Golgi apparatus an open object for future studies. Overall, the history of the Golgi apparatus represents an excellent model not only to follow the transition of the study approaches from cellular biology to molecular cell biology

  12. Control voltage and power fluctuations when connecting wind farms

    Energy Technology Data Exchange (ETDEWEB)

    Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

    2015-12-23

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

  13. Lightning impulse breakdown voltage of liquid nitrogen under the influence of heating

    Science.gov (United States)

    Fink, S.; Noe, M.; Zwecker, V.; Leibfried, T.

    2010-06-01

    For application of high voltage superconducting apparatus liquid nitrogen is often not only used as coolant but also for electrical insulation. A temperature increase, e. g. during a quench of a fault current limiter, may cause a considerable decrease of the breakdown voltage within the apparatus. A cryostat was equipped with an adjustable sphere to plate electrode arrangement for the examination of the breakdown and withstand voltages of liquid nitrogen depending on the gap length. The sphere was connected to high voltage and the plate electrode was grounded. Standard lightning impulses till 360 kV were applied to the arrangement. First investigations with a non heatable plane for pressures till 0.3 MPa (absolute) showed no technical relevant gain by pressure increase especially for negative impulses. Hence the dielectric strength of liquid nitrogen in the heated case in comparison to the not heated mode was only examined at 0.1 MPa (absolute). Approximately a doubling of the gap length was necessary in case of a 0.5 kW heating in order to achieve the same 16% breakdown voltage or the same withstand voltage as in the case with no heating.

  14. Highly-Efficient and Modular Medium-Voltage Converters

    Science.gov (United States)

    2015-09-28

    of the modular multilevel converter based on si and sic switching devices for medium/high-voltage applications," IEEE Trans. Electron Devices, vol...4. TITLE AND SUBTITLE Highly-Efficient and Modula Medium-Voltage Converters 6. AUTHOR(S) Maryam Saeedifard 7. PERFORMING ORGANIZATIC i NAME(S...improving the converter’s efficiency and power density. 15. SUBJECT TERMS Modular Multilevel Converters , DC-DC Conversion, DC-AC Conversion 16

  15. The P̅ANDA apparatus

    Science.gov (United States)

    Calvo, D.

    2014-03-01

    The P̅ANDA experiment will make use of cooled antiproton beams of unprecedented quality that will be available at the Facility for Antiproton and Ion Research (FAIR) in Darmstadt. The envisaged physics program includes: meson spectroscopy, baryon antibaryon production, baryon spectroscopy, hypernuclar physics, hadron properties in the nuclear medium and electromagnetic processes. This rich physics program asks for a general purpose apparatus. The design of the experiment is an advanced stage and the R&D phase is approaching its final phase, as resulted by most of the Technical Design Reports (TDRs) being already completed or under writing. In addition the production phase has already started for the electromagnetic calorimeter.

  16. Coeliac cavity ultrasonic diagnosis apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Ando, O.; Suwaki, T.

    1983-07-05

    A coeliac cavity ultrasonic diagnosis apparatus is disclosed which includes an ultrasonic transducer or scanner portion adapted to be inserted into a coeliac cavity to effect a sector scan of an ultrasonic beam to produce an ultrasonic image of internal tissues and in which the ultrasonic oscillator on the one hand and an ultrasonic reflecting mirror and rotary disc on the other hand are relatively rotated so as to effect the sector scan of the ultrasonic beam and the rotary angle of the rotary disc is detected so as to obtain a deflecting angle of the ultrasonic beam and a display on a cathode ray tube of a precise ultrasonic picture image.

  17. Cluster Implantation and Deposition Apparatus

    DEFF Research Database (Denmark)

    Hanif, Muhammad; Popok, Vladimir

    2015-01-01

    In the current report, a design and capabilities of a cluster implantation and deposition apparatus (CIDA) involving two different cluster sources are described. The clusters produced from gas precursors (Ar, N etc.) by PuCluS-2 can be used to study cluster ion implantation in order to develop...... contributions to the theory of cluster stopping in matter as well as for practical applications requiring ultra-shallow implantation and modification of surfaces on the nanoscale. Metal clusters from the magnetron cluster source are of interest for the production of optical sensors to detect specific biological...

  18. Thermal response simulation for tuning PID controllers in a 1016 mm guarded hot plate apparatus.

    Science.gov (United States)

    Thomas, William C; Zarr, Robert R

    2011-07-01

    A mathematical model has been developed and used to simulate the controlled thermal performance of a large guarded hot-plate apparatus. This highly specialized apparatus comprises three interdependent components whose temperatures are closely controlled in order to measure the thermal conductivity of insulation materials. The simulation model was used to investigate control strategies and derive controller gain parameters that are directly transferable to the actual instrument. The simulations take orders-of-magnitude less time to carry out when compared to traditional tuning methods based on operating the actual apparatus. The control system consists primarily of a PC-based PID control algorithm that regulates the output voltage of programmable power amplifiers. Feedback parameters in the form of controller gains are required for the three heating circuits. An objective is to determine an improved set of gains that meet temperature control criteria for testing insulation materials of interest. The analytical model is based on aggregated thermal capacity representations of the primary components and includes the same control algorithm as used in the actual hot-plate apparatus. The model, accounting for both thermal characteristics and temperature control, was validated by comparisons with test data. The tuning methodology used with the simulation model is described and results are presented. The resulting control algorithm and gain parameters have been used in the actual apparatus without modification during several years of testing materials over wide ranges of thermal conductivity, thickness, and insulation resistance values. Published by Elsevier Ltd on behalf of ISA.

  19. [The isolation and assessment of Golgi apparatus from gastric cancer cells SGC7901].

    Science.gov (United States)

    He, Tingting; Yi, Yongfen; Li, Yanqing; Xiao, Zhong

    2010-10-01

    The Golgi complex is the central organelle of the secretory pathway and has many complicate functions. The endeavours to isolate and purify the Golgi apparatus from cultured cells will benefit further investigation of Golgi. A large number of gastric cancer cells SGC7901 were cultivated in vitro, then Golgi apparatus were isolated from the cells by differential centrifugation combined with sucrose density gradient ultra-centrifugation. Its purity was characterized biochemically by enzymatic assays, morphologically by electron microscopy (EM) and neutral red supravital staining. Finally the Golgi complex was successfully fractionated from gastric cancer cells SGC7901. The first successful isolation of Golgi apparatus from gastric cancer cells SGC7901 by using ultra-centrifugation will lead to research into the function of Golgi apparatus.

  20. Conveyor with rotary airlock apparatus

    Science.gov (United States)

    Kronberg, James W.

    1995-01-01

    An apparatus for transferring objects from a first region to a second reg, the first and second regions having differing atmospheric environments. The apparatus includes a shell having an entrance and an exit, a conveyor belt running through the shell from the entrance to the exit, and a horizontally mounted "revolving door" with at least four vanes revolving about its axis. The inner surface of the shell and the top surface of the conveyor belt act as opposing walls of the "revolving door." The conveyor belt dips as it passes under but against the revolving vanes so as not to interfere with them but to engage at least two of the vanes and define thereby a moving chamber. Preferably, the conveyor belt has ridges or grooves on its surface that engage the edges of the vanes and act to rotate the vane assembly. Conduits are provided that communicate with the interior of the shell and allow the adjustment of the atmosphere of the moving chamber or recovery of constituents of the atmosphere of the first region from the moving chamber before they escape to the second region.

  1. Apparatus for magnetic and electrostatic confinement of plasma

    Science.gov (United States)

    Rostoker, Norman [Irvine, CA; Binderbauer, Michl [Irvine, CA

    2009-08-04

    An apparatus and method for containing plasma and forming a Field Reversed Configuration (FRC) magnetic topology are described in which plasma ions are contained magnetically in stable, non-adiabatic orbits in the FRC. Further, the electrons are contained electrostatically in a deep energy well, created by tuning an externally applied magnetic field. The simultaneous electrostatic confinement of electrons and magnetic confinement of ions avoids anomalous transport and facilitates classical containment of both electrons and ions. In this configuration, ions and electrons may have adequate density and temperature so that upon collisions ions are fused together by nuclear force, thus releasing fusion energy. Moreover, the fusion fuel plasmas that can be used with the present confinement system and method are not limited to neutronic fuels only, but also advantageously include advanced fuels.

  2. Apparatus for magnetic and electrostatic confinement of plasma

    Energy Technology Data Exchange (ETDEWEB)

    Rostoker, Norman; Binderbauer, Michl

    2016-07-05

    An apparatus and method for containing plasma and forming a Field Reversed Configuration (FRC) magnetic topology are described in which plasma ions are contained magnetically in stable, non-adiabatic orbits in the FRC. Further, the electrons are contained electrostatically in a deep energy well, created by tuning an externally applied magnetic field. The simultaneous electrostatic confinement of electrons and magnetic confinement of ions avoids anomalous transport and facilitates classical containment of both electrons and ions. In this configuration, ions and electrons may have adequate density and temperature so that upon collisions ions are fused together by nuclear force, thus releasing fusion energy. Moreover, the fusion fuel plasmas that can be used with the present confinement system and method are not limited to neutronic fuels only, but also advantageously include advanced fuels.

  3. Electron temperature measurement of Ba photoplasma by using an electrostatic probe

    Science.gov (United States)

    Furtlehner, J. P.; Blanchet, A.; Leloutre, B.

    1994-09-01

    We study experimentally and theoretically the time evolution of the electron temperature Te of a photoionized barium vapor which expands freely into a vacuum. Using the gas dynamics fundamental equations and assuming the plasma expansion to be adiabatic, a model is built and analytical expressions are derived for the electron and ion temperatures, velocity, and density time evolutions. The experimental apparatus consists essentially of a vacuum chamber, a Joule effect furnace which produces the Ba vapor. A cylindrical plasma created between the two vertical plates is produced by two-step ionization of the vapor. The electron temperature is measured with a cylindrical electrostatic probe biased by a slowly variable voltage ramp. The current-voltage curve is built step by step with a boxcar averager. The results involve different parameter variations like vapor density or sampling time of the probe current for studying the time evolution of electron temperature. Finally, it was found that the adiabatic cooling model agrees well with the experimental electron temperature evolution, but was limited below 0.025 eV by the Langmuir probe accuracy.

  4. Methods, systems and apparatus for adjusting duty cycle of pulse width modulated (PWM) waveforms

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos-Lopez, Gabriel; Kinoshita, Michael H; Ransom, Ray M; Perisic, Milun

    2013-05-21

    Embodiments of the present invention relate to methods, systems and apparatus for controlling operation of a multi-phase machine in a vector controlled motor drive system when the multi-phase machine operates in an overmodulation region. The disclosed embodiments provide a mechanism for adjusting a duty cycle of PWM waveforms so that the correct phase voltage command signals are applied at the angle transitions. This can reduce variations/errors in the phase voltage command signals applied to the multi-phase machine so that phase current may be properly regulated thus reducing current/torque oscillation, which can in turn improve machine efficiency and performance, as well as utilization of the DC voltage source.

  5. Method and apparatus for in-situ characterization of energy storage and energy conversion devices

    Science.gov (United States)

    Christophersen, Jon P [Idaho Falls, ID; Motloch, Chester G [Idaho Falls, ID; Morrison, John L [Butte, MT; Albrecht, Weston [Layton, UT

    2010-03-09

    Disclosed are methods and apparatuses for determining an impedance of an energy-output device using a random noise stimulus applied to the energy-output device. A random noise signal is generated and converted to a random noise stimulus as a current source correlated to the random noise signal. A bias-reduced response of the energy-output device to the random noise stimulus is generated by comparing a voltage at the energy-output device terminal to an average voltage signal. The random noise stimulus and bias-reduced response may be periodically sampled to generate a time-varying current stimulus and a time-varying voltage response, which may be correlated to generate an autocorrelated stimulus, an autocorrelated response, and a cross-correlated response. Finally, the autocorrelated stimulus, the autocorrelated response, and the cross-correlated response may be combined to determine at least one of impedance amplitude, impedance phase, and complex impedance.

  6. Apparatus for separating solids from a liquid

    NARCIS (Netherlands)

    Rem, P.C.; Berkhout, S.P.M.

    2007-01-01

    The invention relates to an apparatus and a method for separating a material stream consisting of several materials. The materials to be separated have different densities or density ranges, so that the material of the highest density can be discharged through a screen of the apparatus, while the

  7. Apparatus for processing fibrous pulp material

    NARCIS (Netherlands)

    Dekker, J.C.; Bouma, H.; Mulder, F.B.M.

    2008-01-01

    The invention relates to an apparatus (1) for processing a flow of pulp comprising fibrous material, in particular pulp comprising cellulose fibres for making paper, said apparatus comprising a drum (2) having a rotational axis (R), an inlet end (3), an outlet end (4) and an inner surface, a

  8. Voltage Mode Universal Biquad Using CCCII

    Directory of Open Access Journals (Sweden)

    Ashish Ranjan

    2011-01-01

    Full Text Available This paper proposes a multi-input single-output (MISO second-order active-C voltage mode (VM universal filter using two second-generation current-controlled current conveyors (CCCIIs and two equal-valued capacitors. The proposed circuit realizes low pass, band pass, high pass, all pass, and notch responses from the same topology. The filter uses-minimum number of passive components and no resistor which is suitable for IC Design. The filter enjoys low-sensitivity performance and exhibits electronic and orthogonal tunability of pole frequency (0 and quality factor (0 via bias current of CCCIIs. PSPICE simulation results confirm the theory.

