Magnetic lens apparatus for a low-voltage high-resolution electron microscope
Crewe, Albert V.
1996-01-01
A lens apparatus in which a beam of charged particles of low accelerating voltage is brought to a focus by a magnetic field, the lens being situated behind the target position. The lens comprises an electrically-conducting coil arranged around the axis of the beam and a magnetic pole piece extending along the axis of the beam at least within the space surrounded by the coil. The lens apparatus comprises the sole focusing lens for high-resolution imaging in a low-voltage scanning electron microscope.
APPARATUS FOR ELECTRON BEAM HEATING CONTROL
Jones, W.H.; Reece, J.B.
1962-09-18
An improved electron beam welding or melting apparatus is designed which utilizes a high voltage rectifier operating below its temperature saturation region to decrease variations in electron beam current which normally result from the gas generated in such apparatus. (AEC)
X-ray spectral meter of high voltages for X-ray apparatuses
International Nuclear Information System (INIS)
Zubkov, I.P.; Larchikov, Yu.V.
1993-01-01
Design of the X-ray spectral meter of high voltages (XRSMHV) for medical X-ray apparatuses permitting to conduct the voltage measurements without connection to current circuits. The XRSMHV consists of two main units: the detector unit based on semiconductor detector and the LP4900B multichannel analyzer (Afora, Finland). The XRSMYV was tested using the pilot plant based on RUM-20 X-ray diagnostic apparatus with high-voltage regulator. It was shown that the developed XRSMHV could be certify in the range of high constant voltages form 40 up to 120 kV with the basic relative error limits ±0.15%. The XRSMHV is used at present as the reference means for calibration of high-voltage medical X-ray equipment
A Study on Gas Insulation Characteristics for Design Optimization of High Voltage Power Apparatus
Energy Technology Data Exchange (ETDEWEB)
Kim, I S; Kim, M K; Seo, K S; Moon, I W; Choi, C K [Korea Electrotechnology Research Institute (Korea, Republic of)
1996-12-01
This study aim of obtaining the basic data for gas insulation in the high voltage apparatus and for investigating the breakdown characteristics in uniform field and non-uniform which the geometric construction in the practical power apparatus. In this study, the research results on the insulation technology published earlier are reviewed and the basic data for an optimum design of a high voltage apparatus are obtained thorough the experiment and computer simulation by using a uniform field. The main result are summarized as follows: (A) Investigation on the insulation technology in a large-capacity power apparatus. (B) Investigation on the breakdown characteristics in particle contaminated condition. (C) Investigation on the design in computer simulation. (D) Investigation on the simulation technology of breakdown characteristics. (E) Investigation on breakdown characteristics in the nonuniform field and experiment. (author). refs., figs., tabs.
THREE-DIMENSIONAL OBSERVATIONS ON THICK BIOLOGICAL SPECIMENS BY HIGH VOLTAGE ELECTRON MICROSCOPY
Directory of Open Access Journals (Sweden)
Tetsuji Nagata
2011-05-01
Full Text Available Thick biological specimens prepared as whole mount cultured cells or thick sections from embedded tissues were stained with histochemical reactions, such as thiamine pyrophosphatase, glucose-6-phosphatase, cytochrome oxidase, acid phosphatase, DAB reactions and radioautography, to observe 3-D ultrastructures of cell organelles producing stereo-pairs by high voltage electron microscopy at accerelating voltages of 400-1000 kV. The organelles demonstrated were Golgi apparatus, endoplasmic reticulum, mitochondria, lysosomes, peroxisomes, pinocytotic vesicles and incorporations of radioactive compounds. As the results, those cell organelles were observed 3- dimensionally and the relative relationships between these organelles were demonstrated.
Apparatus with a cooled X-ray source and a high voltage generator
Energy Technology Data Exchange (ETDEWEB)
1977-02-01
Apparatus, especially for a dental application, with an X-ray source and a high voltage generator, whereby the X-ray source and a high voltage generator are contained in a housing, which is filled with a coolant medium, characterised by the housing being divided into two chambers, whereby the X-ray source is in the first chamber and the high voltage generator is in the second chamber and between the chambers a dividing wall is placed for the screening of the X-ray irradiation from the first chamber from the second, whereby at least one of the walls of the second chamber is elastic to accommodate the expansion of the coolant medium.
Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques
Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron
2016-01-26
A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.
Low voltage electron beam accelerators
International Nuclear Information System (INIS)
Ochi, Masafumi
2003-01-01
Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)
Low voltage electron beam accelerators
Energy Technology Data Exchange (ETDEWEB)
Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)
2003-02-01
Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)
Vail, W.B. III.
1989-11-21
Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of differential current conducted into formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas are present. Lithological characteristics of the formation such as the presence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes. 48 figs.
Critical voltage effects in electron channeling patterns
International Nuclear Information System (INIS)
Farrow, R.C.
1984-01-01
Electron channeling patterns were used to study critical voltage effects in the metals molybdenum and tungsten. The purpose was to characterize both theoretically and experimentally how a critical voltage will affect the channeling pattern line shapes. The study focused on the second order critical voltage that results from the degeneracy between the Bloch wave states of the (110) and (220) reflections. Theoretical (110) series electron channeling pattern line profiles were calculated using the dynamical theory of Hirsch and Humphreys (1970). A 10 beam dynamical electron diffraction calculation was performed (using complex Fourier lattice potentials) to generate Bloch wave coefficients, excitation amplitudes, and absorption coefficients needed for determining backscattering coefficients and subsequent backscattered electron intensities. The theoretical model is applicable to electron diffraction at all energies since no high energy approximation or perturbation method was used
High voltage power supply systems for electron beam and plasma technologies. Its new element base
International Nuclear Information System (INIS)
Dermengi, P.G.; Kureghan, A.S.; Pokrovsky, S.V.; Tchvanov, V.A.
1994-01-01
Transforming technique and high voltage technique supplementing each other more and more unite in indivisible constructions of modern apparatuses and systems and applicated in modern technologies providing its high efficiency. Specially worked out, ecologically clean, inertial, inflammable perfluororganic liquid is used in elements and electronic apparatuses simultaneously as insulating and cooling media. This liquid is highly fluid, fills tiny cavities in construction elements and in the places of high concentration of losses, where maximum local overheating of active parts or apparatus constructions takes place, it transforms to boiling state with highly intensive taking off of heat energy from cooled surface point. For instance, being cooled by mentioned perfluororganic liquid, copper wire can conduct current to 50 A/mm 2 density, but in ordinary conditions of transformers, reactors and busses, current density can reach only few Amperes. Possibility of considerable increasing of current density, that is reached by means of intensive cooling, provided by worked out liquid, and taking into account its incredibly high insulating features (liquid has electric strength to 50 KV/mm) allows to provide optimum heat regime of active parts of transformers. reactors, condenser, semiconductor devices, resistors, construction elements and electrotechnical apparatus in general. Particularly high effect of decreasing of weight and dimensions characteristics of elements and electrotechnical apparatus in general can be reached under working out of special constructions of each element and apparatus details, adapted to use of mentioned liquid as insulating and cooling media
Kikta, Thomas J.; Mitchell, Ronald D.
1992-01-01
A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.
High-voltage pulse generator for electron gun power supply
International Nuclear Information System (INIS)
Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.
1987-01-01
High-voltage pulse generator with combined capacitive and inductive energy storages for electron gun power supply is described. Hydrogen thyratron set in a short magnetic lense is a current breaker. Times of current interruption in thyratrons are in the range from 100 to 300 ns. With 1 kV charging voltage of capacitive energy storage 25 kV voltage pulse is obtained in the load. The given high-voltage pulse generator was used for supply of an electron gun generating 10-30 keV low-energy electron beam
A new apparatus for electron-ion multiple coincidence momentum imaging spectroscopy
International Nuclear Information System (INIS)
Morishita, Y.; Kato, M.; Pruemper, G.; Liu, X.-J.; Lischke, T.; Ueda, K.; Tamenori, Y.; Oura, M.; Yamaoka, H.; Suzuki, I.H.; Saito, N.
2006-01-01
We have developed a new experimental apparatus for the electron-ion multiple coincidence momentum imaging spectroscopy in order to obtain the angular distributions of vibration-resolved photoelectrons from molecules fixed in space. The apparatus consists of a four-stage molecular supersonic jet and a spectrometer analyzing three-dimensional momenta of fragment ions and electrons in coincidence
Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel
2014-06-03
Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.
Apparatus for irradiation with electron beam
International Nuclear Information System (INIS)
Uehara, K.; Ito, A.; Nishimune, K.; Fujita, K.
1976-01-01
An irradiation apparatus with high energy electrons is disclosed in which a wire shaped or linear object to be irradiated is moved back and forth many times under an electron window so as to irradiate it with an electron beam. According to one feature of the invention, an electron beam, which leaks through gaps between the objects to be irradiated or which penetrates the objects to be irradiated, is reversed by a magnetic field approximately perpendicular to the scanning face of the electron beam by means of a magnet which is disposed under the objects to be irradiated, and the reversed electron beam is thereby again applied to the objects to be irradiated. A high utilization rate of the electron beam is accomplished, and the objects can be thereby uniformly irradiated with the electron beam. 4 claims, 6 drawing figures
An Inexpensive Source of High Voltage
Saraiva, Carlos
2012-01-01
As a physics teacher I like recycling old apparatus and using them for demonstrations in my classes. In physics laboratories in schools, sources of high voltage include induction coils or electronic systems that can be bought from companies that sell lab equipment. But these sources can be very expensive. In this article, I will explain how you…
Light-voltage conversion apparatus
Energy Technology Data Exchange (ETDEWEB)
Fujioka, Yoshiki
1987-09-19
In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)
Characterization of a low-voltage electron beam
International Nuclear Information System (INIS)
Berejka, A.J.
2004-01-01
Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams
Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam
Andreev, Andrey
2005-10-01
The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.
Simulation of electron displacement damage in a high voltage electron microscope
International Nuclear Information System (INIS)
Ono, Susumu; Kanaya, Koichi
1979-01-01
By applying the fundamental theory of the neutron cooling to the conservation law of energy and momentum, the threshold energies of incident electrons for displacing atoms are calculated and illustrated periodically for the atomic number. And the observable damage due to the secondary action of displaced atoms in the practical use of a high voltage electron microscope is described for several materials and accelerating voltages. The trajectories of incident electrons and displaced atoms in several materials are simulated by a Monte-Carlo method, using rigorous formulas of electron scattering events, i.e. elastic and inelastic scattering cross-sections, ionization loss and plasmon excitation. The simulation results are substantially agreement with experiments. (author)
Computer applications: Automatic control system for high-voltage accelerator
International Nuclear Information System (INIS)
Bryukhanov, A.N.; Komissarov, P.Yu.; Lapin, V.V.; Latushkin, S.T.. Fomenko, D.E.; Yudin, L.I.
1992-01-01
An automatic control system for a high-voltage electrostatic accelerator with an accelerating potential of up to 500 kV is described. The electronic apparatus on the high-voltage platform is controlled and monitored by means of a fiber-optic data-exchange system. The system is based on CAMAC modules that are controlled by a microprocessor crate controller. Data on accelerator operation are represented and control instructions are issued by means of an alphanumeric terminal. 8 refs., 6 figs
Apparatus for electron beam irradiation of objects
International Nuclear Information System (INIS)
Dmitriev, S.P.; Ivanov, A.S.; Sviniin, M.P.; Fedotov, M.T.
1984-01-01
This patent provides an apparatus for electron beam irradiation of objects, comprising a shaper of a ribbon-shaped electron beam and a deflecting electromagnet having a frame-type magnetic circuit and used to direct said electron beam onto an irradiated object substantially at an angle of 90 degrees. The deflecting electromagnet has two poles extended over the width of the irradiated object and comprises two windings embracing said poles and connected to a d.c. source. The deflecting electromagnet is arranged in such a manner that the trajectories of the electrons at an area from the shaper to the electromagnet are inclined to the plane of the frame of its magnetic circuit
Vail, W.B. III.
1991-08-27
Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation. 9 figures.
Vail, III, William B.
1991-01-01
Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation.
Inductive voltage adder (IVA) for submillimeter radius electron beam
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Maenchen, J.E.
1996-01-01
The authors have already demonstrated the utility of inductive voltage adder accelerators for production of small-size electron beams. In this approach, the inductive voltage adder drives a magnetically immersed foilless diode to produce high-energy (10--20 MeV), high-brightness pencil electron beams. This concept was first demonstrated with the successful experiments which converted the linear induction accelerator RADLAC II into an IVA fitted with a small 1-cm radius cathode magnetically immersed foilless diode (RADLAC II/SMILE). They present here first validations of extending this idea to mm-scale electron beams using the SABRE and HERMES-III inductive voltage adders as test beds. The SABRE experiments are already completed and have produced 30-kA, 9-MeV electron beams with envelope diameter of 1.5-mm FWHM. The HERMES-III experiments are currently underway
Voltage-pulse generator for electron gun
International Nuclear Information System (INIS)
Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.
1987-01-01
A voltage-pulse generator with combined capacitive and inductive storage devices of an electron gun is described. The current interrupter is a hydrogen thyratron (TGI1-100/8, TGI1-500/16, or TGI1-1000/25) installed in a short magnetic lens. The current interruption time of the thyratrons is 100-300 nsec. When the capacitive storage device is charged to 1 kV, a voltage pulse with an amplitude of 25 kV is obtained at the load
An apparatus for measuring the energy and angular distribution of electrons in ion-atom collisions
International Nuclear Information System (INIS)
Gibson, D.K.; Petersen, M.C.E.
1978-07-01
There is a need for further data on the energy and angular distribution of electrons ejected from atoms and molecules by ion impact. An apparatus in which simultaneous measurements can be made of the energy and angular distributions of such electrons is described. The advantages of the apparatus are the possibility of fast data collection and the ability to make measurements over the whole range of scattering angle. Preliminary tests and a trial measurement with the apparatus are described
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.
1993-01-01
During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm
Modular low-voltage electron emitters
International Nuclear Information System (INIS)
Berejka, Anthony J.
2005-01-01
Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates
Modular low-voltage electron emitters
Berejka, Anthony J.
2005-12-01
Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates.
Electronic Current Transducer (ECT) for high voltage dc lines
Houston, J. M.; Peters, P. H., Jr.; Summerayes, H. R., Jr.; Carlson, G. J.; Itani, A. M.
1980-02-01
The development of a bipolar electronic current transducer (ECT) for measuring the current in a high voltage dc (HVDC) power line at line potential is discussed. The design and construction of a free standing ECT for use on a 400 kV line having a nominal line current of 2000 A is described. Line current is measured by a 0.0001 ohm shunt whose voltage output is sampled by a 14 bit digital data link. The high voltage interface between line and ground is traversed by optical fibers which carry digital light signals as far as 300 m to a control room where the digital signal is converted back to an analog representation of the shunt voltage. Two redundant electronic and optical data links are used in the prototype. Power to operate digital and optical electronics and temperature controlling heaters at the line is supplied by a resistively and capacitively graded 10 stage cascade of ferrite core transformers located inside the hollow, SF6 filled, porcelain support insulator. The cascade is driven by a silicon controlled rectifier inverter which supplies about 100 W of power at 30 kHz.
Switched-mode power supply apparatus and method
2013-01-01
The present invention relates to a switched-mode power supply apparatus and a corresponding method. For an effective compensation of non-linearities caused by dead- time and voltage drops in the switching power amplifier of the apparatus, an apparatus is proposed comprising a switching power
Switched-mode power supply apparatus and method
2013-01-01
The present invention relates to a switched-mode power supply apparatus and a corresponding method. For an effective compensation of non-linearities caused by dead-time and voltage drops in the switching power amplifier of the apparatus, an apparatus is proposed comprising a switching power
A Study on Test Technology to Diagnose the Power Apparatus
Energy Technology Data Exchange (ETDEWEB)
Kim, K H; Kang, Y S; Jeon, Y K; Lee, W Y; Kang, D S; Kyu, H S; Sun, J H; Jo, K H [Korea Electrotechnology Research Institute (Korea, Republic of); Jung, J S; Mun, Y T; Lee, K H; Jung, E H; Kim, J H [Korea Water Resources Corporation (Korea, Republic of)
1997-02-01
In this study, we have educated KOWACO(Korea Water Resources Corporation) specialists about the insulation diagnostic technology and trained them the insulation diagnostic test and estimation method of power apparatus. The main results of this study are as follows; A. Education of basic high-voltage engineering. B. Research of insulation characteristic and deterioration mechanism in power apparatus C. Discussion on high-voltage test standard specifications. D. Study on insulation deterioration diagnostics in power apparatus. E. Field testing of insulation diagnosis in power apparatus. F. Engineering of insulation diagnostic testing apparatus to diagnose power apparatus. KOWACO specialists are able to diagnose insulation diagnostic test of power apparatus through this study. As they have instruments to diagnose power apparatus, they can do the test and estimation of the power apparatus insulation diagnosis. (author). refs., figs., tabs.
Adventitious X-radiation from high voltage equipment
International Nuclear Information System (INIS)
Martin, E.B.M.
1979-01-01
The monograph is concerned with hazards of unwanted x-rays from sources such as television receivers, high voltage equipment, radar transmitters, switchgear and electron beam apparatus for welding, evaporation, analysis and microscopy. Chapters are included on units, production of x radiation, biological effects, protection standards, radiation monitoring, shielding and control of access, medical and dosimetric supervision and types of equipment. A bibliography of 92 references and other cited literature is included. (U.K.)
Electronic voltage and current transformers testing device.
Pan, Feng; Chen, Ruimin; Xiao, Yong; Sun, Weiming
2012-01-01
A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs) with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz). The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.
Light Emitting, Photovoltaic or Other Electronic Apparatus and System
Ray, William Johnstone (Inventor); Lowenthal, Mark D. (Inventor); Shotton, Neil O. (Inventor); Blanchard, Richard A. (Inventor); Lewandowski, Mark Allan (Inventor); Fuller, Kirk A. (Inventor); Frazier, Donald Odell (Inventor)
2018-01-01
The present invention provides an electronic apparatus, such as a lighting device comprised of light emitting diodes (LEDs) or a power generating apparatus comprising photovoltaic diodes, which may be created through a printing process, using a semiconductor or other substrate particle ink or suspension and using a lens particle ink or suspension. An exemplary apparatus comprises a base; at least one first conductor; a plurality of diodes coupled to the at least one first conductor; at least one second conductor coupled to the plurality of diodes; and a plurality of lenses suspended in a polymer deposited or attached over the diodes. The lenses and the suspending polymer have different indices of refraction. In some embodiments, the lenses and diodes are substantially spherical, and have a ratio of mean diameters or lengths between about 10:1 and 2:1. The diodes may be LEDs or photovoltaic diodes, and in some embodiments, have a junction formed at least partially as a hemispherical shell or cap.
Low voltage 80 KV to 125 KV electron processors
International Nuclear Information System (INIS)
Lauppi, U.V.
1999-01-01
The classic electron beam technology made use of accelerating energies in the voltage range of 300 to 800 kV. The first EB processors - built for the curing of coatings - operated at 300 kV. The products to be treated were thicker than a simple layer of coating with thicknesses up to 100g and more. It was only in the beginning of the 1970's that industrial EB processors with accelerating voltages below 300 kV appeared on the market. Our company developed the first commercial electron accelerator without a beam scanner. The new EB machine featured a linear cathode, emitting a shower or 'curtain' of electrons over the full width of the product. These units were much smaller than anv previous EB processors and dedicated to the curing of coatings and other thin layers. ESI's first EB units operated with accelerating voltages between 150 and 200 kV. In 1993 ESI announced the introduction of a new generation of Electrocure. EB processors operating at 120 kV, and in 1998, at the RadTech North America '98 Conference in Chicago, the introduction of an 80 kV electron beam processor under the designation Microbeam LV
Modular low-voltage electron beams
Berejka, Anthony J.; Avnery, Tovi; Carlson, Carl
2004-09-01
Modular, low-voltage systems have simplified electron beam (EB) technology for industrial uses and for research and development. Modular EB units are produced in quantity as sealed systems that are evacuated at the factory eliminating the need for vacuum pumps at the point of use. A simple plug-out—plug-in method of replacement eliminates downtime for servicing. Use of ultra-thin beam windows (innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, combine for ease of use and electrical transfer efficiency at voltages that can be varied between 80 and 150 kV and with high beam currents (up to 40 mA across the 25 cm window). These electron systems are available in three widths, the standard 25 cm and new 5 and 40 cm beams. Traditional uses in the graphic arts and coatings areas as well as uses in surface sterilization have found these compact, lightweight (approximately 15 kg) modular beams of interest. Units have been configured around complex shapes to enable three-dimensional surface curing (as for coatings on aluminum tubing) to be achieved at high production rates. Details of the beam construction and some industrial uses are discussed.
High voltage system design for the IUCF 300 KV electron cooling system
International Nuclear Information System (INIS)
Bertuccio, T.; Brown, B.; Donica, G.; Ellison, T.; Friesel, D.L.
1985-01-01
A summary of the electron beam high voltage system design for the IUCF Cooler now under construction, is presented. There are extremely stringent regulation requirements (about 10ppm) on the main high voltage power supply (-300 kVDC, 15 mA), and less stringent requirements on the gun anode power supply, in order to achieve the regulation needed to store beams in the IUCF Cooler with very low momentum spreads (Δp/p approx. = 2 x 10 -5 ). An overview of the main high voltage power supply (HVPS) specifications and design, as well as provisions and plans to improve the regulation are discussed. The electron collection system, modeled after the FNAL collector which was able to collect between 99.9% and 99.99% of the electron beam, is discussed along with the requirements of the associated power supplies. The designs of the high voltage acceleration structures and high voltage platform are discussed, as well as practical design considerations based upon experience with the Fermilab 120 keV electron cooling system
Energy Technology Data Exchange (ETDEWEB)
Han, Myung-Geun, E-mail: mghan@bnl.gov [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Garlow, Joseph A. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Materials Science and Engineering Department, Stony Brook University, Stony Brook, NY 11794 (United States); Marshall, Matthew S.J.; Tiano, Amanda L. [Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Wong, Stanislaus S. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Cheong, Sang-Wook [Department of Physics and Astronomy, Rutgers Center for Emergent Materials, Rutgers University, Piscataway, NJ 08854 (United States); Walker, Frederick J.; Ahn, Charles H. [Department of Applied Physics and Center for Research on Interface Structures and Phenomena, Yale University, New Haven, CT 06520 (United States); Department of Mechanical Engineering and Materials Science, Yale University, New Haven, CT 06520 (United States); Zhu, Yimei [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States)
2017-05-15
Highlights: • Electron-beam-induced-current (EBIC) and active secondary-electron voltage-contrast (SE-VC) are demonstrated in STEM mode combined with in situ electrical biasing in a TEM. • Electrostatic potential maps in ferroelectric thin films, multiferroic nanowires, and single crystals obtained by off-axis electron holography were compared with EBIC and SE-VC data. • Simultaneous EBIC and active SE-VC performed with atomic resolution STEM are demonstrated. - Abstract: The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fields and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.
On some aspects of high voltage electron microscopy
International Nuclear Information System (INIS)
Jouffrey, B.; Trinquier, J.
1987-01-01
The present paper deals with high voltage electron microscopy (HVEM). It is an overview on this domain due to the pionneer work of G. Dupouy which has permitted to perform a new kind of electron microscopy. Since this time, HVEM has shown its interest in high resolution, irradiations, chemical analysis, in situ experiments
Energy Technology Data Exchange (ETDEWEB)
Mahoney, J M; Gutkin, M V; Tarnovsky, V; Becker, K [Department of Physics and Engineering Physics, Stevens Institute of Technology, Hoboken, NJ 07030 (United States)], E-mail: kbecker@poly.edu
2008-05-15
The fast-neutral-beam technique is a versatile approach to the determination of absolute cross sections for electron-impact ionization of atoms, stable molecules as well as free radicals and metastable species. A fast neutral beam of the species under study is prepared by charge-transfer neutralization of a mass-selected ion beam and the species are subsequently ionized by an electron beam. Mass- and energy-dispersive selection separates singly from multiply charged ions and parent from fragment ions and allows the determination of partial ionization cross sections. Here we describe some major improvements that were made recently to the fast-beam apparatus that has been used extensively for ionization cross section measurements for the past 15 years in our group. Experiments using well-established ionization cross sections in conjunction with extensive ion trajectory simulations were carried out to test the satisfactory performance of the modified fast-neutral-beam apparatus. We also report absolute partial cross sections for the formation of various singly charged positive ions produced by electron impact on SiCl{sub 3} for impact energies from threshold to 200 eV in the modified fast-beam apparatus.
Apparatus for testing semiconductor devices and capacitors
International Nuclear Information System (INIS)
York, R.A.
1984-01-01
An apparatus is provided for testing semiconductor devices. The apparatus tests the impedance of the semiconductor devices in both conducting and non-conducting states to detect semiconductors whose impedance in the conducting state is too high or whose impedance in the non-conducting state is too low. The apparatus uses a battery source for low voltage d.c. The circuitry for detecting when the impedance is too high in the conducting state includes a lamp in series with the battery source and the semiconductor device, whereby the impedance of the semiconductor device determines whether sufficient current will flow through the lamp to cause the lamp to illuminate. A d.c. to d.c. converter is provided to boost the voltage from the battery source to a relatively high voltage d.c. The relatively high voltage d.c. can be connected by a switch to circuitry for detecting when the impedance of the semiconductor device in the non-conducting state is too low. The circuitry for detecting when the impedance of the semiconductor device is too low includes a resistor which senses the current flowing in the device and converts the current into a voltage proportional to the leakage current. This voltage is then compared against a fixed reference. Further circuitry is provided for providing a visual indication when the voltage representative of leakage in relation to the reference signal indicates that there is excessive current flow through the semiconductor device
Methods and apparatus for cooling electronics
Hall, Shawn Anthony; Kopcsay, Gerard Vincent
2014-12-02
Methods and apparatus are provided for choosing an energy-efficient coolant temperature for electronics by considering the temperature dependence of the electronics' power dissipation. This dependence is explicitly considered in selecting the coolant temperature T.sub.0 that is sent to the equipment. To minimize power consumption P.sub.Total for the entire system, where P.sub.Total=P.sub.0+P.sub.Cool is the sum of the electronic equipment's power consumption P.sub.0 plus the cooling equipment's power consumption P.sub.Cool, P.sub.Total is obtained experimentally, by measuring P.sub.0 and P.sub.Cool, as a function of three parameters: coolant temperature T.sub.0; weather-related temperature T.sub.3 that affects the performance of free-cooling equipment; and computational state C of the electronic equipment, which affects the temperature dependence of its power consumption. This experiment provides, for each possible combination of T.sub.3 and C, the value T.sub.0* of T.sub.0 that minimizes P.sub.Total. During operation, for any combination of T.sub.3 and C that occurs, the corresponding optimal coolant temperature T.sub.0* is selected, and the cooling equipment is commanded to produce it.
Electron beam generation in high voltage glow discharges
International Nuclear Information System (INIS)
Rocca, J.J.; Szapiro, B.; Murray, C.
1989-01-01
The generation of intense CW and pulsed electron beams in glow discharges in reviewed. Glow discharge electron guns operate at a pressure of the order of 1 Torr and often have an advantage in applications that require a broad area electron beam in a gaseous atmosphere, such as laser excitation and some aspects of materials processing. Aspects of electron gun design are covered. Diagnostics of the high voltage glow discharges including the electric field distribution mapped by Doppler free laser spectroscopy, and plasma density and electron temperature measurements of the electron yield of different cathode materials under glow discharge conditions are presented
Void formation in NiTi shape memory alloys by medium-voltage electron irradiation
International Nuclear Information System (INIS)
Schlossmacher, P.; Stober, T.
1995-01-01
In-situ electron irradiation experiments of NiTi shape memory alloys, using high-voltage transmission electron microscopes, result in amorphization of the intermetallic compound. In all of these experiments high-voltages more than 1.0 MeV had to be applied in order to induce the crystalline-to-amorphous transformation. To their knowledge no irradiation effects of medium-voltage electrons of e.g. 0.5 MeV have been reported in the literature. In this contribution, the authors describe void formation in two different NiTi shape memory alloys, resulting from in-situ electron irradiation, using a 300 kV electron beam in a transmission electron microscope. First evidence is presented that void formation is correlated with the total oxygen content of the alloys
Modular low-voltage electron beams
International Nuclear Information System (INIS)
Berejka, A.J.; Avnery, Tovi; Carlson, Carl
2004-01-01
Modular, low-voltage systems have simplified electron beam (EB) technology for industrial uses and for research and development. Modular EB units are produced in quantity as sealed systems that are evacuated at the factory eliminating the need for vacuum pumps at the point of use. A simple plug-out--plug-in method of replacement eliminates downtime for servicing. Use of ultra-thin beam windows (<10 μm of titanium foil), solid-state 19 in. (48 cm) rack-mounted power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, combine for ease of use and electrical transfer efficiency at voltages that can be varied between 80 and 150 kV and with high beam currents (up to 40 mA across the 25 cm window). These electron systems are available in three widths, the standard 25 cm and new 5 and 40 cm beams. Traditional uses in the graphic arts and coatings areas as well as uses in surface sterilization have found these compact, lightweight (approximately 15 kg) modular beams of interest. Units have been configured around complex shapes to enable three-dimensional surface curing (as for coatings on aluminum tubing) to be achieved at high production rates. Details of the beam construction and some industrial uses are discussed
Miller, Richard Dean; Thom, Robert Anthony
2017-10-10
A light shielding apparatus for blocking light from reaching an electronic device, the light shielding apparatus including left and right support assemblies, a cross member, and an opaque shroud. The support assemblies each include primary support structure, a mounting element for removably connecting the apparatus to the electronic device, and a support member depending from the primary support structure for retaining the apparatus in an upright orientation. The cross member couples the left and right support assemblies together and spaces them apart according to the size and shape of the electronic device. The shroud may be removably and adjustably connectable to the left and right support assemblies and configured to take a cylindrical dome shape so as to form a central space covered from above. The opaque shroud prevents light from entering the central space and contacting sensitive elements of the electronic device.
Apparatus and method for generating high density pulses of electrons
International Nuclear Information System (INIS)
Lee, C.; Oettinger, P.E.
1981-01-01
An apparatus and method are described for the production of high density pulses of electrons using a laser energized emitter. Caesium atoms from a low pressure vapour atmosphere are absorbed on and migrate from a metallic target rapidly heated by a laser to a high temperature. Due to this heating time being short compared with the residence time of the caesium atoms adsorbed on the target surface, copious electrons are emitted which form a high current density pulse. (U.K.)
Application of a LEED apparatus provided with a lens to the study of vicinal surfaces
International Nuclear Information System (INIS)
Laydevant, Louis; Dupuy, J.C.
1979-01-01
Steps presence on vicinal surfaces changes the low energy electron difraction (LEED) pattern: a system of regulary spaced steps is causing some spots to be splitted. Using a high voltage LEED apparatus allows an easy explanation of the patterns: the spot position does not depend about energy and so some cristallographic parameters can be easily measured [fr
Apparatus for measuring the concentration of a gas
International Nuclear Information System (INIS)
Manin, Ange.
1974-01-01
The apparatus described for measuring the concentration of a gas in an atmosphere is of the kind which has an ionization chamber with an internal radioactive source and associated electronics enabling the ionization current crossing the chamber to be measured. It includes at least one cylindrical metal grid forming an electrode brought to a high voltage in relation to a cylindrical collection electrode fitted to the axis of the grid coated with a radioactive deposit and, around this grid, a screen acting as a protective envelope. The radioactive deposit is tritiated titanium [fr
High voltage high brightness electron accelerator with MITL voltage adder coupled to foilless diode
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poulkey, J.W.; Rovang, D.
1995-01-01
The design and analysis of a high brightness electron beam experiment under construction at Sandia National Laboratory is presented. The beam energy is 12 MeV, the current 35-40 kA, the rms radius 0.5 mm, and the pulse duration FWHM 40 ns. The accelerator is SABRE a pulsed inductive voltage adder, and the electron source is a magnetically immersed foilless diode. This experiment has as its goal to stretch the technology to the edge and produce the highest possible electron current in a submillimeter radius beam
Radiographic apparatus and method for monitoring film exposure time
International Nuclear Information System (INIS)
Vatne, R.S.; Woodmansee, W.E.
1981-01-01
In connection with radiographic inspection of structural and industrial materials, method and apparatus are disclosed for automatically determining and displaying the time required to expose a radiographic film positioned to receive radiation passed by a test specimen, so that the finished film is exposed to an optimum blackening (density) for maximum film contrast. A plot is made of the variations in a total exposure parameter (representing the product of detected radiation rate and time needed to cause optimum film blackening) as a function of the voltage level applied to an X-ray tube. An electronic function generator storing the shape of this plot is incorporated into an exposure monitoring apparatus, such that for a selected tube voltage setting, the function generator produces an electrical analog signal of the corresponding exposure parameter. During the exposure, another signal is produced representing the rate of radiation as monitored by a diode detector positioned so as to receive the same radiation that is incident on the film. The signal representing the detected radiation rate is divided, by an electrical divider circuit into the signal representing total exposure, and the resulting quotient is an electrical signal representing the required exposure time. (author)
Femtosecond electron diffraction. Next generation electron sources for atomically resolved dynamics
Energy Technology Data Exchange (ETDEWEB)
Hirscht, Julian
2015-08-15
Three instruments for femtosecond electron diffraction (FED) experiments were erected, partially commissioned and used for first diffraction experiments. The Relativistic Electron Gun for Atomic Exploration (REGAE) was completed by beamline elements including supports, a specimen chamber and dark current or electron beam collimating elements such that the commissioning process, including first diffraction experiments in this context, could be started. The temporal resolution of this machine is simulated to be 25 fs (fwhm) short, while a transverse coherence length of 30 nm (fwhm) is feasible to resolve proteins on this scale. Whether this machine is capable of meeting these predictions or whether the dynamics of the electron beam will stay limited by accelerator components, is not finally determined by the end of this work, because commissioning and improvement of accelerator components is ongoing. Simultaneously, a compact DC electron diffraction apparatus, the E-Gun 300, designed for solid and liquid specimens and a target electron energy of 300 keV, was built. Fundamental design issues of the high potential carrying and beam generating components occurred and are limiting the maximum potential and electron energy to 120 keV. Furthermore, this is limiting the range of possible applications and consequently the design and construction of a brand new instrument began. The Femtosecond Electron Diffraction CAmera for Molecular Movies (FED-CAMM) bridges the performance problems of very high electric potentials and provides optimal operational conditions for all applied electron energies up to 300 keV. The variability of gap spacings and optimized manufacturing of the high voltage electrodes lead to the best possible electron pulse durations obtainable with a compact DC setup, that does not comprise of rf-structures. This third apparatus possesses pulse durations just a few tenth femtoseconds apart from the design limit of the highly relativistic REGAE and combines the
Femtosecond electron diffraction. Next generation electron sources for atomically resolved dynamics
International Nuclear Information System (INIS)
Hirscht, Julian
2015-08-01
Three instruments for femtosecond electron diffraction (FED) experiments were erected, partially commissioned and used for first diffraction experiments. The Relativistic Electron Gun for Atomic Exploration (REGAE) was completed by beamline elements including supports, a specimen chamber and dark current or electron beam collimating elements such that the commissioning process, including first diffraction experiments in this context, could be started. The temporal resolution of this machine is simulated to be 25 fs (fwhm) short, while a transverse coherence length of 30 nm (fwhm) is feasible to resolve proteins on this scale. Whether this machine is capable of meeting these predictions or whether the dynamics of the electron beam will stay limited by accelerator components, is not finally determined by the end of this work, because commissioning and improvement of accelerator components is ongoing. Simultaneously, a compact DC electron diffraction apparatus, the E-Gun 300, designed for solid and liquid specimens and a target electron energy of 300 keV, was built. Fundamental design issues of the high potential carrying and beam generating components occurred and are limiting the maximum potential and electron energy to 120 keV. Furthermore, this is limiting the range of possible applications and consequently the design and construction of a brand new instrument began. The Femtosecond Electron Diffraction CAmera for Molecular Movies (FED-CAMM) bridges the performance problems of very high electric potentials and provides optimal operational conditions for all applied electron energies up to 300 keV. The variability of gap spacings and optimized manufacturing of the high voltage electrodes lead to the best possible electron pulse durations obtainable with a compact DC setup, that does not comprise of rf-structures. This third apparatus possesses pulse durations just a few tenth femtoseconds apart from the design limit of the highly relativistic REGAE and combines the
Successful application of Low Voltage Electron Microscopy to practical materials problems
International Nuclear Information System (INIS)
Bell, David C.; Mankin, Max; Day, Robert W.; Erdman, Natasha
2014-01-01
Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely
BANSHEE: High-voltage repetitively pulsed electron-beam driver
International Nuclear Information System (INIS)
VanHaaften, F.
1992-01-01
BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-μs pulse width driving a load of ∼100 Ω, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 Ω, up to a level of ∼650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of ∼100 Ω
International Nuclear Information System (INIS)
Kawahashi, Akira; Nakano, Toru; Hosokawa, Tatsuzo; Miyoshi, Yosinori.
1976-01-01
In the time resolving measurement of the growing process and breakdown of electron avalanche in a gap of uniform electric field, the phenomenon that DC breakdown voltage slightly lowered was observed when β ray was irradiated as the initial electron source, as compared with unirradiated condition. Beta source used is 90 Sr- 90 Y of 2 mCi in radiative equilibrium. The experimental results and the examination are described in detail. In brief, the remarkable superposition of succeeding avalanche pulse over the preceeding avalanche pulse waveform was observed under the gap condition in which the breakdown voltage decreased in β-ray irradiation. Thus this superposition of avalanche pulses is considered as one of the causes of the breakdown voltage reduction. When β source is used as the initial electron source, the number of supplied initial electrons is very large as compared with unity, and at the same time, a great number of initial electrons can be supplied within the diffusion radius r of avalanche. Then the effect of initial electron number n 0 was considered by employing a diagram for breakdown scheme. The transition from Townsend type breakdown to streamer type breakdown occurs owing to increasing n 0 , and in that condition, the breakdown voltage lowers slightly. (Wakatsuki, Y)
Capacitive divider for output voltage measurement of intense electron beam accelerator
International Nuclear Information System (INIS)
Ding Desheng; Yi Lingzhi; Yu Binxiong; Hong Zhiqiang; Liu Jinliang
2012-01-01
A kind of simple-mechanism, easy-disassembly self-integrating capacitive divider used for measuring diode output voltage of intense electron beam accelerator (IEBA) is developed. The structure of the capacitive divider is described, and the capacitance value of the capacitive divider is calculated by theoretical analysis and electromagnetic simulation. The dependence of measurement voltage on electrical parameters such as stray capacitance, earth capacitance of front resistance is obtained by PSpice simulation. Measured waveforms appear overshoot phenomenon when stray capacitance of front resistance is larger, and the wavefront will be affected when earth capacitance of front resistance is larger. The diode output voltage waveforms of intense electron beam accelerator, are measured by capacitive divider and calibrated by water resistance divider, which is accordance with that measured by a resistive divider, the division ratio is about 563007. The designed capacitive divider can be used to measure high-voltage pulse with 100 ns full width at half maximum. (authors)
Alexandrov, A. L.; Schweigert, I. V.; Zakrevskiy, Dm. E.; Bokhan, P. A.; Gugin, P.; Lavrukhin, M.
2017-10-01
A subnanosecond breakdown in high-voltage pulse discharge may be a key tool for superfast commutation of high power devices. The breakdown in high-voltage open discharge at mid-high pressure in helium was studied in experiment and in kinetic simulations. The kinetic model of electron avalanche development was constructed, based on PIC-MCC simulations, including dynamics of electrons, ions and fast helium atoms, produced by ions scattering. Special attention was paid to electron emission processes from cathode, such as: photoemission by Doppler-shifted resonant photons, produced in excitation processes involving fast atoms; electron emission by ions and fast atoms bombardment of cathode; the secondary electron emission (SEE) by hot electrons from bulk plasma. The simulations show that the fast atoms accumulation is the main reason of emission growth at the early stage of breakdown, but at the final stage, when the voltage on plasma gap diminishes, namely the SEE is responsible for subnanosecond rate of current growth. It was shown that the characteristic time of the current growth can be controlled by the SEE yield. The influence of SEE yield for three types of cathode material (titanium, SiC, and CuAlMg-alloy) was tested. By changing the pulse voltage amplitude and gas pressure, the area of existence of subnanosecond breakdown is identified. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time value as small as τs = 0.4 ns, for the pulse voltage amplitude of 5÷12 kV. An increase of gas pressure from 15 Torr to 30 Torr essentially decreases the time of of current front growth, whereas the pulse voltage variation weakly affects the results.
Space charge effects and electronic bistability
International Nuclear Information System (INIS)
Ruffini, A.; Strumia, F.; Tommasi, O.
1996-01-01
The excitation of metastable states in an atomic beam apparatus by means of electron collision is a widespread technique. The authors have observed a large bistable behaviour in apparatus designed to provide an intense and collimated beam of metastable helium by excitation with orthogonally impinging electrons. This bistable behaviour largely affects the efficiency of the apparatus and is therefore worth of being carefully investigated. The apparatus has an electrode configuration equivalent to that of a tetrode valve with large intergrid distances. The bistability consists in a hysteresis cycle in the curve of the anode current vs. grid voltage. Experimental measurements, supported by a simple theoretical model and by numerical simulation, stress out the crucial role played by space charge effects for the onset of bistability. A comparison with previous observations of this phenomenon is given. Spontaneous current oscillations with various shapes have been recorded in one of the two curves of the hysteresis cycle
Apparatuses and methods for generating electric fields
Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L
2013-08-06
Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.
