WorldWideScience

Sample records for voltage dependent potassium

  1. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  2. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  3. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  4. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  5. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation.

    Science.gov (United States)

    Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L

    1993-03-01

    The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

  6. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  7. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  8. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  9. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  10. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  11. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  14. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  15. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes

    2018-05-01

    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  16. Inhibition of large conductance calcium-dependent potassium ...

    African Journals Online (AJOL)

    conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

  17. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  18. Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle

    Science.gov (United States)

    Morad, M.; Reeck, S.; Rao, M.

    1981-01-01

    In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.

  19. Functional diversity of potassium channel voltage-sensing domains.

    Science.gov (United States)

    Islas, León D

    2016-01-01

    Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.

  20. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  1. Mechanism of electromechanical coupling in voltage-gated potassium channels

    Directory of Open Access Journals (Sweden)

    Rikard eBlunck

    2012-09-01

    Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

  2. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  3. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  4. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  5. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  6. Sleep disturbances in voltage-gated potassium channel antibody syndrome.

    Science.gov (United States)

    Barone, Daniel A; Krieger, Ana C

    2016-05-01

    Voltage-gated potassium channels (VGKCs) are a family of membrane proteins responsible for controlling cell membrane potential. The presence of antibodies (Ab) against neuronal VGKC complexes aids in the diagnosis of idiopathic and paraneoplastic autoimmune neurologic disorders. The diagnosis of VGKC Ab-associated encephalopathy (VCKC Ab syndrome) should be suspected in patients with subacute onset of disorientation, confusion, and memory loss in the presence of seizures or a movement disorder. VGKC Ab syndrome may present with sleep-related symptoms, and the purpose of this communication is to alert sleep and neurology clinicians of this still-under-recognized condition. In this case, we are presenting the VGKC Ab syndrome which improved after treatment with solumedrol. The prompt recognition and treatment of this condition may prevent the morbidity associated with cerebral atrophy and the mortality associated with intractable seizures and electrolyte disturbances. Copyright © 2016. Published by Elsevier B.V.

  7. Hydrogen bonds as molecular timers for slow inactivation in voltage-gated potassium channels

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

    2013-01-01

    Voltage-gated potassium (Kv) channels enable potassium efflux and membrane repolarization in excitable tissues. Many Kv channels undergo a progressive loss of ion conductance in the presence of a prolonged voltage stimulus, termed slow inactivation, but the atomic determinants that regulate the k...... subunit(s). DOI: http://dx.doi.org/10.7554/eLife.01289.001....

  8. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  9. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  10. The voltage-gated potassium channel subunit, Kv1.3, is expressed in epithelia

    DEFF Research Database (Denmark)

    Grunnet, Morten; Rasmussen, Hanne B; Hay-Schmidt, Anders

    2003-01-01

    The Shaker-type voltage-gated potassium channel, Kv1.3, is believed to be restricted in distribution to lymphocytes and neurons. In lymphocytes, this channel has gained intense attention since it has been proven that inhibition of Kv1.3 channels compromise T lymphocyte activation. To investigate...

  11. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  12. The cooperative voltage sensor motion that gates a potassium channel.

    Science.gov (United States)

    Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

    2005-01-01

    The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

  13. Voltage-Gated Potassium Channels: A Structural Examination of Selectivity and Gating

    Science.gov (United States)

    Kim, Dorothy M.; Nimigean, Crina M.

    2016-01-01

    Voltage-gated potassium channels play a fundamental role in the generation and propagation of the action potential. The discovery of these channels began with predictions made by early pioneers, and has culminated in their extensive functional and structural characterization by electrophysiological, spectroscopic, and crystallographic studies. With the aid of a variety of crystal structures of these channels, a highly detailed picture emerges of how the voltage-sensing domain reports changes in the membrane electric field and couples this to conformational changes in the activation gate. In addition, high-resolution structural and functional studies of K+ channel pores, such as KcsA and MthK, offer a comprehensive picture on how selectivity is achieved in K+ channels. Here, we illustrate the remarkable features of voltage-gated potassium channels and explain the mechanisms used by these machines with experimental data. PMID:27141052

  14. Neuronal trafficking of voltage-gated potassium channels

    DEFF Research Database (Denmark)

    Jensen, Camilla S; Rasmussen, Hanne Borger; Misonou, Hiroaki

    2011-01-01

    The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials is regul......The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials...

  15. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  16. Hyperpolarization moves S4 sensors inward to open MVP, a methanococcal voltage-gated potassium channel.