  9. Hermetic Seal Leak Detection Apparatus

    Science.gov (United States)

    Kelley, Anthony R. (Inventor)

    2013-01-01

    The present invention is a hermetic seal leak detection apparatus, which can be used to test for hermetic seal leaks in instruments and containers. A vacuum tight chamber is created around the unit being tested to minimize gas space outside of the hermetic seal. A vacuum inducing device is then used to increase the gas chamber volume inside the device, so that a slight vacuum is pulled on the unit being tested. The pressure in the unit being tested will stabilize. If the stabilized pressure reads close to a known good seal calibration, there is not a leak in the seal. If the stabilized pressure reads closer to a known bad seal calibration value, there is a leak in the seal. The speed of the plunger can be varied and by evaluating the resulting pressure change rates and final values, the leak rate/size can be accurately calculated.

  10. Ampoule sealing apparatus and process

    Science.gov (United States)

    Debnam, Jr., William J. (Inventor); Clark, Ivan O. (Inventor)

    1988-01-01

    An apparatus 10 for effecting sealing of a fused quartz ampoule 24 while maintaining a vacuum on the ampoule via system 12 is disclosed. A plug 28 of fused quartz is lowered into the vertically disposed ampoule 24 (while maintaining the vacuum thereon) and heat sealed therein to prevent any vapor escape from, or contamination of, the contained semiconductor growth charge 29 during subsequent semiconductor crystal growth processes. A rotary vacuum feed-through mechanism 16 selectively rotates axle 34 and spool 32 to unwind wire 30 for lowering of plug 28 into the reduced diameter portion 24b of ampoule 24. Ampoule 24 is hermatically connected to vacuum housing 18 by quick release flange 20 wherein O-ring 22 retains ampoule 24.

  11. Apparatus for solar coal gasification

    Science.gov (United States)

    Gregg, D.W.

    Apparatus for using focused solar radiation to gasify coal and other carbonaceous materials is described. Incident solar radiation is focused from an array of heliostats onto a tower-mounted secondary mirror which redirects the focused solar radiation down through a window onto the surface of a vertically-moving bed of coal, or a fluidized bed of coal, contained within a gasification reactor. The reactor is designed to minimize contact between the window and solids in the reactor. Steam introduced into the gasification reactor reacts with the heated coal to produce gas consisting mainly of carbon monoxide and hydrogen, commonly called synthesis gas, which can be converted to methane, methanol, gasoline, and other useful products. One of the novel features of the invention is the generation of process steam at the rear surface of the secondary mirror.

  12. Apparatuses to support photovoltaic modules

    Science.gov (United States)

    Ciasulli, John; Jones, Jason

    2017-08-22

    Methods and apparatuses to support photovoltaic ("PV") modules are described. A saddle bracket has a mounting surface to support one or more PV modules over a tube, a gusset coupled to the mounting surface, and a mounting feature coupled to the gusset to couple to the tube. A grounding washer has a first portion to couple to a support; and a second portion coupled to the first portion to provide a ground path to a PV module. A PV system has a saddle bracket; a PV module over the saddle bracket; and a grounding washer coupled to the saddle bracket and the PV module. Saddle brackets can be coupled to a torque tube at predetermined locations. PV modules can be coupled to the saddle brackets.

  13. Modeling of column apparatus processes

    CERN Document Server

    Boyadjiev, Christo; Boyadjiev, Boyan; Popova-Krumova, Petya

    2016-01-01

    This book presents a new approach for the modeling of chemical and interphase mass transfer processes in industrial column apparatuses, using convection-diffusion and average-concentration models. The convection-diffusion type models are used for a qualitative analysis of the processes and to assess the main, small and slight physical effects, and then reject the slight effects. As a result, the process mechanism can be identified. It also introduces average concentration models for quantitative analysis, which use the average values of the velocity and concentration over the cross-sectional area of the column. The new models are used to analyze different processes (simple and complex chemical reactions, absorption, adsorption and catalytic reactions), and make it possible to model the processes of gas purification with sulfur dioxide, which form the basis of several patents.

  14. APPARATUS FOR LIQUID PHASE EXTRACTION

    Science.gov (United States)

    Hicks, T.R.; Lehman, H.R.; Rubin, B.

    1958-09-16

    operation is described. It comprises a tubular colunm having upper and lower enlarged terminal portions, and a constricted central section containing fluid dispersal packing. Pulsing means are coupled to the upper portion of the column. The inlet for the less dense phase is located above the inlet for the denser phase and both are positioned so that liquids enter the constricted packingfilled central section. The apparatos also includes an interfacing level control, and means fer sensing the level of the interface actuate apparatus for controlling the rate of flow of input or discharge. The outlet for the less dense phase is located in the upper packing free portion of the colunm and that of the denser phase in the lower portion.

  15. Voltage Sensors Monitor Harmful Static

    Science.gov (United States)

    2009-01-01

    A tiny sensor, small enough to be worn on clothing, now monitors voltage changes near sensitive instruments after being created to alert Agency workers to dangerous static buildup near fuel operations and avionics. San Diego s Quasar Federal Systems received a Small Business Innovation Research (SBIR) contract from Kennedy Space Center to develop its remote voltage sensor (RVS), a dime-sized electrometer designed to measure triboelectric changes in the environment. One of the unique qualities of the RVS is that it can detect static at greater distances than previous devices, measuring voltage changes from a few centimeters to a few meters away, due to its much-improved sensitivity.

  16. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  17. Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

    Science.gov (United States)

    Cai, Yuanji; Guan, Yonggang; Liu, Weidong

    2017-06-01

    Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

  18. Enhanced output voltage generation via ZnO nanowires (50 nm): Effect of diameter thinning on voltage enhancement

    Science.gov (United States)

    Ahmad, Mansoor; Iqbal, Muhammad Azhar; Kiely, Janice; Luxton, Richard; Jabeen, Musarrat

    2017-05-01

    50 nm ZnO nanowires were grown on indium tin oxide (ITO) coated poly ethylene terephthalate (PET) substrates by adapting facile aqueous growth technique using low temperature and vacuum conditions. Prior to growth of ZnO nanowires, pure hexagonal wurtzite structured seed layer was grown on flexible substrates. Surface morphology of nanostructure has been examined by scanning electron microscopy (SEM). Vertical growth orientation has been evidenced in XRD patterns. Minute external mechanical force ( 50 nN) has produced periodic voltage peaks. 2.5 nm and 7.5 nm thick sputtered Pt electrode have been tested to obtain output voltages. 50 nm ZnO nanowires has produced a maximum output voltage of 2.717 volts having an output power density of 397.1 mW/cm2. By squeezing the diameter, we have reduced reverse leakage current through nanowires and enhanced output voltage.

  19. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Science.gov (United States)

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    energy barrier that follow the trend of the equilibrium fluctuation relation and the Marcus theory of electron transfer. These energetics also allow for a direct estimation of the voltage dependence of channel activation (Q-V curve), offering a quantitative rationale for a correlation between the voltage dependence parabolas and the Q-V curve, upon site-directed mutagenesis or drug binding. Taken together, by introducing the voltage coupling as the energy gap reaction coordinate, our framework brings new perspectives to the thermodynamic models of voltage activation in voltage-sensitive membrane proteins, offering an a framework for a better understating of the structure-function correlations of voltage gating in ion channels as well as electrogenic phenomena in ion pumps and transporters. Significantly, this formulation also provides a powerful bridge between the CG model of voltage coupling and the conventional macroscopic treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. voltage compensation using artificial neural network

    African Journals Online (AJOL)

    Offor Theophilos

    VOLTAGE COMPENSATION USING ARTIFICIAL NEURAL NETWORK: A CASE STUDY OF. RUMUOLA ... using artificial neural network (ANN) controller based dynamic voltage restorer (DVR). ... substation by simulating with sample of average voltage for Omerelu, Waterlines, Rumuola, Shell Industrial and Barracks.

  1. Voltage Controlled Perpendicular Magnetic Anisotropy.

    Science.gov (United States)

    Noviasky, Nicholas; Sabirianov, Ildar; Cao, Shi; Zhang, Xiaozhe; Sokolov, Andrei; Kirianov, Eugene; Dowben, Peter; Ilie, Carolina C.; University of Nebraska at Lincoln Team; State University of New York at Oswego Collaboration

    Here we report the voltage controlled perpendicular magnetic anisotropy of a multilayer stack composed of P-type silicon substrate/ Gd2O3/ Co/ Pt grown by pulsed laser deposition (PLD) under ultra-high vacuum conditions. For examination of the voltage effect on magnetic properties of the samples, we performed magneto optical Kerr effect (MOKE) measurements. The results show a clear inverse relationship between voltage and coercivity. The exchange of oxygen ions which occurs at the interface between gadolinium oxide and cobalt may increase the cobalt oxide concentration within the optical interface layer. One potential application for this research could be the creation of a voltage controlled magnetic tunneling junction memory storage device. Proper implementation may be able to combine non-volatility with higher areal densities and low power consumption. NSF Research Experience for Faculty and Students at Undergraduate Institutions Program, UNL- MRSEC.

  2. Above-bandgap voltages from ferroelectric photovoltaic devices.

    Science.gov (United States)

    Yang, S Y; Seidel, J; Byrnes, S J; Shafer, P; Yang, C-H; Rossell, M D; Yu, P; Chu, Y-H; Scott, J F; Ager, J W; Martin, L W; Ramesh, R

    2010-02-01

    In conventional solid-state photovoltaics, electron-hole pairs are created by light absorption in a semiconductor and separated by the electric field spaning a micrometre-thick depletion region. The maximum voltage these devices can produce is equal to the semiconductor electronic bandgap. Here, we report the discovery of a fundamentally different mechanism for photovoltaic charge separation, which operates over a distance of 1-2 nm and produces voltages that are significantly higher than the bandgap. The separation happens at previously unobserved nanoscale steps of the electrostatic potential that naturally occur at ferroelectric domain walls in the complex oxide BiFeO(3). Electric-field control over domain structure allows the photovoltaic effect to be reversed in polarity or turned off. This new degree of control, and the high voltages produced, may find application in optoelectronic devices.

  3. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...... power quality disturbances, such as interruptions, sags and imbalances. Simulation studies have been performed. The effectiveness of the proposed method has been demonstrated under the simulated typical power disturbances....

  4. Medium voltage substation insulation coordination

    Energy Technology Data Exchange (ETDEWEB)

    Caccia, M.; Gambirasio, D. (SAE Sadelmi, Milan (Italy))

    1991-01-01

    With reference to the provisions contained in applicable CEI (Italian Electrotechnical Committee) and IEC (International Electrotechnical Commission) normatives, a review is made of design criteria for the coordination of medium voltage substation switchgear and control gear. The design problematics are discussed with reference to optimization of neutral grounding, three phase ac short circuit calculation methods, and methods for the evaluation of voltages in fault conditions.

  5. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W.; Silverstein, Brian L. [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  6. First high-voltage measurements using Ca+ ions at the ALIVE experiment

    Science.gov (United States)

    König, K.; Geppert, Ch.; Krämer, J.; Maaß, B.; Otten, E. W.; Ratajczyk, T.; Nörtershäuser, W.

    2017-11-01

    Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

  7. First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment

    Energy Technology Data Exchange (ETDEWEB)

    König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)

    2017-11-15

    Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

  8. Operation of a sub-terahertz CW gyrotron with an extremely low voltage

    Science.gov (United States)

    Bratman, V. L.; Fedotov, A. E.; Fokin, A. P.; Glyavin, M. Yu.; Manuilov, V. N.; Osharin, I. V.

    2017-11-01

    Decreasing the operating voltage for medium-power sub-terahertz gyrotrons aimed at industrial and scientific applications is highly attractive, since it allows size and cost reduction of the tubes and power supply units. In this paper, we examine such an opportunity both numerically and experimentally for the fundamental cyclotron resonance operation of an existing gyrotron initially designed for operation at the second cyclotron harmonic with a relatively high voltage. Simulations predict that output power higher than 10 W can be produced at the fundamental harmonic at voltages less than 2 kV. To form a low-voltage helical electron beam with a sufficiently large pitch-factor, a positive voltage was applied to the first anode of the gyrotron three-electrode magnetron-injection gun with a negative voltage at the cathode. CW gyrotron operation at voltages down to 1.5 kV has been demonstrated at a frequency about of 256 GHz.

  9. Tissue culture apparatus for flight experimentation

    Science.gov (United States)

    Scheld, H. W.; Magnuson, J. W.; Krikorian, A. D.

    1985-01-01

    The development of an apparatus for in-flight treatment of cells, tissues, or small organisms for microscopic and chemical analyses is discussed. The hardware for the apparatus is to have: (1) automated functions, (2) the capability to interface with ground-based facilities, (3) independently controlled chambers, (4) variable chamber configurations and volumes, and (4) the capabilities for processing the materials. The components of the equipment used on Skylab 3 for the study of animal cells are described. The design of an apparatus which incorporates all the required capabilities is proposed.