Apparatuses And Systems For Embedded Thermoelectric Generators
Hussain, Muhammad M.; Inayat, Salman Bin; Smith, Casey Eben
2013-01-01
An apparatus and a system for embedded thermoelectric generators are disclosed. In one embodiment, the apparatus is embedded in an interface where the ambient temperatures on two sides of the interface are different. In one embodiment, the apparatus is fabricated with the interface in integrity as a unitary piece. In one embodiment, the apparatus includes a first thermoelectric material embedded through the interface. The apparatus further includes a second thermoelectric material embedded through the interface. The first thermoelectric material is electrically coupled to the second thermoelectric material. In one embodiment, the apparatus further includes an output structure coupled to the first thermoelectric material and the second thermoelectric material and configured to output a voltage.
Apparatuses And Systems For Embedded Thermoelectric Generators
Hussain, Muhammad M.
2013-08-08
An apparatus and a system for embedded thermoelectric generators are disclosed. In one embodiment, the apparatus is embedded in an interface where the ambient temperatures on two sides of the interface are different. In one embodiment, the apparatus is fabricated with the interface in integrity as a unitary piece. In one embodiment, the apparatus includes a first thermoelectric material embedded through the interface. The apparatus further includes a second thermoelectric material embedded through the interface. The first thermoelectric material is electrically coupled to the second thermoelectric material. In one embodiment, the apparatus further includes an output structure coupled to the first thermoelectric material and the second thermoelectric material and configured to output a voltage.
International Nuclear Information System (INIS)
Snijkers, M.; Janssens, C.
1978-01-01
The working procedure has been established for the use of the high voltage electron microscope of the University of Antwerp (RUCA) as an apparatus for testing the swelling behavior of ferritic and austenitic stainless steels. The local temperature increase of the specimen due to beam heating was measured. The results are in good agreement with measurements done in other laboratories. The intensity of the transmitted beam has been measured as a function of specimen thickness (for thicknesses smaller than a few μ) The operation conditions are described for carrying out irradiation experiments and for taking stereo pairs. (author)
An electronic apparatus for early detection of changes in red cell ...
African Journals Online (AJOL)
1989-08-19
Aug 19, 1989 ... An electronic apparatus was developed for anaesthetists to use to detect changes in red cell concentration during sur- gery. The mechanism is based on the relationship between the red cell content and the electrical conductivity of blood. In a pilot study of 170 blood samples, a correlation coefficient.
An inverted-geometry, high voltage polarized electron gun with UHV load lock
International Nuclear Information System (INIS)
Breidenbach, M.; Foss, M.; Hodgson, J.; Kulikov, A.; Odian, A.; Putallaz, G.; Rogers, H.; Schindler, R.; Skarpaas, K.; Zolotorev, M.
1994-01-01
The design of a high voltage electron source with a GaAs photocathode and a load lock system is described. The inverted high voltage structure of the gun permits a compact and simple design. Test results demonstrate that the load lock system provides a reliable way to achieve high quantum efficiency of the photocathode in a high voltage device. ((orig.))
International Nuclear Information System (INIS)
Christophorou, L.G.; Allen, J.D.; Anderson, V.E.
1976-01-01
Research in atomic and molecular physics is reported. Studies included: experimental evidence for the existence of a Ramsauer-Townsend minimum in liquid methane and liquid argon; discovery of a Ramsauer-Townsend minimum in gaseous ethane and propane; motion of thermal electrons in n-alkane vapors; electron mobilities in high pressure gases; electron capture and drift in liquid media; electron attachment to molecules in dense gases; attachment of slow electrons to hexafluorobenzene; fragmentation of atmospheric halocarbons under electron impact; negative ion resonances and threshold electron excitation spectra of organic molecules; theoretical studies of negative-ion resonance states of organic molecules; kinetics of electron capture by sulfur hexafluoride in solution; interactions of slow electrons with benzene and benzene derivatives; Stokes and anti-Stokes fluorescence of 1 : 12-benzoperylene in solution; photoionization of molecules in liquid media; construction of high-voltage breakdown apparatus for gaseous insulation studies; measurements of the breakdown strengths of gaseous insulators and their relation to basic electron-collision processes; accuracy of the breakdown voltage measurements; and assembling basic data on electronegative gases of significance to breakdown
Evolution of graphene nanoribbons under low-voltage electron irradiation
Zhu, Wenpeng
2012-01-01
Though the all-semiconducting nature of ultrathin graphene nanoribbons (GNRs) has been demonstrated in field-effect transistors operated at room temperature with ∼105 on-off current ratios, the borderline for the potential of GNRs is still untouched. There remains a great challenge in fabricating even thinner GNRs with precise width, known edge configurations and specified crystallographic orientations. Unparalleled to other methods, low-voltage electron irradiation leads to a continuous reduction in width to a sub-nanometer range until the occurrence of structural instability. The underlying mechanisms have been investigated by the molecular dynamics method herein, combined with in situ aberration-corrected transmission electron microscopy and density functional theory calculations. The structural evolution reveals that the zigzag edges are dynamically more stable than the chiral ones. Preferential bond breaking induces atomic rings and dangling bonds as the initial defects. The defects grow, combine and reconstruct to complex edge structures. Dynamic recovery is enhanced by thermal activation, especially in cooperation with electron irradiation. Roughness develops under irradiation and reaches a plateau less than 1 nm for all edge configurations after longtime exposure. These features render low-voltage electron irradiation an attractive technique in the fabrication of ultrathin GNRs for exploring the ultimate electronic properties. © 2012 The Royal Society of Chemistry.
Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons
Energy Technology Data Exchange (ETDEWEB)
Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)
2007-02-21
During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.
An electronic apparatus for early detection of changes in red cell ...
African Journals Online (AJOL)
An electronic apparatus was developed for anaesthetists to use to detect changes in red cell concentration during surgery. The mechanism is based on the relationship between the red cell content and the electrical conductivity of blood. In a pilot study of 170 blood samples, a correlation coefficient of 0,9806 was obtained ...
Metz, Roger N.
1991-01-01
This paper discusses the numerical modeling of electron flows from the sheath surrounding high positively biased objects in LEO (Low Earth Orbit) to regions of voltage or shape discontinuity on the biased surfaces. The sheath equations are derived from the Two-fluid, Warm Plasma Model. An equipotential corner and a plane containing strips of alternating voltage bias are treated in two dimensions. A self-consistent field solution of the sheath equations is outlined and is pursued through one cycle. The electron density field is determined by numerical solution of Poisson's equation for the electrostatic potential in the sheath using the NASCAP-LEO relation between electrostatic potential and charge density. Electron flows are calculated numerically from the electron continuity equation. Magnetic field effects are not treated.
Innovative energy efficient low-voltage electron beam emitters
International Nuclear Information System (INIS)
Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.
2002-01-01
Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates
Innovative energy efficient low-voltage electron beam emitters
Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.
2002-03-01
Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates.
Symmetric low-voltage powering system for relativistic electronic devices
International Nuclear Information System (INIS)
Agafonov, A.V.; Lebedev, A.N.; Krastelev, E.G.
2005-01-01
A special driver for double-sided powering of relativistic magnetrons and several methods of localized electron flow forming in the interaction region of relativistic magnetrons are proposed and discussed. Two experimental installations are presented and discussed. One of them is designed for laboratory research and demonstration experiments at a rather low voltage. The other one is a prototype of a full-scale installation for an experimental research at relativistic levels of voltages on the microwave generation in the new integrated system consisting of a relativistic magnetron and symmetrical induction driver
International Nuclear Information System (INIS)
Wang Jian; Ju Sheng; Li, Z.Y.
2012-01-01
The effect of bias voltage on electron tunneling across a junction with a ferroelectric–ferromagnetic composite barrier is investigated theoretically. Because of the inversion symmetry breaking of the spontaneous ferroelectric polarization, bias voltage dependence of the electron tunneling shows significant differences between the positive bias and the negative one. The differences of spin filtering or tunnel magnetoresistance increase with the increasing absolute value of bias voltage. Such direction preferred electron tunneling is found intimately related with the unusual asymmetry of the electrical potential profile in two-phase composite barrier and provides a unique change to realize rectifying functions in spintronics. - Highlights: ► Electron tunneling across a ferroelectric–ferromagnetic composite barrier junction. ► TMR effect is different under the same value but opposite direction bias voltage. ► This directionality of the electron tunneling enhances with increasing bias voltage.
Directory of Open Access Journals (Sweden)
Xin-Bing Cheng
2011-04-01
Full Text Available The vacuum diode which is used to generate relativistic electron beams is one of the most important parts of a pulsed-power modulator. In this paper, the electron emission of cathode holder of a vacuum diode and its effect on the output voltage is investigated by experiments on an intense electron-beam accelerator with 180 ns full width at half maximum and 200–500 kV output voltage. First, the field emission is analyzed and the electric field of the vacuum chamber is calculated. Then, the flatness of the output voltage is discussed before and after adding an insulation plate when a water load is used. It is found that the electron emission at the edges of the cathode holder is the main reason to cause the change of the flatness. Last, a piece of polyester film is used as a target to further show the electron emission of the cathode holder. This analysis shows that decreasing the electron emission of the cathode holder in such a pulse power modulator could be a good way to improve the quality of the output voltage.
International Nuclear Information System (INIS)
Bradley, C.R.; Zaluzec, N.J.
1987-08-01
The development of medium voltage electron microscopes having high brightness electron sources and ultra-high vacuum environments has been anticipated by the microscopy community now for several years. The advantages of such a configuration have been discussed to great lengths, while the potential disadvantages have for the most part been neglected. The most detrimental of these relative to microcharacterization are the effects of electron sputtering and atomic displacement to the local specimen composition. These effects have in the past been considered mainly in the high voltage electron microscope regime and generally were ignored in lower voltage instruments. Recent experimental measurements have shown that the effects of electron sputtering as well as radiation induced segregation can be observed in conventional transmission electron microscopes. It is, therefore, important to determine at what point the effects will begin to manifest themselves in the new generation of medium voltage analytical electron microscopes. In this manuscript we present new calculations which allow the individual experimentalist to determine the potential threshold levels for a particular elemental system and thus avoid the dangers of introducing artifacts during microanalysis. 12 refs., 3 figs
Energy Technology Data Exchange (ETDEWEB)
Cogo, Joao Roberto [GSI Engenharia e Consultoria Ltda., Taubate, SP (Brazil)], Email: gsi@gsiconsultoria.com.br; Dommel, Hermann Wilhelm [University of British Columbia, Vancouver (Canada)], Email: hermannd@ece.ubc.ca
2007-07-01
The grounding of sensitive electronic equipment such as computers, programmable logic controllers (PLC), process control systems, and other electronic equipment is one of the most important considerations towards obtaining an efficient operation of such systems. Such equipment, which for the purposes of this work is called 'Sensitive Electronic Equipment - SEE' is very sensitive to faults and low intensity random voltages which have no effect upon the electrical power equipment and upon human beings. In this work, the grounding problem is evaluated, to guide the user on the proper installation of SEEs, so as to prevent them from being damaged. The following items will be discussed: voltages which SEEs are subject to during incidence of atmospheric surges in the distribution overhead lines to which they are connected; sustained voltage that the high voltage supply of SEEs must be able to withstand during line-to-ground faults that originate from atmospheric surges that reach the transmission lines which are connected to the electrical power self producers (or electrical power independent producers). (author)
METHOD AND APPARATUS FOR INJECTING AND TRAPPING ELECTRONS IN A MAGNETIC FIELD
Christofilos, N.C.
1962-05-29
An apparatus is designed for the manipulation of electrons in an exially symmetric magnetic field region and may be employed to trap electrons in such a field by directing an electron beam into a gradientially intensified field region therein to form an annular electron moving axially in the field and along a decreasing field gradient. Dissipative loop circuits such as resistive loops are disposed along at least the decreasing field gradient so as to be inductively coupled to the electron bunch so as to extract energy of the electron bunch and provide a braking force effective to reduce the velocity of the bunch. Accordingly, the electron bunch upon entering a lower intensity magnetic field region is retained therein since the electrons no longer possess sufficient energy to escape. (AEC)
Photon- and electron-induced surface voltage in electron spectroscopies on ZnSe(0 0 1)
International Nuclear Information System (INIS)
Cantoni, M.; Bertacco, R.; Brambilla, A.; Ciccacci, F.
2009-01-01
The surface band bending in ZnSe(0 0 1), as a function of the temperature, is investigated both in the valence band (by photoemission) and in the conduction band (by inverse photoemission and absorbed current spectroscopies). Two different mechanisms are invoked for interpreting the experimental data: the band bending due to surface states, and the surface voltage induced by the incident beam. While the latter is well known in photoemission (surface photovoltage), we demonstrate the existence of a similar effect in inverse photoemission and absorbed current spectroscopies, induced by the incident electrons instead of photons. These results point to the importance of considering the surface voltage effect even in electron-in techniques for a correct evaluation of the band bending.
A radiation research apparatus sensitive to wavelength
International Nuclear Information System (INIS)
1980-01-01
The apparatus described is equipped with a radiation source with a tuning device for the generation of X radiation of at least two different wavelength spectra. The detector with ionisation chamber is able to discriminate between these spectra. This is done with the aid of an auxillary electrode between the entrance window and a high voltage electrode. With a lower source of voltage this electrode has a potential equal to the high voltage electrode potential and with a higher voltage source it has a potential equal to the signal electrode potential. (Th.P.)
Design of full digital 50 kV electronic gun high voltage power supply
International Nuclear Information System (INIS)
Ge Lei; Shang Lei
2014-01-01
The design of full digital electronic gun high voltage power supply based on DSP was introduced in this paper. This power supply has innovations of full digital feedback circuit and PID closed-loop control mode. The application of high frequency resonant converter circuit reduces the size of the resonant element and transformer. The current-coupling distributed high voltage transformer and rectifier circuit were employed in this power supply. By this way, the power supply efficiency is improved and the number of distributed parameters is reduced, and the rectifier circuit could work under the oil-free environment. This power supply has been used in electronic grid-control high voltage system of the irradiation accelerator. (authors)
The Architecture Design of Detection and Calibration System for High-voltage Electrical Equipment
Ma, Y.; Lin, Y.; Yang, Y.; Gu, Ch; Yang, F.; Zou, L. D.
2018-01-01
With the construction of Material Quality Inspection Center of Shandong electric power company, Electric Power Research Institute takes on more jobs on quality analysis and laboratory calibration for high-voltage electrical equipment, and informationization construction becomes urgent. In the paper we design a consolidated system, which implements the electronic management and online automation process for material sampling, test apparatus detection and field test. In the three jobs we use QR code scanning, online Word editing and electronic signature. These techniques simplify the complex process of warehouse management and testing report transferring, and largely reduce the manual procedure. The construction of the standardized detection information platform realizes the integrated management of high-voltage electrical equipment from their networking, running to periodic detection. According to system operation evaluation, the speed of transferring report is doubled, and querying data is also easier and faster.
Energy Technology Data Exchange (ETDEWEB)
Chao, Jin Yu [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zhu, Li Qiang, E-mail: lqzhu@nimte.ac.cn; Xiao, Hui [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Yuan, Zhi Guo, E-mail: ncityzg@163.com [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China)
2015-12-21
Modulation of charge carrier density in condensed materials based on ionic/electronic interaction has attracted much attention. Here, protonic/electronic hybrid indium-zinc-oxide (IZO) transistors gated by chitosan based electrolyte were obtained. The chitosan-based electrolyte illustrates a high proton conductivity and an extremely strong proton gating behavior. The transistor illustrates good electrical performances at a low operating voltage of ∼1.0 V such as on/off ratio of ∼3 × 10{sup 7}, subthreshold swing of ∼65 mV/dec, threshold voltage of ∼0.3 V, and mobility of ∼7 cm{sup 2}/V s. Good positive gate bias stress stabilities are obtained. Furthermore, a low voltage driven resistor-loaded inverter was built by using an IZO transistor in series with a load resistor, exhibiting a linear relationship between the voltage gain and the supplied voltage. The inverter is also used for decreasing noises of input signals. The protonic/electronic hybrid IZO transistors have potential applications in biochemical sensors and portable electronics.
Electron heating of voltage-driven and matched dual frequency discharges
International Nuclear Information System (INIS)
Lieberman, M A; Lichtenberg, A J
2010-01-01
In a dual frequency capacitive sheath, a high frequency uniform sheath motion is coupled with a low frequency Child law sheath motion. For current-driven high and low frequency sheaths, the high frequency sheath motion generates most of the ohmic and stochastic heating of the discharge electrons. The low frequency motion, in addition to its primary purpose of establishing the ion bombarding energy, also increases the heating by widening the sheath width and transporting the oscillating electrons to regions of lower plasma density, and hence higher sheath velocity. In this work, we show that for voltage-driven high and low frequency sheaths, increasing the low frequency voltage reduces the heating, due to the reduced high frequency current that flows through the sheath under voltage-driven conditions. We determine the dependence of the heating on various parameters and compare the results with the current-driven case. Particle-in-cell simulations are used to confirm this result. Discharges generally employ a matching network to maximize the power transmitted to the plasma. We obtain analytic expressions for the effect of the low frequency source under matched conditions and, again, find that the low frequency source reduces the heating.
Power-supply system for high-voltage electron guns with grid control
International Nuclear Information System (INIS)
Grigorev, Y.V.
1985-01-01
A power-supply system for electron guns with grid control is described which consists of a source of accelerating voltage between 20 and 180 kV with a current of 100 mA and a control circuit for an electron gun that contains a pulse generator having an output voltage of up to 5 kV for pulse durations of 2, 10, 50 and 90 microseconds. The output pulses of the generator are synchronized with a certain phase of the cathode heater current of the gun, and they can be repeated at a frequency between 100 and 0.4 Hz. The system is reliable and resistant to the overloads associated with breakdowns in the gun
The supply voltage apparatus of the CUORE experiment
Energy Technology Data Exchange (ETDEWEB)
Arnaboldi, C.; Baú, A.; Carniti, P.; Cassina, L.; Giachero, A.; Gotti, C.; Maino, M.; Passerini, A. [INFN, Sezione di Milano Bicocca - Istituto Nazionale di Fisica Nucleare, Piazza della Scienza 3 Milano (Italy); Università di Milano Bicocca - Dipartimento di Fisica, Piazza della Scienza 3 Milano (Italy); Pessina, G., E-mail: Pessina@mib.infn.it [INFN, Sezione di Milano Bicocca - Istituto Nazionale di Fisica Nucleare, Piazza della Scienza 3 Milano (Italy); Università di Milano Bicocca - Dipartimento di Fisica, Piazza della Scienza 3 Milano (Italy)
2016-07-11
The Electronics system of experiments for the study of rare decays, such as the neutrino-less double beta decay, must be very stable over very long expected runs. We introduce our solution for the power supply of such an experiment, CUORE. In this case the power supply chain consists of a series of ACDCs, followed by DCDCs and then Linear Regulators. We emphasize here our approach to the DCDC regulation system that was designed with a complete rejection of the switching noise, across 100 MHz bandwidth. In the experimental layout the DCDC will be located far from the very front-end, with long connecting cables (10 m). We introduced our very simple and safe solution to prevent huge over-voltages, due to the energy stored in the inductance of the cables, generated after the release of accidental short circuits, so avoiding destructive effects. Some micro-controllers are present on every board and take care of the DCDC operation. These micro-controllers are managed from the control room, via CAN BUS protocol coupled via optical fibres. CUORE is an array of 1000 cryogenic detectors that will need 30 of our DCDCs.
The supply voltage apparatus of the CUORE experiment
Arnaboldi, C.; Baú, A.; Carniti, P.; Cassina, L.; Giachero, A.; Gotti, C.; Maino, M.; Passerini, A.; Pessina, G.
2016-07-01
The Electronics system of experiments for the study of rare decays, such as the neutrino-less double beta decay, must be very stable over very long expected runs. We introduce our solution for the power supply of such an experiment, CUORE. In this case the power supply chain consists of a series of ACDCs, followed by DCDCs and then Linear Regulators. We emphasize here our approach to the DCDC regulation system that was designed with a complete rejection of the switching noise, across 100 MHz bandwidth. In the experimental layout the DCDC will be located far from the very front-end, with long connecting cables (10 m). We introduced our very simple and safe solution to prevent huge over-voltages, due to the energy stored in the inductance of the cables, generated after the release of accidental short circuits, so avoiding destructive effects. Some micro-controllers are present on every board and take care of the DCDC operation. These micro-controllers are managed from the control room, via CAN BUS protocol coupled via optical fibres. CUORE is an array of 1000 cryogenic detectors that will need 30 of our DCDCs.
The supply voltage apparatus of the CUORE experiment
International Nuclear Information System (INIS)
Arnaboldi, C.; Baú, A.; Carniti, P.; Cassina, L.; Giachero, A.; Gotti, C.; Maino, M.; Passerini, A.; Pessina, G.
2016-01-01
The Electronics system of experiments for the study of rare decays, such as the neutrino-less double beta decay, must be very stable over very long expected runs. We introduce our solution for the power supply of such an experiment, CUORE. In this case the power supply chain consists of a series of ACDCs, followed by DCDCs and then Linear Regulators. We emphasize here our approach to the DCDC regulation system that was designed with a complete rejection of the switching noise, across 100 MHz bandwidth. In the experimental layout the DCDC will be located far from the very front-end, with long connecting cables (10 m). We introduced our very simple and safe solution to prevent huge over-voltages, due to the energy stored in the inductance of the cables, generated after the release of accidental short circuits, so avoiding destructive effects. Some micro-controllers are present on every board and take care of the DCDC operation. These micro-controllers are managed from the control room, via CAN BUS protocol coupled via optical fibres. CUORE is an array of 1000 cryogenic detectors that will need 30 of our DCDCs.
Choice of operating voltage for a transmission electron microscope
International Nuclear Information System (INIS)
Egerton, R.F.
2014-01-01
An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical
Advances in high voltage insulation and arc interruption in SF6 and vacuum
Maller, V N
1982-01-01
Advances in High Voltage Insulation and Arc Interruption in SF6 and Vacuum deals with high voltage breakdown and arc extinction in sulfur hexafluoride (SF6) and high vacuum, with special emphasis on the application of these insulating media in high voltage power apparatus and devices. The design and developmental aspects of various high voltage power apparatus using SF6 and high vacuum are highlighted. This book is comprised of eight chapters and opens with a discussion on electrical discharges in SF6 and high vacuum, along with the properties and handling of SF6 gas. The following chapters fo
SVC or VSC for reduction of voltage sags and flicker. Trends in power electronics
Energy Technology Data Exchange (ETDEWEB)
Haeusler, M; Schnettler, A [ABB Calor Emag Schaltanlagen AG, Mannheim (Germany); Halvarsson, P [ABB Power Systems AB, Vaesteraas (Sweden)
1997-07-01
In the past complaints about insufficient power quality were often caused by flicker observed in the neighbourhood of industrial networks. Voltage sags due to faults in the power system pass, however, mostly unnoticed as not-so-common events. Now electronic controls are penetrating more and more in industry. Electronic controllers on factory machines - particularly those for variable speed motors - are vulnerable to voltage sags. A one-tenth second sag can cause a $200.000 downtime incident in a big factory. Therefore the demands on power quality are rising in industry as well. The costly separation in clean networks for residential areas and dirty networks for industrial grids is no perfect solution to avoid such problems. Static VAr Compensators (SVC) are traditionally one means to control the voltage in industrial networks. Because of the recent development of powerful gate turn-off semiconductor devices another type of converter has gained new interest for mitigation of system disturbances, the voltage-source converter (VSC). The characteristics of both types of power electronics in view of their possibilities for this application are presented. (orig.)
Electron bunch structure in energy recovery linac with high-voltage dc photoelectron gun
Directory of Open Access Journals (Sweden)
Y. M. Saveliev
2016-09-01
Full Text Available The internal structure of electron bunches generated in an injector line with a dc photoelectron gun is investigated. Experiments were conducted on the ALICE (accelerators and lasers in combined experiments energy recovery linac at Daresbury Laboratory. At a relatively low dc gun voltage of 230 kV, the bunch normally consisted of two beamlets with different electron energies, as well as transverse and longitudinal characteristics. The beamlets are formed at the head and the tail of the bunch. At a higher gun voltage of 325 kV, the beam substructure is much less pronounced and could be observed only at nonoptimal injector settings. Experiments and computer simulations demonstrated that the bunch structure develops during the initial beam acceleration in the superconducting rf booster cavity and can be alleviated either by increasing the gun voltage to the highest possible level or by controlling the beam acceleration from the gun voltage in the first accelerating structure.
A high voltage test stand for electron gun qualification for LINACs
International Nuclear Information System (INIS)
Wanmode, Yashwant D.; Mulchandani, J.; Acharya, M.; Bhisikar, A.; Singh, H.G.; Shrivastava, Purushottam
2011-01-01
An electron gun lest stand has been developed at RRCAT. The test stand consists of a high voltage pulsed power supply, electron gun filament supply, grid supply, UHV system and electron gun current measurement system. Several electron guns developed indigenously were evaluated on this test stand. The shielding is provided for the electron gun set up. Electron gun tests can be tested upto 55 kV with pulse width of 15 microsecs and pulse repetition rates up to 200 Hz. The technical details of the subsystems are furnished and results of performance of the test stand have been reported in this paper. (author)
Xin-Bing Cheng; Jin-Liang Liu; Hong-Bo Zhang; Zhi-Qiang Hong; Bao-Liang Qian
2011-01-01
The vacuum diode which is used to generate relativistic electron beams is one of the most important parts of a pulsed-power modulator. In this paper, the electron emission of cathode holder of a vacuum diode and its effect on the output voltage is investigated by experiments on an intense electron-beam accelerator with 180 ns full width at half maximum and 200–500 kV output voltage. First, the field emission is analyzed and the electric field of the vacuum chamber is calculated. Then, the fla...
Method and apparatus for anti-islanding protection of distributed generations
Ye, Zhihong; John, Vinod; Wang, Changyong; Garces, Luis Jose; Zhou, Rui; Li, Lei; Walling, Reigh Allen; Premerlani, William James; Sanza, Peter Claudius; Liu, Yan; Dame, Mark Edward
2006-03-21
An apparatus for anti-islanding protection of a distributed generation with respect to a feeder connected to an electrical grid is disclosed. The apparatus includes a sensor adapted to generate a voltage signal representative of an output voltage and/or a current signal representative of an output current at the distributed generation, and a controller responsive to the signals from the sensor. The controller is productive of a control signal directed to the distributed generation to drive an operating characteristic of the distributed generation out of a nominal range in response to the electrical grid being disconnected from the feeder.
Jesse, Stephen [Knoxville, TN; Geohegan, David B [Knoxville, TN; Guillorn, Michael [Brooktondale, NY
2009-02-17
Methods and apparatus are described for SEM imaging and measuring electronic transport in nanocomposites based on electric field induced contrast. A method includes mounting a sample onto a sample holder, the sample including a sample material; wire bonding leads from the sample holder onto the sample; placing the sample holder in a vacuum chamber of a scanning electron microscope; connecting leads from the sample holder to a power source located outside the vacuum chamber; controlling secondary electron emission from the sample by applying a predetermined voltage to the sample through the leads; and generating an image of the secondary electron emission from the sample. An apparatus includes a sample holder for a scanning electron microscope having an electrical interconnect and leads on top of the sample holder electrically connected to the electrical interconnect; a power source and a controller connected to the electrical interconnect for applying voltage to the sample holder to control the secondary electron emission from a sample mounted on the sample holder; and a computer coupled to a secondary electron detector to generate images of the secondary electron emission from the sample.
Thermally-induced voltage alteration for integrated circuit analysis
Energy Technology Data Exchange (ETDEWEB)
Cole, E.I. Jr.
2000-06-20
A thermally-induced voltage alteration (TIVA) apparatus and method are disclosed for analyzing an integrated circuit (IC) either from a device side of the IC or through the IC substrate to locate any open-circuit or short-circuit defects therein. The TIVA apparatus uses constant-current biasing of the IC while scanning a focused laser beam over electrical conductors (i.e. a patterned metallization) in the IC to produce localized heating of the conductors. This localized heating produces a thermoelectric potential due to the Seebeck effect in any conductors with open-circuit defects and a resistance change in any conductors with short-circuit defects, both of which alter the power demand by the IC and thereby change the voltage of a source or power supply providing the constant-current biasing. By measuring the change in the supply voltage and the position of the focused and scanned laser beam over time, any open-circuit or short-circuit defects in the IC can be located and imaged. The TIVA apparatus can be formed in part from a scanning optical microscope, and has applications for qualification testing or failure analysis of ICs.
International Nuclear Information System (INIS)
Wrigglesworth, K.J.; Knowles, J.F.
1987-01-01
The patent concerns a pipework inspection apparatus, which is capable of negotiating bends in pipework. The apparatus comprises a TV camera system, which contains an optical section and an electronics section, which are connected by a flexible coupling. The system can be pulled or pushed along the bore of the pipework. (U.K.)
Control and protection system for an electron injector installed in a high-voltage terminal
International Nuclear Information System (INIS)
Martin, D.; Radu, A.; Baciu, G.; Grigore, D.
1979-01-01
The basic principles of operation of the control and protection system for an electron accelerator gun are described. The electron gun parameters are independently controlled by using four special secondary windings of the high-voltage transformer providing the accelerating voltage. Four groups of thyristor ac regulators employing phase control are connected so as to provide independent adjustment of each parameter of the gun. The power controller of modular construction has a single-phase supply from the 50 Hz 220 V mains. (orig.)
Progress in element analysis on a high-voltage electron microscope
International Nuclear Information System (INIS)
Tivol, W.F.; Barnard, D.; Guha, T.
1985-01-01
X-Ray microprobe (XMA) and electron energy-loss (EELS) spectrometers have been installed on the high-voltage electron microscope (HVEM). The probe size has been measured and background reduction is in progress for XMA and EELS as are improvements in electron optics for EELS and sensitivity measurements. XMA is currently useful for qualitative analysis and has been used by several investigators from our laboratory and outside laboratories. However, EELS background levels are still too high for meaningful results to be obtained. Standards suitable for biological specimens are being measured, and a library for quantitative analysis is being compiled
Effect of secondary electron emission on subnanosecond breakdown in high-voltage pulse discharge
Schweigert, I. V.; Alexandrov, A. L.; Gugin, P.; Lavrukhin, M.; Bokhan, P. A.; Zakrevsky, Dm E.
2017-11-01
The subnanosecond breakdown in open discharge may be applied for producing superfast high power switches. Such fast breakdown in high-voltage pulse discharge in helium was explored both in experiment and in kinetic simulations. The kinetic model of electron avalanche development was developed using PIC-MCC technique. The model simulates motion of electrons, ions and fast helium atoms, appearing due to ions scattering. It was shown that the mechanism responsible for ultra-fast breakdown development is the electron emission from cathode. The photoemission and emission by ions or fast atoms impact is the main reason of current growth at the early stage of breakdown, but at the final stage, when the voltage on discharge gap drops, the secondary electron emission (SEE) is responsible for subnanosecond time scale of current growth. It was also found that the characteristic time of the current growth τS depends on the SEE yield of the cathode material. Three types of cathode material (titanium, SiC, and CuAlMg-alloy) were tested. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time as small as τS = 0.4 ns, for the pulse voltage amplitude of 5- 12 kV..
Kumagai, Kazuhiro; Sekiguchi, Takashi
2009-03-01
To understand secondary electron (SE) image formation with in-lens and out-lens detector in low-voltage scanning electron microscopy (LV-SEM), we have evaluated SE signals of an in-lens and an out-lens detector in LV-SEM. From the energy distribution spectra of SEs with various boosting voltages of the immersion lens system, we revealed that the electrostatic field of the immersion lens mainly collects electrons with energy lower than 40eV, acting as a low-pass filter. This effect is also observed as a contrast change in LV-SEM images taken by in-lens and out-lens detectors.
Programmers for diagnostic x-ray apparatus
International Nuclear Information System (INIS)
1981-01-01
Novel apparatus is described for providing a pre-programmed selection of various parameters in X-ray radiography. The equipment consists of push-buttons which prompt the radiographer to make decisions such as thickness of patient, part of the anatomy to be X-rayed etc. From these data the apparatus selects the appropriate parameters such as H.T. voltage, current, product of current and irradiation time etc. The values of these parameters are displayed to the radiographer and facilities are provided to override the programmed parameters at the radiographer's discretion. (U.K.)
Methods of measurements on incidental X-radiation from electron tubes
International Nuclear Information System (INIS)
1977-01-01
The standard describes the method for detection of x-radiation and the method for the direct and indirect measurement of field pattern and exposure rate of random incidental radiation emanating from high voltage electron tubes. Required apparatus and calibration procedure for the exposure rate meter or film mount are described. (M.G.B.)
Polarization Imaging Apparatus with Auto-Calibration
Zou, Yingyin Kevin (Inventor); Zhao, Hongzhi (Inventor); Chen, Qiushui (Inventor)
2013-01-01
A polarization imaging apparatus measures the Stokes image of a sample. The apparatus consists of an optical lens set, a first variable phase retarder (VPR) with its optical axis aligned 22.5 deg, a second variable phase retarder with its optical axis aligned 45 deg, a linear polarizer, a imaging sensor for sensing the intensity images of the sample, a controller and a computer. Two variable phase retarders were controlled independently by a computer through a controller unit which generates a sequential of voltages to control the phase retardations of the first and second variable phase retarders. A auto-calibration procedure was incorporated into the polarization imaging apparatus to correct the misalignment of first and second VPRs, as well as the half-wave voltage of the VPRs. A set of four intensity images, I(sub 0), I(sub 1), I(sub 2) and I(sub 3) of the sample were captured by imaging sensor when the phase retardations of VPRs were set at (0,0), (pi,0), (pi,pi) and (pi/2,pi), respectively. Then four Stokes components of a Stokes image, S(sub 0), S(sub 1), S(sub 2) and S(sub 3) were calculated using the four intensity images.
High voltage processing of the SLC polarized electron gun
International Nuclear Information System (INIS)
Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.
1993-04-01
The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described
Use of high voltage electron microscope to simulate radiation damage by neutrons
International Nuclear Information System (INIS)
Mayer, R.M.
1976-01-01
The use of the high voltage electron microscope to simulate radiation damage by neutrons is briefly reviewed. This information is important in explaining how alloying affects void formation during neutron irradiation
The effect of voltage droop on the output of an electrostatic accelerator free electron laser
International Nuclear Information System (INIS)
Wright, C.C.; Al-Shamma'a, A.I.; Lucas, J.; Stuart, R.A.
2000-01-01
Electrostatic accelerator FEL oscillators when operated with energy recovery offer the prospect of long pulse, single-mode operation with very narrow linewidth at high-power levels. However, special care with wiggler construction, electron beam steering, and collector design is necessary to reduce the fraction of the electron beam lost before depressed collection to a sufficiently small value to stop the output hopping from one longitudinal mode of the cavity to another due to the droop of the terminal accelerating voltage. We are investigating what minimum recovery fraction is required both experimentally and theoretically. We have constructed a pulsed microwave FEM oscillator having an accelerating voltage of 65 kV supplied by a source, which is a capacitor, charged by a low-current, high-voltage supply. By changing the capacitor value, it is easily possible to achieve a range of voltage droop rates. Furthermore, because the gain bandwidth of the FEM is small, only 1 or 2 longitudinal modes are capable of being amplified at any voltage which eases the problem of analysing mode hopping behaviour. A simple model of mode switching is outlined
Method and apparatus for current-output peak detection
De Geronimo, Gianluigi
2017-01-24
A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.
International Nuclear Information System (INIS)
Prajitno; Sudiyanto; Djaziman
2000-01-01
Hardwired electronic circuit of protection system to prevent high voltagegenerator EBM have been made. The protection system consists of processparameters such as safety parameter, dynamic logic circuits and interlockrelay drive circuits. Safety parameters using transducer which is factorymade so that the accuracy and reliability could be controlled. A good resultof electronic circuit has been tested which cover: water flow and temperaturemonitoring, grid current, anode current, anode voltage and logic control. Therange of monitoring temperature from 30 o C to 100 o C with output voltagefrom 1.47 V to 5.38 V. The voltage output of water flow monitoring is 0.083 Vto 3.391 V which is equivalent to 1.5 - 30 l/min. Response time of the logiccontrol about 10 ms. By using design and construction of protection system,have been through about the security aspect of high voltage generatoroperation and also system will give early warning if the disturbance andabnormal operation occurred. (author)
Electron beam producing system for very high acceleration voltages and beam powers
International Nuclear Information System (INIS)
Andelfinger, C.; Dommaschk, W.; Ott, W.; Ulrich, M.; Weber, G.
1975-01-01
An electron beam producing system for acceleration voltages on the order of megavolts and beam powers on the order of gigawatts is described. A tubular housing of insulating material is used, and adjacent to its one closed end, a field emission cathode with a large surface area is arranged, while at its other end, from which the electron beam emerges, an annular anode is arranged. The device for collimating the electron beam consists of annular electrodes. (auth)
Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...
The effect of voltage droop on the output of an electrostatic accelerator free electron laser
Wright, C C; Lucas, J; Stuart, R A
2000-01-01
Electrostatic accelerator FEL oscillators when operated with energy recovery offer the prospect of long pulse, single-mode operation with very narrow linewidth at high-power levels. However, special care with wiggler construction, electron beam steering, and collector design is necessary to reduce the fraction of the electron beam lost before depressed collection to a sufficiently small value to stop the output hopping from one longitudinal mode of the cavity to another due to the droop of the terminal accelerating voltage. We are investigating what minimum recovery fraction is required both experimentally and theoretically. We have constructed a pulsed microwave FEM oscillator having an accelerating voltage of 65 kV supplied by a source, which is a capacitor, charged by a low-current, high-voltage supply. By changing the capacitor value, it is easily possible to achieve a range of voltage droop rates. Furthermore, because the gain bandwidth of the FEM is small, only 1 or 2 longitudinal modes are capable of b...
Apparatus and methods for investigations into acoustic properties of electronic melts
International Nuclear Information System (INIS)
Glazov, V.M.; Timoshenko, V.I.; Kim, S.G.
1985-01-01
Apparatus and highly sensitive methods of systematic investigations into acoustic properties of electronic melts are described. A variant of a measuring cell to investigate agressive melts is presented. A new technique for the reception of an acoustic contact with high transmission capacity of ultrasonic wave based on utilization of clarified layers of liquid boron anhydride is described. Results of calibration tests on lead and aluminium melts point to a good agreement with literature data. High sensitivity of the above technique allows one to reveal thin structural effects in melts
Calculation of current-voltage characteristics of electron-capture detectors
International Nuclear Information System (INIS)
Hinneburg, D.; Grosse, H.J.; Leonhardt, J.; Popp, P.
1983-01-01
Starting from the law of conservation of charge a stationary one-dimensional non-linear differential equation system is derived, which is applied to the direct-current mode of an electron-capture detector with parallel electrode plates. The theory takes into account space-charge, recombination, and inhomogeneous ionization and it deals with three kinds of charge carriers with different mobilities (positive and negative ions, electrons). Terms due to diffusion and gas-flow losses are excluded. The equations so constructed were programmed to get a means of calculating the charge and field distributions and the current-voltage characteristics as functions of various parameters of the detectors, the attaching gas and the ionization. For two cases the results are given. (author)
This report evaluates a high-voltage electron beam (E-beam) technology's ability to destroy volatile organic compounds (VOCs) and other contaminants present in liquid wastes. Specifically, this report discusses performance and economic data from a Superfund Innovative Technology...
The state of the art of the development of SMES for bridging instantaneous voltage dips in Japan
Nagaya, Shigeo; Hirano, Naoki; Katagiri, Toshio; Tamada, Tsutomu; Shikimachi, Koji; Iwatani, Yu; Saito, Fusao; Ishii, Yusuke
2012-12-01
Development of apparatuses for protecting industrial facilities such as semiconductor plants or information industries from instantaneous voltage dips, which requires very large output power, has been expected. A Superconducting magnetic energy storage system (SMES), one of such apparatus, consists of superconducting magnets that must withstand high voltage during operation and require high reliability. We have already development of SMES using conventional superconducting coils and done the field test of the SMES for bridging instantaneous voltage dips. After field test, the commercial SMES for instantaneous voltage dips is working there. Since field test has started, we have confirmed nearly 40 operations, and all have succeeded. In 2011, three commercial SMES units for bridging instantaneous voltage dips are operating in Japan.
Ion Back-Bombardment of GaAs Photocathodes Inside DC High Voltage Electron Guns
Grames, Joseph M; Brittian, Joshua; Charles, Daniel; Clark, Jim; Hansknecht, John; Lynn Stutzman, Marcy; Poelker, Matthew; Surles-Law, Kenneth E
2005-01-01
The primary limitation for sustained high quantum efficiency operation of GaAs photocathodes inside DC high voltage electron guns is ion back-bombardment of the photocathode. This process results from ionization of residual gas within the cathode/anode gap by the extracted electron beam, which is subsequently accelerated backwards to the photocathode. The damage mechanism is believed to be either destruction of the negative electron affinity condition at the surface of the photocathode or damage to the crystal structure by implantation of the bombarding ions. This work characterizes ion formation within the anode/cathode gap for gas species typical of UHV vacuum chambers (i.e., hydrogen, carbon monoxide and methane). Calculations and simulations are performed to determine the ion trajectories and stopping distance within the photocathode material. The results of the simulations are compared with test results obtained using a 100 keV DC high voltage GaAs photoemission gun and beamline at currents up to 10 mA D...