    Science.gov (United States)

    Sesti, Federico; Rajan, Sindhu; Gonzalez-Colaso, Rosana; Nikolaeva, Natalia; Goldstein, Steve A N

    2003-04-01

    MVP, a Methanococcus jannaschii voltage-gated potassium channel, was cloned and shown to operate in eukaryotic and prokaryotic cells. Like pacemaker channels, MVP opens on hyperpolarization using S4 voltage sensors like those in classical channels activated by depolarization. The MVP S4 span resembles classical sensors in sequence, charge, topology and movement, traveling inward on hyperpolarization and outward on depolarization (via canaliculi in the protein that bring the extracellular and internal solutions into proximity across a short barrier). Thus, MVP opens with sensors inward indicating a reversal of S4 position and pore state compared to classical channels. Homologous channels in mammals and plants are expected to function similarly.

  17. Encephalitis due to antibodies to voltage gated potassium channel (VGKC with cerebellar involvement in a teenager

    Directory of Open Access Journals (Sweden)

    Megan M Langille

    2015-01-01

    Full Text Available Encephalitis due to antibodies to voltage gated potassium channel (VGKC typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

  18. Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis

    OpenAIRE

    Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L

    2017-01-01

    We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggress...

  19. Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies

    OpenAIRE

    Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick

    2017-01-01

    Objectives Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, ...

  20. Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager.

    Science.gov (United States)

    Langille, Megan M; Desai, Jay

    2015-01-01

    Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

  1. Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager

    OpenAIRE

    Langille, Megan M.; Desai, Jay

    2015-01-01

    Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum ...

  2. The role of voltage-gated potassium channels in the regulation of mouse uterine contractility

    Directory of Open Access Journals (Sweden)

    Abel Peter W

    2007-11-01

    Full Text Available Abstract Background Uterine smooth muscle cells exhibit ionic currents that appear to be important in the control of uterine contractility, but how these currents might produce the changes in contractile activity seen in pregnant myometrium has not been established. There are conflicting reports concerning the role of voltage-gated potassium (Kv channels and large-conductance, calcium-activated potassium (BK channels in the regulation of uterine contractility. In this study we provide molecular and functional evidence for a role for Kv channels in the regulation of spontaneous contractile activity in mouse myometrium, and also demonstrate a change in Kv channel regulation of contractility in pregnant mouse myometrium. Methods Functional assays which evaluated the effects of channel blockers and various contractile agonists were accomplished by quantifying contractility of isolated uterine smooth muscle obtained from nonpregnant mice as well as mice at various stages of pregnancy. Expression of Kv channel proteins in isolated uterine smooth muscle was evaluated by Western blots. Results The Kv channel blocker 4-aminopyridine (4-AP caused contractions in nonpregnant mouse myometrium (EC50 = 54 micromolar, maximal effect at 300 micromolar but this effect disappeared in pregnant mice; similarly, the Kv4.2/Kv4.3 blocker phrixotoxin-2 caused contractions in nonpregnant, but not pregnant, myometrium. Contractile responses to 4-AP were not dependent upon nerves, as neither tetrodotoxin nor storage of tissues at room temperature significantly altered these responses, nor were responses dependent upon the presence of the endometrium. Spontaneous contractions and contractions in response to 4-AP did not appear to be mediated by BK, as the BK channel-selective blockers iberiotoxin, verruculogen, or tetraethylammonium failed to affect either spontaneous contractions or 4-AP-elicited responses. A number of different Kv channel alpha subunit proteins were

  3. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  4. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  5. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  6. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  7. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  8. Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-23

    Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

  9. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

    Science.gov (United States)

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

    2013-03-01

    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  10. The Molecular Basis of Polyunsaturated Fatty Acid Interactions with the Shaker Voltage-Gated Potassium Channel.

    Directory of Open Access Journals (Sweden)

    Samira Yazdi

    2016-01-01

    Full Text Available Voltage-gated potassium (KV channels are membrane proteins that respond to changes in membrane potential by enabling K+ ion flux across the membrane. Polyunsaturated fatty acids (PUFAs induce channel opening by modulating the voltage-sensitivity, which can provide effective treatment against refractory epilepsy by means of a ketogenic diet. While PUFAs have been reported to influence the gating mechanism by electrostatic interactions to the voltage-sensor domain (VSD, the exact PUFA-protein interactions are still elusive. In this study, we report on the interactions between the Shaker KV channel in open and closed states and a PUFA-enriched lipid bilayer using microsecond molecular dynamics simulations. We determined a putative PUFA binding site in the open state of the channel located at the protein-lipid interface in the vicinity of the extracellular halves of the S3 and S4 helices of the VSD. In particular, the lipophilic PUFA tail covered a wide range of non-specific hydrophobic interactions in the hydrophobic central core of the protein-lipid interface, while the carboxylic head group displayed more specific interactions to polar/charged residues at the extracellular regions of the S3 and S4 helices, encompassing the S3-S4 linker. Moreover, by studying the interactions between saturated fatty acids (SFA and the Shaker KV channel, our study confirmed an increased conformational flexibility in the polyunsaturated carbon tails compared to saturated carbon chains, which may explain the specificity of PUFA action on channel proteins.