  10. Tracing current-voltage curve of solar panel Based on LabVIEW Arduino Interfacing

    OpenAIRE

    Rachid, CHENNI

    2015-01-01

    This study describes a low cost system to measure current and power-voltage characteristics of photovoltaic (PV) silicon solar panel under natural conditions based on LabVIEW software. The desired parameters of PV panel including fill factor, max power, short-circuit current, open-circuit voltage are calculated. The characteristics of the solar panel have been drawn quickly using the MOSFET as an electronic load, which is controlled by means of a suitable gate-source voltage. The new developm...

  11. Apparatus for Sampling Surface Contamination

    Science.gov (United States)

    Wells, Mark

    2008-01-01

    An apparatus denoted a swab device has been developed as a convenient means of acquiring samples of contaminants from surfaces and suspending the samples in liquids. (Thereafter, the liquids can be dispensed, in controlled volumes, into scientific instruments for analysis of the contaminants.) The swab device is designed so as not to introduce additional contamination and to facilitate, simplify, and systematize the dispensing of controlled volumes of liquid into analytical instruments. The swab device is a single apparatus into which are combined all the equipment and materials needed for sampling surface contamination. The swab device contains disposable components stacked together on a nondisposable dispensing head. One of the disposable components is a supply cartridge holding a sufficient volume of liquid for one complete set of samples. (The liquid could be clean water or another suitable solvent, depending on the application.) This supply of liquid is sealed by Luer valves. At the beginning of a sampling process, the user tears open a sealed bag containing the supply cartridge. A tip on the nondisposable dispensing head is engaged with a Luer valve on one end of the supply cartridge and rotated, locking the supply cartridge on the dispensing head and opening the valve. The swab tip includes a fabric swab that is wiped across the surface of interest to acquire a sample. A sealed bag containing a disposable dispensing tip is then opened, and the swab tip is pushed into the dispensing tip until seated. The dispensing head contains a piston that passes through a spring-loaded lip seal. The air volume displaced by this piston forces the liquid out of the supply cartridge, over the swab, and into the dispensing tip. The piston is manually cycled to enforce oscillation of the air volume and thereby to cause water to flow to wash contaminants from the swab and cause the resulting liquid suspension of contaminants to flow into the dispensing tip. After several cycles

  12. Design and development of high voltage high power operational ...

    Indian Academy of Sciences (India)

    systems and the electron deflection systems. Power operational amplifiers have ... approach is cost and availability of high voltage devices in chip form. 2.2 Amplifier with opamp input stage .... power opamp, using chip passive components, semiconductor bare dice minimizes the size while increasing the reliability.

  13. Harmonics and voltage stability analysis in power systems including ...

    Indian Academy of Sciences (India)

    In this study, non-sinusoidal quantities and voltage stability, both known as power quality criteria, are examined together in detail. The widespread use of power electronics elements cause the existence of significant non-sinusoidal quantities in the system. These non-sinusoidal quantities can create serious harmonic ...

  14. Modelling of capacitance and threshold voltage for ultrathin normally ...

    Indian Academy of Sciences (India)

    A compact quantitative model based on oxide semiconductor interface density of states (DOS) is proposed for Al 0.25 Ga 0.75 N/GaN metal oxide semiconductor high electron mobility transistor (MOSHEMT). Mathematical expressions for surface potential, sheet charge concentration, gate capacitance and threshold voltage ...

  15. Influence of temperature and voltage on electrochemical reduction ...

    Indian Academy of Sciences (India)

    In this paper, the influence of temperature and voltage on direct electrochemical reduction were discussed in detail. Reduced graphene oxide is characterized with X-ray diffraction (XRD), fourier transform infrared spectroscopy (FT–IR) and field emission scanning electron microscopy (FE–SEM). It is found that the reduction ...

  16. Special Relativity in the School Laboratory: A Simple Apparatus for Cosmic-Ray Muon Detection

    Science.gov (United States)

    Singh, P.; Hedgeland, H.

    2015-01-01

    We use apparatus based on two Geiger-Müller tubes, a simple electronic circuit and a Raspberry Pi computer to illustrate relativistic time dilation affecting cosmic-ray muons travelling through the atmosphere to the Earth's surface. The experiment we describe lends itself to both classroom demonstration to accompany the topic of special relativity…

  17. Structural organization of the needle complex of the type III secretion apparatus of Shigella flexneri

    NARCIS (Netherlands)

    Sani, Musa; Allaoui, Abdelmounaaïm; Fusetti, Fabrizia; Oostergetel, Gert T.; Keegstra, Wilko; Boekema, Egbert J.

    2007-01-01

    The secretion apparatus known as the needle complex (NC) from the bacterium Shigella flexneri was studied by single particle electron microscopy. The isolated intact NC appears in projection to be composed of a basal body consisting of seven rings and a protruding needle appendage. A comparison of

  18. Method and apparatus for measuring electromagnetic radiation

    Science.gov (United States)

    Been, J. F. (Inventor)

    1973-01-01

    An apparatus and method are described in which the capacitance of a semiconductor junction subjected to an electromagnetic radiation field is utilized to indicate the intensity or strength of the radiation.

  19. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling. The vol......This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling....... The voltage control was evaluated with either active or reactive independent phase load current control. The control performance in field operation in a residential grid situated in Bornholm, Denmark was investigated for different use cases....

  20. 42 CFR 84.74 - Apparatus containers; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Apparatus containers; minimum requirements. 84.74...-Contained Breathing Apparatus § 84.74 Apparatus containers; minimum requirements. (a) Apparatus may be equipped with a substantial, durable container bearing markings which show the applicant's name, the type...

  1. Power Capability in Low Voltage DC Distribution Systems

    Directory of Open Access Journals (Sweden)

    C.O. Gecan

    2009-12-01

    Full Text Available Recent developments in power electronics components enable the use of power electronics in Low Voltage (LV networks. This development makes the model of a Low Voltage Direct Current (LVDC distribution system possible. The technical and economical benefits of this technology make possible the alternative hypothesis of using DC instead of AC distribution systems. Some aspects, such as increasing the capability of the existing lines, interconnecting distributed generation units and even supplying in DC some loads are creating additional requirements of using a LVDC distribution system. The paper presents some general considerations regarding cables used in a LVAC distribution system and different line reconfigurations witch enable the use of cobles in a LVDC distribution system. The reconfigurations are presented in respect of the DC network topologies: unipolar and bipolar. The central aim of this paper is to investigate capability of power transmission and to calculate the transmission distance for cables used in Low Voltage AC and DC distribution systems. Capability computation is considered in respect of two constrains imposed in the cables cross section selection: cable thermal limit and the maximum allowable voltage drop. Cable thermal limit is represented in calculations by the maximum rated current. The equations used to calculate the power capability are presented for single-phase and threephase AC networks and unipolar and bipolar DC networks. Based on these equations, comparisons between power capability of cables with different cross sections used in Low Voltage DC and AC distribution systems are realized and presented.

  2. Voltage Harmonics Mitigation through Hybrid Active Power Filter

    Directory of Open Access Journals (Sweden)

    Anwer Ali Sahito

    2016-01-01

    Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.

  3. Apparatus, System, And Method For Roadway Monitoring

    KAUST Repository

    Claudel, Christian G.

    2015-06-02

    An apparatus, system, and method for monitoring traffic and roadway water conditions. Traffic flow and roadway flooding is monitored concurrently through a wireless sensor network. The apparatus and system comprises ultrasound rangefinders monitoring traffic flow, flood water conditions, or both. Routing information may be calculated from the traffic conditions, such that routes are calculated to avoid roadways that are impassable or are slow due to traffic conditions.

  4. E-beam high voltage switching power supply

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

  5. Automated Voltage Control in LHCb

    CERN Document Server

    Granado Cardoso, L; Jacobsson, R

    2011-01-01

    LHCb is one of the 4 LHC experiments. In order to ensure the safety of the detector and to maximize efficiency, LHCb needs to coordinate its own operations, in particular the voltage configuration of the different subdetectors, according to the accelerator status. A control software has been developed for this purpose, based on the Finite State Machine toolkit and the SCADA system used for control throughout LHCb (and the other LHC experiments). This software permits to efficiently drive both the Low Voltage (LV) and High Voltage (HV) systems of the 10 different sub-detectors that constitute LHCb, setting each sub-system to the required voltage (easily configurable at run-time) based on the accelerator state. The control software is also responsible for monitoring the state of the Sub-detector voltages and adding it to the event data in the form of status-bits. Safe and yet flexible operation of the LHCb detector has been obtained and automatic actions, triggered by the state changes of the ...

  6. Methods, systems and apparatus for optimization of third harmonic current injection in a multi-phase machine

    Science.gov (United States)

    Gallegos-Lopez, Gabriel

    2012-10-02

    Methods, system and apparatus are provided for increasing voltage utilization in a five-phase vector controlled machine drive system that employs third harmonic current injection to increase torque and power output by a five-phase machine. To do so, a fundamental current angle of a fundamental current vector is optimized for each particular torque-speed of operating point of the five-phase machine.

  7. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    Directory of Open Access Journals (Sweden)

    Arash Toudeshki

    2014-01-01

    Full Text Available For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  8. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  9. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  10. Voltage Quality of Grid Connected Wind Turbines

    DEFF Research Database (Denmark)

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...... (VSC) based STATCOM is presented, which shows it is an efficient mean to improve voltage quality....

  11. Portable High Voltage Impulse Generator

    Directory of Open Access Journals (Sweden)

    S. Gómez

    2011-06-01

    Full Text Available This paper presents a portable high voltage impulse generator which was designed and built with insulation up to 20 kV. This design was based on previous work in which simulation software for standard waves was developed. Commercial components and low-cost components were used in this work; however, these particular elements are not generally used for high voltage applications. The impulse generators used in industry and laboratories are usually expensive; they are built to withstand extra high voltage and they are big, making them impossible to transport. The proposed generator is portable, thereby allowing tests to be made on devices that cannot be moved from their location. The results obtained with the proposed impulse generator were satisfactory in terms of time and waveforms compared to other commercial impulse generators and the standard impulse wave simulator.

  12. Voltage Control of Magnetic Anisotropy

    Science.gov (United States)

    Hao, Guanhua; Cao, Shi; Noviasky, Nick; Ilie, Carolina; Sokolov, Andre; Yin, Yuewei; Xu, Xiaoshan; Dowben, Peter

    Pd/Co/Gd2O3/Si heterostructures were fabricated via pulsed laser deposition and e-beam evaporation. Hysteresis loops, obtained by longitudinal magneto-optical Kerr-effect (MOKE) measurements, indicates an initial in-plane magnetic anisotropy. Applying a perpendicular voltage on the sample, the differences between the polar and longitudinal MOKE and anomalous Hall effect data indicates there is a reversible change in magnetic anisotropy, from in-plane to out-of-plane, with applied voltage. Prior work by others suggests that the change in magnetic anisotropy is due to redox reactions at the Co/Gd2O3 interference. Voltage controlled magnetism can result from changing interfacial chemistry and does not always require a magneto-electric coupling tensor.

  13. The calorimetric wattmeter. An accurate method for power loss measurements in energy optimized apparatus and systems. Main report

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, P.; Madsen, K.D.

    2000-08-01

    A measurement system has been built, for Calorimetric Measurement of power in the range 1-50 watt, at test temperatures between 20 and 70 deg. C. This Measurement System is intended to provide a service to research and development engineers working with Power Electronics. Applications for the Measurement System are precision measurements of the power loss in circuits and components, e.g. coils, transformers and power electronics systems. Power losses in these types of apparatus are characteristically difficult to measure, because of the waveforms of current and voltage which occur, non-linear material properties, very small values of loss, and high efficiency. The main purpose of performing precision measurements is to enable verification of the loss values, and the basic loss mechanisms. Knowledge and improved models obtained in this way will enable improved simulations, which are important in connection with optimisation of the loss characteristics and energy performance of apparatus and systems. The principle of the wattmeter is to make a calorimetric measurement of the form of heat emitted inside a reference surface. An advanced control system is provided, to regulate the temperature inside the reference surface. The temperature gradient across the walls of the reference surface is also controlled, to ensure that all heat is removed from the space via the heat exchanger of the precision measurement system. The design of the wattmeter is flexible, so that several experimental methods may be employed. To further ensure precision measurements the operation conditions of the measurement heat transfer system are optimised to suit the value of power to be measured. Experiments have verified that the mesurement uncertainty is 59 mW in the power range 1 to 10 W, for a test temperature of 30% C. An offset of 60 mW has been observed in this range, giving a final uncertainty on the measured value of {+-} 30 mW. The uncertainty increases to 180 mW in the range 10 to 50 W

  14. Whole-cell voltage clamp on skeletal muscle fibers with the silicone-clamp technique.

    Science.gov (United States)

    Lefebvre, Romain; Pouvreau, Sandrine; Collet, Claude; Allard, Bruno; Jacquemond, Vincent

    2014-01-01

    Control of membrane voltage and membrane current measurements are of critical importance for the study of numerous aspects of skeletal muscle physiology and pathophysiology. The silicone-clamp technique makes use of a conventional patch-clamp apparatus to achieve whole-cell voltage clamp of a restricted portion of a fully differentiated adult skeletal muscle fiber. The major part of an isolated muscle fiber is insulated from the extracellular medium with silicone grease and the tip of a single microelectrode connected to the amplifier is then inserted within the fiber through the silicone layer. The method is extremely easy to implement. It represents an alternative to the traditional vaseline-gap isolation and two or three microelectrodes voltage-clamp techniques. The present chapter reviews the benefits of the silicone-clamp technique and provides updated detailed insights into its practical implementation.