A quantum accurate waveform synthesizer as a voltage reference for an electronic primary thermometer
Pollarolo, Alessio; Benz, Samuel; Rogalla, Horst; Dresselhaus, Paul
2014-03-01
We are using a quantum voltage noise source (QVNS) for use as an intrinsically accurate voltage reference for a new type of electronic temperature standard. In Johnson Noise Thermometry (JNT) the noise of a resistor is used to measure temperature or Boltzmann's constant k, because the Nyquist equation =4kTR Δf shows that the power spectral density is proportional to k, temperature T, resistance R and measurement bandwidth Δf . The QVNS is a digital to analog converter used to synthesize a voltage waveform that resembles pseudo-random noise comparable in amplitude to the resistor noise. The signal generated is a frequency comb of harmonics tones that are equally spaced in frequency, all having identical amplitudes but random phases. The QVNS is an array superconducting Josephson junctions that are biased with a pulsed waveform clocked at 10 GHz. The accuracy of the voltage waveform derives from the identical voltage pulses produced by each junction that are perfectly quantized because their time-integrals are always equal to flux quantum h/2 e. The time-dependent output voltage waveform is determined by the number of pulses and their density in time. The measurement electronics exploits cross-correlation techniques to reduce the uncorrelated measurement noise so as to reveal the resistor noise, both of which are on the order of 2 nV/ √Hz. With this technique we have measured k with an uncertainty of about one part in 105, which we hope to improve by another order of magnitude with further research.
Directory of Open Access Journals (Sweden)
Dinorah D. Echeverría
2006-09-01
Full Text Available The aim of this study is to describe the horny structures of the buccal apparatus and buccopharyngeal cavity of A. salai by means ofscanning electron microscopy (SEM, and to compare them to those of the other known species of Atelognathus and related genera.
Switching phenomena in high-voltage circuit breakers
International Nuclear Information System (INIS)
Nakanishi, K.
1991-01-01
The topics covered in this book include: general problems concerning current interruption, the physical arc model, and miscellaneous types of modern switching apparatus, such as gas circuit breakers, gas-insulated switch-gear, vacuum circuit breakers and high-voltage direct-current circuit breakers
Development of an environmental high-voltage electron microscope for reaction science.
Tanaka, Nobuo; Usukura, Jiro; Kusunoki, Michiko; Saito, Yahachi; Sasaki, Katuhiro; Tanji, Takayoshi; Muto, Shunsuke; Arai, Shigeo
2013-02-01
Environmental transmission electron microscopy and ultra-high resolution electron microscopic observation using aberration correctors have recently emerged as topics of great interest. The former method is an extension of the so-called in situ electron microscopy that has been performed since the 1970s. Current research in this area has been focusing on dynamic observation with atomic resolution under gaseous atmospheres and in liquids. Since 2007, Nagoya University has been developing a new 1-MV high voltage (scanning) transmission electron microscope that can be used to observe nanomaterials under conditions that include the presence of gases, liquids and illuminating lights, and it can be also used to perform mechanical operations to nanometre-sized areas as well as electron tomography and elemental analysis by electron energy loss spectroscopy. The new instrument has been used to image and analyse various types of samples including biological ones.
International Nuclear Information System (INIS)
Forneris, J.L.; Hicks, W.W.; Keller, J.H.; McKenna, C.M.; Siermarco, J.A.; Mueller, W.F.
1981-01-01
The invention relates to ion bombardment or implantation apparatus. It comprises an apparatus for bombarding a target with a beam of ions, including an arrangement for measuring the ion beam current and controlling the surface potential of the target. This comprises a Faraday cage formed, at least in part, by the target and by walls adjacent to, and electrically insulated from, the target and surrounding the beam. There is at least one electron source for supplying electrons to the interior of the Faraday cage and means within the cage for blocking direct rectilinear radiation from the source to the target. The target current is measured and combined with the wall currents to provide a measurement of the ion beam current. The quantity of electrons supplied to the interior of the cage can be varied to control the target current and thereby the target surface potential. (U.K.)
Apparatus and method for defect testing of integrated circuits
Cole, Jr., Edward I.; Soden, Jerry M.
2000-01-01
An apparatus and method for defect and failure-mechanism testing of integrated circuits (ICs) is disclosed. The apparatus provides an operating voltage, V.sub.DD, to an IC under test and measures a transient voltage component, V.sub.DDT, signal that is produced in response to switching transients that occur as test vectors are provided as inputs to the IC. The amplitude or time delay of the V.sub.DDT signal can be used to distinguish between defective and defect-free (i.e. known good) ICs. The V.sub.DDT signal is measured with a transient digitizer, a digital oscilloscope, or with an IC tester that is also used to input the test vectors to the IC. The present invention has applications for IC process development, for the testing of ICs during manufacture, and for qualifying ICs for reliability.
Apparatus and method for the electrolysis of water
Greenbaum, Elias
2015-04-21
An apparatus for the electrolytic splitting of water into hydrogen and/or oxygen, the apparatus comprising: (i) at least one lithographically-patternable substrate having a surface; (ii) a plurality of microscaled catalytic electrodes embedded in said surface; (iii) at least one counter electrode in proximity to but not on said surface; (iv) means for collecting evolved hydrogen and/or oxygen gas; (v) electrical powering means for applying a voltage across said plurality of microscaled catalytic electrodes and said at least one counter electrode; and (vi) a container for holding an aqueous electrolyte and housing said plurality of microscaled catalytic electrodes and said at least one counter electrode. Electrolytic processes using the above electrolytic apparatus or functional mimics thereof are also described.
Design of neutral particle incident heating apparatus for large scale helical apparatus
Energy Technology Data Exchange (ETDEWEB)
Kaneko, Osamu; Oka, Yoshihide; Osakabe, Masaki; Takeiri, Yasuhiko; Tsumori, Katsuyoshi; Akiyama, Ryuichi; Asano, Eiji; Kawamoto, Toshikazu; Kuroda, Tsutomu [National Inst. for Fusion Science, Nagoya (Japan)
1997-02-01
In the Institute of Nuclear Fusion Science, construction of the large scale helical apparatus has been progressed favorably, and constructions of the heating apparatus as well as of electron resonance apparatus were begun in their orders under predetermined manner since 1994 fiscal year. And, on 1995 fiscal year, construction of neutral particle incident heating apparatus, leading heat apparatus, was begun under 3 years planning. The plasma heating study system adopted the study results developed in this institute through the large scale hydrogen negative ion source and also adopted thereafter development on nuclear fusion study by modifying the original specification set at the beginning of the research plan before 7 years. As a result, system design was changed from initial 125 KeV to 180 KeV in the beam energy and to execute 15 MW incidence using two sets beam lines, to begin its manufacturing. Here is described on its new design with reason of its modifications. (G.K.)
Disinfection of sludge and waste-water by irradiation with electrons of low accelerating voltage
International Nuclear Information System (INIS)
Holl, P.; Schneider, H.
1975-01-01
From the point of view of hygiene, sewage sludge and water accumulating in ever increasing quantities, some of which is used in agriculture, represent a potential threat to the health of man and beast, as well as to the environment. It is known that these chains of infection can be broken up by ionizing radiation. The use of natural ionizing radiation or electron radiation with high accelerating voltage has not been accepted in practice because the radiation cannot be cut off and the investment cost for electron accelerators with an accelerating voltage of more than 1 MV is very high. These disadvantages may be overcome by using an electron accelerator with low accelerating voltage. Complex experiments have shown that it is not necessary to adapt the thickness of sewage sludge or water layer to the range of electrons. The layer to be irradiated may be much thicker if the substrate is revolved during irradiation. The advantages of this method are low accelerating voltage for the electrons and hence less costly radiation shielding, complete absorption of the radiated energy by the substrate, and low investment and operating cost. The sterilizing effect of the process can be explained by the secondary reactions that take place in the water, in addition to the primary reactions, when irradiating with high specific ionizing density. It is known from experiments carried out by Muenzner that water irradiated with electrons of high specific ionization density, when added to bacterial cultures, will destroy them. This is explained by the Weiss radical theory of water, with reaction products such as H 2 , O 2 and H 2 O 2 . The success of this process is shown by experiments with Escherichia coli, tap water to which Salmonella senftenberg were added, and by the content of Enterobacteriaceae in various sludges as a function of the irradiation period, as well as by the rate at which various invariable species of strongilide larvae, eggs of Ascaris suum, Fasciola hepatica and
Energy Technology Data Exchange (ETDEWEB)
Martínez, G.; Fernández-Martín, M. [Dept. Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Sise, O. [Dept. of Science Education, Faculty of Education, Suleyman Demirel University, 32260 Isparta (Turkey); Madesis, I.; Dimitriou, A. [Dept. of Physics, University of Crete, P.O. Box 2208, GR 71003 Heraklion, Crete (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR 15310 Agia Paraskevi (Greece); Laoutaris, A. [Dept. of Applied Physics, National Technical University of Athens, GR 15780 Zografou (Greece); Zouros, T.J.M. [Dept. of Physics, University of Crete, P.O. Box 2208, GR 71003 Heraklion, Crete (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR 15310 Agia Paraskevi (Greece)
2016-02-15
We present simulation results for a biased paracentric hemispherical deflector analyzer equipped with a 4-element input lens and a position sensitive detector used in our zero-degree Auger projectile spectroscopy apparatus. Calculations of electron trajectories traversing the lens and analyzer fields were performed and cross checked using both boundary-element and finite-difference methods. The two middle lens electrode voltages were varied as free parameters, while various criteria were used to select their optimal values in an effort to obtain improved energy resolution.
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
The energy spectrum of the 'runaway' electrons from a high voltage pulsed discharge
International Nuclear Information System (INIS)
Ruset, C.
1985-01-01
Some experimental results are presented on the influence of the pressure upon the energy spectrum of the runaway electrons generated into a pulsed high voltage argon discharge. These electrons enter a state of continuous acceleration between two collisions with rapidly increasing free path. The applied discharge current varies from 10 to 300 A, the pulse time is about 800 ns. Relativistic effects are taken into consideration. Theoretical explanation is based on the pnenomenon of electron spreading on plasma oscillations. (D.Gy.)
Advanced stability control of multi-machine power system by vips apparatus
Energy Technology Data Exchange (ETDEWEB)
Yokoyama, A [Tokyo Univ., Tokyo (Japan). Dept. of Electrical Engineering; Sekine, Y [Science Univ. of Tokyo, Tokyo (Japan). Dept. of Electrical Engineering
1994-12-31
New technology such as synchronized switching and power electronics will make it possible to change the configuration of transmission network, the impedances of transmission lines and the phase angles of voltage in the future power systems. This paper presents a comprehensive power system damping control by power electronics based variable impedance apparatus such as variable series capacitor and high speed phase shifter and also shows a novel switching-over control of transmission lines by synchronized switching for the first awing stability and damping enhancement. The control scheme discussed in this paper is based on an energy function of multi-machine power system and its time derivative. Its effectiveness is demonstrated by digital simulations and eigenvalue analysis in multi-machine test systems. It is demonstrated that multiple switching of transmission lines improves damping in the post-fault conditions. (author) 13 refs., 24 figs., 5 tabs.
International Nuclear Information System (INIS)
Luthjens, L.H.; Vermeulen, M.J.W.; Hom, M.L.
1980-01-01
An optically isolated electronic trigger system for a pulsed Van de Graaff electron accelerator, producing an external pretrigger pulse 75 ns before arrival of the electron pulse at the target, is described. The total time jitter between trigger signal and electron pulse is 50 ps. The measurement of optical and electrical transients on a subnanosecond time scale with a sequential sampling oscilloscope is demonstrated. The contribution of various parts of the equipment to the total jitter is discussed. Those contributions to the jitter due to the electron transit time fluctuations in the accelerator assuming a constant acceleration voltage gradient and to the shot noise in the photomultiplier detector of the trigger system are calculated to be 5 ps and 12 to 21 ps respectively. Comparison with the experimental results leads to the conclusion that a considerable part of the total jitter may be attributed to acceleration voltage gradient fluctuations, to accelerator vibrations and possibly to density fluctuations in the insulation gas. Possible improvements of the trigger system are discussed. The apparatus is used for pulse radiolysis experiments with subnanosecond time resolution down to 100 ps in combination with subnanosecond time duration electron pulses
Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.
2017-09-01
The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.
TiN coated aluminum electrodes for DC high voltage electron guns
International Nuclear Information System (INIS)
Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew
2015-01-01
Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes
Specifications for surface reaction analysis apparatus
International Nuclear Information System (INIS)
Teraoka, Yuden; Yoshigoe, Akitaka
2001-03-01
A surface reaction analysis apparatus was installed at the JAERI soft x-ray beamline in the SPring-8 as an experimental end-station for the study of surface chemistry. The apparatus is devoted to the study concerning the influence of translational kinetic energy of incident molecules to chemical reactions on solid surfaces with gas molecules. In order to achieve the research purpose, reactive molecular scattering experiments and photoemission spectroscopic measurements using synchrotron radiation are performed in that apparatus via a supersonic molecular beam generator, an electron energy analyzer and a quadrupole mass analyzer. The detail specifications for the apparatus are described in this report. (author)
Low-voltage protonic/electronic hybrid indium zinc oxide synaptic transistors on paper substrates
International Nuclear Information System (INIS)
Wu, Guodong; Wan, Changjin; Wan, Qing; Zhou, Jumei; Zhu, Liqiang
2014-01-01
Low-voltage (1.5 V) indium zinc oxide (IZO)-based electric-double-layer (EDL) thin-film transistors (TFTs) gated by nanogranular proton conducting SiO 2 electrolyte films are fabricated on paper substrates. Both enhancement-mode and depletion-mode operation are obtained by tuning the thickness of the IZO channel layer. Furthermore, such flexible IZO protonic/electronic hybrid EDL TFTs can be used as artificial synapses, and synaptic stimulation response and short-term synaptic plasticity function are demonstrated. The protonic/electronic hybrid EDL TFTs on paper substrates proposed here are promising for low-power flexible paper electronics, artificial synapses and bioelectronics. (paper)
Liu, Zhe; Jiang, Liwei; Zheng, Yisong
2015-02-04
By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.
Operation Manual of the high voltage generator of the Pelletron electron accelerator
International Nuclear Information System (INIS)
Hernandez M, V.; Lopez V, H.; Alba P, U.
1988-04-01
The first version of a manual to operate the generator of high voltage generator of the Pelletron electron accelerator built in the ININ is presented. Since this generator has several components and/or elements, the one manual present has the purpose that the armed one or maintenance of anyone on its parts, is carried out in an orderly and efficient way. (Author)
Studies of dislocation loops produced by irradiation of ZnO in a high-voltage electron microscope
International Nuclear Information System (INIS)
Yoshiie, T.; Iwanaga, H.; Shibata, N.; Suzuki, K.; Takeuchi, S.
1980-01-01
Electron-irradiation studies on vapour-grown ZnO ribbon crystals have been carried out in situ in a high-voltage electron microscope. Dislocation loops nucleate both on stacking-fault planes and in the matrix by irradiation with electron accelerated through voltages higher than 700 kV at room temperature. Two types of loops with the Burgers vectors b=1/2c and b=a exist in the matrix, where a=1/3 and c=[0001]. On the other hand, loops with b=1/2c+a/3 and those with b=1/2c are formed on the prismatic fault planes and basal fault planes, respectively. Diffraction-contrast experiments show these loops to be of interstitial type. A re-irradiation experiment after the annealing indicates a possibility that there exist vacancies in the matrix at 700 0 C. (author)
Voltage-sensitive dye recording from networks of cultured neurons
Chien, Chi-Bin
This thesis describes the development and testing of a sensitive apparatus for recording electrical activity from microcultures of rat superior cervical ganglion (SCG) neurons by using voltage-sensitive fluorescent dyes.The apparatus comprises a feedback-regulated mercury arc light source, an inverted epifluorescence microscope, a novel fiber-optic camera with discrete photodiode detectors, and low-noise preamplifiers. Using an NA 0.75 objective and illuminating at 10 W/cm2 with the 546 nm mercury line, a typical SCG neuron stained with the styryl dye RH423 gives a detected photocurrent of 1 nA; the light source and optical detectors are quiet enough that the shot noise in this photocurrent--about.03% rms--dominates. The design, theory, and performance of this dye-recording apparatus are discussed in detail.Styryl dyes such as RH423 typically give signals of 1%/100 mV on these cells; the signals are linear in membrane potential, but do not appear to arise from a purely electrochromic mechanism. Given this voltage sensitivity and the noise level of the apparatus, it should be possible to detect both action potentials and subthreshold synaptic potentials from SCG cell bodies. In practice, dye recording can easily detect action potentials from every neuron in an SCG microculture, but small synaptic potentials are obscured by dye signals from the dense network of axons.In another microculture system that does not have such long and complex axons, this dye-recording apparatus should be able to detect synaptic potentials, making it possible to noninvasively map the synaptic connections in a microculture, and thus to study long-term synaptic plasticity.
Radiation effects on residual voltage of polyethylene films
International Nuclear Information System (INIS)
Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.
1986-01-01
It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)
Spectrum analysis of a voltage source converter due to semiconductor voltage drops
DEFF Research Database (Denmark)
Rasmussen, Tonny Wederberg; Eltouki, Mustafa
2017-01-01
It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...
Apparatus for the direct conversion of the kinetic energy of charged particles
International Nuclear Information System (INIS)
Mims, L.S.
1976-01-01
An apparatus for converting the output of a high voltage dc source to a lower voltage and a higher current is described. The conversion system is comprised of a plurality of power conversion modules connected electrically in series across the dc source output so that each of the power conversion modules receives only a portion of the high voltage. Each power conversion module includes means for converting the high voltage portion to an ac signal and transformer means for reducing the voltage and increasing the current of such ac signal, the outputs of all of the transformers being connected electrically in parallel. Each of the power conversion means includes a pair of capacitors which are charged by the high voltage dc source and which are alternately, periodically only slightly discharged to convert the dc voltage to an ac signal
OBSERVATION OF MAGNETIC DOMAINS IN IRRADIATED TRANSITION METALS BY HIGH VOLTAGE ELECTRON MICROSCOPY
Ono , F.; Jakubovics , J.; Maeta , H.
1988-01-01
The effect of irradiation on the movement of domain walls was studied in ferromagnetic transition metals by using a high voltage electron microscope. In iron, a domain wall became easily movable at a 300 kV irradiation. The mobility was less affected in cobalt, while in nickel the effect was the greatest.
Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong
2017-08-01
This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.
Krause, H. F.; Deveney, E. F.; Jones, N. L.; Vane, C. R.; Datz, S.; Knudsen, H.; Grafström, P.; Schuch, R.
1997-04-01
Recent atomic physics studies involving ultrarelativistic Pb ions required solid target positioners, scintillators, and a sophisticated data acquisition and control system placed in a remote location at the CERN Super Proton Synchrotron near Geneva, Switzerland. The apparatus, installed in a high-radiation zone underground, had to (i) function for months, (ii) automatically respond to failures such as power outages and particle-induced computer upsets, and (iii) communicate with the outside world via a telephone line. The heart of the apparatus developed was an Apple Macintosh-based CAMAC system that answered the telephone and interpreted and executed remote control commands that (i) sensed and set targets, (ii) controlled voltages and discriminator levels for scintillators, (iii) modified data acquisition hardware logic, (iv) reported control information, and (v) automatically synchronized data acquisition to the CERN spill cycle via a modem signal and transmitted experimental data to a remote computer. No problems were experienced using intercontinental telephone connections at 1200 baud. Our successful "virtual laboratory" approach that uses off-the-shelf electronics is generally adaptable to more conventional bench-type experiments.
Development and application of PIE apparatuses for high-burnup LWR fuels
International Nuclear Information System (INIS)
Harada, Katsuya; Mita, Naoaki; Nishino, Yasuharu; Amano, Hidetoshi
1999-01-01
The Reactor Fuel Examination Facility (RFEF) is developing the following post irradiation examination apparatuses: Ion Microprobe mass analyzer (IMA), Pellet Thermal Capacity measuring apparatus (PTC), Micro Density Measuring apparatus MDM, Shield-type Field Emission Scanning Electron Microscope (FE-SEM). The present paper mainly describes several technical topics of these apparatuses. (author)
Current-voltage curves for molecular junctions computed using all-electron basis sets
International Nuclear Information System (INIS)
Bauschlicher, Charles W.; Lawson, John W.
2006-01-01
We present current-voltage (I-V) curves computed using all-electron basis sets on the conducting molecule. The all-electron results are very similar to previous results obtained using effective core potentials (ECP). A hybrid integration scheme is used that keeps the all-electron calculations cost competitive with respect to the ECP calculations. By neglecting the coupling of states to the contacts below a fixed energy cutoff, the density matrix for the core electrons can be evaluated analytically. The full density matrix is formed by adding this core contribution to the valence part that is evaluated numerically. Expanding the definition of the core in the all-electron calculations significantly reduces the computational effort and, up to biases of about 2 V, the results are very similar to those obtained using more rigorous approaches. The convergence of the I-V curves and transmission coefficients with respect to basis set is discussed. The addition of diffuse functions is critical in approaching basis set completeness
Development of apparatus for surveying uranium surface contamination quantity
International Nuclear Information System (INIS)
Wang Qingheng; Han Jingquan
1994-11-01
An apparatus for measuring uranium contamination of the surface of reactor plate component is described. The searching unit of the apparatus is a large surface multi-wire proportional counter. The cathode of the counter is made of stainless steel with low radioactive background, the window is made of film which is plated with aluminum about 6 μm; and the anode is mad by gild tungsten wire of 0.025 mm diameter. The sensitive area of the counter is 1113 mm x 100 mm. It has been shown that the intrinsic radioactive background of the apparatus is 0.002 cpm/cm 2 (2 count/min). The detecting efficiency is 67% for enriched uranium source (2π solid angle). The stability is 0.84% within 24 hour (including detector, high voltage power supply, amplifier, discriminator, computer, type and display system). The lower detection limit of the apparatus is 4.6 x 10 -10 g/cm 2 (for 20% 235 U, 0.13% 234 U, 79.64% 238 U). The apparatus can present timing by a computer controlling, and it also has the following functions: displaying, automatic alarming, classifying and typing the results. (2 tabs., 7 figs.)
Low voltage powering of on-detector electronics for HL-LHC experiments upgrades
Bobillier, Vincent; Vasey, Francois; Karmakar, Sabyasachi; Maity, Manas; Roy, Subhasish; Kundu, Tapas Kumar
2018-01-01
All LHC experiments will be upgraded during the next LHC long shutdowns (LS2 and LS3). The increase in resolution and luminosity and the use of more advanced CMOS technology nodes typically implies higher current consumption of the on-detector electronics. In this context, and in view of limiting the cable voltage drop, point-of-load DC-DC converters will be used on detector. This will have a direct impact on the existing powering scheme, implying new AC-DC and/or DC-DC stages as well as changes in the power cabling infrastructure. This paper presents the first results obtained while evaluating different LV powering schemes and distribution layouts for HL-LHC trackers. The precise low voltage power source requirements are being assessed and understood using the CMS tracker upgrade as a use-case.
Electronic Devices for Controlling the Very High Voltage in the ALICE TPC Detector
Boccioli, Marco
2007-01-01
The Time Projection Chamber (TPC) is the core of the ALICE experiment at CERN. The TPC Very High Voltage project covers the development of the control system for the power supply that generates the 100kV necessary for the drift field in the TPC. This paper reports on the project progress, introducing the control system architecture from the electronics up to the control level. All the electronic devices will be described, highlighting their communication issues, and the challenges in integrating these devices in a PLC-based control system.
Metering apparatus and tariffs for electricity supply
International Nuclear Information System (INIS)
1990-01-01
Conference papers presented cover system economies and tariff structure with papers on pricing of electricity and new metering technologies. Other topics reviewed include metering apparatus design, electronic metering apparatus and solid phase metering technology. Meter data retrieval, bulk supply metering, test equipment and maintenance, and legal requirements and standards are discussed. (author)
Development and application of a window-type environmental cell in high voltage electron microscope
International Nuclear Information System (INIS)
Wakasugi, Takenobu; Isobe, Shigehito; Umeda, Ayaka; Wang, Yongming; Hashimoto, Naoyuki; Ohnuki, Somei
2013-01-01
Highlights: ► A window-type environmental cell for a high voltage electron microscope (HVEM) is developed. ► In situ HVEM image of Pd under an H2 gas pressure is obtained. ► The effect of the window materials on the resolution and contamination of the HVEM image is tested. -- Abstract: A close type of an environmental cell was developed for a high voltage electron microscope. Using this cell allowed an in situ observation of hydrogenation in Pd particles under H 2 gas of 0.05 MPa at RT. Two types of window films, Tri-Acetyl-Cellulose (TAC) and Silicon Nitride (SiN), were used for testing the contamination on the sample, as well as the strength for pressure. We confirmed the hydrogenation in diffraction patterns and images, and additionally the image resolution of 0.19 nm was obtained by using a SiN film with a thickness of 17 nm
Ion beam exposure apparatus using a liquid metal source
International Nuclear Information System (INIS)
Komuro, M.
1982-01-01
A field effect liquid metal ion source is described. The current-voltage characteristics, the angular intensity distribution and the total energy distribution were measured for gallium, gold and lead sources. The results are presented and the effect of space charge on the emission current is discussed. Optimum working conditions for the use of the ion sources in probe formation are derived. On the basis of the experimental results, an apparatus operating at 50 kV or less was designed. Details of the design, which includes a triode ion gun and an einzel lens, are given together with preliminary results of pattern delineation with the apparatus. (Auth.)
Development of novel low-voltage free-electron lasers in the 5-500GHz region
International Nuclear Information System (INIS)
Zhong, Xiehe
2002-01-01
The electromagnetic spectrum from 5GHz to 500GHz is important for many industrial, commercial, and scientific applications. In particular for the 100 - 500GHz region, free electron lasers (FELs) are usually the only viable radiation sources with sizeable output power and as such are an attractive enabling technology for many applications. One major issue for widespread application of free electron lasers is to reduce their cost and size. This is particularly challenging because of the expensive electron accelerator system they employ. To make it significantly more attractive economically for many important applications, the electron energy has to be reduced to below 300keV. In this thesis two novel electron-energy-reduction techniques are investigated for FEL systems operated in the spectrum from 5GHz to 500GHz with the development of a suite of suitable FEL codes. In the microwave to millimetre-wave region, a novel energy reduction technique based on second harmonic waveguide FELs is studied. It is shown that the required electron voltage is approximately half of what is normally required for comparable conventional waveguide FELs. Effect of electron energy spread is studied for second harmonic waveguide FELs both in microwave and millimetre-wave regions. It is shown that strong wiggler field enhances electron hunching thereby increasing the small-signal gain as well as the insusceptibility to electron voltage spread. Saturation behaviour of second harmonic waveguide FELs is also studied because it is important for evaluation of output power. For FEL generation above 300GHz, it is found that second harmonic waveguide FELs need to increase electron energy above 300keV. To this end, a second energy reduction technique is considered based on a novel quasiperiodic wiggler. It is established that by changing the initial phase angle between the two component wigglers, strong radiation can be generated near 1THz with electron energy below 300keV. (author)
Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung
2017-10-01
Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
National Research Council Canada - National Science Library
Moore, John H; Davis, Christopher C; Coplan, Michael A; Greer, Sandra C
2009-01-01
... specification of the components of apparatus, many new to this edition. Data on the properties of materials and components used by manufacturers are included. Mechanical, optical, and electronic construction techniques carried out in the laboratory, as well as those let out to specialized shops, are also described. Step-by-step instruc...
Methods and apparatus for use with extreme ultraviolet light having contamination protection
Chilese, Francis C.; Torczynski, John R.; Garcia, Rudy; Klebanoff, Leonard E.; Delgado, Gildardo R.; Rader, Daniel J.; Geller, Anthony S.; Gallis, Michail A.
2016-07-12
An apparatus for use with extreme ultraviolet (EUV) light comprising A) a duct having a first end opening, a second end opening and an intermediate opening intermediate the first end opening the second end opening, B) an optical component disposed to receive EUV light from the second end opening or to send light through the second end opening, and C) a source of low pressure gas at a first pressure to flow through the duct, the gas having a high transmission of EUV light, fluidly coupled to the intermediate opening. In addition to or rather than gas flow the apparatus may have A) a low pressure gas with a heat control unit thermally coupled to at least one of the duct and the optical component and/or B) a voltage device to generate voltage between a first portion and a second portion of the duet with a grounded insulative portion therebetween.
Apparatus for the Measurement of Air Blast Pressures by Means of Piezoelectric Gauges
1946-03-01
boam-brightenor atare or in tho voltage at tho cathode of tho cathodo-ray tubo, whether duo to olther 60-oycle hum or lino-voltage fluctuations, aro...AGENC r (Not Knowa-)- P.A. NO (None) TRANSLATING AGENCY DATE: Mar+5 COUNTRY: U.S. LANGUAGE: PAGES: REMARKS: English I 225 I...11. S 1 English PAUS 225 •UMTtATKMS ntntOfl. tables. cHarrs Description and requirements are given of an apparatus used for
International Nuclear Information System (INIS)
Suprapto; Djasiman
2002-01-01
The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)
Ultrahigh Voltage Electron Microscopy Links Neuroanatomy and Neuroscience/Neuroendocrinology
Directory of Open Access Journals (Sweden)
Hirotaka Sakamoto
2012-01-01
Full Text Available The three-dimensional (3D analysis of anatomical ultrastructures is extremely important in most fields of biological research. Although it is very difficult to perform 3D image analysis on exact serial sets of ultrathin sections, 3D reconstruction from serial ultrathin sections can generally be used to obtain 3D information. However, this technique can only be applied to small areas of a specimen because of technical and physical difficulties. We used ultrahigh voltage electron microscopy (UHVEM to overcome these difficulties and to study the chemical neuroanatomy of 3D ultrastructures. This methodology, which links UHVEM and light microscopy, is a useful and powerful tool for studying molecular and/or chemical neuroanatomy at the ultrastructural level.
Apparatus for the deflection of an electron beam
International Nuclear Information System (INIS)
1976-01-01
An X-ray apparatus is described that can be used in tomography. The design of the X-ray tube is the main subject of the patent with emphasis on the way of beam shaping and the control of the beam profile
Levin, A D; Momtaz, Z S; Gusev, G M; Raichev, O E; Bakarov, A K
2015-11-13
We observe the phonon-drag voltage oscillations correlating with the resistance oscillations under microwave irradiation in a two-dimensional electron gas in perpendicular magnetic field. This phenomenon is explained by the influence of dissipative resistivity modified by microwaves on the phonon-drag voltage perpendicular to the phonon flux. When the lowest-order resistance minima evolve into zero-resistance states, the phonon-drag voltage demonstrates sharp features suggesting that current domains associated with these states can exist in the absence of external dc driving.
Shirasaki, O; Terada, H; Niwano, K; Nakanishi, T; Kanai, M; Miyawaki, Y; Souma, T; Tanaka, T; Kusunoki, T
2001-12-01
The Japanese Home-health Apparatus Industrial Association is an official independent organization comprising ten departments. That concerned with home electronic sphygmomanometers, which has seven participants from different Japanese manufacturers, has already undertaken and is currently involved in various activities related to voluntary standards for performance validation and quality assurance. Because Japanese companies form a large proportion of manufacturers, these activities are important in terms of autonomic regulation. Although many improvements have been made to home electronic sphygmomanometers, some problems still remain unresolved, especially in terms of measurement reliability and easy operation by lay people. Another aspect of the department's work relates to making proposals on major validation standards, such as those of the Association for the Advancement of Medical Instrumentation, the British Hypertension Society and Comité Européen de Normalisation (CEN). Clinical validation should be discussed in order to define a more accurate standard method of measurement using auscultation and more appropriate criteria that are unaffected by primary blood pressure variation.
Some applications of the high voltage electron microscope in physical metallurgy
International Nuclear Information System (INIS)
Regnier, P.; Thomas de Montpreville, C.
1976-01-01
The high voltage electron microscope (HVEM) is a microscope with a much higher penetration than the usual ones, as well as being a remarkable irradiation machine. The possible applications of the HVEM related to its advantages over the conventional microscopes are first discussed. The simultaneous use of the HVEM as an irradiation machine and an observation tool is then discussed, experiments carried in the laboratory being referred to. The last use of the HVEM makes it an irreplaceable tool for continuously following the clustering of irradiation defects [fr
Nasr, Mahmoud; El Radaf, I. M.; Mansour, A. M.
2018-04-01
In this study, a crystalline n-PbTe/p-GaP heterojunction was fabricated using the electron beam deposition technique. The structural properties of the prepared heterojunction were examined by X-ray diffraction and scanning electron microscopy. The dark current-voltage characteristics of the heterojunction were investigated at different temperatures ranging from 298 to 398 K. The rectification factor, series resistance, shunt resistance, diode ideality factor, and effective barrier height (ϕb) were determined. The photovoltaic parameters were identified based on the current density-voltage characteristics under illumination. The capacitance-voltage characteristics showed that the junction was abrupt in nature.
Yang, Z.; Li, X.; Li, J.; Long, J. D.; Lan, C. H.; Wang, T.; Dong, P.; He, J. L.
2017-03-01
A large amount of back streaming electrons will bring about a part of current drain on power supply, cause sparking or high-voltage breakdowns, and affect the neutron yield and waveform for a compact sealed-tube pulsed neutron generator. A novel idea which uses a ZnO varistor to provide a constant self-biased voltage to suppress the secondary electrons is introduced. The I-V curve for the ZnO varistor was measured in the experiment. The effects of suppressing the secondary electrons were investigated using a ZnO varistor, linear resistors, and an independent power supply, respectively. The results show that the secondary electrons are suppressed effectively by the compact ZnO varistor, while not increasing the size and the component of the device. It is a promising design for compact sealed-tube neutron generators.
Electron tunnelling through single azurin molecules can be on/off switched by voltage pulses
Energy Technology Data Exchange (ETDEWEB)
Baldacchini, Chiara [Biophysics and Nanoscience Centre, DEB-CNISM, Università della Tuscia, I-01100 Viterbo (Italy); Institute of Agro-Environmental and Forest Biology, CNR, I-05010 Porano (Italy); Kumar, Vivek; Bizzarri, Anna Rita; Cannistraro, Salvatore, E-mail: cannistr@unitus.it [Biophysics and Nanoscience Centre, DEB-CNISM, Università della Tuscia, I-01100 Viterbo (Italy)
2015-05-04
Redox metalloproteins are emerging as promising candidates for future bio-optoelectronic and nano-biomemory devices, and the control of their electron transfer properties through external signals is still a crucial task. Here, we show that a reversible on/off switching of the electron current tunnelling through a single protein can be achieved in azurin protein molecules adsorbed on gold surfaces, by applying appropriate voltage pulses through a scanning tunnelling microscope tip. The observed changes in the hybrid system tunnelling properties are discussed in terms of long-sustained charging of the protein milieu.
Control of an X-ray cine radiography apparatus
International Nuclear Information System (INIS)
Nishio, K.
1982-01-01
This patent application describes an X-ray cine radiography apparatus comprising an X-ray tube, an image intensifier for converting the X-rays transmitted through an object into a visual image and a cine camera for picking up the visual image, a photomultiplier detects the brightness of the visual image to produce a brightness signal and a potentiometer detects the actual tube voltage of said X-ray tube. (author)
Multicusp plasma containment apparatus
International Nuclear Information System (INIS)
Limpaecher, R.
1980-01-01
It has been discovered that plasma containment by a chamber having multi-pole magnetic cusp reflecting walls in combination with electronic injection for electrostatic containment provides the means for generating magnetic field free quiescent plasmas for practical application in ion-pumps, electronic switches, and the like. 1250 ''alnico v'' magnets 1/2 '' X 1/2 '' X 1 1/2 '' provide containment in one embodiment. Electromagnets embodying toroidal funneling extend the principle to fusion apparatus
Maintenance and fabrication of nuclear electronic equipment
International Nuclear Information System (INIS)
Hong, Seok Boong; Chung, Chong Eun; Hwang, In Koo; Koo, In Soo; Park, Bum; Kim, Soo Hee; Lee, Seong Joo; Kim, Min Seok; Choi, Wha Lim
2011-12-01
- process equipment at PIEF, Chemical Analysis Team and RWFTF have been calibrated. - The electronic equipment and radiation equipment at RWTF and PIEF have been prepared. - Development and installation of integrated RMS software for Hanaro Cold Neutron Laboratory Building(CNLB) RMS, and development and performance upgrade of a portal monitor for CNLB. - Performance test of the Hardware/Software of digital unit controller has been performed, and functional upgrade of the Hardware/Software of stimulator for SMART MMIS performance test facility has also been performed. - A controller of high voltage power supply for a small electron beam generator and a controller for razer pinning and a remote monitoring apparatus of cathode power supply for a 0.2 Mev. small electron beam generator have been designed and fabricated. - Database construction for effective maintenance for the process equipment and radiation instruments are designed and constructed
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Czech Academy of Sciences Publication Activity Database
Chomát, Miroslav; Schreier, Luděk
2005-01-01
Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005
International Nuclear Information System (INIS)
Cooperstein, G.; Lanza, R.C.; Sohval, A.R.
1980-01-01
Radiation imaging apparatus especially suited for use in a computerized tomographic (CT) scanner is specified. It employs a fixed array of discrete X-ray sources, each being a cold cathode diode having an impedance in excess of about 100 ohms and an adjacent fixed array of closely packed radiation detectors to produce images of rapidly moving body organs such as the beating heart. The X-ray source is pulsed by a 120 to 130 kv pulse of 150 to 160 ns duration, derived from an unregulated DC source, of output voltage 15 to 30 kv. Each X-ray source may comprise a cold cathode pulse or may be constituted by a pair of annular cathodes having radially extending anodes therebetween. (author)
Voltage control of a power-frequency E-beam irradiator
International Nuclear Information System (INIS)
Zhou Zhizhong; Hu Shouming; Wang Jun; Guo Honglei; Su Haijun
2012-01-01
Voltage stability and precision are key specifications of an electron beam irradiator. A voltage control system was developed for smooth high voltage regulating on a power frequency electron accelerator. Pillar variac driven by servo motor was used as the regulating device, with a programmable logic controller as the control unit. An industrial PC was employed to realize human-machine interaction. Open-loop and closed-loop modes were employed to regulate the high voltage. Experimental results show that the speed, stability and precision for high voltage regulating were improved greatly, hence a much better performance of the electron accelerator. (authors)
Graham, Kenneth; Erwin, Patrick; Nordlund, Dennis; Vandewal, Koen; Li, Ruipeng; Ngongang Ndjawa, Guy Olivier; Hoke, Eric T.; Salleo, Alberto; Thompson, Mark E.; McGehee, Michael D.; Amassian, Aram
2013-01-01
The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Graham, Kenneth
2013-07-30
The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Chaichana Amornchai
2017-01-01
Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.
International Nuclear Information System (INIS)
Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei
2015-01-01
The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)
International Nuclear Information System (INIS)
Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.
2013-01-01
For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).
Azarov, A.V.; Peters, P.J.M.; Boller, Klaus J.
2007-01-01
A large area pulsed electron beam is produced by a high-voltage barrier discharge. We compare the properties of the x-rays generated by stopping this beam of electrons in a thin metal foil with those generated by stopping the electrons directly in various gases. The generation of x-rays was
International Nuclear Information System (INIS)
Raoult, N.
1960-11-01
The temperature regulator and the voltage regulators described have been studied with a view to conferring a high degree of safety to the apparatuses in which they are used. They make use almost exclusively of Transducers which are passive elements acting mainly in these apparatuses as amplifiers and which are entirely satisfactory, ensuring that the regulators studied keep their essential qualities i.e accuracy, reliability, stability and sensitivity. (author) [fr
International Nuclear Information System (INIS)
Weiss, D.E.; Kalweit, H.W.; Kensek, R.P.
1994-01-01
A simple multilayer slab model of an electron beam using the ITS/TIGER code can consistently account for about 80% of the actual dose delivered by a low voltage electron beam. The difference in calculated values is principally due to the 3D hibachi structure which blocks 22% of the beam. A 3D model was constructed using the ITS/ACCEPT code to improve upon the TIGER simulations. A rectangular source description update to the code and reproduction of all key geometric elements involved, including the hibachi, accounted for 90-95% of the dose received by routine dosimetry
International Nuclear Information System (INIS)
Jie Binbin; Sah Chihtang
2011-01-01
Low-frequency and high-frequency Capacitance—Voltage (C—V) curves of Metal—Oxide—Semiconductor Capacitors (MOSC), including electron and hole trapping at the dopant donor and acceptor impurities, are presented to illustrate giant trapping capacitances, from > 0.01C OX to > 10C OX . Five device and materials parameters are varied for fundamental trapping parameter characterization, and electrical and optical signal processing applications. Parameters include spatially constant concentration of the dopant-donor-impurity electron trap, N DD , the ground state electron trapping energy level depth measured from the conduction band edge, E C –E D , the degeneracy of the trapped electron at the ground state, g D , the device temperature, T, and the gate oxide thickness, x OX . (invited papers)
Prediction of breakdown voltages in novel gases for high voltage insulation
International Nuclear Information System (INIS)
Koch, M.