  15. Angle Stability Analysis for Voltage-Controlled Converters

    DEFF Research Database (Denmark)

    Lin, Hengwei; Jia, Chenxi; Guerrero, Josep M.

    2017-01-01

    Power electronics based voltage source converters (VSCs) keep increasing in modern electrical systems. As a branch of stability problems, angle stability is significant for an electrical system. Based on small disturbance analysis and time scale decomposition perspective, this paper proposes...... a criterion to analyze the quasi-steady angle stability and the direct current (DC) side stability for VSCs. The operating limit and the angle instability mechanism are revealed, which is generally applicable to the voltage-controlled converters. During the analysis, the influence of the parameters on angle...

  16. MOS switched-capacitor filters using voltage inverter switches

    Science.gov (United States)

    Fettweis, A.; Pandel, J.; Herbst, D.; Hoefflinger, B.; Schweer, R.

    1980-06-01

    The paper examines MOS switched-capacitor filters which use voltage inverter switches. Low-sensitivity switched-capacitor filters imitating LC and LC/unit-element structures can be built by means of capacitances, ordinary switches, and voltage inverter switches; the latter are simply realizable by electronic means. It was found that there are no restrictions on the operating rate (other than those resulting from the Nyquist theorem), or on the location of the attenuation poles; it was also found that the effects of parasitic capacitances can be overcome by proper design techniques. The experimental results of an integrated third-order low-pass filter are in agreement with theory.

  17. High voltage switch triggered by a laser-photocathode subsystem

    Science.gov (United States)

    Chen, Ping; Lundquist, Martin L.; Yu, David U. L.

    2013-01-08

    A spark gap switch for controlling the output of a high voltage pulse from a high voltage source, for example, a capacitor bank or a pulse forming network, to an external load such as a high gradient electron gun, laser, pulsed power accelerator or wide band radar. The combination of a UV laser and a high vacuum quartz cell, in which a photocathode and an anode are installed, is utilized as triggering devices to switch the spark gap from a non-conducting state to a conducting state with low delay and low jitter.

  18. Recycling potential for low voltage and high voltage high rupturing capacity fuse links.

    Science.gov (United States)

    Psomopoulos, Constantinos S; Barkas, Dimitrios A; Kaminaris, Stavros D; Ioannidis, George C; Karagiannopoulos, Panagiotis

    2017-12-01

    Low voltage and high voltage high-rupturing-capacity fuse links are used in LV and HV installations respectively, protecting mainly the LV and HV electricity distribution and transportation networks. The Waste Electrical and Electronic Equipment Directive (2002/96/EC) for "Waste of electrical and electronic equipment" is the main related legislation and as it concerns electrical and electronic equipment, it includes electric fuses. Although, the fuse links consist of recyclable materials, only small scale actions have been implemented for their recycling around Europe. This work presents the possibilities for material recovery from this specialized industrial waste for which there are only limited volume data. Furthermore, in order to present the huge possibilities and environmental benefits, it presents the potential for recycling of HRC fuses used by the Public Power Corporation of Greece, which is the major consumer for the country, but one of the smallest ones in Europe and globally, emphasizing in this way in the issue. According to the obtained results, fuse recycling could contribute to the effort for minimize the impacts on the environment through materials recovery and reduction of the wastes' volume disposed of in landfills. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  1. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    DEFF Research Database (Denmark)

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...

  2. Effects of load voltage on voltage breakdown modes of electrical exploding aluminum wires in air

    Science.gov (United States)

    Wu, Jian; Li, Xingwen; Yang, Zefeng; Wang, Kun; Chao, Youchuang; Shi, Zongqian; Jia, Shenli; Qiu, Aici

    2015-06-01

    The effects of the load voltage on the breakdown modes are investigated in exploding aluminum wires driven by a 1 kA, 0.1 kA/ns pulsed current in air. From laser probing images taken by laser shadowgraphy, schlieren imaging, and interferometry, the position of the shockwave front, the plasma channel, and the wire core edge of the exploding product can be determined. The breakdown mode makes a transition from the internal mode, which involves breakdown inside the wire core, to the shunting mode, which involves breakdown in the compressed air, with decreasing charging voltage. The breakdown electrical field for a gaseous aluminum wire core of nearly solid density is estimated to be more than 20 kV/cm, while the value for gaseous aluminum of approximately 0.2% solid density decreases to 15-20 kV/cm. The breakdown field in shunting mode is less than 20 kV/cm and is strongly affected by the vaporized aluminum, the desorbed gas, and the electrons emitted from the wire core during the current pause. Ohmic heating during voltage collapses will induce further energy deposition in the current channel and thus will result in different expansion speeds for both the wire core and the shockwave front in the different modes.

  3. Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

    OpenAIRE

    N Hatefi Kargan

    2013-01-01

     In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference ...

  4. Magnetic skyrmion transistor: skyrmion motion in a voltage-gated nanotrack.

    Science.gov (United States)

    Zhang, Xichao; Zhou, Yan; Ezawa, Motohiko; Zhao, G P; Zhao, Weisheng

    2015-06-18

    Magnetic skyrmions are localized and topologically protected spin configurations, which are of both fundamental and applied interests for future electronics. In this work, we propose a voltage-gated skyrmion transistor within the well-established framework of micromagnetics. Its operating conditions and processes have been theoretically investigated and demonstrated, in which the gate voltage can be used to switch on/off a circuit. Our results provide the first time guidelines for practical realization of hybrid skyrmionic-electronic devices.

  5. Magnetic skyrmion transistor: skyrmion motion in a voltage-gated nanotrack

    Science.gov (United States)

    Zhang, Xichao; Zhou, Yan; Ezawa, Motohiko; Zhao, G. P.; Zhao, Weisheng

    2015-06-01

    Magnetic skyrmions are localized and topologically protected spin configurations, which are of both fundamental and applied interests for future electronics. In this work, we propose a voltage-gated skyrmion transistor within the well-established framework of micromagnetics. Its operating conditions and processes have been theoretically investigated and demonstrated, in which the gate voltage can be used to switch on/off a circuit. Our results provide the first time guidelines for practical realization of hybrid skyrmionic-electronic devices.

  6. Magnetic skyrmion transistor: skyrmion motion in a voltage-gated nanotrack

    Science.gov (United States)

    Zhang, Xichao; Zhou, Yan; Ezawa, Motohiko; Zhao, G. P.; Zhao, Weisheng

    2015-01-01

    Magnetic skyrmions are localized and topologically protected spin configurations, which are of both fundamental and applied interests for future electronics. In this work, we propose a voltage-gated skyrmion transistor within the well-established framework of micromagnetics. Its operating conditions and processes have been theoretically investigated and demonstrated, in which the gate voltage can be used to switch on/off a circuit. Our results provide the first time guidelines for practical realization of hybrid skyrmionic-electronic devices. PMID:26087287

  7. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  8. (ann) based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    artificial intelligence to provide smart triggering pulses for the DVR to mitigate and to provide compensation against voltage sags and swells. The Artificial Neural Network (ANN) was trained ... 90% of the nominal rms value and lasting for 0.5cycles. (10msec for 50Hz power system) up to 1 minute. It is considered as the most ...

  9. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  10. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  11. (SPWM) Voltage Source Inverter (VSI)

    African Journals Online (AJOL)

    The quest to achieve less-distorted dc-ac power conversion has resulted in the proliferation of many multilevel inverter configurations. This paper presents an experimental report of a simplified topology for single-phase, SPWM, three-level voltage source inverter wit R-L load. To keep the power circuit component count to a ...

  12. (ann) based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    artificial intelligence to provide smart triggering pulses for the DVR to mitigate and to provide compensation against ... the starting of large induction motor [6]. ... ANN-based DVR under voltage sags and swells phenomena. In this case, the ANN is trained off-line, and the trained network is employed for on-line control.

  13. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  14. Development of Electromechanical Architectures for AC Voltage Metrology

    Directory of Open Access Journals (Sweden)

    Alexandre BOUNOUH

    2010-12-01

    Full Text Available This paper presents results of work undertaken for exploring MEMS capabilities to fabricate AC voltage references for electrical metrology and high precision instrumentation through the mechanical-electrical coupling in MEMS. From first MEMS test structures previously realized, a second set of devices with improved characteristics has been developed and fabricated with Silicon on Insulator (SOI Surface Micromachining process. These MEMS exhibit pull-in voltages of 5 V and 10 V to match with the best performance of the read-out electronics developed for driving the MEMS. Deep Level Transient Spectroscopy measurements carried out on the new design show resonance frequencies of about only some kHz, and the stability of the MEMS output voltage measured at 100 kHz has been found very promising for the best samples where the relative deviation from the mean value over almost 12 hours showed a standard deviation of about 6.3 ppm.

  15. A dual voltage control strategy for single-phase PWM converters with power decoupling function

    DEFF Research Database (Denmark)

    Tang, Yi; Qin, Zian; Blaabjerg, Frede

    2015-01-01

    of the proposed system is presented, and a dual voltage control strategy is then proposed, which comprises one voltage loop implemented in the synchronous reference frame for active power balancing, and another one implemented in the stationary reference frame for ripple power compensation. Special attention......The inherent double line ripple power in single-phase systems is adverse to the performance of power electronics converters, e.g. limited lifetime due to the requirement of large electrolytic capacitors and low voltage control bandwidth due to harmonic disturbance. In this paper, an active...... is given to the bandwidth of voltage control loops because the variation of dc-link voltage should be kept within an acceptable range during load transients. This is particularly important for systems with reduced dc-link capacitance because they are of lower energy capacity and the dc-link voltage...

  16. High Voltage Power Supply With High Output Current and Low Power Consumption for Photomultiplier Tubes

    Science.gov (United States)

    Cunha, José Paulo V. S.; Begalli, Marcia; Bellar, Maria Dias

    2012-04-01

    In some applications, photomultiplier tubes (PMTs) are powered by battery based circuits, where the available energy is severely limited. The most simple approach to design high voltage power supplies (HVPS) for PMTs has considered resistive voltage dividers in order to bias the dynodes. However, this approach usually results in high power losses and, consequently, this undermines the PMT performance. In this work, the proposed solution is the use of a power circuit based on the forward converter connected to a transformer built with several secondary windings. Each secondary voltage is rectified and filtered to eliminate voltage ripple. Each dynode voltage is supplied by a rectified secondary voltage. The proposed topology provides low power consumption as well as low sensitivity of the PMT gain with respect to the dynode currents. Taking into account the Waste Electrical and Electronic Equipment Directive (WEEE), this HVPS has been designed to allow the recycling of old PMTs.

  17. Implementation of floating gate MOSFET in inverter for threshold voltage tunability

    Science.gov (United States)

    Musa, F. A. S.; Nurulain, D.; Ahmad, N.; Mohamad Isa, M.; Ramli, Muhammad M.

    2017-11-01

    This paper presents the ability of floating gate MOSFET (FGMOS) threshold voltage to be programmed or tuned which is exploited to improve the performance of electronic circuit design. This special characteristic owns by FGMOS is definitely contributes towards low voltage and low power circuit design. The comparison of threshold voltage between FGMOS and conventional NMOS is done in order to prove that FGMOS is able to produce a lower threshold voltage compared to conventional NMOS. In addition, in this paper, an implementation of FGMOS into inverter circuit is also done to show the programmability of FGMOS threshold voltage. The operations of the inverter circuits are verified using Sypnopsys simulation in 0.1μm CMOS technology with supply voltage of 1.8V.

  18. Implementation of floating gate MOSFET in inverter for threshold voltage tunability

    Directory of Open Access Journals (Sweden)

    Musa F.A.S.

    2017-01-01

    Full Text Available This paper presents the ability of floating gate MOSFET (FGMOS threshold voltage to be programmed or tuned which is exploited to improve the performance of electronic circuit design. This special characteristic owns by FGMOS is definitely contributes towards low voltage and low power circuit design. The comparison of threshold voltage between FGMOS and conventional NMOS is done in order to prove that FGMOS is able to produce a lower threshold voltage compared to conventional NMOS. In addition, in this paper, an implementation of FGMOS into inverter circuit is also done to show the programmability of FGMOS threshold voltage. The operations of the inverter circuits are verified using Sypnopsys simulation in 0.1μm CMOS technology with supply voltage of 1.8V.

  19. Otolithic apparatus of tetrapods after space flight

    Science.gov (United States)

    Lychakov, Dmitri

    In vertebrates the otolithic membrane is formed of three components: the gelatinous layer, the subcupular meshwork and the otolithic apparatus (Fermin et al., 1998; Lim, 1974; Lindeman, 1969; Lychakov, 1988, 2002). The otolithic apparatus consists of a set of small crystalline otoconia (Tetrapoda), or a single large crystalline otolith (Teleostei). Despite similar functions, the otoconia (Tetrapoda) and otolith otolithic apparatus differ significantly in their embryogenesis, postembryonic growth, chemical composition, etc. It may be suggested that the gravitational challenges may have different effects on otoconia or otoliths. Unfortunately, we have only a few quantitative data on structural adaptation of tetrapod otolithic apparatus to microgravity (Lychakov, 2002; Lychakov, Lavrova,1985; Wiederhold et al., 1997). The BION-M1 provides an opportunity for a quantitative morphological analysis of otolithic apparatus of adult mice exposed to 30 days in a biosatellite on orbit. We expect to analyse otoconia of utriculus and sacculus. Our principal aims are to investigate the morphological characteristics of otoconia. We expect to get novel insights in microgravity induced otoconia adaptation of tetrapods. This work was partly supported by Russian grant RFFI 14-04-00601.

  20. Research on Design and Simulation of Biaxial Tensile-Bending Complex Mechanical Performance Test Apparatus

    Directory of Open Access Journals (Sweden)

    Hailian Li

    2017-09-01

    Full Text Available In order to realize a micro-mechanic performance test of biaxial tensile-bending-combined loading and solve the problem of incompatibility of test apparatus and observation apparatus, novel biaxial-combined tensile-bending micro-mechanical performance test apparatus was designed. The working principle and major functions of key constituent parts of test apparatus, including the servo drive unit, clamping unit and test system, were introduced. Based on the finite element method, biaxial tensile and tension-bending-combined mechanical performances of the test-piece were studied as guidance to learn the distribution of elastic deformation and plastic deformation of all sites of the test-piece and to better plan test regions. Finally, this test apparatus was used to conduct a biaxial tensile test under different pre-bending loading and a tensile test at different rates; the image of the fracture of the test-piece was acquired by a scanning electron microscope and analyzed. It was indicated that as the pre-bending force rises, the elastic deformation phase would gradually shorten and the slope of the elastic deformation phase curve would slightly rise so that a yield limit would appear ahead of time. Bending speed could exert a positive and beneficial influence on tensile strength but weaken fracture elongation. If bending speed is appropriately raised, more ideal anti-tensile strength could be obtained, but fracture elongation would decline.

  1. Electrons in silicon microstructures.

    Science.gov (United States)

    Howard, R E; Jackel, L D; Mankiewich, P M; Skocpol, W J

    1986-01-24

    Silicon microstructures only a few hundred atoms wide can be fabricated and used to study electron transport in narrow channels. Spatially localized voltage probes as close together as 0.1 micrometer can be used to investigate a variety of physical phenomena, including velocity saturation due to phonon emission, the local potentials caused by scattering from a single trapped electron, and quantum tunneling or hopping among very few electron states.

  2. Introduction to electronics

    CERN Document Server

    Korneff, Theodore

    1966-01-01

    Introduction to Electronics focuses on the study of electronics and electronic devices. Composed of 14 chapters, the book starts with discussions on dc circuits, including resistance, voltmeter, ammeter, galvanometer, internal resistance, and positive and negative currents. This topic is followed by discussions on ac circuits, particularly addressing voltage and current, average power, resistive load, complex plane, and parallel circuits. Discussions also focus on filters and tuned circuits, diodes, and power supplies. Particularly given attention are the processes, diagrams, and analyses

  3. New device to adjust on load the voltage level at power transformers

    Energy Technology Data Exchange (ETDEWEB)

    Plesca, A. [Gh. Asachi Technical Univ. of Iasi, Iasi (Romania); Licau, M. [SCEONSA, Iasi (Romania)

    2007-07-01

    This paper described a new device designed to provide online step voltage regulation and continuous voltage adjustment. The variable inductance system was built using 2 identical toroidal magnetic cores a single controlled winding designed using a magnetic amplifier principle with a rated power of 800 Va, 2 primary windings, a controlled winding, and a magnetic circuit. A digital relay was used to provide control signals for the driver circuits of power electronic switches and to provide variable inductive reactance. A power unit was designed to control voltage levels for the solid-state switches. The prototype was mounted into a cabinet and provided with power circuits for step voltage adjustment and current transformers. Test conducted with variable resistive loads demonstrated that the device added step voltages in order to maintain voltage levels within admissible limits when secondary voltage forms were lowered. Voltage levels were reduced when the maximum voltage threshold was reached. Waveforms recorded during the tests showed that the new device restored output voltage between admissible limits in less than 200 milliseconds. It was concluded that the device's modular construction will provide greater installation flexibility. 15 refs., 5 figs.

  4. High-voltage discharge in supersonic jet of plumbum vapor

    Science.gov (United States)

    Amirov, R. Kh; Antonov, N. N.; Liziakin, G. D.; Polistchook, V. P.; Samoylov, I. S.; Usmanov, R. A.; Yartsev, I. M.

    2015-11-01

    During study of vacuum discharge in plumbum evaporating from molybdenum crucible in identical geometry of discharge gap and the same crucible temperature existence of two different discharge forms were observed. These two forms are vacuum arc with current above 10 A and voltage about 15 V and high-voltage discharge with current about 10 mA and voltage of 340 V. Plumbum was placed in heat-isolated crucible (cathode). Electron-beam heater was situated under the crucible. At the temperature of 1.25 kK that corresponds to plumbum saturated vapor pressure about 0.1 kPa voltage from power source (380 V, 200 A) was applied to anode and high-voltage discharge initiated with characteristics mentioned above. After a few seconds this discharge could turn into arc or could exist hundreds of seconds until total plumbum evaporation. Glow of discharge could take the form of a cone, harness or plasma bunch that hanged at the appreciable distance from the electrodes. The estimations of plasma parameters are presented.

  5. Method and apparatus for combinatorial chemistry

    Science.gov (United States)

    Foote, Robert S [Oak Ridge, TN

    2012-06-05

    A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

  6. Apparatus for isotopic alteration of mercury vapor

    Science.gov (United States)

    Grossman, Mark W.; George, William A.; Marcucci, Rudolph V.

    1988-01-01

    An apparatus for enriching the isotopic Hg content of mercury is provided. The apparatus includes a reactor, a low pressure electric discharge lamp containing a fill including mercury and an inert gas. A filter is arranged concentrically around the lamp. In a preferred embodiment, constant mercury pressure is maintained in the filter by means of a water-cooled tube that depends from it, the tube having a drop of mercury disposed in it. The reactor is arranged around the filter, whereby radiation from said lamp passes through the filter and into said reactor. The lamp, the filter and the reactor are formed of a material which is transparent to ultraviolet light.

  7. Continuous air monitor filter changeout apparatus

    Science.gov (United States)

    Rodgers, John C [Santa Fe, NM

    2008-07-15

    An apparatus and corresponding method for automatically changing out a filter cartridge in a continuous air monitor. The apparatus includes: a first container sized to hold filter cartridge replacements; a second container sized to hold used filter cartridges; a transport insert connectively attached to the first and second containers; a shuttle block, sized to hold the filter cartridges that is located within the transport insert; a transport driver mechanism means used to supply a motive force to move the shuttle block within the transport insert; and, a control means for operating the transport driver mechanism.

  8. Method and apparatus for testing microfilaments

    Science.gov (United States)

    Schleitweiler, Patrick M.; Merten, Jr., Charles W.

    1995-08-01

    A method and apparatus are disclosed for testing tensile strength of microfilaments. Fibers as small as 0.001 inch in diameter and 0.04 inches in length have been tested, although the method and apparatus of the invention are capable of testing fibers of smaller diameter and length. The invention utilizes a method wherein one or both ends of a microfilament is gripped using resin which is softened sufficiently to accept an end of the microfilament and then allowed to harden. The invention also employs the use of a translation stage capable of controlled three-dimensional movement suited to facilitating gripping of the microfilament.

  9. Hyperabsorption space conditioning process and apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Macriss, R. A.; Zawacki, T. S.

    1984-12-11

    A high efficiency space conditioning process and apparatus for heating and cooling utilizing an absorption cycle in the nature of absorption heat pumps for heating and cooling. The invention provides a process and apparatus having a higher Coefficient of Performance than conventional absorption heat pumps by utilization of a substantially saturated salt solution cycle between at least one pair of:(1) an absorber and generator, or (2) a condenser and evaporator, wherein the salt is crystallized to the solid phase in the generator or evaporator, respectively, and the heat of crystallization is utilized for refrigerant vaporization occurring simultaneously.

  10. Apparatus for extracting and sequestering carbon dioxide

    Science.gov (United States)

    Rau, Gregory H [Castro Valley, CA; Caldeira, Kenneth G [Livermore, CA

    2010-02-02

    An apparatus and method associated therewith to extract and sequester carbon dioxide (CO.sub.2) from a stream or volume of gas wherein said apparatus hydrates CO.sub.2 and reacts the resulting carbonic acid with carbonate. Suitable carbonates include, but are not limited to, carbonates of alkali metals and alkaline earth metals, preferably carbonates of calcium and magnesium. Waste products are metal cations and bicarbonate in solution or dehydrated metal salts, which when disposed of in a large body of water provide an effective way of sequestering CO.sub.2 from a gaseous environment.

  11. Current–voltage characteristics of manganite–titanite perovskite junctions

    Directory of Open Access Journals (Sweden)

    Benedikt Ifland

    2015-07-01

    Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

  12. Method and apparatus for measuring purity of noble gases

    Science.gov (United States)

    Austin, Robert

    2008-04-01

    A device for detecting impurities in a noble gas includes a detection chamber and a source of pulsed ultraviolet light. The pulse of the ultraviolet light is transferred into the detection chamber and onto a photocathode, thereby emitting a cloud of free electrons into the noble gas within the detection chamber. The cloud of electrons is attracted to the opposite end of the detection chamber by a high positive voltage potential at that end and focused onto a sensing anode. If there are impurities in the noble gas, some or all of the electrons within the cloud will bond with the impurity molecules and not reach the sensing anode. Therefore, measuring a lower signal at the sensing anode indicates a higher level of impurities while sensing a higher signal indicates fewer impurities. Impurities in the range of one part per billion can be measured by this device.

  13. Method and apparatus for remote sensing of molecular species at nanoscale utilizing a reverse photoacoustic effect

    Science.gov (United States)

    Su, Ming [Oviedo, FL; Thundat, Thomas G [Knoxville, TN; Hedden, David [Lenoir City, TN

    2010-02-23

    A method and apparatus for identifying a sample, involves illuminating the sample with light of varying wavelengths, transmitting an acoustic signal against the sample from one portion and receiving a resulting acoustic signal on another portion, detecting a change of phase in the acoustic signal corresponding to the light of varying wavelengths, and analyzing the change of phase in the acoustic signal for the varying wavelengths of illumination to identify the sample. The apparatus has a controlled source for illuminating the sample with light of varying wavelengths, a transmitter for transmitting an acoustic wave, a receiver for receiving the acoustic wave and converting the acoustic wave to an electronic signal, and an electronic circuit for detecting a change of phase in the acoustic wave corresponding to respective ones of the varying wavelengths and outputting the change of phase for the varying wavelengths to allow identification of the sample. The method and apparatus can be used to detect chemical composition or visual features. A transmission mode and a reflection mode of operation are disclosed. The method and apparatus can be applied at nanoscale to detect molecules in a biological sample.

  14. TRANSISTOR HIGH VOLTAGE POWER SUPPLY

    Science.gov (United States)

    Driver, G.E.

    1958-07-15

    High voltage, direct current power supplies are described for use with battery powered nuclear detection equipment. The particular advantages of the power supply described, are increased efficiency and reduced size and welght brought about by the use of transistors in the circuit. An important feature resides tn the employment of a pair of transistors in an alternatefiring oscillator circuit having a coupling transformer and other circuit components which are used for interconnecting the various electrodes of the transistors.

  15. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  16. VOLTAGE REGULATORS OF SYNCHRONOUS GENERATORS

    OpenAIRE

    Grigorash O. V.; Korzenkov P. G.; Popuchieva M. A.

    2015-01-01

    Synchronous generators are the primary source of electrical power autonomous electrosupply systems, including backup systems. They are also used in a structure of rotating electricity converters and are widely used in renewable energy as part of wind power plants of small, mini and micro hydroelectric plants. Increasing the speed and the accuracy of the system of the voltage regulation of synchronous generators is possible due to the development of combined systems containing more stabilizers...

  17. Current-voltage characteristics of quantum-point contacts in the closed-channel regime: Transforming the bias voltage into an energy scale

    DEFF Research Database (Denmark)

    Gloos, K.; Utko, P.; Aagesen, M.

    2006-01-01

    We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our...... analysis is based on a single scaling factor, extracted from the experimental I(V) characteristics. For both polarities, this scaling factor transforms the change of bias voltage into a change of electron energy. The latter is determined with respect to the top of the potential barrier of the contact...

  18. Biased low differential input impedance current receiver/converter device and method for low noise readout from voltage-controlled detectors

    Science.gov (United States)

    Degtiarenko, Pavel V [Williamsburg, VA; Popov, Vladimir E [Newport News, VA

    2011-03-22

    A first stage electronic system for receiving charge or current from voltage-controlled sensors or detectors that includes a low input impedance current receiver/converter device (for example, a transimpedance amplifier), which is directly coupled to the sensor output, a source of bias voltage, and the device's power supply (or supplies), which use the biased voltage point as a baseline.