2015-01-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media
Mesyats, G. A.; Pedos, M. S.; Rukin, S. N.; Rostov, V. V.; Romanchenko, I. V.; Sadykova, A. G.; Sharypov, K. A.; Shpak, V. G.; Shunailov, S. A.; Ul'masculov, M. R.; Yalandin, M. I.
2018-04-01
Fulfillment of the condition that the voltage rise time across an air gap is comparable with the time of electron acceleration from a cathode to an anode allows a flow of runaway electrons (REs) to be formed with relativistic energies approaching that determined by the amplitude of the voltage pulse. In the experiment described here, an RE energy of 1.4 MeV was observed by applying a negative travelling voltage pulse of 860-kV with a maximum rise rate of 10 MV/ns and a rise time of 100-ps. The voltage pulse amplitude was doubled at the cathode of the 2-cm-long air gap due to the delay of conventional pulsed breakdown. The above-mentioned record-breaking voltage pulse of ˜120 ps duration with a peak power of 15 GW was produced by an all-solid-state pulsed power source utilising pulse compression/sharpening in a multistage gyromagnetic nonlinear transmission line.
Directory of Open Access Journals (Sweden)
Xin-Bing Cheng
2010-07-01
Full Text Available The Blumlein pulse forming line (BPFL consisting of an inner coaxial pulse forming line (PFL and an outer coaxial PFL is widely used in the field of pulsed power, especially for intense electron-beam accelerators (IEBA. The output voltage waveform determines the quality and characteristics of the output beam current of the IEBA. Comparing with the conventional BPFL, an IEBA based on a helical type BPFL can increase the duration of the output voltage in the same geometrical volume. However, for the helical type BPFL, the voltage waveform on a matched load may be distorted which influences the electron-beam quality. In this paper, an IEBA based on helical type BPFL is studied theoretically. Based on telegrapher equations of the BPFL, a formula for the output voltage of IEBA is obtained when the transition section is taken into account, where the transition section is between the middle cylinder of BPFL and the load. From the theoretical analysis, it is found that the wave impedance and transit time of the transition section influence considerably the main pulse voltage waveform at the load, a step is formed in front of the main pulse, and a sharp spike is also formed at the end of the main pulse. In order to get a well-shaped square waveform at the load and to improve the electron-beam quality of such an accelerator, the wave impedance of the transition section should be equal to that of the inner PFL of helical type BPFL and the transit time of the transition section should be designed as short as possible. Experiments performed on an IEBA with the helical type BPFL show reasonable agreement with theoretical analysis.
3.5. Apparatus for plasma electron temperature measurement by Thomson scattering
International Nuclear Information System (INIS)
Kolacek, K.; Babicky, V.
1981-01-01
Equipment was developed and tested for measuring time-resolved local electron plasma temperature and density by the Thomson scattering of ruby laser light. The laser consists of a Q-switched generator (ruby 12 mm in diameter by 150 mm long) followed by one amplifier (ruby 16 mm indi long) followed by one amplifier (ruby 16 mm in diameter by 250 mm long). For Q-switching a Pockels cell with a z-cut ADP crystal was used. The laser is capable of delivering 4 J of energy in a pulse of 50 ns in duration. The spectrum of the laser light scattered at an angle of 9a degrees is analyzed by a six-channel polychromator. Fibre optics and photomultipliers with gated amplifiers are used. Output signals are transmitted via a parallel-to-series converter to a single-trace oscilloscope. The whole Thomson scattering apparatus was successfully tested by the Rayleigh scattering in the air at atmospheric pressure. (J.U.)
Flash X-Ray Apparatus With Spectrum Control Functions For Medical Use And Fuji Computed Radiography
Isobe, H.; Sato, E.; Hayasi, Y.; Suzuki, M.; Arima, H.; Hoshino, F.
1985-02-01
Flash radiographic bio-medical studies at sub-microsecond intervals were performed by using both a new type of flash X-ray(FX) apparatus with spectrum control functions and Fuji Computed Radiography(FCR). This single flasher tends to have a comparatively long exposure time and the electric pulse width of the FX wave form is about 0.3,usec. The maximum FX dose is about 50mR at 1m per pulse, and the effective focal spot varies according to condenser charging voltage, A-C distance, etc., ranging from 1.0 to 3.0mm in diameter, but in the low dose rate region it can be reduced to less than 1.0mm in diameter. The FX dose is determined by the condenser charging voltage and the A-C distance, while the FX spectrum is determined by the average voltage of the FX tube and filters. Various clear FX images were obtained by controlling the spectrum and dose. FCR is a new storage medium for medical radiography developed by the Fuji Photo Film Co., Ltd. and this apparatus has various image forming functions: low dose radiography, film density control, image contrast control, subtraction management and others. We have used this new apparatus in conjunction with our FX radiography and have obtained some new and interesting biomedical radiograms: the edge enhancement image, the instantaneous enlarged image, and the single exposure energy subtraction image using the FX spectrum distribution.
Lee, Ya-Ju; Yao, Yung-Chi; Huang, Chun-Ying; Lin, Tai-Yuan; Cheng, Li-Lien; Liu, Ching-Yun; Wang, Mei-Tan; Hwang, Jung-Min
2014-01-01
In this paper, we numerically study an enhancement of breakdown voltage in AlGaN/GaN high-electron-mobility transistors (HEMTs) by using the AlGaN/GaN/AlGaN quantum-well (QW) electron-blocking layer (EBL) structure. This concept is based on the superior confinement of two-dimensional electron gases (2-DEGs) provided by the QW EBL, resulting in a significant improvement of breakdown voltage and a remarkable suppression of spilling electrons. The electron mobility of 2-DEG is hence enhanced as well. The dependence of thickness and composition of QW EBL on the device breakdown is also evaluated and discussed.
Development of Multi-Functional Voltage Restore System
Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki
Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.
Apparatus for reading and recharging condenser ionization chambers
International Nuclear Information System (INIS)
McCall, R.C.
1977-01-01
A metering circuit for a condenser ionization chamber is disclosed for simultaneously recharging the ionization chamber and reading out the amount of charge required to recharge the chamber. During the recharging process, the amount of charge necessary to recharge the ionization chamber capacitor is placed on an integrating capacitor in the metering apparatus. The resultant voltage across the integrating capacitor is a measure of the radiation to which the ionization chamber was exposed. 9 claims, 1 figure
High resolution and high voltage electron microscopy at the University of California, Berkeley
International Nuclear Information System (INIS)
Thomas, G.; Westmacott, K.H.
1978-01-01
Recent applications of high-resolution and high-voltage techniques at Berkely are described, using 100-kV TEMs and a standard 650-keV HVEM: grain boundary precipitation in Al--Zn, lattice imaging of grain boundaries in ceramics, steels, phase transitions and magnetic properties of ferrites, lattice defects, precipitation in Al--Si and behavior of interstitial dislocations under electron irradiation, effect of oxide films on loop formation in Al--Mg, and polytypism in magnesium Sialon. 13 refs. 12 figs
Prediction of breakdown voltages in novel gases for high voltage insulation
Energy Technology Data Exchange (ETDEWEB)
Koch, M.
2015-07-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.
Effect of gate length on breakdown voltage in AlGaN/GaN high-electron-mobility transistor
International Nuclear Information System (INIS)
Luo Jun; Zhao Sheng-Lei; Mi Min-Han; Zhang Jin-Cheng; Ma Xiao-Hua; Hao Yue; Chen Wei-Wei; Hou Bin
2016-01-01
The effects of gate length L G on breakdown voltage V BR are investigated in AlGaN/GaN high-electron-mobility transistors (HEMTs) with L G = 1 μm∼ 20 μm. With the increase of L G , V BR is first increased, and then saturated at L G = 3 μm. For the HEMT with L G = 1 μm, breakdown voltage V BR is 117 V, and it can be enhanced to 148 V for the HEMT with L G = 3 μm. The gate length of 3 μm can alleviate the buffer-leakage-induced impact ionization compared with the gate length of 1 μm, and the suppression of the impact ionization is the reason for improving the breakdown voltage. A similar suppression of the impact ionization exists in the HEMTs with L G > 3 μm. As a result, there is no obvious difference in breakdown voltage among the HEMTs with L G = 3 μm∼20 μm, and their breakdown voltages are in a range of 140 V–156 V. (paper)
Electronic band gap and transport in graphene superlattice with a Gaussian profile potential voltage
International Nuclear Information System (INIS)
Zhang Yu-Ping; Yin Yi-Heng; Lü Huan-Huan; Zhang Hui-Yun
2014-01-01
We study the electronic properties for the graphene-based one-dimensional superlattices, whose potential voltages vary according to the envelope of a Gaussian function. It is found that an unusual Dirac point exists and its location is exactly associated with a zero-averaged wave number (zero-k-bar ) gap. This zero-k-bar gap is less sensitive to incident angle and lattice constants, properties opposing those of Bragg gap. The defect mode appearing inside the zero-k-bar gap has an effect on transmission, conductance, and shot noise, which will be useful for further investigation. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Project for an analogue divider using electronic counting
International Nuclear Information System (INIS)
Novat, J.
1964-01-01
The apparatus which has been developed is designed to give the reciprocal of a number between 10 3 and 10 7 . In practice this number can be the pulse count provided during a given time by a detector of the BF 3 type during a criticality experiment. The apparatus is made up of two parts: one provides, by means of relays, a voltage proportional to the reciprocal required, the other is a numeric voltmeter measuring this voltage between 0.1 and 1 volt. The relative error of the result is under 5 per cent. (author) [fr
Directory of Open Access Journals (Sweden)
Supachai Klungtong
2017-01-01
Full Text Available This paper presents a second-order voltage-mode filter with three inputs and single-output voltage using single commercially available IC, one resistor, and two capacitors. The used commercially available IC, called LT1228, is manufactured by Linear Technology Corporation. The proposed filter is based on parallel RLC circuit. The filter provides five output filter responses, namely, band-pass (BP, band-reject (BR, low-pass (LP, high-pass (HP, and all-pass (AP functions. The selection of each filter response can be done without the requirement of active and passive component matching condition. Furthermore, the natural frequency and quality factor are electronically controlled. Besides, the nonideal case is also investigated. The output voltage node exhibits low impedance. The experimental results can validate the theoretical analyses.
Pulse radiolysis apparatus for monitoring at 2000 Å
DEFF Research Database (Denmark)
Christensen, H.C.; Nilsson, G.; Pagsberg, Palle Bjørn
1969-01-01
A pulse radiolysis apparatus with photometric monitoring has been built around an 11 MeV, 250 mA peak current, linac that delivers single 0.25 to 4 μsec pulses. The novel features of the apparatus include (1) a 450 W xenon lamp as the analyzing light source which in pulsed operation had a 25 times...... increased luminance; (2) a fast electronic switch that cut out the signal due to the Cerenkov radiation; (3) a secondary emission chamber that allowed the simultaneous measurement of the current and the direction of the pulsed electron beam; and (4) a system for remote controlled change of liquid samples...
Modeling and Analysis of the Common Mode Voltage in a Cascaded H-Bridge Electronic Power Transformer
Directory of Open Access Journals (Sweden)
Yun Yang
2017-09-01
Full Text Available Electronic power transformers (EPTs have been identified as emerging intelligent electronic devices in the future smart grid, e.g., the Energy Internet, especially in the application of renewable energy conversion and management. Considering that the EPT is directly connected to the medium-voltage grid, e.g., a10 kV distribution system, and its cascaded H-bridges structure, the common mode voltage (CMV issue will be more complex and severe. The CMV will threaten the insulation of the entire EPT device and even produce common mode current. This paper investigates the generated mechanism and characteristics of the CMV in a cascaded H-bridge EPT (CHB-EPT under both balanced and fault grid conditions. First, the CHB-EPT system is introduced. Then, a three-phase simplified circuit model of the high-voltage side of the EPT system is presented. Combined with a unipolar modulation strategy and carrier phase shifting technology by rigorous mathematical analysis and derivation, the EPT internal CMV and its characteristics are obtained. Moreover, the influence of the sinusoidal pulse width modulation dead time is considered and discussed based on analytical calculation. Finally, the simulation results are provided to verify the validity of the aforementioned model and the analysis results. The proposed theoretical analysis method is also suitable for other similar cascaded converters and can provide a useful theoretical guide for structural design and power density optimization.
Damage structure of gallium arsenide irradiated in a high-voltage electron microscope
International Nuclear Information System (INIS)
Loretto, D.; Loretto, M.H.
1989-01-01
Semi-insulating undoped gallium arsenide has been irradiated in a high-voltage electron microscope between room temperature and about 500 0 C for doses of up to 5 x 10 22 electrons cm -2 at 1 MeV. Room-temperature irradiation produces small (less than 5 nm) damage clusters. As the temperature of the irradiation is increased, the size of these clusters increases, until at about 300 0 C a high density of dislocation loops can be resolved. The dislocation loops, 20 nm or less in diameter, which are produced at about 500 0 C have been analysed in a bright field using a two-beam inside-outside method which minimises the tilt necessary between micrographs. It is concluded that the loops are an interstitial perfect-edge type with a Burgers vector of (a/2) . (author)
International Nuclear Information System (INIS)
Lasa, J.; Sliwka, I.; Drozdowicz, B.
1989-01-01
The paper contains results of measurements of current characteristics and of the signal for the constant concentration of freon F-11 of the ECD supplied with pulse voltage of changeable time of pulse duration t p , amplitude U 1 and the time of pulse repetition t r . In the course of measurements the detector worked at temperature 573 K with the additional constant polarization voltage. The polarization voltage has been observed to cause the effect of hypercoulometry. The presented mathematical analysis helps to determine the values of the coefficient of efficiency of electron capture p, the coefficient of electron loss k D , the coefficient of collecting of electric charges by the anode k' 3 and the coefficient of collecting of electric charges by the detector cathode k u . The coefficients are determined on the basis of experimental measurements. An attempt of physical interpretation of calculated values of these coefficients and their dependence on the parameters of the pulses supplying the detector has been presented. This interpretation requires the assumption that in some pulse periods t r the concentration of positive ions in the detector considerably exceeds concentration n 0 + = √a xα e /V, where a is an efficiency of the carrier gas ionization, α e is the coefficient of the electron-ion recombination and V is the detector volume. This statement helping to describe the effects observed in the electron capture polarized by voltage U a contradicts the recognized concept that the concentration of positive ions in the detector does not exceed the concentration n 0 + . The paper shows that the detector of the cylindrical construction, supplied with a pulse voltage can be used for coulometric measurements and the voltage polarizing the cathode can cause an effect of hypercoulometry. 33 figs., 9 refs. (author)
High frequency breakdown voltage
International Nuclear Information System (INIS)
Chu, Thanh Duy.
1992-03-01
This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance
Energy Technology Data Exchange (ETDEWEB)
Wan, Q., E-mail: qwan2@sheffield.ac.uk [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Masters, R.C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Lidzey, D. [Department of Physics and Astronomy, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Abrams, K.J. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Dapor, M. [European Centre for Theoretical Studies in Nuclear Physics and Related Areas (ECT-FBK) and Trento Institute for Fundamental Physics and Applications (TIFPA-INFN), via Sommarive 18, I-38123 Trento (Italy); Plenderleith, R.A. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Rimmer, S. [Department of Chemistry, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Claeyssens, F.; Rodenburg, C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom)
2016-12-15
Recently developed detectors can deliver high resolution and high contrast images of nanostructured carbon based materials in low voltage scanning electron microscopes (LVSEM) with beam deceleration. Monte Carlo Simulations are also used to predict under which exact imaging conditions purely compositional contrast can be obtained and optimised. This allows the prediction of the electron signal intensity in angle selective conditions for back-scattered electron (BSE) imaging in LVSEM and compares it to experimental signals. Angle selective detection with a concentric back scattered (CBS) detector is considered in the model in the absence and presence of a deceleration field, respectively. The validity of the model prediction for both cases was tested experimentally for amorphous C and Cu and applied to complex nanostructured carbon based materials, namely a Poly(N-isopropylacrylamide)/Poly(ethylene glycol) Diacrylate (PNIPAM/PEGDA) semi-interpenetration network (IPN) and a Poly(3-hexylthiophene-2,5-diyl) (P3HT) film, to map nano-scale composition and crystallinity distribution by avoiding experimental imaging conditions that lead to a mixed topographical and compositional contrast - Highlights: • An optimised model for nano-scale analysis of beam sensitive materials by LVSEM. • Simulation and separation of composition and topography in a CBS detector. • Selective angle backscattered electron collection for mapping of polymers.
International Nuclear Information System (INIS)
Wan, Q.; Masters, R.C.; Lidzey, D.; Abrams, K.J.; Dapor, M.; Plenderleith, R.A.; Rimmer, S.; Claeyssens, F.; Rodenburg, C.
2016-01-01
Recently developed detectors can deliver high resolution and high contrast images of nanostructured carbon based materials in low voltage scanning electron microscopes (LVSEM) with beam deceleration. Monte Carlo Simulations are also used to predict under which exact imaging conditions purely compositional contrast can be obtained and optimised. This allows the prediction of the electron signal intensity in angle selective conditions for back-scattered electron (BSE) imaging in LVSEM and compares it to experimental signals. Angle selective detection with a concentric back scattered (CBS) detector is considered in the model in the absence and presence of a deceleration field, respectively. The validity of the model prediction for both cases was tested experimentally for amorphous C and Cu and applied to complex nanostructured carbon based materials, namely a Poly(N-isopropylacrylamide)/Poly(ethylene glycol) Diacrylate (PNIPAM/PEGDA) semi-interpenetration network (IPN) and a Poly(3-hexylthiophene-2,5-diyl) (P3HT) film, to map nano-scale composition and crystallinity distribution by avoiding experimental imaging conditions that lead to a mixed topographical and compositional contrast - Highlights: • An optimised model for nano-scale analysis of beam sensitive materials by LVSEM. • Simulation and separation of composition and topography in a CBS detector. • Selective angle backscattered electron collection for mapping of polymers.
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1993-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1991-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs
Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.
Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.
Kakiuchi, Takuhiro; Hashimoto, Shogo; Fujita, Narihiko; Mase, Kazuhiko; Tanaka, Masatoshi; Okusawa, Makoto
We have developed an electron electron ion coincidence (EEICO) apparatus for high-resolution Auger photoelectron coincidence spectroscopy (APECS) and electron ion coincidence (EICO) spectroscopy. It consists of a coaxially symmetric mirror electron energy analyzer (ASMA), a miniature double-pass cylindrical mirror electron energy analyzer (DP-CMA), a miniature time-of-flight ion mass spectrometer (TOF-MS), a magnetic shield, an xyz stage, a tilt-adjustment mechanism, and a conflat flange with an outer diameter of 203 mm. A sample surface was irradiated by synchrotron radiation, and emitted electrons were energy-analyzed and detected by the ASMA and the DP-CMA, while desorbed ions were mass-analyzed and detected by the TOF-MS. The performance of the new EEICO analyzer was evaluated by measuring Si 2p photoelectron spectra of clean Si(001)-2×1 and Si(111)-7×7, and by measuring Si-L23VV-Si-2p Auger photoelectron coincidence spectra (Si-L23VV-Si-2p APECS) of clean Si(001)-2×1.
International Nuclear Information System (INIS)
1977-01-01
The X-ray photographic system is designed for medical applications. Two detectors are used for surveys in different planes, and produce electrical signals which are supplied to a comparator. The electron beams are examined according to a system of reference time steps. The apparatus includes a light source and a photo-detector and enables a reference signal to be produced against which the detected signals are compared. The beam source is formed from an electron gun, an extractor electrode and an anode; beam then passes through a collimator. (G.C.)
Procedure and apparatus for controlling the ion energy in a mass spectrometer
Energy Technology Data Exchange (ETDEWEB)
Fies, W J; Reeher, J R; Story, M S; Smith, R D
1977-03-03
The invention relates to a process and apparatus for adjusting the energy of ions of different masses in a mass spectrometer. Specifically, it concerns a mass spectrometer having a gas inlet and ionisation space. A multipole mass filter includes several electrodes. A focusing system connects the ionisation space and the mass filter. Provision is made for applying to the electrodes a mass adjusting voltage combining a high frequency voltage and a d.c. voltage of increasing amplitude, so that the ions of a pre-determined mass can be selected. This system also includes a device connected to the electrodes, sensitive to the mass adjusting voltage and enabling the energy of the ions to be adjusted to that of the selected ions, depending on the mass of the ions, by modifying the difference in potential between the ionisation volume and the mean potential of the electrodes .
International Nuclear Information System (INIS)
Wareing, J.B.
1976-01-01
A method and apparatus are described for coating wire, rod or strip material comprising first subjecting the material to electron bombardment in a glow discharge to heat and activate the surface and then subjecting it to sputtering by use of a soft cathode discharge. The apparatus comprises a low pressure gas chamber through which the material is passed, and containing a glow discharge electron gun having a tubular cathode shaped so that the material can be passed axially through it, and an anode surrounding the cathode. The cathode is formed in two parts, the first part at one end, being made of material of low sputtering yield, and the second part being formed at least partially of the required coating material. The first part of the cathode may be of stainless steel or Al. The two parts of the cathode are electrically isolated with means provided for applying a lower negative potential, with respect to the anode, to the second part compared with the first part. The voltage applied to the second part may be controlled so as to control the sputtering rate. The gas pressure in the chamber is also controllable. The coating material may be arranged as inserts in the fixed cathode structure or as segments around the surface to be coated, and may be composed of Pb, Zn or Cu. (U.K.)
Data eye monitor method and apparatus
Energy Technology Data Exchange (ETDEWEB)
Gara, Alan G [Mount Kisco, NY; Marcella, James A [Rochester, MN; Ohmacht, Martin [Yorktown Heights, NY
2012-01-31
An apparatus and method for providing a data eye monitor. The data eye monitor apparatus utilizes an inverter/latch string circuit and a set of latches to save the data eye for providing an infinite persistent data eye. In operation, incoming read data signals are adjusted in the first stage individually and latched to provide the read data to the requesting unit. The data is also simultaneously fed into a balanced XOR tree to combine the transitions of all incoming read data signals into a single signal. This signal is passed along a delay chain and tapped at constant intervals. The tap points are fed into latches, capturing the transitions at a delay element interval resolution. Using XORs, differences between adjacent taps and therefore transitions are detected. The eye is defined by segments that show no transitions over a series of samples. The eye size and position can be used to readjust the delay of incoming signals and/or to control environment parameters like voltage, clock speed and temperature.
Palviainen, T; Tuuva, T; Eranen, S; Härkönen, J; Luukka, P; Tuovinen, E
2006-01-01
The structure of silicon semi three-dimensional radiation detector is simulated on purpose to find out its electrical characteristics such as the depletion voltage and electric field. Two-dimensional simulation results are compared to voltage and electric field measurements done by a scanning electron microscope.
International Nuclear Information System (INIS)
Boehning, C.W.
1983-01-01
Gold removal rate was measured as a function of ion beam voltage and raster size using Auger electron spectroscopy (AES). Three different gold thicknesses were developed as standards. Two sputter rate calibration curves were generated by which gold sputter rate could be determined for variations in ion beam voltage or raster size
International Nuclear Information System (INIS)
Peon A, R.
1978-01-01
A regulated direct current feeding source was designed for the Nuclear Energy National Institute Electronics Labortory, with the following characteristics: a) voltage input 105-130V a.c. 50-60 Hz; b) voltage output 0.40 V d.c.; c) output current 0-2 Amp d.c.; d) load regulation 0.001%; e) line regulation 0.001%; f) ripple and noise 200 μ Vpp; g) temperature interval 3-60 0 C; h) stability 0.5%; i) output impedance as voltage source 0.01 ohms; j) transient response 50 μ seg. Besides of operating normally, that is as voltage source or current-source through the front controls, the source can be used and interconnected with one or other compatible sources (autoseries, autoparallel and programmed reference). The source will cost 70,000 pesos approximately. (author)
Optimization design on breakdown voltage of AlGaN/GaN high-electron mobility transistor
Yang, Liu; Changchun, Chai; Chunlei, Shi; Qingyang, Fan; Yuqian, Liu
2016-12-01
Simulations are carried out to explore the possibility of achieving high breakdown voltage of GaN HEMT (high-electron mobility transistor). GaN cap layers with gradual increase in the doping concentration from 2 × 1016 to 5 × 1019 cm-3 of N-type and P-type cap are investigated, respectively. Simulation results show that HEMT with P-doped GaN cap layer shows more potential to achieve higher breakdown voltage than N-doped GaN cap layer under the same doping concentration. This is because the ionized net negative space charges in P-GaN cap layer could modulate the surface electric field which makes more contribution to RESURF effect. Furthermore, a novel GaN/AlGaN/GaN HEMT with P-doped GaN buried layer in GaN buffer between gate and drain electrode is proposed. It shows enhanced performance. The breakdown voltage of the proposed structure is 640 V which is increased by 12% in comparison to UID (un-intentionally doped) GaN/AlGaN/GaN HEMT. We calculated and analyzed the distribution of electrons' density. It is found that the depleted region is wider and electric field maximum value is induced at the left edge of buried layer. So the novel structure with P-doped GaN buried layer embedded in GaN buffer has the better improving characteristics of the power devices. Project supported by the National Basic Research Program of China (No. 2014CB339900) and the Open Fund of Key Laboratory of Complex Electromagnetic Environment Science and Technology, China Academy of Engineering Physics (No. 2015-0214.XY.K).
Realtime radiation exposure monitor and control apparatus
International Nuclear Information System (INIS)
Cowart, R.W.
1981-01-01
This patent application relates to an apparatus and methods used to obtain image information from modulation of a uniform flux. An exposure measuring apparatus is disclosed which comprises a multilayered detector structure having an external circuit connected to a transparent insulating layer and to a conductive plate a radiation source adapted to irradiate the detector structure with radiation capable of producing electron-hole pairs in a photoconductive layer of the detector wherein the flow of current within the external circuit is measured when the detector is irradiated by the radiation source. (author)
Investigation of Electron Beam Induced Mass Loss of Embedding Media in the Low Voltage STEM
Czech Academy of Sciences Publication Activity Database
Novotná, V.; Hrubanová, Kamila; Nebesářová, J.; Krzyžánek, Vladislav
2014-01-01
Roč. 20, S3 (2014), s. 1270-1271 ISSN 1431-9276 R&D Projects: GA MŠk EE.2.3.20.0103; GA MŠk(CZ) LO1212; GA ČR(CZ) GA14-20012S; GA TA ČR TE01020118 Institutional support: RVO:68081731 Keywords : mass loss * mass -thickness measurement * low voltage STEM Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 1.877, year: 2014
Pulsed wire discharge apparatus for mass production of copper nanopowders.
Suematsu, H; Nishimura, S; Murai, K; Hayashi, Y; Suzuki, T; Nakayama, T; Jiang, W; Yamazaki, A; Seki, K; Niihara, K
2007-05-01
A pulsed wire discharge (PWD) apparatus for the mass production of nanopowders has been developed. The apparatus has a continuous wire feeder, which is operated in synchronization with a discharging circuit. The apparatus is designed for operation at a maximum repetition rate of 1.4 Hz at a stored energy of 160 J. In the present study, Cu nanopowder was synthesized using the PWD apparatus and the performance of the apparatus was examined. Cu nanopowder of 2.0 g quantity was prepared in N(2) gas at 100 kPa for 90 s. The particle size distribution of the Cu nanopowder was analyzed by transmission electron microscopy and the mean surface diameter was determined to be 65 nm. The ratio of the production mass of the powder to input energy was 362 g/kW h.
Useinov, Arthur
2011-10-22
In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-01-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-07-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.
High-voltage engineering and testing
Ryan, Hugh M
2013-01-01
This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.
Phase-wise enhanced voltage support from electric vehicles in a Danish low-voltage distribution grid
DEFF Research Database (Denmark)
Knezovic, Katarina; Marinelli, Mattia
2016-01-01
High deployment of electric vehicles (EVs) imposes great challenges for the distribution grids, especially in unbalanced systems with notable voltage variations which detrimentally affect security of supply. On the other hand, with development of Vehicle-to-Grid technology, EVs may be able...... to provide numerous services for grid support, e.g., voltage control. Implemented electronic equipment will allow them to exchange reactive power for autonomous voltage support without communicating with the distribution system operator or influencing the available active power for primary transportation...
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
The Design of Nanosecond Fast-switch Pulsed High Voltage Power Supply Based on Solid-state
International Nuclear Information System (INIS)
Chen Wenguang; Chen Wei; Rao Yihua
2009-01-01
The high voltage pulsed power supply is applied in the experiment of the nuclear science widely. It main consist of DC high-voltage power supply (HVPS) and pulse modulator. The high-frequency series-resonant inverter technology and IGBT series technology are used to design the HVPS and the modulator, respectively. The main circuit, control circuit, high voltage transformer and solid-state switch are illuminated in the paper. The apparatus can operate at a maximum output voltage of 6 kilovolt, which can be modulated single pulse and also be modulated by series pulse. A prototype is fabricated and tested, experimental results show that the pulsed power supply is well-designed and rising edge time to meet the nsclass; it can achieve the requirement of rapid modulation. (authors)
International Nuclear Information System (INIS)
Yadav, Namita; Bhatt, Pragya; Singh, Raj; Singh, B.K.; Quarles, C.A.; Shanker, R.
2014-01-01
An apparatus is developed to measure the energy- and angular distributions of bremsstrahlung generated from collisions of energetic electrons with isolated atoms and molecules. A considerable reduction of thick target bremsstrahlung (TTB) background produced by scattered electrons from the chamber wall is achieved. Details of the experimental setup with regard to design of its components, experimental technique, data acquisition and analysis etc. are given and discussed. The reliability and performance of the setup are demonstrated by obtaining some test results on angular- and energy distributions of bremsstrahlung produced in collisions of 4.0 keV electrons with free argon atoms. These results are compared with the theoretical predictions of the ordinary- and the polarization bremsstrahlung emissions. In this comparison, the experimental data for energy distributions of BS photons are found to be in reasonable agreement while they are found to have noticeable differences in shape of angular distributions. - Highlights: • Experimental setup is developed to study DDCS of electron-bremsstrahlung from gaseous targets. • TTB from scattering chamber's wall is reduced appreciably by using a teflon cylinder. • Shape of DDCS of bremsstrahlung compared with the theories shows a satisfactory match. • Angular distributions of bremsstrahlung show anisotropy but still affected by TTB background photons
Energy Technology Data Exchange (ETDEWEB)
Vexler, M. I., E-mail: vexler@mail.ioffe.ru; Illarionov, Yu. Yu.; Grekhov, I. V. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation)
2017-04-15
The prerequisites for electron storage in the quantum well of a metal–oxide–p{sup +}-Si resonant-tunneling structure and the effect of the stored charge on the voltage distribution are theoretically investigated. Systems with SiO{sub 2}, HfO{sub 2}, and TiO{sub 2} insulators are studied. It is demonstrated that the occurrence of a charge in the well in the case of resonant transport can be expected in structures on substrates with an acceptor concentration from (5–6) × 10{sup 18} to (2–3) × 10{sup 19} cm{sup –3} in the range of oxide thicknesses dependent on this concentration. In particular, the oxide layer thickness in the structures with SiO{sub 2}/p{sup +}-Si(10{sup 19} cm{sup –3}) should exceed ~3 nm. The electron density in the well can reach ~10{sup 12} cm{sup –2} and higher. However, the effect of this charge on the electrostatics of the structure becomes noticeable only at relatively high voltages far above the activation of resonant transport through the first subband.
Hlaing, Htay; Kim, Chang-Hyun; Carta, Fabio; Nam, Chang-Yong; Barton, Rob A; Petrone, Nicholas; Hone, James; Kymissis, Ioannis
2015-01-14
The vertical integration of graphene with inorganic semiconductors, oxide semiconductors, and newly emerging layered materials has recently been demonstrated as a promising route toward novel electronic and optoelectronic devices. Here, we report organic thin film transistors based on vertical heterojunctions of graphene and organic semiconductors. In these thin heterostructure devices, current modulation is accomplished by tuning of the injection barriers at the semiconductor/graphene interface with the application of a gate voltage. N-channel devices fabricated with a thin layer of C60 show a room temperature on/off ratio >10(4) and current density of up to 44 mAcm(-2). Because of the ultrashort channel intrinsic to the vertical structure, the device is fully operational at a driving voltage of 200 mV. A complementary p-channel device is also investigated, and a logic inverter based on two complementary transistors is demonstrated. The vertical integration of graphene with organic semiconductors via simple, scalable, and low-temperature fabrication processes opens up new opportunities to realize flexible, transparent organic electronic, and optoelectronic devices.
Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen
2015-10-21
The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.
Methods and apparatus for controlling rotary machines
Bagepalli, Bharat Sampathkumaran [Niskayuna, NY; Jansen, Patrick Lee [Scotia, NY; Barnes, Gary R [Delanson, NY; Fric, Thomas Frank [Greer, SC; Lyons, James Patrick Francis [Niskayuna, NY; Pierce, Kirk Gee [Simpsonville, SC; Holley, William Edwin [Greer, SC; Barbu, Corneliu [Guilderland, NY
2009-09-01
A control system for a rotary machine is provided. The rotary machine has at least one rotating member and at least one substantially stationary member positioned such that a clearance gap is defined between a portion of the rotating member and a portion of the substantially stationary member. The control system includes at least one clearance gap dimension measurement apparatus and at least one clearance gap adjustment assembly. The adjustment assembly is coupled in electronic data communication with the measurement apparatus. The control system is configured to process a clearance gap dimension signal and modulate the clearance gap dimension.
Vaz, R.; May, P. W.; Fox, N. A.; Harwood, C. J.; Chatterjee, V.; Smith, J. A.; Horsfield, C. J.; Lapington, J. S.; Osbourne, S.
2015-03-01
Diamond-based photomultipliers have the potential to provide a significant improvement over existing devices due to diamond's high secondary electron yield and narrow energy distribution of secondary electrons which improves energy resolution creating extremely fast response times. In this paper we describe an experimental apparatus designed to study secondary electron emission from diamond membranes only 400 nm thick, observed in reflection and transmission configurations. The setup consists of a system of calibrated P22 green phosphor screens acting as radiation converters which are used in combination with photomultiplier tubes to acquire secondary emission yield data from the diamond samples. The superior signal voltage sampling of the phosphor screen setup compared with traditional Faraday Cup detection allows the variation in the secondary electron yield across the sample to be visualised, allowing spatial distributions to be obtained. Preliminary reflection and transmission yield data are presented as a function of primary electron energy for selected CVD diamond films and membranes. Reflection data were also obtained from the same sample set using a Faraday Cup detector setup. In general, the curves for secondary electron yield versus primary energy for both measurement setups were comparable. On average a 15-20% lower signal was recorded on our setup compared to the Faraday Cup, which was attributed to the lower photoluminescent efficiency of the P22 phosphor screens when operated at sub-kilovolt bias voltages.
Method and apparatus for altering material
Stinnett, Regan W.; Greenly, John B.
2002-02-05
Methods and apparatus for thermally altering the near surface characteristics of a material are described. In particular, a repetitively pulsed ion beam system comprising a high energy pulsed power source and an ion beam generator are described which are capable of producing single species high voltage ion beams (0.25-2.5 MeV) at 1-1000 kW average power and over extended operating cycles (10.sup.8). Irradiating materials with such high energy, repetitively pulsed ion beams can yield surface treatments including localized high temperature anneals to melting, both followed by rapid thermal quenching to ambient temperatures to achieve both novel and heretofore commercially unachievable physical characteristics in a near surface layer of material.
Innovation of High Voltage Supply Adjustment Device on Diagnostic X-Ray Machine
International Nuclear Information System (INIS)
Sujatno; Wiranto Budi Santoso
2010-01-01
Innovation of high voltage supply adjustment device on diagnostic x-ray machine has been carried out. The innovation is conducted by utilizing an electronic circuit as a high voltage adjustment device. Usually a diagnostic x-ray machine utilizes a transformer or an auto-transformer as a high voltage supply adjustment device. A high power diagnostic x-ray machine needs a high power transformer which has big physical dimension. Therefore a box control where the transformer is located has to have big physical dimension. Besides, the price of the transformer is expensive and hardly found in local markets. In this innovation, the transformer is replaced by an electronic circuit. The main component of the electronic circuit is Triac BTA-40. As adjustment device, the triac is controlled by a variable resistor which is coupled by a stepper motor. A step movement of stepper motor varies a value of resistor. The resistor value determines the triac gate voltage. Furthermore the triac will open according to the value of electrical current flowing to the gate. When the gate is open, electrical voltage and current will flow from cathode to anode of the triac. The value of these electrical voltage and current depend on gate open condition. Then this triac output voltage is feed to diagnostic x-ray machine high voltage supply. Therefore the high voltage value of diagnostic x-ray machine is adjusted by the output voltage of the electronic circuit. By using this electronic circuit, the physical dimension of diagnostic x-ray machine box control and the price of the equipment can be reduced. (author)
International Nuclear Information System (INIS)
Weiss, M.E.
1980-01-01
Intra-oral dental X-ray apparatus for panoramic dental radiography is described in detail. It comprises an electron gun having an elongated tubular target carrier extending into the patient's mouth. The carrier supports an inclined target for direction of an X-ray pattern towards a film positioned externally of the patient's mouth. Image definition is improved by a focusing anode which focuses the electron beam into a sharp spot (0.05 to 0.10 mm diameter) on the target. The potential on the focusing anode is adjustable to vary the size of the spot. An X-ray transmitting ceramic (oxides of Be, Al and Si) window is positioned adjacent to the front face of the target. The electron beam can be magnetically deflected to change the X-ray beam direction. (author)
Cavallo's multiplier for in situ generation of high voltage
Clayton, S. M.; Ito, T. M.; Ramsey, J. C.; Wei, W.; Blatnik, M. A.; Filippone, B. W.; Seidel, G. M.
2018-05-01
A classic electrostatic induction machine, Cavallo's multiplier, is suggested for in situ production of very high voltage in cryogenic environments. The device is suitable for generating a large electrostatic field under conditions of very small load current. Operation of the Cavallo multiplier is analyzed, with quantitative description in terms of mutual capacitances between electrodes in the system. A demonstration apparatus was constructed, and measured voltages are compared to predictions based on measured capacitances in the system. The simplicity of the Cavallo multiplier makes it amenable to electrostatic analysis using finite element software, and electrode shapes can be optimized to take advantage of a high dielectric strength medium such as liquid helium. A design study is presented for a Cavallo multiplier in a large-scale, cryogenic experiment to measure the neutron electric dipole moment.
Zhang, Zhu; Li, Hongbin; Tang, Dengping; Hu, Chen; Jiao, Yang
2017-10-01
Metering performance is the key parameter of an electronic voltage transformer (EVT), and it requires high accuracy. The conventional off-line calibration method using a standard voltage transformer is not suitable for the key equipment in a smart substation, which needs on-line monitoring. In this article, we propose a method for monitoring the metering performance of an EVT on-line based on cyber-physics correlation analysis. By the electrical and physical properties of a substation running in three-phase symmetry, the principal component analysis method is used to separate the metering deviation caused by the primary fluctuation and the EVT anomaly. The characteristic statistics of the measured data during operation are extracted, and the metering performance of the EVT is evaluated by analyzing the change in statistics. The experimental results show that the method successfully monitors the metering deviation of a Class 0.2 EVT accurately. The method demonstrates the accurate evaluation of on-line monitoring of the metering performance on an EVT without a standard voltage transformer.
International Nuclear Information System (INIS)
Zhang, Zhu; Li, Hongbin; Hu, Chen; Jiao, Yang; Tang, Dengping
2017-01-01
Metering performance is the key parameter of an electronic voltage transformer (EVT), and it requires high accuracy. The conventional off-line calibration method using a standard voltage transformer is not suitable for the key equipment in a smart substation, which needs on-line monitoring. In this article, we propose a method for monitoring the metering performance of an EVT on-line based on cyber-physics correlation analysis. By the electrical and physical properties of a substation running in three-phase symmetry, the principal component analysis method is used to separate the metering deviation caused by the primary fluctuation and the EVT anomaly. The characteristic statistics of the measured data during operation are extracted, and the metering performance of the EVT is evaluated by analyzing the change in statistics. The experimental results show that the method successfully monitors the metering deviation of a Class 0.2 EVT accurately. The method demonstrates the accurate evaluation of on-line monitoring of the metering performance on an EVT without a standard voltage transformer. (paper)
Directory of Open Access Journals (Sweden)
Margo P
2009-11-01
Full Text Available Dynamic Voltage Restorer (DVR is a power electronics device to protect sensitive load when voltage sag occurs. Commonly, sensitive loads are electronic-based devices which generate harmonics. The magnitude and phase of compensated voltage in DVR depend on grounding system and type of fault. If the system is floating, the zero sequence components do not appear on the load side. Meanwhile, in a neutral grounded system, voltage sag is extremely affected by zero sequence components. A blocking transformer is commonly installed in series with DVR to reduce the effect of zero sequence components. This paper proposes a new DVR control scheme that is capable of eliminating the blocking transformer and reducing harmonic distortion. The system uses fuzzy polar controller to replace the conventional PI or FL controller that is commonly used. By taking into account the zero sequence components in the controller design, the effects of zero sequence components can be compensated. Simulated results show the effectiveness of the proposed DVR controller
International Nuclear Information System (INIS)
Auciello, O.; Krauss, A.R.; Gruen, D.M.; Shah, P.; Corrigan, T.; Kordesch, M.E.; Chang, R.P.; Barr, T.L.