  19. High-voltage plasma interactions calculations using NASCAP/LEO

    Science.gov (United States)

    Mandell, M. J.; Katz, I.

    1990-01-01

    This paper reviews four previous simulations (two laboratory and two space-flight) of interactions of a high-voltage spacecraft with a plasma under low-earth orbit conditions, performed using a three-dimensional computer code NASCAP/LEO. Results show that NASCAP/LEO can perform meaningful simulations of high-voltage plasma interactions taking into account three-dimensional effects of geometry, spacecraft motion, and magnetic field. Two new calculations are presented: (1) for current collection by 1-mm pinholes in wires (showing that a pinhole in a wire can collect far more current than a similar pinhole in a flat plate); and (2) current collection by Charge-2 mother vehicle launched in December 1985. It is shown that the Charge-2 calculations predicted successfully ion collection at negative bias, the floating potential of a probe outside or inside the sheath under negative bias conditions, and magnetically limited electron collection under electron beam operation at high altitude.

  20. Methods and apparatus for handling or treating particulate material

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2009-01-01

    An improved draft tube spout fluid bed (DTSFB) mixing, handling, conveying, and treating apparatus and systems, and methods for operating are provided. The apparatus and systems can accept particulate material and pneumatically or hydraulically conveying the material to mix and/or treat the material. In addition to conveying apparatus, a collection and separation apparatus adapted to receive the conveyed particulate material is also provided. The collection apparatus may include an impaction plate against which the conveyed material is directed to improve mixing and/or treatment. The improved apparatus are characterized by means of controlling the operation of the pneumatic or hydraulic transfer to enhance the mixing and/or reacting by controlling the flow of fluids, for example, air, into and out of the apparatus. The disclosed apparatus may be used to mix particulate material, for example, mortar; react fluids with particulate material; coat particulate material, or simply convey particulate material.

  1. A wiggler magnet for FEL low voltage operation

    Energy Technology Data Exchange (ETDEWEB)

    Al-Shamma`a, A.; Stuart, R.A.; Lucas, J.

    1995-12-31

    In low voltage FELs (ie, 200kV), operation is necessarily in the microwave frequency range for wiggler periods of the order of cms., so that a waveguide system is mandatory. Also, because of the relatively low velocity of the electron beam, the wiggle amplitude of the electron beam can be much larger than is normal for highly relativistic FELs. Both these factors mean that the electron trajectory must be carefully controlled to avoid beam collision with the waveguide walls. A wiggler system with half poles at entrance and exit is not an acceptable solution because of the offset is gives rise to the electron trajectory. Consequently, we have designed and constructed a wiggler magnet with exponential entrance and exit tapers for a minimal deflection and displacement of the electron beam. Simulations and experimental measurements showed that an on axis trajectory is easily obtainable.

  2. Method and apparatus for assembling battery components

    Energy Technology Data Exchange (ETDEWEB)

    Sabatino, A.; Romanchuk, R. N.; Schaumburg, E. G.; Stanefski, E. F.

    1985-04-09

    A method and apparatus for assembling battery components including a battery case having a plurality of divider walls defining a plurality of side-by-side cell spaces opening through a top portion of the case. A plurality of intermediate cell elements are provided in the cell spaces intermediate the end cell spaces and end cell elements having terminal post portions are inserted in the end cell spaces. The apparatus effects an automatic pickup of the cell elements at one or more insert stations from delivery conveyors suitably positions the picked-up cell elements for proper polarity relationship in the inserted disposition within the battery case, and after moving the picked-up cell elements to overlying relationship with the battery case, inserts the cell elements automatically into the proper cell spaces. Control of delivery of the battery cases to the respective insert positions is effected and coordinated with the delivery of the necessary cell elements from apparatus for preforming the cell elements. Apparatus is provided for accurately spacing the end cell elements upon delivery thereof to the pickup position. The pickup structure includes finger devices arranged to engage plate connecting straps provided on the cell elements in effecting positive pickup, transfer and insertion thereof.

  3. Filter apparatus for actively reducing noise

    NARCIS (Netherlands)

    Berkhoff, Arthur P.; Nijsse, G.

    2010-01-01

    A filter apparatus for reducing noise from a primary noise source, comprising a secondary source signal connector for generating secondary noise to reduce said primary noise and a sensor connector for connecting to a sensor for measuring said primary and secondary noise as an error signal. A first

  4. A filter apparatus for actively reducing noise

    NARCIS (Netherlands)

    Berkhoff, Arthur P.; Nijsse, G.

    2006-01-01

    A filter apparatus for reducing noise from a primary noise source, comprising a secondary source signal connector for generating secondary noise to reduce said primary noise and a sensor connector for connecting to a sensor for measuring said primary and secondary noise as an error signal. A first

  5. The Compartmental Organization of the Golgi Apparatus.

    Science.gov (United States)

    Rothman, James E.

    1985-01-01

    Relations between structure and function of the Golgi apparatus are emerging from recent laboratory work on this cellular organelle which modifies proteins, sorts them, and packages them for delivery. The structure's three specialized compartments are explained through discussions of the glycosylation pathway, density-gradient experiments,…

  6. 47 CFR 32.2311 - Station apparatus.

    Science.gov (United States)

    2010-10-01

    ... (excluding mobile), installed for customer's use. Items included in this account shall remain herein until... 47 Telecommunication 2 2010-10-01 2010-10-01 false Station apparatus. 32.2311 Section 32.2311 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES UNIFORM SYSTEM OF ACCOUNTS...

  7. Process and apparatus for conversion of biomass

    NARCIS (Netherlands)

    Bakker, R.R.C.; Hazewinkel, J.H.O.; Groenestijn, van J.W.

    2006-01-01

    The invention is directed to a process for the conversion of biomass, in particular lignocellulose-containing biomass into a product that may be further processes in a fermentation step. The invention is further directed to apparatus suitable for carrying out such processes. According to the

  8. Process and apparatus for conversion of biomass

    NARCIS (Netherlands)

    Bakker, R.R.C.; Hazewinkel, J.H.O.; Groenestijn, van J.W.

    2006-01-01

    The invention is directed to a process for the conversion of cellulosic biomass, in particular lignocellulose-containing biomass into fermentable sugars. The invention is further directed to apparatus suitable for carrying out such processes. According to the invention biomass is converted into

  9. Apparatus and method of navigating an instrument

    NARCIS (Netherlands)

    Bakker, N.H.; Den Heeten, G.J.

    2004-01-01

    An apparatus to be used with navigating an instrument in a vascular tree of a patient, comprises a patient's examination table, a C-arm, mounted to which is an X-ray source and an image recorder for registering first X-ray images of the patient, obtained by the use of the X-ray source, and a

  10. Method and apparatus for calibrating spectrophotometers

    NARCIS (Netherlands)

    Schreutelkamp, F.H.

    2003-01-01

    The present invention relates to a method of calibrating spectrophotometers by placing one or more filters in the light path of the spectrophotometer and measuring the amount of radiation by means of a detector. The present invention furthermore relates to an apparatus to be used with such a method.

  11. Apparatus for performing oil field laser operations

    Science.gov (United States)

    Zediker, Mark S.; Land, Mark S.; Rinzler, Charles C.; Faircloth, Brian O.; Koblick, Yeshaya; Moxley, Joel F.

    2017-01-03

    A system, apparatus and methods for delivering high power laser energy to perform laser operations in oil fields and to form a borehole deep into the earth using laser energy. A laser downhole assembly for the delivery of high power laser energy to surfaces and areas in a borehole, which assembly may have laser optics and a fluid path.

  12. Method and apparatus for desuperheating refrigerant

    Energy Technology Data Exchange (ETDEWEB)

    Zess, James A. (Kelso, WA); Drost, M. Kevin (Richland, WA); Call, Charles J. (Richland, WA)

    1997-01-01

    The present invention is an apparatus and method for de-superheating a primary refrigerant leaving a compressor wherein a secondary refrigerant is used between the primary refrigerant to be de-superheated. Reject heat is advantageously used for heat reclaim.

  13. Kinematic X-Ray Analysis Apparatus

    NARCIS (Netherlands)

    Koningsberger, D.C.; Brinkgreve, P.

    1983-01-01

    In an X-ray analysis apparatus, a moving mechanism is provided by a main guide member along which a main slide device can be displaced. Rotatably connected with the main slide device is a detector guide member along which a detection slide device is displaced. The main slide device, as well as the

  14. VOLTAGE COMPENSATION USING ARTIFICIAL NEURAL NETWORK

    African Journals Online (AJOL)

    A study of hourly voltage log taken over a period of six months from Rumuola Distribution network Port Harcourt, Rivers State indicates that power quality problems prevalent in the Network are undervoltage/voltage sags and overvoltage/voltage swells. This paper aims at addressing these power quality problems in the ...

  15. 49 CFR 234.221 - Lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  16. Flash X-Ray (FXR) Accelerator Optimization - Beam-induced Voltage Simulation and TDR Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Ong, M M; Vogtlin, G E

    2004-04-07

    Lawrence Livermore National Laboratory (LLNL) is evaluating design alternatives to improve the voltage regulation in our Flash X-Ray (FXR) accelerator cell and pulse-power system. The goal is to create a more mono-energetic electron beam that will create an x-ray source with a smaller spot-size. Studying the interaction of the beam and accelerator cell will generate improved designs for high-current accelerators at Livermore and elsewhere. When an electron beam crosses the energized gap of an accelerator cell, the electron energy is increased. However, the beam with the associated electromagnetic wave also looses a small amount of energy because of the increased impedance seen across the gap. The phenomenon is sometimes called beam loading. It can also be described as a beam-induced voltage at the gap which is time varying. This creates beam energy variations that we need to understand and control. A high-fidelity computer simulation of the beam and cell interaction has been completed to quantify the time varying induced voltage at the gap. The cell and pulse-power system was characterized using a Time-domain Reflectometry (TDR) measurement technique with a coaxial air-line to drive the cell gap. The beam-induced cell voltage is computed by convoluting the cell impedance with measured beam current. The voltage was checked against other measurements to validate the accuracy. The simulation results predicted that there are significant beam-induced gap voltage variations. Beam-induced voltages from different current profiles and cell impedances were simulated and compared. This allows us to predict the effect on voltage regulation for different design alternatives before making hardware changes and high-voltage testing. The beam-induced voltages are incorporated into a larger accelerator system-model to quantify their effect on total beam energy variations.

  17. Substrate bias voltage and deposition temperature dependence on ...

    Indian Academy of Sciences (India)

    employed as the sputter target and rf matching was controlled to fix the power. Argon gas of 99·99% purity was used ... SUPRA40 field-emission gun scanning electron microscope with an acceleratized voltage of 5 kV and a ... ing dimension of 0·04 radians was used to control the diver- gence in axial plane. For line focusing ...

  18. Parametric dependence of ion temperature and electron density in the SUMMA hot-ion plasma using laser light scattering and emission spectroscopy

    Science.gov (United States)

    Snyder, A.; Patch, R. W.; Lauver, M. R.

    1980-01-01

    Hot-ion plasma experiments were conducted in the NASA Lewis SUMMA facility. A steady-state modified Penning discharge was formed by applying a radially inward dc electric field of several kilovolts near the magnetic mirror maxima. Results are reported for a hydrogen plasma covering a wide range in midplane magnetic flux densities from 0.5 to 3.37 T. Input power greater than 45 kW was obtained with water-cooled cathodes. Steady-state plasmas with ion kinetic temperatures from 18 to 830 eV were produced and measured spectroscopically. These ion temperatures were correlated with current, voltage, and magnetic flux density as the independent variables. Electron density measurements were made using an unusually sensitive Thomson scattering apparatus. The measured electron densities range from 2.1 x 10 to the 11th to 6.8 x 10 to the 12th per cu cm.

  19. Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

    Directory of Open Access Journals (Sweden)

    N Hatefi Kargan

    2013-09-01

    Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

  20. An extraordinary tabletop speed of light apparatus

    Science.gov (United States)

    Pegna, Guido

    2017-09-01

    A compact, low-cost, pre-aligned apparatus of the modulation type is described. The apparatus allows accurate determination of the speed of light in free propagation with an accuracy on the order of one part in 104. Due to the 433.92 MHz radio frequency (rf) modulation of its laser diode, determination of the speed of light is possible within a sub-meter measuring base and in small volumes (some cm3) of transparent solids or liquids. No oscilloscope is necessary, while the required function generators, power supplies, and optical components are incorporated into the design of the apparatus and its receiver can slide along the optical bench while maintaining alignment with the laser beam. Measurement of the velocity factor of coaxial cables is also easily performed. The apparatus detects the phase difference between the rf modulation of the laser diode by further modulating the rf signal with an audio frequency signal; the phase difference between these signals is then observed as the loudness of the audio signal. In this way, the positions at which the minima of the audio signal are found determine where the rf signals are completely out of phase. This phase detection method yields a much increased sensitivity with respect to the display of coincidence of two signals of questionable arrival time and somewhat distorted shape on an oscilloscope. The displaying technique is also particularly suitable for large audiences as well as in unattended exhibits in museums and science centers. In addition, the apparatus can be set up in less than one minute.

  1. 21 CFR 870.5050 - Patient care suction apparatus.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Patient care suction apparatus. 870.5050 Section 870.5050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... suction apparatus. (a) Identification. A patient care suction apparatus is a device used with an...

  2. Diffusion voltage in polymer light emitting diodes measured with electric field induced second harmonic generation

    Energy Technology Data Exchange (ETDEWEB)

    Kristensen, P.K.; Rafaelsen, J.; Pedersen, T.G.; Pedersen, K. [Department of Physics and Nanotechnology, Aalborg University, Pontoppidanstraede 103, 9220 Aalborg East (Denmark)

    2005-12-01

    We apply electric field induced second harmonic (EFISH) to polymer light emitting diodes (PLEDs) and demonstrate the ability to determine the diffusion voltage in PLED devices. The EFISH signal is proportional to the square of the effective field, which is the sum of the diffusion voltage and the applied voltage. By minimizing the EFISH-signal as a function of the applied voltage, the diffusion voltage is determined by measuring the applied voltage that cancels out the diffusion voltage. The PLEDs are fabricated with indium tin oxide (ITO) as the hole injecting contact and two different electron injecting contacts, namely aluminum and calcium. The diffusion voltage originates from the rearranged charges caused by the difference in Fermi levels in the materials in the PLEDs. Different contacts will thus cause different diffusion voltages. We demonstrate here that the EFISH signal is proportional to the square of the effective field in both reverse and forward bias, and discuss the dependence on contact materials. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  3. Design of a pulsewidth-modulated resonant converter for a high-output-voltage power supply

    Science.gov (United States)

    Turnbull, Fred G.; Tompkins, Russell E.

    1987-12-01

    The design and fabrication of a parallel resonant converter circuit and a high-frequency step-up transformer used to supply an adjustable dc voltage to a load is described. The 500-W system is operated from 115/230 V single-phase 60Hz power, which is rectified and filtered to form a 310-V dc link. A two-transistor half-bridge circuit operating at a fixed frequency above the ciruits resonant frequency converts the dc voltage to an ac voltage at approximately 20 kHx. This high-frequency voltage is transformed with a low-capacitance oil-impregnated ferrite transformer. The output voltage is rectified to form a dc voltage with a maximum value of 90-kV peak. The output voltage is adjustable using pulsewidth modulation of the conduction time of the two transistors in the power circuit. The energy stored in the resonant circuit provides a sinusoidal transformer voltage at fixed frequency over a wide range of control. The system is provided with a closed-loop peak-voltage regulator and an on-off capability from the control electronics. The transformer is designed for a specific value of inductance and capacitance to operate at the desired resonant frequency and characteristic impedance.

  4. Fluctuation of average position of electrons in Coulomb island in Si single-electron transistor

    Energy Technology Data Exchange (ETDEWEB)

    Horiguchi, Seiji, E-mail: seijih@ipc.akita-u.ac.jp [Graduate School of Engineering and Resource Sciense, Akita University, 1-1 Tegata-gakuen-machi, Akita-shi, Akita, 010-8502 Japan (Japan); Fujiwara, Akira [NTT Basic Research Laboratories, NTT Corporation, 3-1 Morinosato Wakamiya, Atsugi, Kanagawa, 243-0198 Japan (Japan)

    2012-02-01

    Average position of electrons along thickness direction in a Coulomb island in an n-channel Si single-electron transistor is estimated by analyzing the back-gate voltage dependence of peak voltage (defined as the gate voltage giving a drain current peak) as a function of peak number. It is found that the accuracy of estimated average position is better than 0.5 nm and that the average position fluctuates as the peak number increases.

  5. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    Science.gov (United States)

    2011-11-15

    ... Energy Regulatory Commission Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011 from 9 a.m. to 4:30 p.m. This staff-led workshop will be held...

  6. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    Science.gov (United States)

    2011-11-22

    ... Energy Regulatory Commission Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop... between voltage control, reliability, and economic dispatch. In addition, the Commission will consider how improvements to dispatch and voltage control software could improve reliability and market efficiency. This...

  7. Reluctance apparatus for flywheel energy storage

    Energy Technology Data Exchange (ETDEWEB)

    Hull, John R. (Downers Grove, IL)

    2000-01-01

    A motor generator for providing high efficiency, controlled voltage output or storage of energy in a flywheel system. A motor generator includes a stator of a soft ferromagnetic material, a motor coil and a generator coil, and a rotor has at least one embedded soft ferromagnetic piece. Control of voltage output is achieved by use of multiple stator pieces and multiple rotors with controllable gaps between the stator pieces and the soft ferromagnetic piece.

  8. Improving transition voltage spectroscopy of molecular junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...... is approximately half the voltage required to see a peak in the dI/dV curve. Information about the molecular level position can thus be obtained at relatively low voltages. In this work we show that the molecular level position can be determined at even lower voltages, Vmin(α), by finding the minimum of ln...

  9. A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level

    DEFF Research Database (Denmark)

    Newman, M.J.; Holmes, D.G.; Nielsen, J.G.

    2005-01-01

    Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... voltage harmonic compensation capabilities with minimal effect on the sag compensation performance of the basic DVR. The proposed controller has been experimentally verified on a medium-voltage (10 kV) three-phase DVR prototype under a range of conditions, including distorted supply voltages, nonlinear...... loads, and operation during distorted voltage sags....

  10. Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

    Science.gov (United States)

    Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

    2017-10-23

    The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

  11. Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

    Science.gov (United States)

    Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

    2014-11-01

    The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

  12. Spacecraft-generated plasma interaction with high voltage solar array

    Science.gov (United States)

    Parks, D. E.; Katz, I.

    1978-01-01

    Calculations are made of the effect of interactions of spacecraft-generated plasmas and high voltage solar array components on an advanced Solar Electric Propulsion system. The plasma consists of mercury ions and electrons resulting from the operation of ion thrusters and associated hollow cathode neutralizers. Because large areas of the solar array are at high potential and not completely insulated from the surrounding plasma, the array can, under some conditions, collect excessive electron currents. Results are given for the parasitic currents collected by the solar arrays and means for reducing these currents are considered.

  13. Low power, scalable multichannel high voltage controller

    Science.gov (United States)

    Stamps, James Frederick [Livermore, CA; Crocker, Robert Ward [Fremont, CA; Yee, Daniel Dadwa [Dublin, CA; Dils, David Wright [Fort Worth, TX

    2008-03-25

    A low voltage control circuit is provided for individually controlling high voltage power provided over bus lines to a multitude of interconnected loads. An example of a load is a drive for capillary channels in a microfluidic system. Control is distributed from a central high voltage circuit, rather than using a number of large expensive central high voltage circuits to enable reducing circuit size and cost. Voltage is distributed to each individual load and controlled using a number of high voltage controller channel switches connected to high voltage bus lines. The channel switches each include complementary pull up and pull down photo isolator relays with photo isolator switching controlled from the central high voltage circuit to provide a desired bus line voltage. Switching of the photo isolator relays is further controlled in each channel switch using feedback from a resistor divider circuit to maintain the bus voltage swing within desired limits. Current sensing is provided using a switched resistive load in each channel switch, with switching of the resistive loads controlled from the central high voltage circuit.

  14. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    OpenAIRE

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia; Han, Xue

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis. The load profiles are characterized by using single phase measurement data on voltages, currents and active powers with a 10 minutes resolution. Different scenarios are considered: no tap action, th...

  15. Analysis of ride through capability of fluorescent lamps during voltage sags

    Energy Technology Data Exchange (ETDEWEB)

    Shareef, H.; Mohamed, A.; Marzuki, N. [Kebangsaan Malaysia Univ., Selangor (Malaysia). Dept. of Electrical, Electronic and Systems Engineering, Faculty of Engineering and Built Environment

    2009-03-11

    A comparative analysis of the sensitivity to voltage sags of various low-wattage fluorescent lamps (FL) used in commercial and residential lighting applications was presented. A power corrupter and advanced photometer were used to conduct the tests on three 18 watt FLs with different ballasts. Sag depth and duration were varied in order to develop voltage immunity curves for a predefined malfunction criterion of 0 illuminance. The study showed that ballast technologies play a significant role in voltage sag event ride-through. Lamps with electromagnetic ballasts were more sensitive to voltage sags than lamps equipped with electronic ballasts. The study also demonstrated that the voltage immunity levels of the compact fluorescent lamps (CFLs) with electromagnetic ballasts did not meet ITIC and SEMI F47 standards. 12 refs., 1 tab., 10 figs.

  16. Simulation and resolution of voltage reversal in microbial fuel cell stack.

    Science.gov (United States)

    Sugnaux, Marc; Savy, Cyrille; Cachelin, Christian Pierre; Hugenin, Gérald; Fischer, Fabian

    2017-08-01

    To understand the biotic and non-biotic contributions of voltage reversals in microbial fuel cell stacks (MFC) they were simulated with an electronic MFC-Stack mimic. The simulation was then compared with results from a real 3L triple MFC-Stack with shared anolyte. It showed that voltage reversals originate from the variability of biofilms, but also the external load plays a role. When similar biofilm properties were created on all anodes the likelihood of voltage reversals was largely reduced. Homogenous biofilms on all anodes were created by electrical circuit alternation and electrostimulation. Conversely, anolyte recirculation, or increased nutriment supply, postponed reversals and unfavourable voltage asymmetries on anodes persisted. In conclusion, voltage reversals are often a negative event but occur also in close to best MFC-Stack performance. They were manageable and this with a simplified MFC architecture in which multiple anodes share the same anolyte. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Breakdown voltage reduction by field emission in multi-walled carbon nanotubes based ionization gas sensor

    Science.gov (United States)

    Saheed, M. Shuaib M.; Muti Mohamed, Norani; Arif Burhanudin, Zainal

    2014-03-01

    Ionization gas sensors using vertically aligned multi-wall carbon nanotubes (MWCNT) are demonstrated. The sharp tips of the nanotubes generate large non-uniform electric fields at relatively low applied voltage. The enhancement of the electric field results in field emission of electrons that dominates the breakdown mechanism in gas sensor with gap spacing below 14 μm. More than 90% reduction in breakdown voltage is observed for sensors with MWCNT and 7 μm gap spacing. Transition of breakdown mechanism, dominated by avalanche electrons to field emission electrons, as decreasing gap spacing is also observed and discussed.

  18. Complementary circuits based on solution processed low-voltage organic field-effect transistors

    NARCIS (Netherlands)

    Ball, James M.; Wöbkenberg, Paul H.; Kooistra, Floris B.; Hummelen, Jan C.; Leeuw, Dago M. de; Bradley, Donal D.C.; Anthopoulos, Thomas D.

    2009-01-01

    The field of organic electronics is advancing quickly towards ultra low-cost, low-end applications and is expected to provide the necessary technology required for flexible/printed electronics. Here we address the need for solution processed low-voltage complementary logic in order to reduce power

  19. 49 CFR 236.551 - Power supply voltage; requirement.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Power supply voltage; requirement. 236.551 Section... supply voltage; requirement. The voltage of power supply shall be maintained within 10 percent of rated voltage. ...

  20. Transmission electron microscope CCD camera

    Science.gov (United States)

    Downing, Kenneth H.

    1999-01-01

    In order to improve the performance of a CCD camera on a high voltage electron microscope, an electron decelerator is inserted between the microscope column and the CCD. This arrangement optimizes the interaction of the electron beam with the scintillator of the CCD camera while retaining optimization of the microscope optics and of the interaction of the beam with the specimen. Changing the electron beam energy between the specimen and camera allows both to be optimized.

  1. Temperature and voltage measurement in quantum systems far from equilibrium

    Science.gov (United States)

    Shastry, Abhay; Stafford, Charles A.

    2016-10-01

    We show that a local measurement of temperature and voltage for a quantum system in steady state, arbitrarily far from equilibrium, with arbitrary interactions within the system, is unique when it exists. This is interpreted as a consequence of the second law of thermodynamics. We further derive a necessary and sufficient condition for the existence of a solution. In this regard, we find that a positive temperature solution exists whenever there is no net population inversion. However, when there is a net population inversion, we may characterize the system with a unique negative temperature. Voltage and temperature measurements are treated on an equal footing: They are simultaneously measured in a noninvasive manner, via a weakly coupled thermoelectric probe, defined by requiring vanishing charge and heat dissipation into the probe. Our results strongly suggest that a local temperature measurement without a simultaneous local voltage measurement, or vice versa, is a misleading characterization of the state of a nonequilibrium quantum electron system. These results provide a firm mathematical foundation for voltage and temperature measurements far from equilibrium.

  2. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.

    1995-03-01

    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  3. Electron Beam Materials Processing

    Science.gov (United States)

    Powers, Donald E.

    2012-06-01

    In electron beam processing, a well-defined beam of relatively energetic electrons produced by a high voltage acceleration gap is used to transmit thermal energy into a material in a precise manner. This controlled deposition of heat is employed in a wide variety of industrial applications for precision cutting, drilling, and welding of materials as well as annealing, glazing, and surface hardening. This chapter will describe the equipment used and the most prominent industrial applications for this process.

  4. Power electronics substrate for direct substrate cooling

    Science.gov (United States)

    Le, Khiet [Mission Viejo, CA; Ward, Terence G [Redondo Beach, CA; Mann, Brooks S [Redondo Beach, CA; Yankoski, Edward P [Corona, CA; Smith, Gregory S [Woodland Hills, CA

    2012-05-01

    Systems and apparatus are provided for power electronics substrates adapted for direct substrate cooling. A power electronics substrate comprises a first surface configured to have electrical circuitry disposed thereon, a second surface, and a plurality of physical features on the second surface. The physical features are configured to promote a turbulent boundary layer in a coolant impinged upon the second surface.