1999-01-01
Alkali metals have extremely low work functions and are, therefore, expected to result in significant enhancement of the electron emission if they are used as coatings on Mo or Si microtip field-emission arrays (FEAs). However, the alkali metals are physically and chemically unstable in layers exceeding a few Angstrom in thickness. Maximum enhancement of electron emission occurs for alkali - metal layers 0.5 - 1 ML thick, but it is extremely difficult to fabricate and maintain such a thin alkali - metal coating. We present here an alternative means of producing chemically and thermally stable, self-replenishing lithium coatings approximately 1 ML thick, which results in a 13-fold reduction in the threshold voltage for electron emission compared with uncoated Si FEAs. copyright 1999 American Institute of Physics
Fiber-optic voltage measuring system
Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang
1993-09-01
A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.
A New Version of an Old Demonstration Experiment Using the Elihu Thomson Jumping Ring Apparatus
Foster, Theodore; Cary, Arthur; Mottmann, John; van Wyngaarden, Willem
2016-01-01
The goal of this paper is to make more widely known an eye-catching demonstration experiment in which a hanging conducting can is made to spin when placed near the iron core of an Elihu Thomson "jumping ring" apparatus. An explanation is given based on Faraday's law of induced voltages and the magnetic forces due to the core's fields…
Hysteresis analysis of graphene transistor under repeated test and gate voltage stress
International Nuclear Information System (INIS)
Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang
2014-01-01
The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)
On the theory of non-self-maintained low voltage arc discharge
International Nuclear Information System (INIS)
Shcherbinin, P.P.; Cherednichenko, Yu.G.
1980-01-01
In the approximation of constant temperature of plasma electrons for two emitter temperatures 1440 and 1830 K calculated are the volt-ampere characteristics and components of the voltage internal drop in a thermionic converter in the cases of self-maintained discharge in cesium and with an external source of atom ionization and electron heating. It is obtained, that using an external ionization source the decrease of voltage drop in the interelectrode gap with account of ionization energy constitutes about 0.1 V. Electron heating is not effective. For further reduction of voltage losses it is necessary to search for ways for decreasing electron Coulomb scattering on ions
Energy Technology Data Exchange (ETDEWEB)
Hernandez M, V; Lopez V, H; Alba P, U
1988-04-15
The first version of a manual to operate the generator of high voltage generator of the Pelletron electron accelerator built in the ININ is presented. Since this generator has several components and/or elements, the one manual present has the purpose that the armed one or maintenance of anyone on its parts, is carried out in an orderly and efficient way. (Author)
Design and Control of a Dynamic Voltage Restorer
DEFF Research Database (Denmark)
Nielsen, John Godsk
voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...
Ion-beam apparatus and method for analyzing and controlling integrated circuits
Campbell, Ann N.; Soden, Jerry M.
1998-01-01
An ion-beam apparatus and method for analyzing and controlling integrated circuits. The ion-beam apparatus comprises a stage for holding one or more integrated circuits (ICs); a source means for producing a focused ion beam; and a beam-directing means for directing the focused ion beam to irradiate a predetermined portion of the IC for sufficient time to provide an ion-beam-generated electrical input signal to a predetermined element of the IC. The apparatus and method have applications to failure analysis and developmental analysis of ICs and permit an alteration, control, or programming of logic states or device parameters within the IC either separate from or in combination with applied electrical stimulus to the IC for analysis thereof. Preferred embodiments of the present invention including a secondary particle detector and an electron floodgun further permit imaging of the IC by secondary ions or electrons, and allow at least a partial removal or erasure of the ion-beam-generated electrical input signal.
Nakachi, Yoshiki; Ueda, Fukashi; Kajikawa, Takuya; Amau, Tooru; Kameyama, Hirokazu; Ito, Hisanori
This paper verifies the mechanism of occurring over voltage phenomena in the distributed power system on energizing the transformer. This over-voltage, which is observed at the actual distributed power system, with heavy inrush current is found to occur at about 0.1-0.2sec after the energizing and continue for a duration of more than 0.1[sec]. There is a concern that this over-voltage may operate the protection relay and deteriorate the insulation of apparatus. It is basically caused by the resonance between the shunt capacitors and saturated/unsaturated magnetizing inductance of transformer, system inductance. By using analytical formulation of a simple equivalent circuit, its mechanism has been verified through simulations carried out by using EMTP. Moreover, the sympathetic interaction between transformers is prolonged the duration of the over-voltage by the field test data is discussed in this paper.
Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge
Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.
2014-11-01
The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.
Calculation of the electron trajectory for 200 kV self-shielded electron accelerator
International Nuclear Information System (INIS)
Wang Shuiqing
2000-01-01
In order to calculate the electron trajectory of 200 kV self-shielded electron accelerator, the electric field is calculated with a TRAJ program. In this program, following electron track mash points one by one, the electron beam trajectories are calculated. Knowing the effect of grid voltage on electron optics and gaining grid voltage focusing effect in the various energy grades, the authors have gained scientific basis for adjusting grid voltage, and also accumulated a wealth of experience for designing self-shielded electron accelerator or electron curtain in future
Useinov, Arthur; Mryasov, Oleg; Kosel, Jü rgen
2011-01-01
In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR
Foot-and-mouth disease virus-induced RNA polymerase is associated with Golgi apparatus.
Polatnick, J; Wool, S H
1985-01-01
Electrophoretic analysis of the Golgi apparatus isolated by differential centrifugation from radiolabeled cells infected with foot-and-mouth disease virus showed about 10 protein bands. The virus-induced RNA polymerase was identified by immunoprecipitation and electron microscope staining procedures. Pulse-chase experiments indicated that the polymerase passed through the Golgi apparatus in less than 1 h.
Semiconductor apparatus and method of fabrication for a semiconductor apparatus
2010-01-01
The invention relates to a semiconductor apparatus (1) and a method of fabrication for a semiconductor apparatus (1), wherein the semiconductor apparatus (1) comprises a semiconductor layer (2) and a passivation layer (3), arranged on a surface of the semiconductor layer (2), for passivating the
An apparatus and process for forming P-N junction semiconductor units
International Nuclear Information System (INIS)
1975-01-01
It is stated that although many methods of ion implantation have been developed it seems that the method of 'hot implantation' is still in its infancy. In this method the target is preheated in an ion implantor during implantation of ions, leading to radiation enhanced diffusion. The apparatus described comprises the following: (i) a bell jar evacuated to -3 Torr containing four electrodes arranged in two pairs, one electrode of the first pair being in the form of a mesh; (ii) a source of high pulsating direct voltage connected to the first pair of electrodes, with the mesh electrode negatively poled, to ionise the rarified air in the bell jar and accelerate the resulting positive N and O ions; (iii) an RF voltage source connected to the other pair of electrodes to facilitate the ionisation; (iv) a dopant semiconductor body, heated by a wire wound heater, placed underneath the mesh electrode so that the accelerated ions bombard the dopant layer through the mesh electrode and implant dopant atoms in the semiconductor body. The distance between the mesh electrode and the surface of the dopant-coated semiconductive body, should be about 5mm. The mesh electrode consists of a sputtering-resistant refractory metal, and includes a cooling system. The dopant-coated semiconductive body is placed on a ceramic plate in the bell jar, and the power supply line of the heater is insulated from the voltage applied to the negative electrode, which is earthed, by using an insulated heater transformer combined with an autotransformer. The ceramic plate is attached to a plate on which the heater is wound, and the temperature of the heating should be variable between 400 0 and 500 0 C. A process for forming P-N junction semiconductor units using this apparatus is described. (U.K.)
Functional Morphology of Venom Apparatus of Euscorpius mingrelicus(Scorpiones: Euscorpiidae)
YİĞİT, Nazife; BAYRAM, Abdullah; DANIŞMAN, Tarık
2007-01-01
The objective of the present study is to describe the functional morphology of venom apparatus of Euscorpius mingrelicus (Kessler, 1874) by using light microscope and scanning electron microscope (SEM). The venom apparatus, situates in the last segment of metasoma (telson), is composed of a pair of venom glands and sting. Telson is covered by cuticular exoskeleton as well as all body, and there are cuticular setae and pits on it as serve sensory organ. The general organization of the venom ap...
Loop-voltage tomography in tokamaks using transient synchrotron radiation
International Nuclear Information System (INIS)
Fisch, N.J.; Kritz, A.H.; Hunter Coll., New York, NY
1989-07-01
The loop voltage in tokamaks is particularly difficult to measure anywhere but at the plasma periphery. A brief, deliberate, perturbation of hot plasma electrons, however, produces a transient radiation response that is sensitive to this voltage. We investigate how such a radiation response can be used to diagnose the loop voltage. 24 refs., 6 figs
Spectroscopic Chemical Analysis Methods and Apparatus
Hug, William F. (Inventor); Reid, Ray D. (Inventor); Bhartia, Rohit (Inventor); Lane, Arthur L. (Inventor)
2018-01-01
Spectroscopic chemical analysis methods and apparatus are disclosed which employ deep ultraviolet (e.g. in the 200 nm to 300 nm spectral range) electron beam pumped wide bandgap semiconductor lasers, incoherent wide bandgap semiconductor light emitting devices, and hollow cathode metal ion lasers to perform non-contact, non-invasive detection of unknown chemical analytes. These deep ultraviolet sources enable dramatic size, weight and power consumption reductions of chemical analysis instruments. In some embodiments, Raman spectroscopic detection methods and apparatus use ultra-narrow-band angle tuning filters, acousto-optic tuning filters, and temperature tuned filters to enable ultra-miniature analyzers for chemical identification. In some embodiments Raman analysis is conducted along with photoluminescence spectroscopy (i.e. fluorescence and/or phosphorescence spectroscopy) to provide high levels of sensitivity and specificity in the same instrument.
Constant potential high-voltage generator
International Nuclear Information System (INIS)
Resnick, T.A.; Dupuis, W.A.; Palermo, T.
1980-01-01
An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)
International Nuclear Information System (INIS)
Takata, N.
2000-01-01
It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the
Receivers for processing electron beam pick-up electrode signals
International Nuclear Information System (INIS)
Anon.
1991-01-01
There are several methods of determining the transverse position of the electron beam, based upon sensing either the electric field, the magnetic field, or both. At the NSLS the transverse beam position monitors each consist of a set of four circular electrodes. There are 48 sets of pick-up electrodes in the X-ray ring and 24 in the VUV storage ring for determining the electron orbit, and a few extra sets installed for specialized purposes. When the beam passes between the four electrodes, charge is induced on each electrode, the amount depending upon the distance of the beam from that electrode. If V a , V b , V c and V d given by a difference between pairs of electrodes normalized for variations in beam current by dividing by the sum of electrode voltages. The method of processing these signals depends upon their time structure. The electrons circulating around the vacuum chamber are concentrated in short bunches within stability buckets produced by the accelerating voltage in the RF cavities. The charges induced on the pickup electrodes then are narrow pulses, a fraction of a nanosecond long, and would result in a monopolar voltage pulses if it were not for the impedance of the cable connecting the electrode to the processing apparatus. The capacitance between each electrode and the chamber wall is only a few picofarads and is effectively in parallel with the cable impedance (50 ohms). Thus an appreciable amount of the charge flows off the electrode while the bunch is between the electrodes, resulting in potential of opposite sign as the bunch is leaving the vicinity of the electrode. The resulting signal consists of a series of bipolar pulses, each of less than one nanosecond duration
Method and apparatus for in-situ characterization of energy storage and energy conversion devices
Christophersen, Jon P [Idaho Falls, ID; Motloch, Chester G [Idaho Falls, ID; Morrison, John L [Butte, MT; Albrecht, Weston [Layton, UT
2010-03-09
Disclosed are methods and apparatuses for determining an impedance of an energy-output device using a random noise stimulus applied to the energy-output device. A random noise signal is generated and converted to a random noise stimulus as a current source correlated to the random noise signal. A bias-reduced response of the energy-output device to the random noise stimulus is generated by comparing a voltage at the energy-output device terminal to an average voltage signal. The random noise stimulus and bias-reduced response may be periodically sampled to generate a time-varying current stimulus and a time-varying voltage response, which may be correlated to generate an autocorrelated stimulus, an autocorrelated response, and a cross-correlated response. Finally, the autocorrelated stimulus, the autocorrelated response, and the cross-correlated response may be combined to determine at least one of impedance amplitude, impedance phase, and complex impedance.
International Nuclear Information System (INIS)
Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.
2016-01-01
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Energy Technology Data Exchange (ETDEWEB)
Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.
2016-07-11
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
Energy Technology Data Exchange (ETDEWEB)
Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)
2014-11-14
Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.
High-voltage electron-microscopical observation of crack-tip dislocations in silicon crystals
International Nuclear Information System (INIS)
Tanaka, Masaki; Higashida, Kenji
2005-01-01
Crack-tip dislocations in silicon single crystals were observed by high-voltage electron microscopy. Cracks were introduced into silicon wafers at room temperature by a Vickers indenter. The indented specimens were annealed at 823 K in order to activate dislocation emission from the crack tip under the residual stress due to the indentation. In the specimen without annealing, no dislocations were observed around the crack. On the other hand, in the specimen after the annealing, the aspect of the early stage of dislocation emission was observed, where dislocations were emitted not as a perfect dislocation but as a partial dislocation in the hinge-type plastic zone. Prominent dislocation arrays that were emitted from a crack tip were also observed, and they were found to be of shielding type, which increases the fracture toughness of those crystals
The fabrication of 3-D nanostructures by a low- voltage EBL
Energy Technology Data Exchange (ETDEWEB)
Oh, Seung Hun [Department of Nano Science and Technology, Pusan National University (Korea, Republic of); Kim, Jae Gu [Department of Nano-Mechanical Systems, Korea Institute of Machinery and Materials (Korea, Republic of); Kim, Chang Seok [Department of Cogno-Mechatronics Engineering, Pusan National University (Korea, Republic of); Choi, Doo Sun; Chang, Sunghwan [Department of Nano-Mechanical Systems, Korea Institute of Machinery and Materials (Korea, Republic of); Jeong, Myung Yung, E-mail: myjeong@pusan.ac.kr [Department of Cogno-Mechatronics Engineering, Pusan National University (Korea, Republic of)
2011-02-15
Three-dimensional (3-D) structures are used in many applications, including the fabrication of opto-electronic and bio-MEMS devices. Among the various fabrication techniques available for 3-D structures, nano imprint lithography (NIL) is preferred for producing nanoscale 3-D patterns because of its simplicity, relatively short processing time, and high manufacturing precision. For efficient replication in NIL, a precise 3-D stamp must be used as an imprinting tool. Hence, we attempted the fabrication of original 3-D master molds by low-voltage electron beam lithography (EBL). We then fabricated polydimethylsiloxane (PDMS) stamps from the original 3-D mold via replica molding with ultrasonic vibration.First, we experimentally analyzed the characteristics of low-voltage EBL in terms of various parameters such as resist thickness, acceleration voltage, aperture size, and baking temperature. From these e-beam exposure experiments, we found that the exposure depth and width were almost saturated at 3 kV or lesser, even when the electron dosage was increased. This allowed for the fabrication of various stepped 3-D nanostructures at a low voltage. In addition, by using line-dose EBL, V-groove patterns could be fabricated on a cured electron resist (ER) at a low voltage and low baking temperature. Finally, the depth variation could be controlled to within 10 nm through superposition exposure at 1 kV. From these results, we determined the optimum electron beam exposure conditions for the fabrication of various 3-D structures on ERs by low-voltage EBL. We then fabricated PDMS stamps via the replica molding process.
49 CFR 234.205 - Operating characteristics of warning system apparatus.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Operating characteristics of warning system... characteristics of warning system apparatus. Operating characteristics of electromagnetic, electronic, or... limits within which the system is designed to operate. ...
Magnetic resonance imaging apparatus
International Nuclear Information System (INIS)
Ehnholm, G.J.
1991-01-01
This patent describes an electron spin resonance enhanced magnetic resonance (MR) imaging (ESREMRI) apparatus able to generate a primary magnetic field during periods of nuclear spin transition excitation and magnetic resonance signal detection. This allows the generation of ESREMRI images of a subject. A primary magnetic field of a second and higher value generated during periods of nuclear spin transition excitation and magnetic resonance signal detection can be used to generate conventional MR images of a subject. The ESREMRI and native MR images so generated may be combined, (or superimposed). (author)
Electron beam hardening type copper plate printing ink
International Nuclear Information System (INIS)
Kawamura, Eiji; Inoue, Mitsuo; Kusaki, Satoichiro
1989-01-01
Copper plate printing is the printing method of filling ink in the parts of concave printing elements on a type area, and transferring the ink to a base, and it is the feature that the ink in the printing element parts of a print rises. Copper plate prints show profound feeling, in addition, its effect of preventing forgery is high. This method is generally called engraving printing, and is used frequently for printing various bills and artistic prints. The electron beam irradiation apparatus installed in the laboratory of the Printing Bureau, Ministry of Finance, is an experimental machine of area beam type, and is so constructed as to do batch conveyance and web conveyance. As the ink in printing element parts rises, the offset at the delivery part of a printing machine becomes a problem. Electron beam is superior in its transparency, and can dry instantaneously to the inside of opaque ink. At 200 kV of acceleration voltage, the ink of copper plate prints can be hardened by electron beam irradiation. The dilution monomers as the vehicle for ink were tested for their dilution capability and the effect of electron beam hardening. The problem in the utilization of electron beam is the deterioration of papers, and the counter-measures were tested. (K.I.)
Cheng, Xin-bing; Liu, Jin-liang; Qian, Bao-liang; Zhang, Yu; Zhang, Hong-bo
2009-11-01
A high voltage pulse transformer (HVPT) is usually used as a charging device for the pulse forming line (PFL) of intense electron-beam accelerators (IEBAs). Insulation of the HVPT is one of the important factors that restrict the development of the HVPT. Until now, considerable effort has been focused on minimizing high field regions to avoid insulation breakdown between windings. Characteristics of the HVPT have been widely discussed to achieve these goals, but the effects of the PFL and load resistance on HVPT are usually neglected. In this paper, a HVPT is used as a charging device for the PFL of an IEBA and the effect of the change in the load resistance on the HVPT of the IEBA is presented. When the load resistance does not match the wave impedance of the PFL, a high-frequency bipolar oscillating voltage will occur, and the amplitude of the oscillating voltage will increase with the decrease in the load resistance. The load resistance approximates to zero and the amplitude of the oscillating voltage is much higher. This makes it easier for surface flashover along the insulation materials to form and decrease the lifetime of the HVPT.
Energy Technology Data Exchange (ETDEWEB)
Jeon, Hyeon Soo; Cho, Sang Hee [Department of Information Display and Advanced Display Research Center, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Seo, Jaewon; Park, Yongsup [Department of Physics, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Suh, Min Chul, E-mail: mcsuh@khu.ac.kr [Department of Information Display and Advanced Display Research Center, Kyung Hee University, Seoul 130-701 (Korea, Republic of)
2013-11-01
We present polymeric buffer materials based on poly[2,7-(9,9-dioctyl-fluorene)-co-(1,4-phenylene -((4-sec-butylphenyl)imino)-1,4-phenylene)] (TFB) for highly efficient solution processed organic light emitting diodes (OLEDs). Doped TFB with 9,10-dicyanoanthracene, a weak electron acceptor results in significant improvement of current flow and driving voltage. Maximum current- and power-efficiency value of 12.6 cd/A and 18.1 lm/W are demonstrated from phosphorescent red OLEDs with this doped polymeric anode buffer system. - Highlights: • Polymeric buffer materials for organic light emitting diodes (OLEDs). • Method to control hole conductivity of polymeric buffer layer in OLED device. • Enhanced current density of buffer layers upon 9,10-dicyanoanthracene (DCA) doping. • Comparison of OLED devices having polymeric buffer layer with or without DCA. • Effect on operating voltage by doping DCA in the buffer layer.
Silicone elastomers with covalently incorporated aromatic voltage stabilisers
DEFF Research Database (Denmark)
A Razak, Aliff Hisyam; Skov, Anne Ladegaard
2017-01-01
to the incorporationof an aromatic voltage stabiliser, were prepared by cross-linking synthesised polydimethylsiloxane–polyphenylmethylsiloxane (PDMS–PPMS) copolymers. PPMS possesses voltage stabilisation capabilitiesbut is immiscible in PDMS, and thus the copolymerisation of the two components was necessary...... forhomogeneity. Concentrations of the voltage stabiliser were varied by changing the molecular weights ofthe PPMS in the copolymer. The developed elastomers were inherently soft with enhanced electricalbreakdown strengths, due to delocalisedp-electrons of the aromatic constituent. An optimumconcentration...
Evaluation of Niobium as Candidate Electrode Material for DC High Voltage Photoelectron Guns
BastaniNejad, M.; Mohamed, Abdullah; Elmustafa, A. A.; Adderley, P.; Clark, J.; Covert, S.; Hansknecht, J.; Hernandez-Garcia, C.; Poelker, M.; Mammei, R.;
2012-01-01
The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirror-like finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain) that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium) could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (< 10 pA) at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18:7 MV/m.
Precision High-Voltage DC Dividers and Their Calibration
Czech Academy of Sciences Publication Activity Database
Dragounová, Naděžda
2005-01-01
Roč. 54, č. 5 (2005), s. 1911-1915 ISSN 0018-9456 R&D Projects: GA AV ČR KSK1048102; GA ČR GA202/03/0889 Keywords : calibration * dc voltage * high voltage (HV) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.665, year: 2005
Apparatus including a plurality of spaced transformers for locating short circuits in cables
Cason, R. L.; Mcstay, J. J. (Inventor)
1978-01-01
A cable fault locator is described for sensing faults such as short circuits in power cables. The apparatus includes a plurality of current transformers strategically located along a cable. Trigger circuits are connected to each of the current transformers for placing a resistor in series with a resistive element responsive to an abnormally high current flowing through that portion of the cable. By measuring the voltage drop across the resistive element, the location of the fault can be determined.
Modular High Voltage Power Supply
Energy Technology Data Exchange (ETDEWEB)
Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-05-18
The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.
Harmonic current interaction at a low voltage customer's installations
Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.
2009-01-01
The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low
Coating and curing apparatus and methods
Brophy, Brenor L; Maghsoodi, Sina; Neyman, Patrick J; Gonsalves, Peter R; Hirsch, Jeffrey G; Yang, Yu S
2015-02-24
Disclosed are coating apparatus including flow coating and roll-coating that may be used for uniform sol-gel coating of substrates such as glass, solar panels, windows or part of an electronic display. Also disclosed are methods for substrate preparation, flow coating and roll coating. Lastly systems and methods for skin curing sol-gel coatings deposited onto the surface of glass substrates using a high temperature air-knife are disclosed.
DEFF Research Database (Denmark)
2017-01-01
The present invention relates to the field of filtering, more precisely the present invention concerns an apparatus and a method for the separation of dry matter from a medium and the use of said apparatus. One embodiment discloses an apparatus for the separation of dry matter and liquid from a m...
Prototype Design of Plasma-Nitriding Apparatus for Components of Industries
International Nuclear Information System (INIS)
Bandriyana, B.; Tutun Nugraha; Silakhuddin
2003-01-01
An apparatus to carry-out plasma-nitriding surface treatment has been designed. The construction was planned as a prototype for a larger system at industrial scale. The design was based on a similar apparatus currently operating at the Accelerator Laboratory at the P3TM-BATAN, in Yogyakarta. The system consists of a main vacuum chamber from steel SS-304, 45 cm OD, 55 cm height and is equipped with a nitriding chamber in the inner part that also functions as a plasma container (Quartz, cylindrical, 38 cm OD, 40 cm height). The system utilized an anode-cathode pair to generate nitrogen plasma, as well as to accelerate and direct the positively-charged-plasma toward the surface of the material to be treated. The pressure inside the chamber is designed to be in the region of 10 -3 mb with a temperature between 350-590 o C. Pulsated DC high voltage can be set at 1-50 kV at a frequency between 100-1000 Hz and current 1- 50 mA. The safety and reliability features have been designed to obtain nitriding results that are in accordance with the required technical specification as well as economical constrain. It is hoped that this device can become a prototype for future development of an industrial scale plasma-nitriding apparatus. (author)
Energy Technology Data Exchange (ETDEWEB)
Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)
2014-07-01
Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.
Hu, Chen; Chen, Mian-zhou; Li, Hong-bin; Zhang, Zhu; Jiao, Yang; Shao, Haiming
2018-05-01
Ordinarily electronic voltage transformers (EVTs) are calibrated off-line and the calibration procedure requires complex switching operations, which will influence the reliability of the power grid and induce large economic losses. To overcome this problem, this paper investigates a 110 kV on-site calibration system for EVTs, including a standard channel, a calibrated channel and a PC equipped with the LabView environment. The standard channel employs a standard capacitor and an analogue integrating circuit to reconstruct the primary voltage signal. Moreover, an adaptive full-phase discrete Fourier transform (DFT) algorithm is proposed to extract electrical parameters. The algorithm involves the process of extracting the frequency of the grid, adjusting the operation points, and calculating the results using DFT. In addition, an insulated automatic lifting device is designed to realize the live connection of the standard capacitor, which is driven by a wireless remote controller. A performance test of the capacitor verifies the accurateness of the standard capacitor. A system calibration test shows that the system ratio error is less than 0.04% and the phase error is below 2‧, which meets the requirement of the 0.2 accuracy class. Finally, the developed calibration system was used in a substation, and the field test data validates the availability of the system.
Recycling potential for low voltage and high voltage high rupturing capacity fuse links.
Psomopoulos, Constantinos S; Barkas, Dimitrios A; Kaminaris, Stavros D; Ioannidis, George C; Karagiannopoulos, Panagiotis
2017-12-01
Low voltage and high voltage high-rupturing-capacity fuse links are used in LV and HV installations respectively, protecting mainly the LV and HV electricity distribution and transportation networks. The Waste Electrical and Electronic Equipment Directive (2002/96/EC) for "Waste of electrical and electronic equipment" is the main related legislation and as it concerns electrical and electronic equipment, it includes electric fuses. Although, the fuse links consist of recyclable materials, only small scale actions have been implemented for their recycling around Europe. This work presents the possibilities for material recovery from this specialized industrial waste for which there are only limited volume data. Furthermore, in order to present the huge possibilities and environmental benefits, it presents the potential for recycling of HRC fuses used by the Public Power Corporation of Greece, which is the major consumer for the country, but one of the smallest ones in Europe and globally, emphasizing in this way in the issue. According to the obtained results, fuse recycling could contribute to the effort for minimize the impacts on the environment through materials recovery and reduction of the wastes' volume disposed of in landfills. Copyright © 2017 Elsevier Ltd. All rights reserved.
Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation
Directory of Open Access Journals (Sweden)
N Hatefi Kargan
2013-09-01
Full Text Available In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.
Multipactor discharge apparatus
International Nuclear Information System (INIS)
1976-01-01
The invention deals with a multipactor discharge apparatus which can be used for tuning microwave organs such as magnetron oscillators and other cavity resonators. This apparatus is suitable for delivering an improved tuning effect in a resonation organ wherefrom the working frequency must be set. This apparatus is equipped with two multipactor discharge electrodes set in a configuration such to that a net current flows from one electrode to another. These electrodes are parallel and flat. The apparatus can be used in magnetron devices as well for continuous waves as for impulses
Generation of low KV x-ray portal images with mega-voltage electron beams
International Nuclear Information System (INIS)
Kenny, J.; Ebert, M.
2004-01-01
Full text: The increasing complexity of radiation therapy plans and reduced target margins, have made accurate localization of patients at treatment a crucial quality assurance issue. Mega-voltage portal images, the standard for treatment localization, are inherently low in contrast because x-ray attenuation at these energies is similar for most body tissues. Thus anatomical features are difficult to distinguish and match to features on a reference diagnostic image. This project investigates the possibly of using x-rays created by an external target placed in the path of a clinical mega-voltage electron beam. This target is optimised to produce a higher proportion of useful imaging x-rays in the range of 50-200kV. It is thought that a high efficiency Varian aSi500 amorphous silicon EPID will be sufficient to compensate for the very low efficiency of x-ray production. The project was undertaken with concurrent theoretical and experimental components. The former involved Monte Carlo models of low Z target design while in the later, experimental data was gathered to validate the model and explore the practical issues associated with electron mode image acquisition. A 6 MeV electron beam model for a Varian Clinac 21EX was developed with EGS4/BEAMnrc User Code and compared to measured beam data. Phase space data scored at the secondary collimator then became the input for simulations of a target placed in the accessory tray. Target materials were predominately low atomic number (Z) because a) production of high energy x-rays is minimized and, b) fewer low energy x-rays produced will be absorbed within the target. Photon and electron energy spectrums of the modified beam were evaluated for a range of target geometries. Ultimately, several materials were used in combination to optimise an x-ray yield for energies <200kV while removing electrons and very low energy x-rays, that contribute to patient dose but not to image formation. Low energy images of a PIPs EPID QA
International Nuclear Information System (INIS)
Span, F.J.
1988-01-01
The patent concerns a gamma tomography apparatus for medical diagnosis. The apparatus comprises a gamma scintillation camera head and a suspension system for supporting and positioning the camera head with respect for the patient. Both total body scanning and single photon emission tomography can be carried out with the apparatus. (U.K.)
All-Pass Filter Based Linear Voltage Controlled Quadrature Oscillator
Directory of Open Access Journals (Sweden)
Koushick Mathur
2017-01-01
Full Text Available A linear voltage controlled quadrature oscillator implemented from a first-order electronically tunable all-pass filter (ETAF is presented. The active element is commercially available current feedback amplifier (AD844 in conjunction with the relatively new Multiplication Mode Current Conveyor (MMCC device. Electronic tunability is obtained by the control node voltage (V of the MMCC. Effects of the device nonidealities, namely, the parasitic capacitors and the roll-off poles of the port-transfer ratios of the device, are shown to be negligible, even though the usable high-frequency ranges are constrained by these imperfections. Subsequently the filter is looped with an electronically tunable integrator (ETI to implement the quadrature oscillator (QO. Experimental responses on the voltage tunable phase of the filter and the linear-tuning law of the quadrature oscillator up to 9.9 MHz at low THD are verified by simulation and hardware tests.
High-Voltage Clock Driver for Photon-Counting CCD Characterization
Baker, Robert
2013-01-01
A document discusses the CCD97 from e2v technologies as it is being evaluated at Goddard Space Flight Center's Detector Characterization Laboratory (DCL) for possible use in ultra-low background noise space astronomy applications, such as Terrestrial Planet Finder Coronagraph (TPF-C). The CCD97 includes a photoncounting mode where the equivalent output noise is less than one electron. Use of this mode requires a clock signal at a voltage level greater than the level achievable by the existing CCD (charge-coupled-device) electronics. A high-voltage waveform generator has been developed in code 660/601 to support the CCD97 evaluation. The unit generates required clock waveforms at voltage levels from -20 to +50 V. It deals with standard and arbitrary waveforms and supports pixel rates from 50 to 500 kHz. The system is designed to interface with existing Leach CCD electronics.
International Nuclear Information System (INIS)
Sujatno; Tatah Nurbarkah; Toto Trikasjono; Nugroho
2013-01-01
The control system has made a parameter X-ray machine mobile IX 7-02 using personal computers. The X-Ray or Roentgen apparatus is an equipment used for medical diagnosis. Before the X-Ray apparatus is operated, its parameter to be set are high voltage (kV), tube current (mA) and exposure time (s). The control system in a conventional X-Ray apparatus still use analog system. On the X-Ray manual operations resulted the value of velocity data that are less accurate, therefore it needs to be carried out a control system modifying using micro controller AT89S51 and the parameter value was setting through personal computer. In the limited voltage regulation to the movement of the stepper motor that drives the chain dimer, the result of testing obtained the value of angle stepper motors with an estimated value of voltage 50 kV, 60 kV, 70 kV, 80 kV, 90 kV and 100 kV respectively 164°, 182°, 200°, 218°, 236° and 258°. Current selection by 4 choices such as 50 mA, 60 mA, 70 mA and 80 mA can successfully activate the relay. The timing of exposure in the range of 0.01 to 1 second which is set through the microcontroller program can be realized as well. The X-ray can be operated with these results. (author)
Experiments in high voltage electron microscopy. Progress report, October 31, 1975--August 1976
International Nuclear Information System (INIS)
Mitchell, T.E.; Das, G.; Barnard, R.; Ro, D.
1976-08-01
High voltage electron microscopy (HVEM) is being used to study the effects of irradiation on a variety of materials. The vacancies and interstitials produced by displacement can agglomerate to form dislocation loops and voids, annihilate at sinks, or enhance various diffusion processes such as precipitation and recrystallization. Threshold displacement energies, E/sub d/, have been determined for a number of fcc, bcc, and hcp metals. Directions for minimum E/sub d/ have been correlated with the crystal structure and the magnitude of E/sub d/ has been related to the sublimation energy. The effects of electron irradiation on precipitation in Al--Cu, Al--Si and Ni--Al alloys have been investigated. Precipitation respectively of theta', Si and γ' is enhanced and growth rates are being related quantitatively to theories of radiation-enhanced diffusion. Results on radiation damage in oxides (quartz, alumina, and magnesia) have also been obtained. Displacement damage gives rise to dislocation loop nucleation and growth in all cases, including multi-layer loops in Al 2 O 3 . In SiO 2 , ionization damage also occurs, which destroys the crystallinity. Threshold displacement and temperature effects have also been investigated
International Nuclear Information System (INIS)
Jaeger, W.; Urban, K.; Frank, W.
1980-01-01
Thin copper foils were irradiated with 650 keV electrons at 10 K in a high-voltage electron microscope (HVEM) to doses phi in the range 2 x 10 23 electrons/m 2 approximately 25 electrons /m 2 and then annealed in situ up to room temperature and outside the HVEM between room temperature and 470 K. During irradiation visible defect clusters were formed only at phi >= 2.5 x 10 24 electrons/m 2 . At smaller doses defect clusters became visible after annealing at 50 K. Between 50 K and 120 K further clusters, mainly dislocation loops on brace111 planes, appeared. Above 120 K, particularly between 160 K and 300 K, some of the dislocation loops became glissile. They glided out of the specimens or agglomerated to larger clusters of frequently complex shapes. As a consequence between 160 K and 300 K the cluster density decreased strongly, whereas the mean cluster size increased monotonously through the entire range of annealing temperatures covered. Contrast analyses between 180 K and 400 K revealed that the great majority of the dislocation loops were of interstitial type. At 470 K a new type of small clusters emerged, presumably of vacancy type. These observations are compared with other studies on electron-irradiated copper and with the current models of radiation damage in metals. (author)
Qiu, Yongfeng; Liu, Jinliang; Yang, Jianhua; Cheng, Xinbing; Yang, Xiao
2017-08-01
A compact control system based on Delphi and Field Programmable Gate Array(FPGA) is developed for a repetitive intense electron-beam accelerator(IEBA), whose output power is 10GW and pulse duration is 160ns. The system uses both hardware and software solutions. It comprises a host computer, a communication module and a main control unit. A device independent applications programming interface, devised using Delphi, is installed on the host computer. Stability theory of voltage in repetitive mode is analyzed and a detailed overview of the hardware and software configuration is presented. High voltage experiment showed that the control system fulfilled the requests of remote operation and data-acquisition. The control system based on a time-sequence control method is used to keep constant of the voltage of the primary capacitor in every shot, which ensured the stable and reliable operation of the electron beam accelerator in the repetitive mode during the experiment. Compared with the former control system based on Labview and PIC micro-controller developed in our laboratory, the present one is more compact, and with higher precision in the time dimension. It is particularly useful for automatic control of IEBA in the high power microwave effects research experiments where pulse-to-pulse reproducibility is required.
Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy
2011-01-01
Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.
Three-dimentional imaging of dentomaxillofacial region using electron beam tomography
International Nuclear Information System (INIS)
Tanaka, Takemasa; Kanda, Shigenobu; Muranaka, Toru
1998-01-01
Authors reported their results of the 3-D imaging of dentomaxillofacial region mainly for jaw deformity with electron beam tomography (EBT). The EBT apparatus used was Imatron C-100 (Imatron Corp.), with which, using bremsstrahlung radiation generated from the electron beam, CT is possible with rapid scanning rate at <0.1 sec. Imaging was done with those conditions as tube voltage: 130 kV, current: 610 mA, scanning rate: 0.1 sec/slice whose thickness was 1.5 mm, feeding rate: 1.5 mm and number of slices: 40-170. Patients were 15 cases with jaw deformity. Data were processed for 3-D image by Scribe Imaging Workstation (Multi-dimensional Imaging Inc.) which giving surface rendering and further by Power Macintosh 8500 (Apple Computer Inc.) with VoxBlast 1.1.0 (VayTec Inc.) software which giving volume rendering or with Image 1.60 (NIH) which allowing multi-planar reconstruction and re-analog projection. These actual images were presented in the report. (K.H.)
International Nuclear Information System (INIS)
Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda
2013-01-01
HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V
International Nuclear Information System (INIS)
Weiss, M.E.
1980-01-01
Intra-oral X-ray apparatus which reduces the number of exposures necessary to obtain panoramic dental radiographs is described in detail. It comprises an electron gun, a tubular target carrier projecting from the gun along the beam axis and carrying at its distal end a target surrounded by a shield of X-ray opaque material. This shield extends forward and laterally of the target and has surfaces which define a wedge or cone-shaped radiation pattern delimited vertically by the root tips of the patient's teeth. A film holder is located externally of the patient's mouth. A disposable member can fit on the target carrier to depress the patient's tongue out of the radiation pattern and to further shield the roof of the mouth. The electron beam can be magnetically deflected to change the X-ray beam direction. (author)
Temperature Induced Voltage Offset Drifts in Silicon Carbide Pressure Sensors
Okojie, Robert S.; Lukco, Dorothy; Nguyen, Vu; Savrun, Ender
2012-01-01
We report the reduction of transient drifts in the zero pressure offset voltage in silicon carbide (SiC) pressure sensors when operating at 600 C. The previously observed maximum drift of +/- 10 mV of the reference offset voltage at 600 C was reduced to within +/- 5 mV. The offset voltage drifts and bridge resistance changes over time at test temperature are explained in terms of the microstructure and phase changes occurring within the contact metallization, as analyzed by Auger electron spectroscopy and field emission scanning electron microscopy. The results have helped to identify the upper temperature reliable operational limit of this particular metallization scheme to be 605 C.
Current voltage perspective of an organic electronic device
Mukherjee, Ayash K.; Kumari, Nikita
2018-05-01
Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.
Effects of contrast improvement on high voltage rectification type of x-ray diagnostic apparatus
Energy Technology Data Exchange (ETDEWEB)
Lee, Hoo Min; Yoon, Joon [Dept. of Radiological technology, Dongnam Health University, Suwon (Korea, Republic of); Kim, Hyun Ju [Dept. of Radiology, Soonchunhyang University Hospital Buchen, Bucheon (Korea, Republic of)
2014-09-15
The purpose of this study was to analyze the effect on the selectivity on of high-voltage rectification device that measured the performance of the grid, and the contrast improvement ability (K factor) by measuring the scattered radiation content of the transmitted X-rays. The scattered radiation generated when the X-ray flux comes from the diagnostic X-ray generator that passes through an object. Targeting four different rectifications of X-ray generators, the mean value of the tube voltage and the tube current was measured in order to maximize the accuracy of the generating power dose within the same exposure condition. Using fluorescence meter, the content of the scattered rays that are transmitted through the acrylic was measured depending on the grid usage. When grid is not used, the content of the scattered rays was the lowest (34.158%) with the single-phase rectifier, was increased with the inverter rectifier (37.043%) and the three-phase 24-peak rectification method (37.447%). The difference of the scattered radiation content of each device was significant from the lowest 0.404% to the highest 3.289% while using 8:1 grid, the content of the scattered ray was the lowest with the single content of the scattered ray was the lowest with the single-phase rectifier (18.258%), was increased with the rectifier (25.502%) and the 24-peaks rectification (24.217%). Furthermore, there was difference up to content 7.244% to the lowest content 1.285% within three-phase 24-peaks rectification, inverter rectifications, and single-phase rectifier depending on the selectivity of the grid. Drawn from the statistical analysis, there was a similar relationship between the contrast improvement factor and the K factor. As a result, the grid selectivity and the contrast were increased within the single-phase rectifier rather than the constant voltage rectifier.
Effects of contrast improvement on high voltage rectification type of x-ray diagnostic apparatus
International Nuclear Information System (INIS)
Lee, Hoo Min; Yoon, Joon; Kim, Hyun Ju
2014-01-01
The purpose of this study was to analyze the effect on the selectivity on of high-voltage rectification device that measured the performance of the grid, and the contrast improvement ability (K factor) by measuring the scattered radiation content of the transmitted X-rays. The scattered radiation generated when the X-ray flux comes from the diagnostic X-ray generator that passes through an object. Targeting four different rectifications of X-ray generators, the mean value of the tube voltage and the tube current was measured in order to maximize the accuracy of the generating power dose within the same exposure condition. Using fluorescence meter, the content of the scattered rays that are transmitted through the acrylic was measured depending on the grid usage. When grid is not used, the content of the scattered rays was the lowest (34.158%) with the single-phase rectifier, was increased with the inverter rectifier (37.043%) and the three-phase 24-peak rectification method (37.447%). The difference of the scattered radiation content of each device was significant from the lowest 0.404% to the highest 3.289% while using 8:1 grid, the content of the scattered ray was the lowest with the single content of the scattered ray was the lowest with the single-phase rectifier (18.258%), was increased with the rectifier (25.502%) and the 24-peaks rectification (24.217%). Furthermore, there was difference up to content 7.244% to the lowest content 1.285% within three-phase 24-peaks rectification, inverter rectifications, and single-phase rectifier depending on the selectivity of the grid. Drawn from the statistical analysis, there was a similar relationship between the contrast improvement factor and the K factor. As a result, the grid selectivity and the contrast were increased within the single-phase rectifier rather than the constant voltage rectifier
Voltage regulation and power losses reduction in a wind farm integrated MV distribution network
Fandi, Ghaeth; Igbinovia, Famous Omar; Tlusty, Josef; Mahmoud, Rateb
2018-01-01
A medium-voltage (MV) wind production system is proposed in this paper. The system applies a medium-voltage permanent magnet synchronous generator (PMSG) as well as MV interconnection and distribution networks. The simulation scheme of an existing commercial electric-power system (Case A) and a proposed wind farm with a gearless PMSG insulated gate bipolar transistor (IGBT) power electronics converter scheme (Case B) is compared. The analyses carried out in MATLAB/Simulink environment shows an enhanced voltage profile and reduced power losses, thus, efficiency in installed IGBT power electronics devices in the wind farm. The resulting wind energy transformation scheme is a simple and controllable medium voltage application since it is not restrained by the IGBT power electronics voltage source converter (VSC) arrangement. Active and reactive power control is made possible with the aid of the gearless PMSG IGBT power converters.
Control voltage and power fluctuations when connecting wind farms
Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana
2015-12-01
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.
Control voltage and power fluctuations when connecting wind farms
International Nuclear Information System (INIS)
Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana
2015-01-01
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve
Control voltage and power fluctuations when connecting wind farms
Energy Technology Data Exchange (ETDEWEB)
Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)
2015-12-23
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.
A high-voltage triggered pseudospark discharge experiment
International Nuclear Information System (INIS)
Ramaswamy, K.; Destler, W.W.; Rodgers, J.
1996-01-01
The design and execution of a pulsed high-voltage (350 endash 400 keV) triggered pseudospark discharge experiment is reported. Experimental studies were carried out to obtain an optimal design for stable and reliable pseudospark operation in a high-voltage regime (approx-gt 350 kV). Experiments were performed to determine the most suitable fill gas for electron-beam formation. The pseudospark discharge is initiated by a trigger mechanism involving a flashover between the trigger electrode and hollow cathode housing. Experimental results characterizing the electron-beam energy using the range-energy method are reported. Source size imaging was carried out using an x-ray pinhole camera and a novel technique using Mylar as a witness plate. It was experimentally determined that strong pinching occurred later in time and was associated with the lower-energy electrons. copyright 1996 American Institute of Physics
Daniel, Michael T.
Here in the early 21st century humanity is continuing to seek improved quality of life for citizens throughout the world. This global advancement is providing more people than ever with access to state-of-the-art services in areas such as transportation, entertainment, computing, communication, and so on. Providing these services to an ever-growing population while considering the constraints levied by continuing climate change will require new frontiers of clean energy to be developed. At the time of this writing, offshore wind has been proven as both a politically and economically agreeable source of clean, sustainable energy by northern European nations with many wind farms deployed in the North, Baltic, and Irish Seas. Modern offshore wind farms are equipped with an electrical system within the farm itself to aggregate the energy from all turbines in the farm before it is transmitted to shore. This collection grid is traditionally a 3-phase medium voltage alternating current (MVAC) system. Due to reactive power and other practical constraints, it is preferable to use a medium voltage direct current (MVDC) collection grid when siting farms >150 km from shore. To date, no offshore wind farm features an MVDC collection grid. However, MVDC collection grids are expected to be deployed with future offshore wind farms as they are sited further out to sea. In this work it is assumed that many future offshore wind farms may utilize an MVDC collection grid to aggregate electrical energy generated by individual wind turbines. As such, this work presents both per-phase and per-pole power electronic converter systems suitable for interfacing individual wind turbines to such an MVDC collection grid. Both interfaces are shown to provide high input power factor at the wind turbine while providing DC output current to the MVDC grid. Common mode voltage stress and circulating currents are investigated, and mitigation strategies are provided for both interfaces. A power sharing
New method for determining avalanche breakdown voltage of silicon photomultipliers
International Nuclear Information System (INIS)
Chirikov-Zorin, I.
2017-01-01
The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru
Absolute Determination of High DC Voltages by Means of Frequency Measurement
Peier, Dirk; Schulz, Bernd
1983-01-01
A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.
Voltage generators of high voltage high power accelerators
International Nuclear Information System (INIS)
Svinin, M.P.
1981-01-01
High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)
International Nuclear Information System (INIS)
Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.
1988-01-01
A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown
A new linear induction voltage adder approach to radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.
1992-01-01
At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap
E-beam high voltage switching power supply
Shimer, Daniel W.; Lange, Arnold C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.
E-beam high voltage switching power supply
International Nuclear Information System (INIS)
Shimer, D.W.; Lange, A.C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs
Cai, Yuanji; Guan, Yonggang; Liu, Weidong
2017-06-01
Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.
Determination of the internal parameters of tc from the current-voltage characteristics
International Nuclear Information System (INIS)
Kaibyshev, V.Z.
1986-01-01
This paper proposes a method for determining the effective work function of a collector, the electron temperature, and the voltage drop in the interelectrode gap from the experimental vurrent-voltage characteristics (IVC). Analysis of the boundary conditions at the collector shows that as the emission from the collector increases the height of the potential jump retarding plasma electrons decrease
An analytic current-voltage model for quasi-ballistic III-nitride high electron mobility transistors
Li, Kexin; Rakheja, Shaloo
2018-05-01
We present an analytic model to describe the DC current-voltage (I-V) relationship in scaled III-nitride high electron mobility transistors (HEMTs) in which transport within the channel is quasi-ballistic in nature. Following Landauer's transport theory and charge calculation based on two-dimensional electrostatics that incorporates negative momenta states from the drain terminal, an analytic expression for current as a function of terminal voltages is developed. The model interprets the non-linearity of access regions in non-self-aligned HEMTs. Effects of Joule heating with temperature-dependent thermal conductivity are incorporated in the model in a self-consistent manner. With a total of 26 input parameters, the analytic model offers reduced empiricism compared to existing GaN HEMT models. To verify the model, experimental I-V data of InAlN/GaN with InGaN back-barrier HEMTs with channel lengths of 42 and 105 nm are considered. Additionally, the model is validated against numerical I-V data obtained from DC hydrodynamic simulations of an unintentionally doped AlGaN-on-GaN HEMT with 50-nm gate length. The model is also verified against pulsed I-V measurements of a 150-nm T-gate GaN HEMT. Excellent agreement between the model and experimental and numerical results for output current, transconductance, and output conductance is demonstrated over a broad range of bias and temperature conditions.
Compositional redistribution in alloy films under high-voltage electron microscope irradiation
Lam, Nghi Q.; Leaf, O. K.; Minkoff, M.
1983-10-01
The problem of nonequilibrium segregation in alloy films under high-voltage electron microscope (HVEM) irradiation at elevated temperatures is re-examined in the present work, taking into account the damage-rate gradients caused by radial variation in the electron flux. Axial and radial compositional redistributions in model solid solutions, representative of concentrated Ni-Cu, Ni-Al and Ni-Si alloys, were calculated as a function of time, temperature, and film thickness, using a kinetic theory of segregation in binary alloys. The numerical results were achieved by means of a new software package (DISPL2) for solving convection-diffusion-kinetics problems with general orthogonal geometries. It was found that HVEM irradiation-induced segregation in thin films consists of two stages. Initially, due to the proximity of the film surfaces as sinks for point defects, the usual axial segregation (to surfaces) occurs at relatively short irradiation times, and rapidly attains quasi-steady state. Then, radial segregation becomes more and more competitive, gradually affecting the kinetics of axial segregation. At a given temperature, the buildup time to steady state is much longer in the present situation than in the simple case of one-dimensional segregation with uniform defect production. Changes in the alloy composition occur in a much larger zone than the irradiated volume. As a result, the average alloy composition within the irradiated region can differ greatly from that of the unirradiated alloy. The present calculations may be useful in the interpretation of the kinetics of certain HVEM irradiation-induced processes in alloys.
Evaluation of niobium as candidate electrode material for dc high voltage photoelectron guns
Directory of Open Access Journals (Sweden)
M. BastaniNejad
2012-08-01
Full Text Available The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirrorlike finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (<10 pA at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18.7 MV/m.
Flow coating apparatus and method of coating
Hanumanthu, Ramasubrahmaniam; Neyman, Patrick; MacDonald, Niles; Brophy, Brenor; Kopczynski, Kevin; Nair, Wood
2014-03-11
Disclosed is a flow coating apparatus, comprising a slot that can dispense a coating material in an approximately uniform manner along a distribution blade that increases uniformity by means of surface tension and transfers the uniform flow of coating material onto an inclined substrate such as for example glass, solar panels, windows or part of an electronic display. Also disclosed is a method of flow coating a substrate using the apparatus such that the substrate is positioned correctly relative to the distribution blade, a pre-wetting step is completed where both the blade and substrate are completed wetted with a pre-wet solution prior to dispensing of the coating material onto the distribution blade from the slot and hence onto the substrate. Thereafter the substrate is removed from the distribution blade and allowed to dry, thereby forming a coating.
Characteristics of a cold cathode electron source combined with secondary electron emission in a FED
International Nuclear Information System (INIS)
Lei Wei; Zhang Xiaobing; Zhou Xuedong; Zhu Zuoya; Lou Chaogang; Zhao Hongping
2005-01-01
In electron beam devices, the voltage applied to the cathode (w.r.t. grid voltage) provides the initial energy for the electrons. Based on the type of electron emission, the electron sources are (mainly) classified into thermionic cathodes and cold cathodes. The power consumption of a cold cathode is smaller than that of a thermionic cathode. The delay time of the electron emission from a cold cathode following the voltage rise is also smaller. In cathode ray tubes, field emission display (=FED) panels and other devices, the electron current emitted from the cathode needs to be modulated. Since the strong electric field, which is required to extract electrons from the cold cathode, accelerates the electrons to a high velocity near the gate electrode, the required voltage swing for the current modulation is also high. The design of the driving circuit becomes quite difficult and expensive for a high driving voltage. In this paper, an insulator plate with holes is placed in front of a cold cathode. When the primary electrons hit the surface of the insulator tunnels, secondary electrons are generated. In this paper, the characteristics of the secondary electrons emitted from the gate structure are studied. Because the energies of the secondary electrons are smaller than that of the primary electron, the driving voltage for the current modulation is decreased by the introduction of the insulator tunnels, resulting in an improved energy uniformity of the electron beam. Triode structures with inclined insulator tunnels and with double insulator plates are also fabricated and lead to further improvements in the energy uniformity. The improved energy uniformity predicted by the simulation calculations is demonstrated by the improved brightness uniformity in the screen display images
Borehole sealing method and apparatus
International Nuclear Information System (INIS)
Hartley, J.N.; Jansen, G. Jr.
1977-01-01
A method and apparatus is described for sealing boreholes in the earth. The borehole is blocked at the sealing level, and a sealing apparatus capable of melting rock and earth is positioned in the borehole just above seal level. The apparatus is heated to rock-melting temperature and powdered rock or other sealing material is transported down the borehole to the apparatus where it is melted, pooling on the mechanical block and allowed to cool and solidify, sealing the hole. Any length of the borehole can be sealed by slowly raising the apparatus in the borehole while continuously supplying powdered rock to the apparatus to be melted and added to the top of the column of molten and cooling rock, forming a continuous borehole seal. The sealing apparatus consists of a heater capable of melting rock, including means for supplying power to the heater, means for transporting powdered rock down the borehole to the heater, means for cooling the apparatus and means for positioning the apparatus in the borehole. 5 claims, 1 figure
Energy Technology Data Exchange (ETDEWEB)
Akazawa, Housei, E-mail: akazawa.housei@lab.ntt.co.jp [NTT Device Innovation Center, Morinosato Wakamiya, Atsugi, Kanagawa 243-0198 (Japan)
2016-06-15
The branched-waveguide electron cyclotron resonance plasma sputtering apparatus places quartz windows for transmitting microwaves into the plasma source not in the line of sight of the target. However, the quartz windows must be replaced after some time of operation. For maintenance, the loop waveguide branching from the T-junction must be dismounted and re-assembled accurately, which is a time-consuming job. We investigated substituting the waveguide branches with two sets of coaxial cables and waveguide/coaxial cable converters to simplify assembly as far as connection and disconnection go. The resulting hybrid system worked well for the purposes of plasma generation and film deposition.
Akazawa, Housei
2016-06-01
The branched-waveguide electron cyclotron resonance plasma sputtering apparatus places quartz windows for transmitting microwaves into the plasma source not in the line of sight of the target. However, the quartz windows must be replaced after some time of operation. For maintenance, the loop waveguide branching from the T-junction must be dismounted and re-assembled accurately, which is a time-consuming job. We investigated substituting the waveguide branches with two sets of coaxial cables and waveguide/coaxial cable converters to simplify assembly as far as connection and disconnection go. The resulting hybrid system worked well for the purposes of plasma generation and film deposition.
Present status of radiation-pasteurization apparatus
International Nuclear Information System (INIS)
Mio, Keigo
2006-01-01
Electron beams with the energy less than 10 MeV can be utilized to destroy directly DNA of microorganism or indirectly via OH radicals produced from water which may diffuse toward the DNA. The article summarizes the features of radiation pasteurization in general, using X-rays or electron beams, followed by stating the advantage claimed for electron beam treatment compared to X-ray treatment. The article explains various types of electron-beam accelerators now used for pasteurization and food preservation. For this purposes some specific apparatus are introduced with which food irradiation facilities should be equipped, for example beam scanning systems and sample transport systems with an automatic switch for door open-shut. The objects of each type of food to be irradiated and necessary dose range are tabulated. Finally, some recent problems regarding food irradiation are discussed: possible radioactivity induced by irradiation, use of methyl bromide instead of irradiation, etc. (S. Ohno)
Apparatus for drying sugar cubes
Derckx, H.A.J.; Torringa, H.M.
1999-01-01
Device for drying sugar cubes containing a heating apparatus for heating and dehumidifying the sugar cubes, a conditioning apparatus for cooling off and possibly further dehumidifying the sugar cubes and a conveying apparatus for conveying the sugar cubes through the heating apparatus and the
International Nuclear Information System (INIS)
Monteith, W.D.
1983-01-01
Training apparatus for use in contamination surveillance uses a mathematical model of a hypothetical contamination source (e.g. nuclear, bacteriological or chemical explosion or leak) to determine from input data defining the contamination source, the contamination level at any location within a defined exercise area. The contamination level to be displayed by the apparatus is corrected to real time from a real time clock or may be displayed in response to a time input from a keyboard. In a preferred embodiment the location is defined by entering UTM grid reference coordinates using the keyboard. The mathematical model used by a microprocessor of the apparatus for simulation of contamination levels in the event of a nuclear explosion is described. (author)
Variation of microchannel plate resistance with temperature and applied voltage
International Nuclear Information System (INIS)
Pearson, J.F.; Fraser, G.W.; Whiteley, M.J.
1987-01-01
The resistance of microchannel plate electron multiplier is well known to be a function of both applied voltage and detector temperature. We show that the apparent variation of resistance with bias voltage is simply due to plate temperature increases resulting from resistive heating. (orig.)
DEFF Research Database (Denmark)
Gloos, K.; Utko, P.; Aagesen, M.
2006-01-01
We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...
International Nuclear Information System (INIS)
Monnet, I.; Van den Berghe, T.; Dubuisson, Ph.
2012-01-01
ODS materials are considered for nuclear applications but previous experimental studies have shown a partial dissolution of some oxides under neutron irradiation. In this work, electron irradiations were used to evaluate the stability of the oxides depending on the chemical composition of the oxide dispersion. Four ferritic steels based on EM10 (Fe–9Cr–1Mo) and reinforced respectively by Al 2 O 3 , MgO, MgAl 2 O 4 and Y 2 O 3 , were studied. These materials were irradiated with 1 MeV or 1.2 MeV electrons in a High Voltage Electron Microscope. This technique allows to follow one single oxide and to determine the evolution of its size during the irradiation. In situ HVEM observations indicate that the dissolution rate depends on the chemical composition of the oxide, on the temperature and on the irradiation dose.
In-situ observation of the alpha/beta cristobalite transition using high voltage electron microscopy
International Nuclear Information System (INIS)
Meike, A.; Glassley, W.E.
1990-01-01
A high temperature water vapor phase is expected to persist in the vicinity of high level radioactive waste packages for several hundreds of years. The authors have begun an investigation of the structural and chemical effects of water on cristobalite because of its abundance in the near field environment. A high voltage transmission electron microscope (HVEM) investigation of bulk synthesized α-cristobalite to be used in single phase dissolution and precipitation kinetics experiments revealed the presence β-cristobalite, quartz and amorphous silica, in addition to α-cristobalite. Consequently, this apparent metastable persistence of β-cristobalite and amorphous silica during the synthesis of α-cristobalite was investigated using a heating stage and an environmental cell installed in the HVEM that allowed the introduction of either dry CO 2 or a CO 2 + H 2 O vapor. Preliminary electron diffraction evidence suggests that the presence of water vapor affected the α-β transition temperature. Water vapor may also be responsible for the development of an amorphous silica phase at the transition that may persist over an interval of several tens of degrees. The amorphous phase was not documented during the dry heating experiments
In-situ observation of the alpha/beta cristobalite transition using high voltage electron microscopy
International Nuclear Information System (INIS)
Meike, A.; Glassley, W.
1989-10-01
A high temperature water vapor phase is expected to persist in the vicinity of high level radioactive waste packages for several hundreds of years. The authors have begun an investigation of the structural and chemical effects of water on cristobalite because of its abundance in the near field environment. A high voltage transmission electron microscope (HVEM) investigation of bulk synthesized α-cristobalite to be used in single phase dissolution and precipitation kinetics experiments revealed the presence β-cristobalite, quartz and amorphous silica, in addition to α-cristobalite. Consequently, this apparent metastable persistence of β-cristobalite and amorphous silica during the synthesis of α-cristobalite was investigated using a heating stage and an environmental cell installed in the HVEM that allowed the introduction of either dry CO 2 or a CO 2 + H 2 O vapor. Preliminary electron diffraction evidence suggests that the presence of water vapor affected the α-β transition temperature. Water vapor may also be responsible for the development of an amorphous silica phase at the transition that may persist over an interval of several tens of degrees. The amorphous phase was not documented during the dry heating experiments. 20 refs., 7 figs., 5 tabs
Voltage harmonics mitigation through hybrid active power filer
International Nuclear Information System (INIS)
Sahito, A.A.; Tunio, S.M.; Khizer, A.N.
2016-01-01
Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion) of 18.91 and 7.61 percentage in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter) is proposed to reduce these THD values below 5 percentage as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5 percentage. (author)
Voltage Harmonics Mitigation through Hybrid Active Power Filter
Directory of Open Access Journals (Sweden)
Anwer Ali Sahito
2016-01-01
Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.
Apparatus for neutralization of accelerated ions
International Nuclear Information System (INIS)
Fink, J.H.; Frank, A.M.
1979-01-01
Apparatus is described for neutralization of a beam of accelerated ions, such as hydrogen negative ions (H - ), using relatively efficient strip diode lasers which emit monochromatically at an appropriate wavelength (lambda = 8000 A for H - ions) to strip the excess electrons by photodetachment. A cavity, formed by two or more reflectors spaced apart, causes the laser beams to undergo multiple reflections within the cavity, thus increasing the efficiency and reducing the illumination required to obtain an acceptable percentage (approx. 85%) of neutralization
Single electron counting using a dual MCP assembly
International Nuclear Information System (INIS)
Yang, Yuzhen; Liu, Shulin; Zhao, Tianchi; Yan, Baojun; Wang, Peiliang; Yu, Yang; Lei, Xiangcui; Yang, Luping; Wen, Kaile; Qi, Ming
2016-01-01
The gain, pulse height resolution and peak-to-valley ratio of single electrons detected by using a Chevron configured Microchannel Plate (MCP) assembly are studied. The two MCPs are separated by a 280 µm gap and are biased by four electrodes. The purpose of the study is to determine the optimum bias voltage arrangements for single electron counting. By comparing the results of various bias voltage combinations, we conclude that good performance for the electron counting can be achieved by operating the MCP assembly in saturation mode. In addition, by applying a small reverse bias voltage across the gap while adjusting the bias voltages of the MCPs, optimum performance of electron counting can be obtained. - Highlights: • Dual MCPs assembly with four electrodes using different voltage combinations has been investigated for single electron counting. • Both the MCP voltages and the gap voltage can affect the gain, pulse height resolution and P/V ratio. • A high gain of the first stage MCP, a saturation mode of the second stage MCP and an appropriately reverse gap voltage can improve the resolution greatly. • The optimum voltage arrangements is significant for the design of MCP detectors in single electron counting applications.
An improved control method of power electronic converters in low voltage micro-grid
DEFF Research Database (Denmark)
Xiaofeng, Sun; Qingqiu, Lv; Yanjun, Tian
2011-01-01
control of the voltage and frequency deviation added to power references could achieve secondary regulation of the voltage and frequency. In this paper, the authors take the steady and transient transition of grid connecting and disconnecting of the micro-grid as an example, and demonstrate......With the increasing acceptance, micro-grid, combined with distributed generation (DG), may be operated in two modes: grid-connected mode and island mode. In grid connected mode, energy management is the control objective. While in island mode, the control of Voltage and frequency will take...... the place. The conventional droop control can perform the energy management in grid-connected mode, but may not so effective when micro-grid transferring between grid-connected mode and island mode. The paper analysis the micro-grid in different modes (Conventional droop control, Voltage reference...
Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.
1998-01-01
The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured
Pore roller filtration apparatus
DEFF Research Database (Denmark)
2014-01-01
The present invention relates to the field of filtering, more precisely the present invention concerns an apparatus and a method for the separation of dry matter from a medium and the use of said apparatus. One embodiment discloses an apparatus for the separation of dry matter from a medium, comp...
Improvements in or relating to X-ray apparatus
International Nuclear Information System (INIS)
1981-01-01
In this invention an apparatus is described for producing X-ray radiation. It comprises a target which, in use, is exposed to an electron beam so as to produce a conical beam of X-ray radiation, a primary collimator with an opening defining the largest desired angle of the conical beam of radiation and a first electron absorber made from one or more elements having an atomic number lower than that of copper, (aluminium or graphite) and a second electron absorber, made from a similar material, mounted in the opening of the primary collimator, with dimensions similar to those of the opening. The effective cross-section for producing x-ray radiation increases with the atomic number and the electron absorption is proportional to the density. With the lower atomic number of the electron absorber material, the proportion of additional X-radiation arising is reduced. The problem of the reduced electron absorption is overcome by the use of two electron absorbers. (U.K.)
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...
International Nuclear Information System (INIS)
Leconte, Philippe.
1976-01-01
The 58 Ni ground state was studied using electron elastic scattering. Experimental results on charge distribution are presented and briefly discussed in terms of nuclear structure in the framework of the Hartree-Fock approximation. The experimental part is described in details. The apparatus using the electron beam from the 600MeV Saclay Linac asked for the construction of a system of beam transport and analysis that defines the direction, identity and energy with a focalization on the target of a mobile spectrometer, and data analysis procedure. The spectrometer mobile around a vertical axis, with its shielding and detection system analyzes the scattered electron energy in an interval of 10% with a resolution of 2x10 -4 , and in direction from 25 deg to 155 deg in a solid angle of 5msr at maximum. The background rejection is such that cross sections of 10 -38 cm 2 may be reached. The experimental procedure was completed, after data acquisition, by an analysis in view of obtaining a diffraction pattern-cross section plotting and a partial wave analysis giving the charge distribution in the nucleus [fr
Apparatus for magnetic and electrostatic confinement of plasma
Rostoker, Norman; Binderbauer, Michl
2013-06-11
An apparatus and method for containing plasma and forming a Field Reversed Configuration (FRC) magnetic topology are described in which plasma ions are contained magnetically in stable, non-adiabatic orbits in the FRC. Further, the electrons are contained electrostatically in a deep energy well, created by tuning an externally applied magnetic field. The simultaneous electrostatic confinement of electrons and magnetic confinement of ions avoids anomalous transport and facilitates classical containment of both electrons and ions. In this configuration, ions and electrons may have adequate density and temperature so that upon collisions ions are fused together by nuclear force, thus releasing fusion energy. Moreover, the fusion fuel plasmas that can be used with the present confinement system and method are not limited to neutronic fuels only, but also advantageously include advanced fuels.
International Nuclear Information System (INIS)
Povzner, A.A.; Volkov, A.G.
2017-01-01
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Energy Technology Data Exchange (ETDEWEB)
Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru
2017-06-15
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Bureau of Naval Personnel, Washington, DC.
In this module the student will learn to apply the rules previously learned for series and parallel circuits to more complex circuits called series-parallel circuits, discover the utility of a common reference when making reference to voltage values, and learn how to obtain a required voltage from a voltage divider network. The module is divided…
Microelectromechanical acceleration-sensing apparatus
Lee, Robb M [Albuquerque, NM; Shul, Randy J [Albuquerque, NM; Polosky, Marc A [Albuquerque, NM; Hoke, Darren A [Albuquerque, NM; Vernon, George E [Rio Rancho, NM
2006-12-12
An acceleration-sensing apparatus is disclosed which includes a moveable shuttle (i.e. a suspended mass) and a latch for capturing and holding the shuttle when an acceleration event is sensed above a predetermined threshold level. The acceleration-sensing apparatus provides a switch closure upon sensing the acceleration event and remains latched in place thereafter. Examples of the acceleration-sensing apparatus are provided which are responsive to an acceleration component in a single direction (i.e. a single-sided device) or to two oppositely-directed acceleration components (i.e. a dual-sided device). A two-stage acceleration-sensing apparatus is also disclosed which can sense two acceleration events separated in time. The acceleration-sensing apparatus of the present invention has applications, for example, in an automotive airbag deployment system.
Apparatus for gamma ray radiography
International Nuclear Information System (INIS)
Kobayashi, Masatoshi; Enomoto, Shigemasa; Oga, Hiroshi
1979-01-01
This is the standard of Japan Non-Destructive Inspection Society, NDIS 1101-79, which stipulates on the design, construction and testing method of the apparatuses for gamma ray radiography used for taking industrial radiograms. The gamma ray apparatuses stipulated in this standard are those containing sealed radioactive isotopes exceeding 100 μCi, which emit gamma ray. The gamma ray apparatuses are classified into three groups according to their movability. The general design conditions, the irradiation dose rate and the sealed radiation sources for the gamma ray apparatuses are stipulated. The construction of the gamma ray apparatuses must be in accordance with the notification No. 52 of the Ministry of Labor, and safety devices and collimators must be equipped. The main bodies of the gamma ray apparatuses must pass the vibration test, penetration test, impact test and shielding efficiency test. The method of each test is described. The attached equipments must be also tested. The tests according to this standard are carried out by the makers of the apparatuses. The test records must be made when the apparatuses have passed the tests, and the test certificates are attached. The limit of guarantee by the endurance test must be clearly shown. The items to be shown on the apparatuses are stipulated. (Kako, I.)
International Nuclear Information System (INIS)
Moir, R.W.
1981-01-01
A mirror plasma apparatus which utilizes shielding by arc discharge to form a blanket plasma and lithium walls to reduce neutron damage to the wall of the apparatus. An embodiment involves a rotating liquid lithium blanket for a tandem mirror plasma apparatus wherein the first wall of the central mirror cell is made of liquid lithium which is spun with angular velocity great enough to keep the liquid lithium against the first material wall, a blanket plasma preventing the lithium vapor from contaminating the plasma
Water intake fish diversion apparatus
International Nuclear Information System (INIS)
Taft, E.P. III; Cook, T.C.
1995-01-01
A fish diversion apparatus uses a plane screen to divert fish for variety of types of water intakes in order to protect fish from injury and death. The apparatus permits selection of a relatively small screen angle, for example ten degrees, to minimize fish injury. The apparatus permits selection of a high water velocity, for example ten feet per second, to maximize power generation efficiency. The apparatus is especially suitable retrofit to existing water intakes. The apparatus is modular to allow use plural modules in parallel to adjust for water flow conditions. The apparatus has a floor, two opposite side walls, and a roof which define a water flow passage and a plane screen within the passage. The screen is oriented to divert fish into a fish bypass which carries fish to a safe discharge location. The dimensions of the floor, walls, and roof are selected to define the dimensions of the passage and to permit selection of the screen angle. The floor is bi-level with a level upstream of the screen and a level beneath screen selected to provide a uniform flow distribution through the screen. The apparatus may include separation walls to provide a water flow channel between the apparatus and the water intake. Lead walls may be used to adjust water flow conditions into the apparatus. The apparatus features stoplog guides near its upstream and downstream ends to permit the water flow passage to be dewatered. 3 figs
Apparatus and methods for controlling electron microscope stages
Duden, Thomas
2015-08-11
Methods and apparatus for generating an image of a specimen with a microscope (e.g., TEM) are disclosed. In one aspect, the microscope may generally include a beam generator, a stage, a detector, and an image generator. A plurality of crystal parameters, which describe a plurality of properties of a crystal sample, are received. In a display associated with the microscope, an interactive control sphere based at least in part on the received crystal parameters and that is rotatable by a user to different sphere orientations is presented. The sphere includes a plurality of stage coordinates that correspond to a plurality of positions of the stage and a plurality of crystallographic pole coordinates that correspond to a plurality of polar orientations of the crystal sample. Movement of the sphere causes movement of the stage, wherein the stage coordinates move in conjunction with the crystallographic coordinates represented by pole positions so as to show a relationship between stage positions and the pole positions.
An apparatus to measure stopping powers for low-energy antiprotons and protons
Andersen, H H; Ichioka, T; Knudsen, H; Møller, S P; Uggerhøj, U
2002-01-01
One of the experiments to be performed under the ASACUSA collaboration at the CERN Antiproton Decelerator is a measurement of the energy loss of low energy antiprotons in thin foils. An electrostatic spectrometer has been developed for this task. We describe the design and initial tests of the apparatus with protons. By changing a high-voltage applied on the target the energy of the projectile ions at impact on the target can easily be varied. In this way we have measured the stopping-power and the energy-loss straggling for protons over a wide energy range to below one keV.
Energy Technology Data Exchange (ETDEWEB)
Savic, M.S.
1986-07-01
The switching off and on of small capacitive currents charging busbar capacitances, connection conductors and open circuit breakers with disconnectors causes high-frequency transients in high-voltage networks. In low voltage circuits, these transient processes induce dangerous overvoltages for the electronic equipment in the substation. A modified construction of the disconnector with a damping resistor was investigated. Digital simulation of the transient process in a high-voltage network during the arcing period between the disconnector contacts with and without damping resistor were performed. A significant decrease of the arcing duration and the decrease of the electromagnetic field magnitude in the vicinity of the operating disconnector were noticed. In the low voltage circuit protected with the surge arrester, the overvoltage magnitude was not affected by the damping resistor due to the arrester protection effect.
International Nuclear Information System (INIS)
Dalton, B.L.
1984-01-01
This patent application describes a radiographic apparatus including an array of radiation sensors, a source of radiation for projecting a beam through a body and means for moving one of said source and array relative to the body and for producing an electrical signal representative of the movement of the other of said source and array needed to bring the array into register with the beam. Drive means are arranged to move the other of said source and array in response to the electrical signal. In one embodiment, the source is rotated by an amount measured by a grating and associated electronics. The required movement of the array to maintain registration is calculated and transmitted to a driver. Alternatively, a laser may be mounted with the same and the array driven so that the laser beam continuously impinges on a photocell mounted with the array. (author)
Development of high voltage lead wires using electron beam irradiation
International Nuclear Information System (INIS)
Bae Hunjai; Sohn Hosoung; Choi Dongjung
1995-01-01
It is known to those skilled to the art that the electric wires used in high voltage operating electric equipments such as TV sets, microwave ovens, duplicators and etc., have such a structure that a conductor is coated with an insulating layer which is encapsulated with a protecting jacket layer. The electric wire specification such as UL and CSA requires superior cut-through property and flame-retardant property of the wire for utilization safety. The cut-through property of insulation material, for example, high density polyethylene, can be increased by crosslinking of the polymer. Also the flame-retardant property of jacket material which protects the flammable inner insulation can be raised by flame-retardant formulating of the material. In the wire and cable industry, crosslinking by electron beam processing is more effective than that by chemical processing in the viewpoint of through-put rate of the products. The jacket layer of the wire plays the role of protecting the insulation material from burning. The protecting ability of the jacket is related to its inherent flammability and formability of swollen carbonated layer when burned. Crosslinking of the material gives a good formability of swollen carbonated layer, and it protects the insulation material from direct flame. In formulating the flame-retardant jacket material, a crosslinking system must be considered with base polymers and other flame-retardant additives. (Author)
Development of high voltage lead wires using electron beam irradiation
International Nuclear Information System (INIS)
Bae Hunjai; Sohn Hosoung; Choi Dongjung
1995-01-01
It is known to those skilled to the art that the electric wires used in high voltage operating electric equipment such as TV sets, microwave ovens, duplicators etc., have such a structure that a conductor is coated with an insulating layer which is encapsulated with a protecting jacket layer. The electric wire specification such as UL and CSA requires superior cut-through and flame-retardant property of the wire for utilization safety. The cut-through property of insulation material, for example, high density polyethylene, can be increased by crosslinking of the polymer. Also the flame-retardant property of jacket material which protects the flammable inner insulation can be raised by flame-retardant formulating of the material. In the wire and cable industry, crosslinking by electron beam processing is more effective than that by chemical processing in the viewpoint of through-put rate of the products. The jacket layer of the wire plays the role of protecting the insulation material from burning. The protecting ability of the jacket is related to its inherent flammability and formability of swollen carbonated layer when burned. Crosslinking of the material gives a good formability of swollen carbonated layer, and it protects the insulation material from direct flame. In formulating the flame-retardant jacket material, a crosslinking system must be considered with base polymers and other flame-retardant additives. (Author)
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
Gamma apparatuses for radiotherapy
International Nuclear Information System (INIS)
Sul'kin, A.G.
1986-01-01
Scientific and technical achievements in development and application of gamma therapeutic apparatuses for external and intracavity irradiations are generalized. Radiation-physical parameters of apparatuses providing usability of progressive methods in radiotherapy of onclogical patients are given. Optimization of main apparatus elements, ensurance of its operation reliability, reduction of errors of irradiation plan reproduction are considered. Attention is paid to radiation safety
Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell
Directory of Open Access Journals (Sweden)
Walker Don
2017-01-01
Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.
Efficient Low-Voltage Operation of a CW Gyrotron Oscillator at 233 GHz.
Hornstein, Melissa K; Bajaj, Vikram S; Griffin, Robert G; Temkin, Richard J
2007-02-01
The gyrotron oscillator is a source of high average power millimeter-wave through terahertz radiation. In this paper, we report low beam power and high-efficiency operation of a tunable gyrotron oscillator at 233 GHz. The low-voltage operating mode provides a path to further miniaturization of the gyrotron through reduction in the size of the electron gun, power supply, collector, and cooling system, which will benefit industrial and scientific applications requiring portability. Detailed studies of low-voltage operation in the TE(2) (,) (3) (,) (1) mode reveal that the mode can be excited with less than 7 W of beam power at 3.5 kV. During CW operation with 3.5-kV beam voltage and 50-mA beam current, the gyrotron generates 12 W of RF power at 233.2 GHz. The EGUN electron optics code describes the low-voltage operation of the electron gun. Using gun-operating parameters derived from EGUN simulations, we show that a linear theory adequately predicts the low experimental starting currents.
Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement
International Nuclear Information System (INIS)
Boudjella, Aissa
2011-01-01
The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.
Current–voltage characteristics of manganite–titanite perovskite junctions
Directory of Open Access Journals (Sweden)
Benedikt Ifland
2015-07-01
Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.
OPTIMIZATION OF OPERATION PARAMETERS OF 80-KEV ELECTRON GUN
Directory of Open Access Journals (Sweden)
JEONG DONG KIM
2014-06-01
As a first step, the electron generator of an 80-keV electron gun was manufactured. In order to produce the high beam power from electron linear accelerator, a proper beam current is required form the electron generator. In this study, the beam current was measured by evaluating the performance of the electron generator. The beam current was determined by five parameters: high voltage at the electron gun, cathode voltage, pulse width, pulse amplitude, and bias voltage at the grid. From the experimental results under optimal conditions, the high voltage was determined to be 80 kV, the pulse width was 500 ns, and the cathode voltage was from 4.2 V to 4.6 V. The beam current was measured as 1.9 A at maximum. These results satisfy the beam current required for the operation of an electron linear accelerator.
Van Lancker, Marc; Herer, Arnold; Cleland, Marshall R.; Jongen, Yves; Abs, Michel
1999-05-01
The Rhodotron is a high-voltage, high-power electron beam accelerator based on a design concept first proposed in 1989 by J. Pottier of the French Atomic Agency, Commissariat à l'Energie Atomique (CEA). In December 1991, the Belgian particle accelerator manufacturer, Ion Beam Applications s.a. (IBA) entered into an exclusive agreement with the CEA to develop and industrialize the Rhodotron. Electron beams have long been used as the preferential method to cross-link a variety of polymers, either in their bulk state or in their final form. Used extensively in the wire and cable industry to toughen insulating jackets, electron beam-treated plastics can demonstrate improved tensile and impact strength, greater abrasion resistance, increased temperature resistance and dramatically improved fire retardation. Electron beams are used to selectively cross-link or degrade a wide range of polymers in resin pellets form. Electron beams are also used for rapid curing of advanced composites, for cross-linking of floor-heating and sanitary pipes and for cross-linking of formed plastic parts. Other applications include: in-house and contract medical device sterilization, food irradiation in both electron and X-ray modes, pulp processing, electron beam doping of semi-conductors, gemstone coloration and general irradiation research. IBA currently markets three models of the Rhodotron, all capable of 10 MeV and alternate beam energies from 3 MeV upwards. The Rhodotron models TT100, TT200 and TT300 are typically specified with guaranteed beam powers of 35, 80 and 150 kW, respectively. Founded in 1986, IBA, a spin-off of the Cyclotron Research Center at the University of Louvain (UCL) in Belgium, is a pioneer in accelerator design for industrial-scale production.
International Nuclear Information System (INIS)
Lancker, Marc van; Herer, Arnold; Cleland, Marshall R.; Jongen, Yves; Abs, Michel
1999-01-01
The Rhodotron is a high-voltage, high-power electron beam accelerator based on a design concept first proposed in 1989 by J. Pottier of the French Atomic Agency, Commissariat a l'Energie Atomique (CEA). In December 1991, the Belgian particle accelerator manufacturer, Ion Beam Applications s.a. (IBA) entered into an exclusive agreement with the CEA to develop and industrialize the Rhodotron. Electron beams have long been used as the preferential method to cross-link a variety of polymers, either in their bulk state or in their final form. Used extensively in the wire and cable industry to toughen insulating jackets, electron beam-treated plastics can demonstrate improved tensile and impact strength, greater abrasion resistance, increased temperature resistance and dramatically improved fire retardation. Electron beams are used to selectively cross-link or degrade a wide range of polymers in resin pellets form. Electron beams are also used for rapid curing of advanced composites, for cross-linking of floor-heating and sanitary pipes and for cross-linking of formed plastic parts. Other applications include: in-house and contract medical device sterilization, food irradiation in both electron and X-ray modes, pulp processing, electron beam doping of semi-conductors, gemstone coloration and general irradiation research. IBA currently markets three models of the Rhodotron, all capable of 10 MeV and alternate beam energies from 3 MeV upwards. The Rhodotron models TT100, TT200 and TT300 are typically specified with guaranteed beam powers of 35, 80 and 150 kW, respectively. Founded in 1986, IBA, a spin-off of the Cyclotron Research Center at the University of Louvain (UCL) in Belgium, is a pioneer in accelerator design for industrial-scale production
Muroi, Yukiko; Chanda, Baron
2009-01-01
Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
The construction and operation of an ion channelling apparatus
International Nuclear Information System (INIS)
Grimshaw, J. A.; Barrat, E.E.; Wilson, C.G.; Spooner, F.J.
1975-12-01
The ion channelling facility at the Royal Military College of Science Rutherford Laboratory is described. A detailed account is given of new apparatus installed on the beam line of the 2.5 MeV Van de Graaf accelerator. Emphasis is placed on the mechanical and electronic requirements of such a system for the attainment of the required experimental conditions for good channelling. (author)
Modeling and simulation of dynamic voltage restorer in power system
International Nuclear Information System (INIS)
Abdel Aziz, M.A.A.M.
2012-01-01
There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.
The high energy electron beam irradiation technology is a low temperature method for destroying complex mixtures of hazardous organic chemicals in solutions containing solids. The system consists of a computer-automated, portable electron beam accelerator and a delivery system. T...
Accurate determination of the voltage of a transmission electron ...
Indian Academy of Sciences (India)
The techniques established are found to be suitable for TEMs operating at a setting voltage of about 250 kV. For the TEM studies, a regular double-tilt specimen holder is required in order to be able to get to the desired zone axes. When the experiments were repeated using a cryogenic double-tilt holder, an improvement in ...