  5. Ultrastructure of the egg apparatus of Spinacia

    Directory of Open Access Journals (Sweden)

    H. J. Wilms

    2014-01-01

    Full Text Available The egg apparatus of Spinacia was studied from the time the embryo sac reaches its maximal size to just before fertilization, i.e., until about 8-9 hours after pollination. At maturity each synergid has a large elongated nucleus and prominent chalazal vacuoles, Numerous mitochondria, plastids, dictyosomes, free ribosomes, rough endoplasmic reticulum (RER, and lipid bodies are present. The cell wall exists only around the micropylar half of the synergids and each cell has a distinct, striated filiform apparatus. In general, degeneration of one synergid starts after pollination. The egg cell has a spherical nucleus and nucleolus and a large micropylar vacuole. Numerous mitochondria, some plastids with starch grains, dictyosomes, free ribosomes, and HER are present. A continuous cell wall is absent around the chalazal end of the egg cell.

  6. Method and apparatus for spraying molten materials

    Science.gov (United States)

    Glovan, R.J.; Tierney, J.C.; McLean, L.L.; Johnson, L.L.; Nelson, G.L.; Lee, Y.M.

    1996-06-25

    A metal spray apparatus is provided with a supersonic nozzle. Molten metal is injected into a gas stream flowing through the nozzle under pressure. By varying the pressure of the injected metal, the droplet can be made in various selected sizes with each selected size having a high degree of size uniformity. A unique one piece graphite heater provides easily controlled uniformity of temperature in the nozzle and an attached tundish which holds the pressurized molten metal. A unique U-shaped gas heater provides extremely hot inlet gas temperatures to the nozzle. A particularly useful application of the spray apparatus is coating of threads of a fastener with a shape memory alloy. This permits a fastener to be easily inserted and removed but provides for a secure locking of the fastener in high temperature environments. 12 figs.

  7. Ionomer-Membrane Water Processing Apparatus

    Science.gov (United States)

    MacCallum, Taber K. (Inventor); Kelsey, Laura Katrina (Inventor)

    2017-01-01

    This disclosure provides water processing apparatuses, systems, and methods for recovering water from wastewater such as urine. The water processing apparatuses, systems, and methods can utilize membrane technology for extracting purified water in a single step. A containment unit can include an ionomer membrane, such as Nafion.RTM., over a hydrophobic microporous membrane, such as polytetrafluoroethylene (PTFE). The containment unit can be filled with wastewater, and the hydrophobic microporous membrane can be impermeable to liquids and solids of the wastewater but permeable to gases and vapors of the wastewater, and the ionomer membrane can be permeable to water vapor but impermeable to one or more contaminants of the gases and vapors. The containment unit can be exposed to a dry purge gas to maintain a water vapor partial pressure differential to drive permeation of the water vapor, and the water vapor can be collected and processed into potable water.

  8. Apparatus, system, and method for traffic monitoring

    KAUST Repository

    Claudel, Christian G.

    2016-08-25

    An apparatus, system, and method for traffic monitory can have a Lagrangian inertial measurement unit. The Lagrangian inertial measurement unit can have a processor, an accelerometer, a gyroscope, and/or a wireless transmitter. The processor can have an integrated direction cosine matrix. The accelerometer can be configured to measure linear accelerations of a vehicle and/or can communicate measured linear acceleration to the processor. The gyroscope can be configured to measure rotational accelerations of the vehicle and/or can communicate measured rotational acceleration to the processor. The processor can be configured to calculate estimated vehicle speed and/or estimated vehicle attitude. The wireless transmitter can be configured to wirelessly transmit estimated vehicle speed and/or estimated vehicle attitude. The apparatus, system, and method can be integrated with a wireless sensor network.

  9. Method and apparatus to assess compartment syndrome

    Science.gov (United States)

    Ueno, Toshiaki (Inventor); Hargens, Alan R. (Inventor); Yost, William T. (Inventor)

    2008-01-01

    A method and apparatus for measuring pressure buildup in a body compartment that encases muscular tissue. The method includes assessing the body compartment configuration and identifying the effect of pulsatile components on at least one compartment dimension. This process is used in preventing tissue necrosis, and in decisions of whether to perform surgery on the body compartment for prevention of Compartment Syndrome. An apparatus is used for measuring excess pressure in the body compartment having components for imparting ultrasonic waves such as a transducer, placing the transducer to impart the ultrasonic waves, capturing the reflected imparted ultrasonic waves, and converting them to electrical signals, a pulsed phase-locked loop device for assessing a body compartment configuration and producing an output signal, and means for mathematically manipulating the output signal to thereby categorize pressure build-up in the body compartment from the mathematical manipulations.

  10. Ionomer-Membrane Water Processing Apparatus

    Science.gov (United States)

    MacCallum, Taber K. (Inventor); Kelsey, Laura (Inventor)

    2016-01-01

    This disclosure provides water processing apparatuses, systems, and methods for recovering water from wastewater such as urine. The water processing apparatuses, systems, and methods can utilize membrane technology for extracting purified water in a single step. A containment unit can include an ionomer membrane, such as Nafion(Registered Trademark), over a hydrophobic microporous membrane, such as polytetrafluoroethylene (PTFE). The containment unit can be filled with wastewater, and the hydrophobic microporous membrane can be impermeable to liquids and solids of the wastewater but permeable to gases and vapors of the wastewater, and the ionomer membrane can be permeable to water vapor but impermeable to one or more contaminants of the gases and vapors. The containment unit can be exposed to a dry purge gas to maintain a water vapor partial pressure differential to drive permeation of the water vapor, and the water vapor can be collected and processed into potable water.

  11. PRIMA: An apparatus for medical application

    Energy Technology Data Exchange (ETDEWEB)

    Sipala, V., E-mail: valeria.sipala@ct.infn.it [Dipartimento di Fisica e Astronomia, Universita degli Studi di Catania (Italy); INFN, sezione di Catania (Italy); Brianzi, M. [INFN, sezione di Firenze (Italy); Bruzzi, M. [INFN, sezione di Firenze (Italy); Dipartimento di Energetica, Universita degli Studi di Firenze (Italy); Bucciolini, M. [Dipartimento di Fisiopatologia Clinica, Universita degli Studi di Firenze (Italy); INFN, sezione di Firenze (Italy); Cirrone, G.A.P. [Laboratori Nazionali del Sud-INFN, Catania (Italy); Civinini, C. [INFN, sezione di Firenze (Italy); Cuttone, G. [Laboratori Nazionali del Sud-INFN, Catania (Italy); Lo Presti, D. [Dipartimento di Fisica e Astronomia, Universita degli Studi di Catania (Italy); INFN, sezione di Catania (Italy); Pallotta, S. [Dipartimento di Fisiopatologia Clinica, Universita degli Studi di Firenze (Italy); Randazzo, N. [INFN, sezione di Catania (Italy); Romano, F. [Laboratori Nazionali del Sud-INFN, Catania (Italy); Stancampiano, C. [INFN, sezione di Catania (Italy); Scaringella, M. [INFN, sezione di Firenze (Italy); Dipartimento di Energetica, Universita degli Studi di Firenze (Italy); Talamonti, C. [Dipartimento di Fisiopatologia Clinica, Universita degli Studi di Firenze (Italy); INFN, sezione di Firenze (Italy); Tesi, M. [Dipartimento di Energetica, Universita degli Studi di Firenze (Italy)

    2011-12-01

    In this paper a proton Computed Radiography (pCR) apparatus for medical applications, realized by PRIMA (PRoton IMAging) Italian Collaboration, is described. The system is oriented to acquire tomography images and meets clinical demands for the use of protons in radiotherapy treatments. The approach proposed here is based on 'single proton tracking' method with Most Likely Path (MLP) reconstruction of the single particle. A pCR prototype, with a field of view of about 5 Multiplication-Sign 5 cm{sup 2} and an acquisition time of the order of 10 s (10 kHz, 10{sup 5} events), has been developed and tested with a 62 MeV proton beam at the INFN-Laboratori Nazionali del Sud (LNS). The apparatus architecture will be described and first proton radiographies will be shown.

  12. Apparatus and method for radioactive waste screening

    Science.gov (United States)

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  13. Apparatuses and methods for tuning center frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Wojciechowski, Kenneth; Olsson, Roy H.

    2016-02-23

    Apparatuses and methods for tuning center frequencies are described herein. Examples of tuning described herein including tuning using feedback from the resonator. Variable gain feedback for tuning of acoustic wave resonators is provided in some examples. An example apparatus may include a resonator and a feedback loop. The resonator may be configured to receive a tuning signal and to provide a feedback signal. The feedback signal may be based on the tuning signal. The feedback loop may be configured to receive the feedback signal from the resonator. The feedback loop further may be configured to provide the tuning signal to actively tune a center frequency of the resonator. The tuning signal may be based on the feedback signal.

  14. Methods and apparatus for coating particulate material

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2012-01-01

    Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

  15. Nuclear propulsion apparatus with alternate reactor segments

    Science.gov (United States)

    Szekely, Thomas

    1979-04-03

    1. Nuclear propulsion apparatus comprising: A. means for compressing incoming air; B. nuclear fission reactor means for heating said air; C. means for expanding a portion of the heated air to drive said compressing means; D. said nuclear fission reactor means being divided into a plurality of radially extending segments; E. means for directing a portion of the compressed air for heating through alternate segments of said reactor means and another portion of the compressed air for heating through the remaining segments of said reactor means; and F. means for further expanding the heated air from said drive means and the remaining heated air from said reactor means through nozzle means to effect reactive thrust on said apparatus.

  16. Data structures and apparatuses for representing knowledge

    Science.gov (United States)

    Hohimer, Ryan E; Thomson, Judi R; Harvey, William J; Paulson, Patrick R; Whiting, Mark A; Tratz, Stephen C; Chappell, Alan R; Butner, Robert S

    2014-02-18

    Data structures and apparatuses to represent knowledge are disclosed. The processes can comprise labeling elements in a knowledge signature according to concepts in an ontology and populating the elements with confidence values. The data structures can comprise knowledge signatures stored on computer-readable media. The knowledge signatures comprise a matrix structure having elements labeled according to concepts in an ontology, wherein the value of the element represents a confidence that the concept is present in an information space. The apparatus can comprise a knowledge representation unit having at least one ontology stored on a computer-readable medium, at least one data-receiving device, and a processor configured to generate knowledge signatures by comparing datasets obtained by the data-receiving devices to the ontologies.

  17. Preparation methodology and possible treatments for improved ceramics for high voltage vacuum applications

    CERN Document Server

    Tan, J

    1998-01-01

    The flashover characteristics of an insulator bridged high voltage vacuum gap can play an important role in the overall performance of a high voltage device, for example in the extreme environments of high energy particle accelerators. The detailed preparation of the insulators is, at present, governed by the commercial production methods and by standard bulk cleaning processes, which for a particular application may be far from optimum. The influence of the mechanical preparation, thermal history and particular cleaning technique have been investigated for commercially available alumina samples, with measurement of surface characteristics by scanning electron microscopy and laser diffraction, measurement of the secondary electron emission curve and analysis of the high voltage performance with the possibility of applied fields up to 200kV/cm. The results of the different measurements are discussed in the overall context of the problems encountered in the full sized high voltage devices, and suggestions are m...

  18. Low-voltage organic transistors based on solution processed semiconductors and self-assembled monolayer gate dielectrics

    NARCIS (Netherlands)

    Woebkenberg, Paul H.; Ball, James; Kooistra, Floris B.; Hummelen, Jan C.; de Leeuw, Dago M.; Bradley, Donal D. C.; Anthopoulos, Thomas D.

    2008-01-01

    Reduction in the operating voltage of organic transistors is of high importance for successful implementation in low-power electronic applications. Here we report on low-voltage n-channel transistors fabricated employing a combination of soluble organic semiconductors and a self-assembled gate

  19. Solution processed self-assembled monolayer gate dielectrics for low-voltage organic transistors. : Section Title: Electric Phenomena

    NARCIS (Netherlands)

    Ball, James; Wobkenberg, Paul H.; Colleaux, Florian; Kooistra, Floris B.; Hummelen, Jan C.; Bradley, Donal D. C.; Anthopoulos, Thomas D.

    2008-01-01

    Low-voltage org. transistors are sought for implementation in high vol. low-power portable electronics of the future. Here we assess the suitability of three phosphonic acid based self-assembling mols. for use as ultra-thin gate dielecs. in low-voltage soln. processable org. field-effect

  20. Modeling, analysis, and design of stationary reference frame droop controlled parallel three-phase voltage source inverters

    DEFF Research Database (Denmark)

    Vasquez, Juan Carlos; Guerrero, Josep M.; Savaghebi, Mehdi

    2011-01-01

    Power electronics based microgrids consist of a number of voltage source inverters (VSIs) operating in parallel. In this paper, the modeling, control design, and stability analysis of three-phase VSIs are derived. The proposed voltage and current inner control loops and the mathematical models...