Timer switch to convert suction apparatus for negative pressure wound therapy application
Directory of Open Access Journals (Sweden)
Surath Amarnath
2014-01-01
Full Text Available Background: Negative pressure wound therapy (NPWT is an established modality in the treatment of chronic wounds, open fractures, and post-operative wound problems. This method has not been widely used due to the high cost of equipment and consumables. This study demonstrates an indigenously developed apparatus which gives comparable results at a fraction of the cost. Readily available materials are used for the air-tight dressing. Materials and Methods: Equipment consists of suction apparatus with adjustable pressure valve set to a pressure 125-150 mmHg. An electronic timer switch with a sequential working time of 5 min and a standby time of 3 min provides the required intermittent negative pressure. Readily available materials such as polyvinyl alcohol sponge, suction drains and steridrapes were used to provide an air tight wound cover. Results: A total of 90 cases underwent 262 NPWT applications from 2009 to 2014. This series, comprised of 30 open fractures, 21 post-operative and 39 chronic wounds. The wound healing rate in our study was comparable to other published studies using NPWT. Conclusion: The addition of electronic timer switch will convert a suction apparatus into NPWT machine, and the results are equally effective compared to more expensive counter parts. The use of indigenous dressing materials reduces the cost significantly.
Inductive voltage adder advanced hydrodynamic radiographic technology demonstration
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Maenchen; Rovang, D.C.
1997-04-01
This paper presents the design, results, and analysis of a high-brightness electron beam technology demonstration experiment completed at Sandia National Laboratories, performed in collaboration with Los Alamos National Laboratory. The anticipated electron beam parameters were: 12 MeV, 35-40 kA, 0.5-mm rms radius, and 40-ns full width half maximum (FWHM) pulse duration. This beam, on an optimum thickness tantalum converter, should produce a very intense x-ray source of ∼ 1.5-mm spot size and 1 kR dose at sign 1 m. The accelerator utilized was SABRE, a pulsed inductive voltage adder, and the electron source was a magnetically immersed foilless electron diode. For these experiments, SABRE was modified to high-impedance negative-polarity operation. A new 100-ohm magnetically insulated transmission line cathode electrode was designed and constructed; the cavities were rotated 180 degrees poloidally to invert the central electrode polarity to negative; and only one of the two pulse forming lines per cavity was energized. A twenty- to thirty-Tesla solenoidal magnet insulated the diode and contained the beam at its extremely small size. These experiments were designed to demonstrate high electron currents in submillimeter radius beams resulting in a high-brightness high-intensity flash x-ray source for high-resolution thick-object hydrodynamic radiography. The SABRE facility high-impedance performance was less than what was hoped. The modifications resulted in a lower amplitude (9 MV), narrower-than-anticipated triangular voltage pulse, which limited the dose to ∼ 20% of the expected value. In addition, halo and ion-hose instabilities increased the electron beam spot size to > 1.5 mm. Subsequent, more detailed calculations explain these reduced output parameters. An accelerator designed (versus retrofit) for this purpose would provide the desired voltage and pulse shape
Waste Water Treatment Apparatus and Methods
Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)
2014-01-01
An improved draft tube spout fluid bed (DTSFB) mixing, handling, conveying, and treating apparatus and systems, and methods for operating are provided. The apparatus and systems can accept particulate material and pneumatically or hydraulically conveying the material to mix and/or treat the material. In addition to conveying apparatus, a collection and separation apparatus adapted to receive the conveyed particulate material is also provided. The collection apparatus may include an impaction plate against which the conveyed material is directed to improve mixing and/or treatment. The improved apparatus are characterized by means of controlling the operation of the pneumatic or hydraulic transfer to enhance the mixing and/or reacting by controlling the flow of fluids, for example, air, into and out of the apparatus. The disclosed apparatus may be used to mix particulate material, for example, mortar; react fluids with particulate material; coat particulate material, or simply convey particulate material.
Energy Technology Data Exchange (ETDEWEB)
Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)
2017-02-15
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
International Nuclear Information System (INIS)
Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.
2017-01-01
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
High-voltage nanosecond pulse shaper
International Nuclear Information System (INIS)
Kapishnikov, N.K.; Muratov, V.M.; Shatanov, A.A.
1987-01-01
A high-voltage pulse shaper with an output of up to 250 kV, a base duration of ∼ 10 nsec, and a repetition frequency of 50 pulses/sec is described. The described high-voltage nanosecond pulse shaper is designed for one-orbit extraction of an electron beam from a betatron. A diagram of the pulse shaper, which employs a single-stage generator is shown. The shaping element is a low-inductance capacitor bank of series-parallel KVI-3 (2200 pF at 10 kV) or K15-10 (4700 pF at 31.5 kV) disk ceramic capacitors. Four capacitors are connected in parallel and up to 25 are connected in series
Construction of shallow land simulation apparatuses
International Nuclear Information System (INIS)
Yamamoto, Tadatoshi; Ohtsuka, Yoshiro; Takebe, Shinichi; Ohnuki, Toshihiko; Ogawa, Hiromichi; Harada, Yoshikane; Saitoh, Kazuaki; Wadachi, Yoshiki
1984-07-01
Shallow land simulation apparatuses in which natural soil can be used as testing soil have been constructed to investigate the migration characteristics of radionuclides in a disposal site. These apparatuses consist of aerated zone apparatus and aquifer zone one. In the aerated zone apparatus, aerated soil upon ground water level is contained in the soil column (d: 30cm x h: 120cm). In the aquifer zone apparatus, aquifer soil laying ground water level is contained in the soil vessel (b: 90cm x l: 270cm x h: 45cm). This report describes the outline of shallow land simulation apparatuses : function of apparatuses and specification of devices, analysis of obstructions, safety rules, analysis of accidents and operation manual. (author)
Excitation of voltage oscillations in an induction voltage adder
Directory of Open Access Journals (Sweden)
Nichelle Bruner
2009-07-01
Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.
Low-Cost Voltage Zero-Crossing Detector for AC-Grid Applications
Directory of Open Access Journals (Sweden)
Vorobyov Maxim
2014-10-01
Full Text Available Renewable energy sources and energy storage devices are becoming more popular. Some of them like small hydropower turbines, wind turbines and diesel generators produce AC voltage with different frequency and voltage than the main grid. For them power electronics converters are necessary. Power electronics converters presented in industry use two or three level energy conversion, although direct AC to AC converters exist, but one of the main problems is the switch commutation when current or voltage is crossing the zero point. Zero crossing sensors are used to solve this problem. They consist of current or voltage measurement unit and zero crossing detector. Different approaches are used for zero crossing: hardware or software. Hardware approach is simple but it has low precision. Software approach has high precision but it is complicated and expensive. In this paper a simple low cost high precision approach is presented. It takes all advantages from both approaches. While tested with two types of microcontrollers the precision of experimental measurement is 25 μs - 40 μs.
High energy electron disinfection of sewage wastewater in flow systems
Energy Technology Data Exchange (ETDEWEB)
Miyata, T; Arai, H; Hosono, M; Tokunaga, O; Machi, S [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Kondoh, M; Minemura, T; Nakao, A; Seike, Y [Sumitomo Heavy Industries Ltd., Tokyo (Japan)
1990-01-01
The disinfection of effluent municipal wastewaters by high-energy electrons in flow systems was studied using an experimental apparatus which has the maximum treatment capacity of 10.8 m{sup 3}/h. An electron accelerator with an accelerating voltage of 2 MV was used. The electron beam current was controlled to deliver the desired doses ranging from 0.05 to 1 kGy. Treatment times were in the range from 0.0022 to 0.051 s. Preliminary experiments with batch system using Petri dish of 100 ml showed that the effectiveness of electron irradiation on inactivation of coliforms was not influenced significantly by factors such as pH, SS, COD, DO and irradiation temperature. The dose required to produce 99.9% kill in the total population presented in wastewater were markedly affected by the thickness of water exposure to electron irradiation; that is, 0.39, 0.4 and 0.44 kGy for the depth of 5, 6 and 7 mm, respectively. The data obtained after a suitable correction for the doses due to the depth dose distribution showed no deviation from an experimental survival curve. Experiments with flow system indicated no measureable effect of the flow rate of wastewaters on the efficiency of disinfection in the range from 0.5 to 3.5 m/s. (author).
Energy Technology Data Exchange (ETDEWEB)
Su, Guo-Qiang; Wang, Yi-Bo; Song, Bai-Peng; Mu, Hai-Bao, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn; Zhang, Guan-Jun, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, School of Electrical Engineering, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Li, Feng; Wang, Meng [Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China)
2016-06-15
The luminescence evolution phenomena from alumina ceramic surface in vacuum under high voltage of direct and alternating current are reported, with the voltage covering a large range from far below to close to the flashover voltage. Its time resolved and spatial distributed behaviors are examined by a photon counting system and an electron-multiplying charge-coupled device (EMCCD) together with a digital camera, respectively. The luminescence before flashover exhibits two stages as voltage increasing, i.e., under a relative low voltage (Stage A), the luminescence is ascribed to radiative recombination of hetero-charges injected into the sample surface layer by Schottky effect; under a higher voltage (Stage B), a stable secondary electron emission process, resulting from the Fowler-Nordheim emission at the cathode triple junction (CTJ), is responsible for the luminescence. Spectrum analysis implies that inner secondary electrons within the surface layer of alumina generated during the SSEE process also participate in the luminescence of Stage B. A comprehensive interpretation of the flashover process is formulated, which might promote a better understanding of flashover issue in vacuum.
Implementation of floating gate MOSFET in inverter for threshold voltage tunability
Directory of Open Access Journals (Sweden)
Musa F.A.S.
2017-01-01
Full Text Available This paper presents the ability of floating gate MOSFET (FGMOS threshold voltage to be programmed or tuned which is exploited to improve the performance of electronic circuit design. This special characteristic owns by FGMOS is definitely contributes towards low voltage and low power circuit design. The comparison of threshold voltage between FGMOS and conventional NMOS is done in order to prove that FGMOS is able to produce a lower threshold voltage compared to conventional NMOS. In addition, in this paper, an implementation of FGMOS into inverter circuit is also done to show the programmability of FGMOS threshold voltage. The operations of the inverter circuits are verified using Sypnopsys simulation in 0.1μm CMOS technology with supply voltage of 1.8V.
Studies of radiation blistering effects on voltage holding
International Nuclear Information System (INIS)
Miley, G.H.
1975-01-01
The surfaces of niobium and tungsten wires were blistered by 300-keV helium-ion irradiation and then tested for voltage holding. A cylindrical projection-tube technique was employed so that regions of strong electron emission could be observed and later examined with a scanning electron microscope (SEM). Blistering was found to cause significant increases in pre-breakdown currents. However, these currents tend to saturate over a region corresponding to around 200-400 kV/cm surface field such that the ultimate voltage breakdown limit is not seriously reduced. Emission image observations and SEM photographs suggest that, in many cases, parts of the blistered surface are gradually erected by the strong surface fields, but this may not occur until after several arc breakdowns. SEM photographs also indicate that vapor from the anode may play an important part in the breakdown mechanism. Implications of these results to the design of devices important to fusion development, such as direct collectors and ion sources, are briefly discussed. The importance of future in situ irradiation-voltage experiments is also stressed. (U.S.)
Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor
International Nuclear Information System (INIS)
Kim, N.; Cheong, Y.; Song, W.
2010-01-01
We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.
Federal Laboratory Consortium — This test apparatus, when combined with the National Full-Scale Aerodynamics Complex, produces a thorough, full-scale test capability. The Large Rotor Test Apparatus...
Nachbar, Henry D.; Korytkowski, Alfred S.
1991-01-01
A grinding apparatus for grinding the interior portion of a valve stem receiving area of a valve. The apparatus comprises a faceplate, a plurality of cams mounted to an interior face of the faceplate, a locking bolt to lock the faceplate at a predetermined position on the valve, a movable grinder and a guide tube for positioning an optical viewer proximate the area to be grinded. The apparatus can either be rotated about the valve for grinding an area of the inner diameter of a valve stem receiving area or locked at a predetermined position to grind a specific point in the receiving area.
Wang, Hongyue; Lhuillier, Emmanuel; Yu, Qian; Mottaghizadeh, Alireza; Ulysse, Christian; Zimmers, Alexandre; Dubertret, Benoit; Aubin, Herve
2015-03-01
We present a tunnel spectroscopy study of the electronic spectrum of single PbS Quantum Dots (QDs) trapped between nanometer-spaced electrodes, measured at low temperature T=5 K. The carrier filling of the QD can be controlled either by the drain voltage in the shell filling regime or by a gate voltage. In the empty QD, the tunnel spectrum presents the expected signature of the 8x degenerated excited levels. In the drain controlled shell filling regime, the levels degeneracies are lifted by the global electrostatic Coulomb energy of the QD; in the gate controlled shell filling regime, the levels degeneracies are lifted by the intra-Coulomb interactions. In the charged quantum dot, electron-phonons interactions lead to the apparition of Franck-Condon side bands on the single excited levels and possibly Franck Condon blockade at low energy. The sharpening of excited levels at higher gate voltage suggests that the magnitude of electron-phonon interactions is decreased upon increasing the electron filling in the quantum dot. This work was supported by the French ANR Grants 10-BLAN-0409-01, 09-BLAN-0388-01, by the Region Ile-de-France in the framework of DIM Nano-K and by China Scholarship Council.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment
Energy Technology Data Exchange (ETDEWEB)
König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)
2017-11-15
Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.
DEFF Research Database (Denmark)
Qu, Hao; Yang, Xijun; Guo, Yougui
2014-01-01
Single-phase voltage source converter (VSC) is an important power electronic converter (PEC), including single-phase voltage source inverter (VSI), single-phase voltage source rectifier (VSR), single-phase active power filter (APF) and single-phase grid-connection inverter (GCI). Single-phase VSC...
Assembly and handling apparatus for the EBFA Marx generator
International Nuclear Information System (INIS)
Staller, G.E.; Hiett, G.E.; Hamilton, I.D.; Aker, M.F.; Daniels, G.A.
1979-05-01
Marx generators, a major slow-pulsed power component in Sandia Laboratories' Electron Beam Fusion Accelerator (EBFA), were assembled at a remote facility modified to utilize an assembly-line technique. Due to the size and weight of the various components, as well as the final Marx generator assembly, special handling apparatus was designed. Time and manpower constraints required that this assembly be done in parallel with the construction of the Electron Beam Fusion Facility (EBFF). The completed Marx generators were temporarily stored and then moved from the assembly building to the EBFF using special transportation racks designed specifically for this purpose
Nuclear logging apparatus and MWD-equipment for formation evaluation
International Nuclear Information System (INIS)
Perry, C.A.; Daigle, G.A.; Rountree, S.P.; Talmadge, G.; Grunbeck, J.; Wassell, M
1998-01-01
An apparatus for nuclear logging is presented. In accordance with the present invention, nuclear detectors and electronic components are all mounted in chambers within the sub wall with covers being removably attached to the chambers. A single bus for delivering both power and signals extends through the sub wall between either end of the tool. This bus terminates at a modular ring connector positioned on each tool end. This tool construction (including sub wall mounted sensors and electronics, single power and signal bus, and ring connectors) is also well suited for other formation evaluation tools used in measurement-while-drilling applications. 28 refs
Experiments in high voltage electron microscopy. Progress report, October 31, 1976--August 1977
International Nuclear Information System (INIS)
Mitchell, T.E.; Hobbs, L.W.; Howitt, D.G.; Barnard, R.; Ro, H.
1977-07-01
High voltage electron microscopy (HVEM) is being used to study the effects of irradiation on a variety of materials. The vacancies and interstitials produced by displacement can aggregate to form dislocation loops and voids, annihilate at sinks, or enhance various diffusion processes such as precipitation and recrystallization. Threshold displacement energies, E/sub d/, have been determined for a number of fcc, bcc and hcp metals and for various oxides. In MgO, E/sub d/ is less along (100) than (110); also, E/sub d/ decreases with increasing temperature, possibly due to thermally activated escape of interstitials from recombination volumes or softening of saddle points. The effects of electron irradiation on precipitation in Al--Cu, Al--Si and Ni--Al alloys have been investigated. Precipitation respectively of theta', Si and γ' is enhanced and growth rates are explicable in terms of theories of radiation-enhanced diffusion, with D/sub rad/ approx. 10 -15 cm 2 sec -1 . In oxides, damage gives rise to interstitial dislocation loop nucleation and growth in all cases, perfect [110] loops in MgO faulted basal and prismatic loops in Al 2 O 3 . Quantitative analysis of loop growth rates in MgO gives a migration energy of 3.3 eV for anion vacancies. Other radiation effects include sublimation of MgO and decomposition of MgAl 2 O 4 and Mg 2 SiO 4 into MgO plus other phases
The Effect of Image Potential on the Current-Voltage Characteristics of a Ferritin-layer
Directory of Open Access Journals (Sweden)
Eunjung Bang
2010-11-01
Full Text Available Considering for the concept of power storage systems, such as those used to supply power to microelectronic devices, ferritins have aroused a lot of interests for applications in bioelectrochemical devices. And electron transfer rates from the proteins to electrode surface are key determinants of overall performance and efficiency of the ferritin-based devices. Here we have investigated the electron transport mechanism of ferritin layer which was immobilized on an Au electrode. The current-voltage (I-V curves are obtained by a conductive atomic force microscope (c-AFM as a function of contact area between AFM tip and the ferritin layer. In the low voltage region, I-V curves are affected by both Fowler-Nordheim tunneling and image force. On the other hand, the experimental results are consistent with a Simmons model in a high voltage region, indicating that, as the voltage increases, the image potential has a dominant effect on the electron transport mechanism. These results are attributed to the film-like character of the ferritin layer, which generates an image potential to lower the barrier height in proportion to the voltage increment.
Simulation of Electron Beam Trajectory of Thermionic Electron Gun Type with Pierce Electrode
International Nuclear Information System (INIS)
Suprapto; Djoko-SP; Djasiman
2000-01-01
The simulation of electron beam trajectory for electron gun of electron beam machine has been done. The simulation is carried out according to mechanical design of the electron gun. The simulation is carried out by using the software made by Andrzej Soltan Institute for Nuclear Studies, Swierk-Poland. The result obtained from simulation is approximately parallel electron beam trajectory of 20 mA beam current at 0.66 kV anode voltage, 15 mm cathode-anode distance and 67.5 o cathode angle. Arrangement of electron gun and accelerating tube with 15 kV voltage between anode and the first electrode of accelerating tube yields focus distance of 34 mm from the to cathode. To obtain the approximately parallel beam trajectory which has -0.03 o entrance angles to accelerating tube, the suitable cathode-anode voltage is 12.66 kV. With the entrance angle of -0.03 o it is expected that the electron beam can be accelerated and the beam profile has a small divergence after passing the accelerating tube. (author)
Improved coating and fixation methods for scanning electron microscope autoradiography
International Nuclear Information System (INIS)
Weiss, R.L.
1984-01-01
A simple apparatus for emulsion coating is described. The apparatus is inexpensive and easily assembled in a standard glass shop. Emulsion coating for scanning electron microscope autoradiography with this apparatus consistently yields uniform layers. When used in conjunction with newly described fixation methods, this new approach produces reliable autoradiographs of undamaged specimens
Energy Technology Data Exchange (ETDEWEB)
Xue, JunShuai, E-mail: junshuaixue@hotmail.com; Zhang, JinCheng; Hao, Yue [Key Laboratory of Wide Band Gap Semiconductor Materials and Devices, School of Microelectronics, Xidian University, Xi' an 710071 (China)
2016-01-04
In this work, InAlN/AlGaN heterostructures employing wider bandgap AlGaN instead of conventional GaN channel were grown on sapphire substrate by pulsed metal organic chemical vapor deposition, where the nominal Al composition in InAlN barrier and AlGaN channel were chosen to be 83% and 5%, respectively, to achieve close lattice-matched condition. An electron mobility of 511 cm{sup 2}/V s along with a sheet carrier density of 1.88 × 10{sup 13 }cm{sup −2} were revealed in the prepared heterostructures, both of which were lower compared with lattice-matched InAlN/GaN due to increased intrinsic alloy disorder scattering resulting from AlGaN channel and compressively piezoelectric polarization in barrier, respectively. While the high electron mobility transistor (HEMT) processed on these structures not only exhibited a sufficiently high drain output current density of 854 mA/mm but also demonstrated a significantly enhanced breakdown voltage of 87 V, which is twice higher than that of reported InAlN/GaN HEMT with the same device dimension, potential characteristics for high-voltage operation of GaN-based electronic devices.
The LMF triaxial MITL voltage adder system
International Nuclear Information System (INIS)
Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.
1992-01-01
The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...
Method for controlling low-energy high current density electron beams
International Nuclear Information System (INIS)
Lee, J.N.; Oswald, R.B. Jr.
1977-01-01
A method and an apparatus for controlling the angle of incidence of low-energy, high current density electron beams are disclosed. The apparatus includes a current generating diode arrangement with a mesh anode for producing a drifting electron beam. An auxiliary grounded screen electrode is placed between the anode and a target for controlling the average angle of incidence of electrons in the drifting electron beam. According to the method of the present invention, movement of the auxiliary screen electrode relative to the target and the anode permits reliable and reproducible adjustment of the average angle of incidence of the electrons in low energy, high current density relativistic electron beams
Gas-phase hydrosilylation of cyclohexene in an experimental radiation-chemical accelerator apparatus
International Nuclear Information System (INIS)
Pecherkin, A.S.; Sidorov, V.I.; Chernyshev, E.A.
1992-01-01
A process for the synthesis of methylcyclohexyldichlorosilane (a basic monomer for the production of organosilicon photoresists) has been investigated and perfected on an experimental apparatus with an ELV-2 electron accelerator; this synthesis involves gas-phase radiation-induced hydrosilylation of cyclohexene by methyldichlorosilane. Basic characteristics of the yield of the desired product under static conditions were determined. With the help of experiments on the synthesis of methylcyclohexyldichlorosilane in a flow- through mode, the technical features of the process of radiation-chemical hydrosilylation of cyclohexene on an accelerator apparatus were determined and studied, the optimal conditions for the synthesis were determined, and an experimental batch of the desired product was produced
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Energy Technology Data Exchange (ETDEWEB)
Sun, Shichuang [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China); Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Fu, Kai, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn; Yu, Guohao; Zhang, Zhili; Song, Liang; Deng, Xuguang; Li, Shuiming; Sun, Qian; Cai, Yong; Zhang, Baoshun [Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Qi, Zhiqiang; Dai, Jiangnan; Chen, Changqing, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China)
2016-01-04
This letter has studied the performance of AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors on silicon substrate with GaN buffer treated by aluminum ion implantation for insulating followed by a channel regrown by metal–organic chemical vapor deposition. For samples with Al ion implantation of multiple energies of 140 keV (dose: 1.4 × 10{sup 14} cm{sup −2}) and 90 keV (dose: 1 × 10{sup 14} cm{sup −2}), the OFF-state leakage current is decreased by more than 3 orders and the breakdown voltage is enhanced by nearly 6 times compared to the samples without Al ion implantation. Besides, little degradation of electrical properties of the 2D electron gas channel is observed where the maximum drain current I{sub DSmax} at a gate voltage of 3 V was 701 mA/mm and the maximum transconductance g{sub mmax} was 83 mS/mm.
Cable control and take-up mechanisms and x-ray scanning apparatus incorporating such mechanisms
International Nuclear Information System (INIS)
Braden, A.B.; Lekan, J.J.; Taylor, S.K.; Richey, J.B.
1977-01-01
In this patent, an invention for cable control and take-up mechanisms for elongated, flexible cables is described. Such cables are used in X-ray scanner apparatus to provide power, electronic signals and fluids. A detailed design and description is given of the cable harness, control and take-up mechanism that would be used in conjunction with an X-ray scanner. As a result of this invention, the cables are prevented from becoming prematurely worn or entangled in the X-ray apparatus during the rotational and translational movements necessary in tomographic examinations. This invention is also applicable to other types of apparatus and environments where a number of different positions is required and where it is necessary to control the take-up of elongated, flexible, cable-like members. (U.K.)
Computer-aided analysis of power-electronic systems simulation of a high-voltage power converter
International Nuclear Information System (INIS)
Bordry, F.; Isch, H.W.; Proudlock, P.
1987-01-01
In the study of semiconductor devices, simulation methods play an important role in both the design of systems and the analysis of their operation. The authors describe a new and efficient computer-aided package program for general power-electronic systems. The main difficulty when taking into account non-linear elements, such as semiconductors, lies in determining the existence and the relations of the elementary sequences defined by the conduction or nonconduction of these components. The method does not require a priori knowledge of the state sequences of the semiconductor nor of the commutation instants, but only the circuit structure, its parameters and the commands to the controlled switches. The simulation program computes automatically both transient and steady-state waveforms for any circuit configuration. The simulation of a high-voltage power converter is presented, both for its steady-state and transient overload conditions. This 100 kV power converter (4 MW) will feed two klystrons in parallel
Novel high-voltage power lateral MOSFET with adaptive buried electrodes
International Nuclear Information System (INIS)
Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji
2012-01-01
A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Intrinsic non-radiative voltage losses in fullerene-based organic solar cells
Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen
2017-06-01
Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.
Selective irradiation for fast switching thyristor with low forward voltage drop
International Nuclear Information System (INIS)
Brown, J.L.
1975-01-01
The switching speed of a thyristor is increased without correspondingly increasing the forward voltage drop by selectively irradiating at least portions of the PN junction between the conducting and gating portions, and 5 to 30 percent of the adjacent surface area of the conducting portions of the device. 50 to 100 percent of the surface area of the gating portions, and the peripheral portions can also be irradiated at the same time to decrease gate sensitivity and increase blocking voltage of the thyristor, respectively. Preferably, the thyristor is irradiated with electron radiation which preferably is of an intensity greater than 1 MeV and most desirably about 2 MeV. The electron irradiation is preferably to a dosage of between about 1 x 10 13 electrons/cm 2 and 1 x 10 15 electrons/cm 2 . (auth)
High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter
International Nuclear Information System (INIS)
Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.
1987-01-01
The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
International Nuclear Information System (INIS)
1981-01-01
Apparatus for performing a quantitative radioimmunoassay comprising: a substantially spherical bead for carrying an antibody and a gripper for gripping said bead, said gripper comprising an integrally formed unit having a single elongate handle portion and a plurality of resilient fingers arranged at the base of the handle so that when said bead is secured within said fingers, said bead may be freely rotated about any diametric axis of the bead. In particular the invention relates to an apparatus for a two site immunoradiometric assay for serum ferritin in human blood samples. (author)
Wolfgang, F.; Nicol, J.
1962-11-01
Transformer apparatus is designed for measuring the amount of a paramagnetic substance dissolved or suspended in a diamagnetic liquid. The apparatus consists of a cluster of tubes, some of which are closed and have sealed within the diamagnetic substance without any of the paramagnetic material. The remaining tubes are open to flow of the mix- ture. Primary and secondary conductors are wrapped around the tubes in such a way as to cancel noise components and also to produce a differential signal on the secondaries based upon variations of the content of the paramagnetic material. (AEC)
International Nuclear Information System (INIS)
Leung, P.M.; Webb, H.P.J.
1985-01-01
This invention relates to apparatus for applying intracavitary radiotherapy. In previously-known systems radioactive material is conveyed to a desired location within a patient by transporting a chain of balls pneumatically to and from an appropriately inserted applicator. According to this invention a ball chain for such a purpose comprises several radioactive balls separated by non-radioactive tracer balls of radiographically transparent material of lower density and surface hardness than the radioactive balls. The invention also extends to radiotherapy treatment apparatus comprising a storage, sorting and assembly system
International Nuclear Information System (INIS)
Shigekawa, Y.; Kasamatsu, Y.; Shinohara, A.
2016-01-01
The nucleus "2"3"5"mU is an isomer with extremely low excitation energy (76.8 eV) and decays dominantly through the internal conversion (IC) process. Because outer-shell electrons are involved in the IC process, the decay constant of "2"3"5"mU depends on its chemical environment. We plan to study the deexcitation process of "2"3"5"mU by measuring the energy spectra of IC electrons in addition to the decay constants for various chemical forms. In this paper, the preparation method of "2"3"5"mU samples from "2"3"9Pu by using alpha-recoil energy is reported. A Collection Apparatus for Recoil Products was fabricated, and then collection efficiencies under various conditions were determined by collecting "2"2"4Ra recoiling out of "2"2"8Th electrodeposited and precipitated sources. The pressure in the apparatus (vacuum or 1 atm of N_2 gas) affected the variations of the collection efficiencies depending on the negative voltage applied to the collector. The maximum values of the collection efficiencies were mainly affected by the thickness of the "2"2"8Th sources. From these results, the suitable conditions of the "2"3"9Pu sources for preparation of "2"3"5"mU were determined. In addition, dissolution efficiencies were determined by washing collected "2"2"4Ra with solutions. When "2"2"4Ra was collected in 1 atm of N_2 gas and dissolved with polar solutions such as water, the dissolution efficiencies were nearly 100%. The method of rapid dissolution of recoil products would be applicable to rapid preparation of short-lived "2"3"5"mU samples for various chemical forms.
Apparatus for Teaching Physics.
Gottlieb, Herbert H., Ed.
1981-01-01
Describes: (1) a variable inductor suitable for an inductance-capacitance bridge consisting of a fixed cylindrical solenoid and a moveable solenoid; (2) long-range apparatus for demonstrating falling bodies; and (3) an apparatus using two lasers to demonstrate ray optics. (SK)
Current integrator using the voltage to frequency converter
International Nuclear Information System (INIS)
Ukai, K.; Gomi, K.
1975-01-01
A current integrator using the Voltage to Frequency Converter has been constructed to measure the beam intensity of the 1.3 GeV Electron Synchrotron at the INS. This integrator ranges the current 10 -7 to 10 -11 amperes and has been calibrated by the extracted electron beam and constant current sources. The accuracy of this integrator agrees with the previous integrator within 1%. (auth.)
International Nuclear Information System (INIS)
1979-01-01
This invention relates to a radiation imaging apparatus. It relates more particularly to apparatus of this general type which employs stationary X-ray source and detector arrays capable of acquiring multiple ultrafast scans per second to facilitate the dynamic study of moving human organs such as the beating heart. While the invention has many applications, it has particular utility in connection with computerized tomographic (CT) scanners. (Auth.)
Grainger, Brandon Michael
The growth in the electric power industry's portfolio of Direct Current (DC) based generation and loads have captured the attention of many leading research institutions. Opportunities for using DC based systems have been explored in electric ship design and have been a proven, reliable solution for transmitting bulk power onshore and offshore. To integrate many of the renewable resources into our existing AC grid, a number of power conversions through power electronics are required to condition the equipment for direct connection. Within the power conversion stages, there is always a requirement to convert to or from DC. The AC microgrid is a conceptual solution proposed for integrating various types of renewable generation resources. The fundamental microgrid requirements include the capability of operating in islanding mode and/or grid connected modes. The technical challenges associated with microgrids include (1) operation modes and transitions that comply with IEEE1547 without extensive custom engineering and (2) control architecture and communication. The Medium Voltage DC (MVDC) architecture, explored by the University of Pittsburgh, can be visualized as a special type of DC microgrid. This dissertation is multi-faceted, focused on many design aspects of an offshore DC microgrid. The focal points of the discussion are focused on optimized high power, high frequency magnetic material performance in electric machines, transformers, and DC/DC power converters---all components found within offshore, power system architectures. A new controller design based upon model reference control is proposed and shown to stabilize the electric motor drives (modeled as constant power loads), which serve as the largest power consuming entities in the microgrid. The design and simulation of a state-of-the-art multilevel converter for High Voltage DC (HVDC) is discussed and a component sensitivity analysis on fault current peaks is explored. A power management routine is
Gated-controlled electron pumping in connected quantum rings
International Nuclear Information System (INIS)
Lima, R.P.A.; Domínguez-Adame, F.
2014-01-01
We study the electronic transport across connected quantum rings attached to leads and subjected to time-harmonic side-gate voltages. Using the Floquet formalism, we calculate the net pumped current generated and controlled by the side-gate voltage. The control of the current is achieved by varying the phase shift between the two side-gate voltages as well as the Fermi energy. In particular, the maximum current is reached when the side-gate voltages are in quadrature. This new design based on connected quantum rings controlled without magnetic fields can be easily integrated in standard electronic devices. - Highlights: • We introduce and study a minimal setup to pump electrons through connected quantum rings. • Quantum pumping is achieved by time-harmonic side-gate voltages instead of the more conventional time-dependent magnetic fluxes. • Our new design could be easily integrated in standard electronic devices
Single-molecule electron tunnelling through multiple redox levels with environmental relaxation
DEFF Research Database (Denmark)
Kuznetsov, A.M.; Ulstrup, Jens
2004-01-01
represent the substrate and tip in electrochemical in situ scanning tunnelling microscopy. An equivalent three-electrode configuration represents a molecular single-electron transistor in which the enclosing electrodes constitute source and drain, and the reference electrode the gate. Current-bias voltage...... relations at fixed electrochemical overpotential or gate voltage, and current-overpotential or current-gate voltage relations at fixed bias voltage are equivalent in the two systems. Due to the activation-less nature of the processes, electron flow between the electrodes through the molecular redox levels...... level(s) subsequent to electron transfer. Several physical mechanisms can be distinguished and distinctive current-overpotential/gate voltage or current-bias voltage relations obtained. These reflect electronic level separation, environmental nuclear reorganisation, and coherent or incoherent multi...
International Nuclear Information System (INIS)
Ma Da; Luo Xiao-Rong; Wei Jie; Tan Qiao; Zhou Kun; Wu Jun-Feng
2016-01-01
A new ultra-low specific on-resistance (R on,sp ) vertical double diffusion metal–oxide–semiconductor field-effect transistor (VDMOS) with continuous electron accumulation (CEA) layer, denoted as CEA-VDMOS, is proposed and its new current transport mechanism is investigated. It features a trench gate directly extended to the drain, which includes two PN junctions. In on-state, the electron accumulation layers are formed along the sides of the extended gate and introduce two continuous low-resistance current paths from the source to the drain in a cell pitch. This mechanism not only dramatically reduces the R on,sp but also makes the R on,sp almost independent of the n-pillar doping concentration (N n ). In off-state, the depletion between the n-pillar and p-pillar within the extended trench gate increases the N n , and further reduces the R on,sp . Especially, the two PN junctions within the trench gate support a high gate–drain voltage in the off-state and on-state, respectively. However, the extended gate increases the gate capacitance and thus weakens the dynamic performance to some extent. Therefore, the CEA-VDMOS is more suitable for low and medium frequencies application. Simulation indicates that the CEA-VDMOS reduces the R on,sp by 80% compared with the conventional super-junction VDMOS (CSJ-VDMOS) at the same high breakdown voltage (BV). (paper)
International Nuclear Information System (INIS)
Marmo, A.R.
1979-01-01
An improved design of a sludge recovery apparatus used in the fabrication of nuclear fuel is described. This apparatus provides for automatic separation of sludge from the grinder coolant, drying of the sludge into a flowable powder and transfer of the dry powder to a salvage container. It can be constructed to comply with criticality-safe-geometry requirements and to obviate need for operating personnel in its immediate vicinity. (UK)
Sprout inhibition of potatoes by electron irradiation, (2)
International Nuclear Information System (INIS)
Furuta, Junichiro; Hiraoka, Eiichi; Okamoto, Shinichi; Fujishiro, Masatoshi; Kanazawa, Tamotsu; Ohnishi, Tokuhiro; Tsujii, Yukio; Hori, Shiro
1982-01-01
Sprouting of potatoes are inhibited usually by the gamma-ray irradiation. The buds of potatoes exist in a very thin layer near surface of each tuber. So the inhibition will be performed sufficiently by surface irradiation using electron beams. To irradiate all surfaces of each potato uniformly, the authors prepare a new apparatus which is a conveyer passing under an electron beam scanner of accelerator rotating the potatoes by many rotating rollers. The sprout inhibition experiment of potatoes was performed by following three methods to obtain the performance of this apparatus, and the results were compared. 1) turn over irradiation method --- potatoes were arranged in one layer in plastic baskets and were irradiated on the conveyor. After irradiation, the potatoes were turned over and were irradiated again. 2) rotating irradiation method --- potatoes were rotated on the rotating roller apparatus set on the conveyer and were passed under the electron beam scanner. 3) rotating irradiation method with an improved rotating roller apparatus --- the rotating rollers have many protuberances on their surface to irradiate all of potato surface more uniform. 550 keV electron beams by Cockcroft-Walton type accelerator were used for the irradiation and the irradiated dose was 5 to 20 krad. 40 pieces of potates, ''Danshaku'' variety yielded in June 1981, were irradiated for each dose in the beginning of August. Prior to these irradiation experiments, the dose and dose uniformity were checked by the agar color dosimeters. After the irradiation, potatoes were stored in natural condition and their sprouting was observed. The potatoes irradiated by the improved rotating roller apparatus were almost completely sprout-inhibited by 20 krad irradiation. (author)
Informationization nuclear apparatus communication technique
International Nuclear Information System (INIS)
Yu Tiqi; Fang Zongliang; Wen Qilin
2006-01-01
The paper explains the request of communication ability in nuclear technique application area. Based on the actuality of nuclear apparatus communication ability, and mainly combining with the development of communication technique, the authors analyzes the application trend of communication technique applying in nuclear apparatus, for the apparatus and system needing communication ability, they need selecting suitable communication means to make them accomplish the task immediately and effectively. (authors)
Development of a New Cascade Voltage-Doubler for Voltage Multiplication
Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri
2014-01-01
For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.
Simultaneous specimen and stage cleaning device for analytical electron microscope
Zaluzec, Nestor J.
1996-01-01
An improved method and apparatus are provided for cleaning both a specimen stage, a specimen and an interior of an analytical electron microscope (AEM). The apparatus for cleaning a specimen stage and specimen comprising a plasma chamber for containing a gas plasma and an air lock coupled to the plasma chamber for permitting passage of the specimen stage and specimen into the plasma chamber and maintaining an airtight chamber. The specimen stage and specimen are subjected to a reactive plasma gas that is either DC or RF excited. The apparatus can be mounted on the analytical electron microscope (AEM) for cleaning the interior of the microscope.
Nishida, Tomoki; Yoshimura, Ryoichi; Endo, Yasuhisa
2017-09-01
Neurite varicosities are highly specialized compartments that are involved in neurotransmitter/ neuromodulator release and provide a physiological platform for neural functions. However, it remains unclear how microtubule organization contributes to the form of varicosity. Here, we examine the three-dimensional structure of microtubules in varicosities of a differentiated PC12 neural cell line using ultra-high voltage electron microscope tomography. Three-dimensional imaging showed that a part of the varicosities contained an accumulation of organelles that were separated from parallel microtubule arrays. Further detailed analysis using serial sections and whole-mount tomography revealed microtubules running in a spindle shape of swelling in some other types of varicosities. These electron tomographic results showed that the structural diversity and heterogeneity of microtubule organization supported the form of varicosities, suggesting that a different distribution pattern of microtubules in varicosities is crucial to the regulation of varicosities development.
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
International Nuclear Information System (INIS)
Cuneo, M.E.; Hanson, D.L.; Menge, P.R.; Poukey, J.W.; Savage, M.E.
1994-01-01
SABRE (Sandia Accelerator and Beam Research Experiment) is a ten-cavity linear induction magnetically insulated voltage adder (6 MV, 300 kA) operated in positive polarity to investigate issues relevant to ion beam production and propagation for inertial confinement fusion. The voltage adder section is coupled to an applied-B extraction ion diode via a long coaxial output transmission line. Observations indicate that the power propagates in a vacuum wave prior to electron emission. After the electron emission threshold is reached, power propagates in a magnetically insulated wave. The precursor is observed to have a dominant impact on he turn-on, impedance history, and beam characteristics of applied-B ion diodes since the precursor voltage is large enough to cause electron emission at the diode from both the cathode feed and cathode tips. The amplitude of the precursor at the load (3--4.5 MV) is a significant fraction of the maximum load voltage (5--6 MV) because (1) the transmission line gaps ( ∼ 9 cm at output) and therefore impedances are relatively large, and hence the electric field threshold for electron emission (200 to 300 kV/cm) is not reached until well into the power pulse rise time; and (2) the rapidly falling forward wave and diode impedance reduces the ratio of main pulse voltage to precursor voltage. Experimental voltage and current data from the transmission line and the ion diode will be presented and compared with TWOQUICK (2-D electromagnetic PIC code) simulations and analytic models
Generation of runaway electron beams in high-pressure nitrogen
Tarasenko, V. F.; Burachenko, A. G.; Baksht, E. Kh
2017-07-01
In this paper the results of experimental studies of the amplitude-temporal characteristics of a runaway electron beam, as well as breakdown voltage in nitrogen are presented. The voltage pulses with the amplitude in incident wave ≈120 kV and the rise time of ≈0.3 ns was used. The supershort avalanche electron beam (SAEB) was detected by a collector behind the flat anode. The amplitude-time characteristics of the voltage and SAEB current were studied with subnanosecond time resolution. The maximum pressure at which a SAEB is detectable by collector was ∼1 MPa. This pressure increases with decreasing the voltage rise time. The waveforms of the discharge and runaway electron beam currents was synchronized with the voltage pulses. The mechanism of the runaway electron generation in atmospheric-pressure gases is analyzed on the basis of the obtained experimental data.
A superheterodyne spectrometer for electronic paramagnetic. Resonance
International Nuclear Information System (INIS)
Laffon, J.L.
1963-12-01
After a few generalities about electron paramagnetic resonance, a consideration of different experimental techniques authorises the choice of a particular type of apparatus. An EPR superheterodyne spectrometer built in the laboratory and having a novel circuit is described in detail. With this apparatus, many experimental results have been obtained and some of these are described as example. (author) [fr
International Nuclear Information System (INIS)
Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M
2016-01-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)
International Nuclear Information System (INIS)
Guo Huiping; Lu Ning; Shang Aiguo; Zhou Chunlin; Chen Yingfen; Yu Hongwei
2004-12-01
For actual demand, an idea of 'on-line monitoring' is put forward as a way of radon monitoring, instead of traditional so called 'off-line monitoring'. In this way, the apparatus has some automatic functions such as continuous monitoring, real-time alarm; thereby, there is no need for operators' intervention in each monitoring process. With technique of hardware and software design in automation's field, the authors have successfully developed the prototype and finished the scale of it in a standard radon-chamber. This apparatus is composed of detector part and secondary-instrument. The detector part is made up of a passive diffusion collecting chamber, high voltage static electricity, semiconductor detector, charge-sensitive preamplifier and forming circuit. The secondary-instrument is actually a micro-controller system, which consists of a single-chip micro-controller cored measure-controlling unit, display unit, printing unit and alarming unit. Taking this apparatus as a cell, a 'on-line Radon Monitoring Platform' based on CAN bus has been put forward, which can realize multi-points environmental radioactivity real-time monitoring radioactivity and data process. (authors)
Apparatus and method for inhibiting the generation of excessive radiation
International Nuclear Information System (INIS)
Hernandez, F.; Chamberlain, J.
1991-01-01
This patent describes an apparatus for generating electron radiation or X-ray radiation. It comprises accelerator means for generating and accelerating electrons to form an electron beam which has a predetermined low intensity level for the generation of the electron radiation or a predetermined high intensity level for the generation of the X-ray radiation; supporting means for supporting a scattering foil and a target and for selectively moving either the foil into the trajectory of the electron beam having the low intensity level for generating the electron radiation upon impingement of the electrons there or on the target into the trajectory of the electron beam having the high intensity level for generating the X-ray radiation upon impingement of the electrons thereon; detecting means operable by the supporting means for sensing the position of the target relative to the trajectory of the electron beam; and inhibiting means coupled to the accelerator means and to the detecting means for preventing the generation of an electron beam having the high intensity level if the foil and not the target is positioned in the trajectory of the electron beam
Gray, C.F.; Thompson, R.H.
1958-10-01
An improved apparatus for the melting and casting of uranium is described. A vacuum chamber is positioned over the casting mold and connected thereto, and a rod to pierce the oxide skin of the molten uranium is fitted into the bottom of the melting chamber. The entire apparatus is surrounded by a jacket, and operations are conducted under a vacuum. The improvement in this apparatus lies in the fact that the top of the melting chamber is fitted with a plunger which allows squeezing of the oxide skin to force out any molten uranium remaining after the skin has been broken and the molten charge has been cast.
Computerized dosimetric system for studying radiation fields of afterloading apparatus
International Nuclear Information System (INIS)
Andryushin, O.S.; Gorshkov, M.I.
1988-01-01
Works on designing a computerized dosimetric scanner (CODOS) for studying radiation fields of remote therapeutic apparatus, providing dosimetric data input from semiconductor transducers and ionization chambers directly into the computer memory were carried out. The basic problems were to provide reproducibility and accuracy of the initial dosimetric data, formation of the data bank on LUEhV-15M1 accelerator bremsstrahlung and electron radiation fields. An extra problem was to provide isodose curves for manual scheduling of radiotherapy. The 15 VUMS-28-025 complex based on Elektronika-60 computer was chosen as a host computer, photodiodes were used as a semiconductor detector, the 70108 rod chamber and VA-J-18 dosemeters were used as an ionization chamber. The results of studies with the CODOS system have been shown that it meets the dosimetric requirements for therapeutic apparatus
Mitigation of Flicker using STATCOM with Three-Level 12-pulse Voltage Source Inverter
Ali Z a'fari
2011-01-01
Voltage flicker is a disturbance in electrical power systems. The reason for this disturbance is mainly the large nonlinear loads such as electric arc furnaces. Synchronous static compensator (STATCOM) is considered as a proper technique to mitigate the voltage flicker. Application of more suitable and precise power electronic converter leads to a more precise performance of the compensator. In this paper a three-level 12-pulse voltage source inverter (VSI) with a 12-term...
Organic ice resists for 3D electron-beam processing: Instrumentation and operation
DEFF Research Database (Denmark)
Tiddi, William; Elsukova, Anna; Beleggia, Marco
2018-01-01
Organic vapors condensed into thin layers of ice on the surface of a cold substrate are exposed with an electron beam to create resist patterns for lithography applications. The entire spin- and development-free lithography process requires a single custom instrument. We report the design, material...... choice, implementation and operation of this apparatus. It is based on a scanning electron microscope fitted with an electron beam control system that is normally used for electron beam lithography in a multi-user open-access laboratory. The microscope was also equipped with a gas injection system......, a liquid nitrogen cooled cryostage, a temperature control system, and a load-lock. Three steps are required to initialize the apparatus for organic ice resist processing, and two steps are required to restore the apparatus for routine multi-user operations. Five steps are needed to create organic ice...
Davidson, J. K.; Houck, W. H.
1971-01-01
Electronic circuit for monitoring excessive ripple voltage on dc power lines senses voltage variations from few millivolts to maximum of 10 volts rms. Instrument is used wherever power supply fluctuations might endanger system operations or damage equipment. Device is inexpensive and easily packaged in small chassis.
Solid State High Voltage Supply for EB and X-Ray Generators
Czech Academy of Sciences Publication Activity Database
Zobač, Martin; Vlček, Ivan
2009-01-01
Roč. 44, 5-6 (2009), s. 73-75 ISSN 0861-4717 R&D Projects: GA AV ČR KAN300100702 Institutional research plan: CEZ:AV0Z20650511 Keywords : high voltage supply * electron beam generator * x-ray generator Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering
Self-propelled pulse X-ray apparatus Sirena-1
International Nuclear Information System (INIS)
Danil'chenko, N.T.; Ershov, L.S.; Il'chenko, A.V.; Krasil'nikov, S.B.; Kristalinskij, A.L.; Lozovoj, L.N.; Markov, S.N.; Morgovskij, L.Ya.
1984-01-01
The structure and specifications of a self-propelled pulse X-ray apparatus ''Sirena-1'' for testing oilt and gas pipelines welded joints are described. The apparatus is designed on the base of pulse X-ray apparatus MIRA. Apparatus control is realized by means of the 137 Cs source or manual control desk. The apparatus ensures perfect control sensitivity
International Nuclear Information System (INIS)
1981-01-01
An X-ray apparatus is described for determining the size and location of brain tumours by tomography during pneumoencephalography. The apparatus comprises an image recording device arranged opposite an X-ray source and a frame mounted on a tiltable patient table and rotatable with respect to the table. A patient support is arranged in the frame and is rotatable with respect to the frame. Air injected into the patients' spinal column travels up into the brain and displaces some of the cerebral fluid. Tomographic X-ray exposures are made of the air bubble which moves around in the brain cavities as the patient is rotated. (U.K.)
International Nuclear Information System (INIS)
Sashin, D.; Sternglass, E.J.
1982-01-01
The apparatus of the present invention provides radiography apparatus wherein the use of a flat, generally rectangular beam or a fan-shaped beam of radiation in combination with a collimator, scintillator and device for optically coupling a self-scanning array of photodiodes to the scintillator means will permit production of images or image data with high contrast sensitivity and detail. It is contemplated that the self-scanning array of photodiodes may contain from about 60 to 2048, and preferably about 256 to 2048, individual photodiode elements per inch of object width, thereby permitting maximum data collection to produce a complete image or complete collection of image data
International Nuclear Information System (INIS)
Elsner, H.J.
1979-01-01
Calibration apparatus for verifying the position and orientation of transducers used in nuclear reactor vessel inspection apparatus is disclosed. A tank, filled with water, the operating inspection medium, is fitted with a movable mounting assembly adapted to securely accommodate a transducer and the mounting assembly in which it is normally secured during an inspection procedure. The tank is also provided with a slidably mounted target positioned therein at a predetermined distance from the target which is selected to avoid the distortion effects in the near field of the transducer response. The calibration apparatus can be used to check the normal transducer mounting for either perpendicularity or angular orientation by moving the tank's mounting assembly via a lead screw with which it is threadingly engaged. 6 claims
High Bandwidth Optical Links for Micro-Satellite Support
Chao, Tien-Hsin (Inventor); Wilson, Keith E. (Inventor); Coste, Keith (Inventor)
2016-01-01
A method, systems, apparatus and device enable high bandwidth satellite communications. An onboard tracking detector, installed in a low-earth orbit satellite, detects a position of an incoming optical beam received/transmitted from a first ground station of one or more ground stations. Tracker electronics determine orientation information of the incoming optical beam based on the position. Control electronics receive the orientation information from the tracker electronics, and control a waveguide drive electronics. The waveguide drive electronics control a voltage that is provided to an electro-optic waveguide beam steering device. The electro-optic waveguide beam steering device steers an outgoing optical beam to one of the one or more ground stations based on the voltage.
Supply system with microprocessor control for electron gun
International Nuclear Information System (INIS)
Duplin, N.I.; Sergeev, N.N.
1988-01-01
Precision supply system for electron gun used in Auger-spectrometer is described. The supply system consists of control and high-voltage parts, made as separate units. Supply high-voltage unit includes system supply module, filament module to supply electron gun cathode and 6 high-volt modules to supply accelerating, modulating and three focusing electrodes of the gun. High-voltage modules have the following characteristics: U-(100-1000)V output voltage, 5x10 -5 U stability, 10 -5 xU pulsation amplitude, J-(0-5)A filament current change range at 10 -4 xJ stability. Control unit including microprocessor, timer and storage devices forms control voltage for all modules and regulates voltage and current of filament at electrodes
Brodusch, Nicolas; Voisard, Frédéric; Gauvin, Raynald
2017-11-01
Characterising the impact of lithium additions in the precipitation sequence in Al-Li-Cu alloys is important to control the strengthening of the final material. Since now, transmission electron microscopy (TEM) at high beam voltage has been the technique of choice to monitor the size and spatial distribution of δ' precipitates (Al 3 Li). Here we report on the imaging of the δ' phase in such alloys using backscattered electrons (BSE) and low accelerating voltage in a high-resolution field-emission scanning electron microscope. By applying low-energy Ar + ion milling to the surface after mechanical polishing (MP), the MP-induced corroded layers were efficiently removed and permitted the δ's to be visible with a limited impact on the observed microstructure. The resulting BSE contrast between the δ's and the Al matrix was compared with that obtained using Monte Carlo modelling. The artefacts possibly resulting from the sample preparation procedure were reviewed and discussed and permitted to confirm that these precipitates were effectively the metastable δ's. The method described in this report necessitates less intensive sample preparation than that required for TEM and provides a much larger field of view and an easily interpretable contrast compared to the transmission techniques. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.
Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2017-02-16
The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Experiments with Coler magnetic current apparatus
Ludwig, T.
Experiments with a replica of the famous Coler "Magnetstromapparat" (magnetic current apparatus) were conducted. The replica was built at the same institute at the Technical University of Berlin where the original was tested by Prof. Kloss in 1925. The details of the setup will be presented in this paper. The investigation of the Coler device was done with modern methods. The output was measured with a digital multi meter (DMM) and a digital storage oscilloscope (DSO). The results of the measurements will be presented. Did Coler convert vacuum fluctuations via magnetic, electric and acoustic resonance into electricity? There is a strong connection between magnetism and quantum field radiation energy. The magnetic moment of the electron is in part an energy exchange with the radiation field. The energy output of the Coler apparatus is measured. Furthermore the dynamics of the ferromagnetic magnets that Coler reported as the working principle of his device was investigated with magnetic force microscopy (MFM) and the spectroscopy mode of an atomic force microscope (AFM). The magnetic and acoustic resonance was investigated with magnetic force microscopy (MFM). The connection between ZPE and magnetism will be discussed as well as the perspective of using magnetic systems as a means to convert vacuum fluctuations into usable electricity.
DEFF Research Database (Denmark)
Zhang, Jingdong; Kuznetsov, A.M.; Ulstrup, Jens
2003-01-01
Theories of in situ scanning tunnelling microscopy (STM) of molecules with redox levels near the substrate and tip Fermi levels point to 'spectroscopic' current-overpotential features. Prominent features require a narrow 'probing tip', i.e. a small bias voltage, eV(bias), compared...... a broad tunnelling current-overpotential range at a constant (large) bias voltage of +0.2 V. The current is found to be constant over a 0.25 V overpotential range, which covers roughly the range where the oxidised and reduced redox levels are located within the energy tip. STM contrast and apparent...... of previous theoretical work on in situ STM of redox molecules, to large bias voltages, \\eV(bias)\\ > E-r. Large bias voltages give tunnelling contrasts independent of the overpotential over a broad range, as both the oxidised and reduced redox levels are located within the 'energy tip' between the substrate...
International Nuclear Information System (INIS)
Wakalopulos, G.
1976-01-01
In the disclosed electron gun positive ions generated by a hollow cathode plasma discharge in a first chamber are accelerated through control and shield grids into a second chamber containing a high voltage cold cathode. These positive ions bombard a surface of the cathode causing the cathode to emit secondary electrons which form an electron beam having a distribution adjacent to the cathode emissive surface substantially the same as the distribution of the ion beam impinging upon the cathode. After passing through the grids and the plasma discharge chamber, the electron beam exits from the electron gun via a foil window. Control of the generated electron beam is achieved by applying a relatively low control voltage between the control grid and the electron gun housing (which resides at ground potential) to control the density of the positive ions bombarding the cathode
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
Multichannel Thomson scattering apparatus
International Nuclear Information System (INIS)
Bretz, N.; Dimock, D.; Foote, V.; Johnson, D.; Long, D.; Tolnas, E.
1977-07-01
A Thomson scattering apparatus for measuring the electron temperature and density along a 90 cm diameter of the PLT plasma has been built. A wide angle objective images the 3 mm x 900 mm ruby laser beam onto an image dissector which rearranges the 300 : 1 image to 20 : 1 forming the input slit of a spectrometer. The stigmatic spectrometer provides 20 wavelength elements of approximately 70 A each. A micro-channel-plate image intensifier optically coupled to a cooled SIT tube provides detection with single frame linearity and 1000 : 1 dynamic range. Spatial profiles of N/sub e/ and T/sub e/ in the range 10 13 - 10 14 cm -3 and 0.05 - 3 keV have an accuracy of 30 √10 13 /N/sub e/ (cm -3 ) percent per 1.2 cm element
Electron refrigeration in hybrid structures with spin-split superconductors
Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.
2018-01-01
Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.
Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics
Directory of Open Access Journals (Sweden)
Yuji Isshiki
2018-02-01
Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.
Electron beam effects in auger electron spectroscopy and scanning electron microscopy
International Nuclear Information System (INIS)
Fontaine, J.M.; Duraud, J.P.; Le Gressus, C.
1979-01-01
Electron beam effects on Si(100) and 5% Fe/Cr alloy samples have been studied by measurements of the secondary electron yield delta, determination of the surface composition by Auger electron spectroscopy and imaging with scanning electron microscopy. Variations of delta as a function of the accelerating voltage Esub(p) (0.5 -9 Torr has no effect on technological samples covered with their reaction layers; the sensitivities to the beam depend rather on the earlier mechanical, thermal and chemical treatment of the surfaces. (author)
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
International Nuclear Information System (INIS)
Tomita, Chuji.
1980-01-01
A principal object of the present invention is to provide an X-ray apparatus which is such that the distance between the surface of the patient's table and the floor on which the apparatus is installed is sufficiently small in the horizontal position of the patient's table of the roentgenographical pedestal and that the rotation of the pedestal from the horizontal position to a tilted position and further to the vertical position of the table can be carried out smoothly. (auth)
Nuclear core baffling apparatus
International Nuclear Information System (INIS)
Cooper, F.W. Jr.; Silverblatt, B.L.; Knight, C.B.; Berringer, R.T.
1979-01-01
An apparatus for baffling the flow of reactor coolant fluid into and about the core of a nuclear reactor is described. The apparatus includes a plurality of longitudinally aligned baffle plates with mating surfaces that allow longitudinal growth with temperature increases while alleviating both leakage through the aligned plates and stresses on the components supporting the plates
Energy Technology Data Exchange (ETDEWEB)
Meng, Xing, E-mail: xmeng101@gmail.com
2017-02-15
Estimation was made for visibility of phase contrast with varying extraction voltages. The resulting decay rates of visibility show that images with low image contrast from cryo EM will be seriously impacted with high extraction voltages. - Highlights: • Cryo EM • Phase contrast • Extraction votage.
Neutron generator tube ion source control apparatus
International Nuclear Information System (INIS)
Bridges, J.R.
1982-01-01
A pulsed neutron well logging system includes a neutron generator tube of the deuterium-tritium accelerator type and an ion source control apparatus providing extremely sharply time-defined neutron pulses. A low voltage control pulse supplied to an input by timing circuits turns a power FET on via a buffer-driver whereby a 2000 volt pulse is produced in the secondary of a pulse transformer and applied to the ion source of the tube. A rapid fall in this ion source control pulse is ensured by a quenching circuit wherein a one-shot responds to the falling edge of the control pulse and produces a 3 microsecond delay to compensate for the propagation delay. A second one-shot is triggered by the falling edge of the output of the first one-shot and gives an 8 microsecond pulse to turn on the power FET which, via an isolation transformer turns on a series-connected transistor to ground the secondary of the pulse transformer and the ion source. (author)
Directory of Open Access Journals (Sweden)
Hailian Li
2017-09-01
Full Text Available In order to realize a micro-mechanic performance test of biaxial tensile-bending-combined loading and solve the problem of incompatibility of test apparatus and observation apparatus, novel biaxial-combined tensile-bending micro-mechanical performance test apparatus was designed. The working principle and major functions of key constituent parts of test apparatus, including the servo drive unit, clamping unit and test system, were introduced. Based on the finite element method, biaxial tensile and tension-bending-combined mechanical performances of the test-piece were studied as guidance to learn the distribution of elastic deformation and plastic deformation of all sites of the test-piece and to better plan test regions. Finally, this test apparatus was used to conduct a biaxial tensile test under different pre-bending loading and a tensile test at different rates; the image of the fracture of the test-piece was acquired by a scanning electron microscope and analyzed. It was indicated that as the pre-bending force rises, the elastic deformation phase would gradually shorten and the slope of the elastic deformation phase curve would slightly rise so that a yield limit would appear ahead of time. Bending speed could exert a positive and beneficial influence on tensile strength but weaken fracture elongation. If bending speed is appropriately raised, more ideal anti-tensile strength could be obtained, but fracture elongation would decline.
International Nuclear Information System (INIS)
Matsuoka, Shingo; Nakamura, Hirone; Tamura, Takaaki; Fujii, Toshihiro.
1984-01-01
A flowing afterglow apparatus was constructed and the operation of the afterglow system including data analysis was tested by measuring the rate constants for the reactions N + + NO, N 2 + + NO, He + + N 2 , and SF 6 + e; the results were 5.8 x 10 -10 , 3.9 x 10 -10 , 1.20 x 10 -9 , and 2.1 x 10 -7 cm 3 s -1 respectively. In the measurements an extraction voltage for ion sampling was not applied to the nose cone in order not to introduce an electric field into the reaction region. A ''non-ambipolar'' model developed by us was used for the data analysis of the ion/molecule reactions. For the data analysis of the electron attachment, a typical curve fit mehtod to the product ion signal was used. However, no theoretical curves fit the experimental points. This disagreement is attributed to a change of the ion-sampling efficiency through the nose-cone aperture arising from a change of the electron-dominated plasma to a negative-ion-dominated plasma with an increasing flow rate of SF 6 . Nevertheless, the attachment rate could be determined by fitting the theoretical and experimantal curves in the limited region of the SF 6 flow rate where the negative-ion-dominated plasma is established at the sampling aperture. All the rate constants obtained here agree reasonably well with literature values. Next, errors in the positive ion/molecule reaction rate constants, which would occur if the diffusion coefficients of the ions and neutrals each have a + 10 % error were calculated for the flow model to be -0.4 and +1.2 % respectively, demonstrating that these parameters are not important in the analysis of data. This insensitivity explains why the nose-cone voltage applied in a typical flowing afterglow operation has not caused a significant error in the published rate constants although it disturbs the ion diffusive behavior. (author)
Experimental validation of prototype high voltage bushing
Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.
2017-08-01
Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.
Mitigation of voltage sags in the distribution system with dynamic voltage restorer
International Nuclear Information System (INIS)
Viglas, D.; Belan, A.
2012-01-01
Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)
Lam, N. Q.; Okamoto, P. R.
1984-05-01
The effects of defect-production rate gradients, caused by the radial nonuniformity in the electron flux distribution, on solute segregation and phase stability in alloy films undergoing high-voltage electron-microscope (HVEM) irradiation at high temperatures are assessed. Two-dimensional (axially symmetric) compositional redistributions were calculated, taking into account both axial and transverse radial defect fluxes. It was found that when highly focused beams were employed radiation-induced segregation consisted of two stages: dominant axial segregation at the film surfaces at short irradiation times and competitive radial segregation at longer times. The average alloy composition within the irradiated region could differ greatly from that irradiated with a uniform beam, because of the additional atom transport from or to the region surrounding the irradiated zone under the influence of radial fluxes. Damage-rate gradient effects must be taken into account when interpreting in-situ HVEM observations of segregation-induced phase instabilities. The theoretical predictions are compared with experimental observations of the temporal and spatial dependence of segregation-induced precipitation in thin films of Ni-Al, Ni-Ge and Ni-Si solid solutions.
DEFF Research Database (Denmark)
Vasquez, Juan Carlos; Guerrero, Josep M.; Savaghebi, Mehdi
2013-01-01
Power electronics based MicroGrids consist of a number of voltage source inverters (VSIs) operating in parallel. In this paper, the modeling, control design, and stability analysis of parallel connected three-phase VSIs are derived. The proposed voltage and current inner control loops and the mat......Power electronics based MicroGrids consist of a number of voltage source inverters (VSIs) operating in parallel. In this paper, the modeling, control design, and stability analysis of parallel connected three-phase VSIs are derived. The proposed voltage and current inner control loops...... control restores the frequency and amplitude deviations produced by the primary control. Also, a synchronization algorithm is presented in order to connect the MicroGrid to the grid. Experimental results are provided to validate the performance and robustness of the parallel VSI system control...
Energy Technology Data Exchange (ETDEWEB)
Saheed, M. Shuaib M.; Muti Mohamed, Norani; Arif Burhanudin, Zainal, E-mail: zainabh@petronas.com.my [Centre of Innovative Nanostructures and Nanodevices, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak (Malaysia)
2014-03-24
Ionization gas sensors using vertically aligned multi-wall carbon nanotubes (MWCNT) are demonstrated. The sharp tips of the nanotubes generate large non-uniform electric fields at relatively low applied voltage. The enhancement of the electric field results in field emission of electrons that dominates the breakdown mechanism in gas sensor with gap spacing below 14 μm. More than 90% reduction in breakdown voltage is observed for sensors with MWCNT and 7 μm gap spacing. Transition of breakdown mechanism, dominated by avalanche electrons to field emission electrons, as decreasing gap spacing is also observed and discussed.
Voltage Balance of Separate DC Capacitors for CSAPF
Czech Academy of Sciences Publication Activity Database
You, X.; Geng, W.; Valouch, Viktor
2005-01-01
Roč. 50, č. 1 (2005), s. 23-33 ISSN 0001-7043 R&D Projects: GA AV ČR(CZ) IAA2057301 Institutional research plan: CEZ:AV0Z20570509 Keywords : cascade shunt active filter * voltage balance * control strategy Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering
Energy Technology Data Exchange (ETDEWEB)
Jou, S.Y.; Hung, C.T.; Chiu, Y.M.; Wu, J.S. [Department of Mechanical Engineering, National Chiao Tung University, Hsinchu (China); Wei, B.Y. [High-Efficiency Gas Discharge Lamps Group, Material and Chemical Research Laboratories, Hsinchu (China)
2011-12-15
Enhancement of vacuum UV emission (172 nm VUV) from a coaxial xenon excimer UV lamp (EUV) driven by distorted 50 kHz bipolar square voltages, as compared to that by sinusoidal voltages, is investigated numerically in this paper. A self-consistent radial one-dimensional fluid model, taking into consideration non-local electron energy balance, is employed to simulate the discharge physics and chemistry. The discharge is divided into two three-period portions; these include: the pre-discharge, the discharge (most intense at 172 nm VUV emission) and the post-discharge periods. The results show that the efficiency of VUV emission using the distorted bipolar square voltages is much greater than when using sinusoidal voltages; this is attributed to two major mechanisms. The first is the much larger rate of change of the voltage in bipolar square voltages, in which only the electrons can efficiently absorb the power in a very short period of time. Energetic electrons then generate a higher concentration of metastable (and also excited dimer) xenon that is distributed more uniformly across the gap, for a longer period of time during the discharge process. The second is the comparably smaller amount of ''wasted'' power deposition by Xe{sup +}{sub 2} in the post-discharge period, as driven by distorted bipolar square voltages, because of the nearly vanishing gap voltage caused by the shielding effect resulting from accumulated charges on both dielectric surfaces (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Radioactive waste material melter apparatus
Newman, D.F.; Ross, W.A.
1990-04-24
An apparatus for preparing metallic radioactive waste material for storage is disclosed. The radioactive waste material is placed in a radiation shielded enclosure. The waste material is then melted with a plasma torch and cast into a plurality of successive horizontal layers in a mold to form a radioactive ingot in the shape of a spent nuclear fuel rod storage canister. The apparatus comprises a radiation shielded enclosure having an opening adapted for receiving a conventional transfer cask within which radioactive waste material is transferred to the apparatus. A plasma torch is mounted within the enclosure. A mold is also received within the enclosure for receiving the melted waste material and cooling it to form an ingot. The enclosure is preferably constructed in at least two parts to enable easy transport of the apparatus from one nuclear site to another. 8 figs.
Radioactive waste material melter apparatus
International Nuclear Information System (INIS)
Newman, D.F.; Ross, W.A.
1990-01-01
An apparatus for preparing metallic radioactive waste material for storage is disclosed. The radioactive waste material is placed in a radiation shielded enclosure. The waste material is then melted with a plasma torch and cast into a plurality of successive horizontal layers in a mold to form a radioactive ingot in the shape of a spent nuclear fuel rod storage canister. The apparatus comprises a radiation shielded enclosure having an opening adapted for receiving a conventional transfer cask within which radioactive waste material is transferred to the apparatus. A plasma torch is mounted within the enclosure. A mold is also received within the enclosure for receiving the melted waste material and cooling it to form an ingot. The enclosure is preferably constructed in at least two parts to enable easy transport of the apparatus from one nuclear site to another. 8 figs
2005-01-01
A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional
Parallel operation of voltage-source converters: issues and applications
Energy Technology Data Exchange (ETDEWEB)
Almeida, F.C.B.; Silva, D.S. [Federal University of Juiz de Fora (UFJF), MG (Brazil)], Emails: felipe.brum@engenharia.ufjf.br, salomaoime@yahoo.com.br; Ribeiro, P.F. [Calvin College, Grand Rapids, MI (United States); Federal University of Juiz de Fora (UFJF), MG (Brazil)], E-mail: pfribeiro@ieee.org
2009-07-01
Technological advancements in power electronics have prompted the development of advanced AC/DC conversion systems with high efficiency and flexible performance. Among these devices, the Voltage-Source Converter (VSC) has become an essential building block. This paper considers the parallel operation of VSCs under different system conditions and how they can assist the operation of highly complex power networks. A multi-terminal VSC-based High Voltage Direct Current (M-VSC-HVDC) system is chosen to be modeled, simulated and then analyzed as an example of VSCs operating in parallel. (author)
High voltage switch triggered by a laser-photocathode subsystem
Chen, Ping; Lundquist, Martin L.; Yu, David U. L.
2013-01-08
A spark gap switch for controlling the output of a high voltage pulse from a high voltage source, for example, a capacitor bank or a pulse forming network, to an external load such as a high gradient electron gun, laser, pulsed power accelerator or wide band radar. The combination of a UV laser and a high vacuum quartz cell, in which a photocathode and an anode are installed, is utilized as triggering devices to switch the spark gap from a non-conducting state to a conducting state with low delay and low jitter.
Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories
Energy Technology Data Exchange (ETDEWEB)
Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)
2016-07-11
High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.
Impacts on the Voltage Profile of DC Distribution Network with DG Access
Tu, J. J.; Yin, Z. D.
2017-07-01
With the development of electronic, more and more distributed generations (DGs) access into grid and cause the research fever of direct current (DC) distribution network. Considering distributed generation (DG) location and capacity have great impacts on voltage profile, so use IEEE9 and IEEE33 typical circuit as examples, with DGs access in centralized and decentralized mode, to compare voltage profile in alternating and direct current (AC/DC) distribution network. Introducing the voltage change ratio as an evaluation index, so gets the general results on voltage profile of DC distributed network with DG access. Simulation shows that, in the premise of reasonable location and capacity, DC distribution network is more suitable for DG access.
Fractionation and rectification apparatus
Energy Technology Data Exchange (ETDEWEB)
Sauerwald, A
1932-05-25
Fractionation and rectifying apparatus with a distillation vessel and a stirring tube, drainage tubes leading from its coils to a central collecting tube, the drainage tubes being somewhat parallel and attached to the outer half of the stirring tube and partly on the inner half of the central collecting tube, whereby distillation and rectification can be effected in a single apparatus.
10-channel neutral particle energy analyser apparatus and its application to tokamak plasmas
International Nuclear Information System (INIS)
Takeuchi, Hiroshi; Funahashi, Akimasa; Takahashi, Koki; Shirakata, Hirofumi; Yano, Syukuro.
1976-07-01
A 10-channel neutral particle energy analyser apparatus for measurement of charge-exchange fast atoms emitted from a hot tokamak plasma has been constructed to determine the ion temperature of plasma from fewer discharge shots and to improve the accuracy of measurement. It consists of a 45-degrees parallel plate electrostatic analyser with ten ion detectors (Ceratron multipliers), a charge stripping cell, a dry vacuum pumping system and pulse-counting circuits for data acquisition. A calibration experiment of the apparatus is made for the particle energy and the energy resolution with electron beams of 100 to 1000 eV. The transmission efficiency of particles in the energy analyser is measured with proton beams of 1, 2 and 3 keV, and the conversion efficiency for H 2 gas in a charge stripping cell is also determined with hydrogen-atom beams of 2, 3 and 4 keV. Ion temperatures of JFT-2a and JFT-2 devices were measured with this apparatus, in order to check the usefulness and reliability of the apparatus and to investigate the parameter dependence of ion temperatures. It is found that an ion temperature can be measured with sufficient accuracy from six plasma shots (three shots to determine particle signals and three shots to determine background noises). The peak ion temperatures 80 to 400 eV are about (1/2 - 1/3) of the central electron temperatures. Dependence of the ion temperatures on plasma current I sub(p), toroidal magnetic field B sub(t) and average electron density anti n sub(e) is investigated for I sub(p) = 15 to 170 kAmp, B sub(t) = 10 to 18 kGauss and anti n sub(e) = (0.8 to 1.8) x 10 13 cm -3 on JFT-2a and JFT-2 devices. It is shown that the ion temperatures are in good agreement with the scaling law by Artsimovich Tsub(i) proportional to (Isub(p)Bsub(t) anti n sub(e)R 2 )sup(1/3), with R as the major radius of a tokamak device. (J.P.N.)
Contribution to high voltage matrix switches reliability
International Nuclear Information System (INIS)
Lausenaz, Yvan
2000-01-01
Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr
High-voltage pixel sensors for ATLAS upgrade
Energy Technology Data Exchange (ETDEWEB)
Perić, I., E-mail: ivan.peric@ziti.uni-heidelberg.de [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Kreidl, C.; Fischer, P. [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Bompard, F.; Breugnon, P.; Clemens, J.-C.; Fougeron, D.; Liu, J.; Pangaud, P.; Rozanov, A.; Barbero, M. [CPPM, Marseille (France); Feigl, S.; Capeans, M.; Ferrere, D.; Pernegger, H.; Ristic, B. [CERN, Geneve (Switzerland); Muenstermann, D.; Gonzalez Sevilla, S.; La Rosa, A.; Miucci, A. [University of Geneve (Switzerland); and others
2014-11-21
The high-voltage (HV-) CMOS pixel sensors offer several good properties: a fast charge collection by drift, the possibility to implement relatively complex CMOS in-pixel electronics and the compatibility with commercial processes. The sensor element is a deep n-well diode in a p-type substrate. The n-well contains CMOS pixel electronics. The main charge collection mechanism is drift in a shallow, high field region, which leads to a fast charge collection and a high radiation tolerance. We are currently evaluating the use of the high-voltage detectors implemented in 180 nm HV-CMOS technology for the high-luminosity ATLAS upgrade. Our approach is replacing the existing pixel and strip sensors with the CMOS sensors while keeping the presently used readout ASICs. By intelligence we mean the ability of the sensor to recognize a particle hit and generate the address information. In this way we could benefit from the advantages of the HV sensor technology such as lower cost, lower mass, lower operating voltage, smaller pitch, smaller clusters at high incidence angles. Additionally we expect to achieve a radiation hardness necessary for ATLAS upgrade. In order to test the concept, we have designed two HV-CMOS prototypes that can be readout in two ways: using pixel and strip readout chips. In the case of the pixel readout, the connection between HV-CMOS sensor and the readout ASIC can be established capacitively.
Electron microscopy of boron carbide before and after electron irradiation
International Nuclear Information System (INIS)
Stoto, T.; Zuppiroli, L.; Beauvy, M.; Athanassiadis, T.
1984-06-01
The microstructure of boron carbide has been studied by electron microscopy and related to the composition of the material. After electron irradiations in an usual transmission electron microscope and in a high voltage electron microscope at different temperatures and fluxes no change of these microstructures have been observed but a sputtering of the surface of the samples, which has been studied quantitatively [fr
System for high-voltage control detectors with large number photomultipliers
International Nuclear Information System (INIS)
Donskov, S.V.; Kachanov, V.A.; Mikhajlov, Yu.V.
1985-01-01
A simple and inexpensive on-line system for hihg-voltage control which is designed for detectors with a large number of photomultipliers is developed and manufactured. It has been developed for the GAMC type hodoscopic electromagnetic calorimeters, comprising up to 4 thousand photomultipliers. High voltage variation is performed by a high-speed potentiometer which is rotated by a microengine. Block-diagrams of computer control electronics are presented. The high-voltage control system has been used for five years in the IHEP and CERN accelerator experiments. The operation experience has shown that it is quite simple and convenient in operation. In case of about 6 thousand controlled channels in both experiments no potentiometer and microengines failures were observed
42 CFR 84.74 - Apparatus containers; minimum requirements.
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Apparatus containers; minimum requirements. 84.74...-Contained Breathing Apparatus § 84.74 Apparatus containers; minimum requirements. (a) Apparatus may be equipped with a substantial, durable container bearing markings which show the applicant's name, the type...
PLL strategies of grid connected converters under distorted input voltages
Czech Academy of Sciences Publication Activity Database
Šimek, Petr; Škramlík, Jiří; Valouch, Viktor
2014-01-01
Roč. 59, č. 1 (2014), s. 1-12 ISSN 0001-7043 Institutional support: RVO:61388998 Keywords : voltage source converter * grid - connected applications * phase locked loop Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering
Induced over voltage test on transformers using enhanced Z-source inverter based circuit
Peter, Geno; Sherine, Anli
2017-09-01
The normal life of a transformer is well above 25 years. The economical operation of the distribution system has its roots in the equipments being used. The economy being such, that it is financially advantageous to replace transformers with more than 15 years of service in the second perennial market. Testing of transformer is required, as its an indication of the extent to which a transformer can comply with the customers specified requirements and the respective standards (IEC 60076-3). In this paper, induced over voltage testing on transformers using enhanced Z source inverter is discussed. Power electronic circuits are now essential for a whole array of industrial electronic products. The bulky motor generator set, which is used to generate the required frequency to conduct the induced over voltage testing of transformers is nowadays replaced by static frequency converter. First conventional Z-source inverter, and second an enhanced Z source inverter is being used to generate the required voltage and frequency to test the transformer for induced over voltage test, and its characteristics is analysed.
Research on lightning stroke model and characteristics of electronic transformer
Directory of Open Access Journals (Sweden)
Li Mu
2018-01-01
Full Text Available In order to improve the reliability of power supply, a large number of electronic voltage and current transformers are used in digital substations. In this paper, the mathematical model of the electronic transformer is analyzed firstly, and its circuit model is given. According to the difference of working characteristics between voltage transformer and current transformer, the circuit model of voltage type electronic transformer and current type electronic transformer is given respectively. By analyzing their broadband transmission characteristics, the accuracy of the model is verified, and their lightning analysis models are obtained.
Bureau of Naval Personnel, Washington, DC.
This module covers the relationships between current and voltage; resistance in a series circuit; how to determine the values of current, voltage, resistance, and power in resistive series circuits; the effects of source internal resistance; and an introduction to the troubleshooting of series circuits. This module is divided into five lessons:…
Energy Technology Data Exchange (ETDEWEB)
Cooperstein, G; Mosher, D; Stephanakis, S J; Weber, B V; Young, F C [Naval Research Laboratory, Washington, DC (United States); Swanekamp, S B [JAYCOR, Vienna, VA (United States)
1997-12-31
Backscattered electrons from anodes with high-atomic-number substrates cause early-time anode-plasma formation from the surface layer leading to faster, more intense electron beam pinching, and lower diode impedance. A simple derivation of Child-Langmuir current from a thin hollow cathode shows the same dependence on the diode aspect ratio as critical current. Using this fact, it is shown that the diode voltage and current follow relativistic Child-Langmuir theory until the anode plasma is formed, and then follows critical current after the beam pinches. With thin hollow cathodes, electron beam pinching can be suppressed at low voltages (< 800 kV) even for high currents and high-atomic-number anodes. Electron beam pinching can also be suppressed at high voltages for low-atomic-number anodes as long as the electron current densities remain below the plasma turn-on threshold. (author). 8 figs., 2 refs.
iDEEAA: A novel, versatile apparatus for electron spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Lupulescu, C., E-mail: cosmin.lupulescu@helmholtz-berlin.de [Technische Universität Berlin, Institut für Optik und Atomare Physik, Straße des 17. Juni 135, 10623 Berlin (Germany); Arion, T. [Centre for Free-Electron Laser Science (DESY), Notkestrasse 85, 22607 Hamburg (Germany); Institut für Experimentalphysik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Hergenhahn, U. [Max-Planck-Institut für Plasmaphysik, EURATOM Association, Teilinstitut Greifswald, Wendelsteinstr. 1, 17491 Greifswald (Germany); Ovsyannikov, R. [Helmholtz-Zentrum Berlin, Albert-Einstein-Str. 15, 12489 Berlin (Germany); Förstel, M. [Max-Planck-Institut für Plasmaphysik, EURATOM Association, Teilinstitut Greifswald, Wendelsteinstr. 1, 17491 Greifswald (Germany); Gavrila, G. [Technische Universität Chemnitz, Fakultät Elektrotechnik und Informationstechnik, Reichenhainer Str. 70, 09126 Chemnitz (Germany); Eberhardt, W. [Technische Universität Berlin, Institut für Optik und Atomare Physik, Straße des 17. Juni 135, 10623 Berlin (Germany); Centre for Free-Electron Laser Science (DESY), Notkestrasse 85, 22607 Hamburg (Germany)
2013-12-15
Highlights: •We developed an experimental end station for time- and angle-resolved X-ray electron spectroscopy. •The instrument can operate in combination with synchrotron radiation, VUV Helium discharge source or table-top high-harmonic laser sources. •Band mapping in solids is possible with unprecedented rapidity. •Electron–electron coincidence spectroscopy is performed at higher data collection rate (due to improved transmission) and with improved energy resolution. -- Abstract: We report the development and present status of the iDEEAA (Instrument for Direct Electron Energy and Angular Analysis) experimental end station for time- and angle-resolved X-ray photoelectron spectroscopy. The setup is based on multidimensional detection of photoelectrons by means of both time-of-flight (TOF) and/or electrostatic analyzers. The instrument offers the possibility to record simultaneously and independently photoelectron and Auger electron spectra. Samples can be either gases or solids. The system can operate with multiple photon sources, such as laboratory-based table-top laser extreme ultraviolet (EUV) sources, monochromatic Helium discharge lamp and soft X-ray synchrotron pulses. We demonstrate the performance of the setup by carrying out electron–electron coincidence experiments on CH{sub 4} and by mapping the band structure of Bi{sub 2}Se{sub 3} using photons of the BESSY II electron storage ring.
Chief of Naval Education and Training Support, Pensacola, FL.
This individualized learning module on the relationships of current, voltage, and resistance is one in a series of modules for a course in basic electricity and electronics. The course is one of a number of military-developed curriculum packages selected for adaptaticn to vocational instructional and curriculum development in a civilian setting.…