  11. High Grade Glioma Mimicking Voltage Gated Potassium Channel Complex Associated Antibody Limbic Encephalitis

    Directory of Open Access Journals (Sweden)

    Dilan Athauda

    2014-01-01

    Full Text Available Though raised titres of voltage gated potassium channel (VGKC complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE. This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

  12. High grade glioma mimicking voltage gated potassium channel complex associated antibody limbic encephalitis.

    Science.gov (United States)

    Athauda, Dilan; Delamont, R S; Pablo-Fernandez, E De

    2014-01-01

    Though raised titres of voltage gated potassium channel (VGKC) complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE). This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

  13. Presence of voltage-gated potassium channel complex antibody in a case of genetic prion disease.

    Science.gov (United States)

    Jammoul, Adham; Lederman, Richard J; Tavee, Jinny; Li, Yuebing

    2014-06-05

    Voltage-gated potassium channel (VGKC) complex antibody-mediated encephalitis is a recently recognised entity which has been reported to mimic the clinical presentation of Creutzfeldt-Jakob disease (CJD). Testing for the presence of this neuronal surface autoantibody in patients presenting with subacute encephalopathy is therefore crucial as it may both revoke the bleak diagnosis of prion disease and allow institution of potentially life-saving immunotherapy. Tempering this optimistic view is the rare instance when a positive VGKC complex antibody titre occurs in a definite case of prion disease. We present a pathologically and genetically confirmed case of CJD with elevated serum VGKC complex antibody titres. This case highlights the importance of interpreting the result of a positive VGKC complex antibody with caution and in the context of the overall clinical manifestation. 2014 BMJ Publishing Group Ltd.

  14. Reversible Dementia: Two Nursing Home Patients With Voltage-Gated Potassium Channel Antibody-Associated Limbic Encephalitis

    NARCIS (Netherlands)

    Reintjes, W.; Romijn, M.D.M.; den Hollander, D.; ter Bruggen, J.P.; van Marum, R.J.

    2015-01-01

    Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable

  15. Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

    Science.gov (United States)

    Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

    2008-01-01

    In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

  16. Voltage-gated potassium channel-complex autoimmunity and associated clinical syndromes.

    Science.gov (United States)

    Irani, Sarosh R; Vincent, Angela

    2016-01-01

    Voltage-gated potassium channel (VGKC)-complex antibodies are defined by the radioimmunoprecipitation of Kv1 potassium channel subunits from brain tissue extracts and were initially discovered in patients with peripheral nerve hyperexcitability (PNH). Subsequently, they were found in patients with PNH plus psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) with prominent amnesia and frequent seizures. Most recently, they have been described in patients with pure epilepsies, especially in patients with the novel and distinctive semiology termed faciobrachial dystonic seizures (FBDS). In each of these conditions, there is a close correlation between clinical measures and antibody levels. The VGKC-complex is a group of proteins that are strongly associated in situ and after extraction in mild detergent. Two major targets of the autoantibodies are leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein 2 (CASPR2). The patients with PNH or MoS are most likely to have CASPR2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. Crucially, each of these conditions has a good response to immunotherapies, often corticosteroids and plasma exchange, although optimal regimes require further study. VGKC-complex antibodies have also been described in neuropathic pain syndromes, chronic epilepsies, a polyradiculopathy in porcine abattoir workers, and some children with status epilepticus. Increasingly, however, the antigenic targets in these patients are not defined and in some cases the antibodies may be secondary rather than the primary cause. Future serologic studies should define all the antigenic components of the VGKC-complex, and further inform mechanisms of antibody pathogenicity and related inflammation. © 2016 Elsevier B.V. All rights reserved.

  17. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu

    2010-01-01

    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  18. Antibodies to voltage-gated potassium and calcium channels in epilepsy.

    Science.gov (United States)

    Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela

    2006-10-01

    To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.

  19. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Urbach, H.; Mader, I. [University Medical Center Freiburg, Department of Neuroradiology, Freiburg (Germany); Rauer, S.; Baumgartner, A. [University Medical Center Freiburg, Department of Neurology, Freiburg (Germany); Paus, S. [University Medical Center, Department of Neurology, Bonn (Germany); Wagner, J. [University Medical Center, Department of Epileptology, Bonn (Germany); Malter, M.P. [University of Cologne, Department of Neurology, Cologne (Germany); Pruess, H. [Charite - Universitaetsmedizin Berlin, Department of Neurology, Berlin (Germany); Lewerenz, J.; Kassubek, J. [Ulm University, Department of Neurology, Ulm (Germany); Hegen, H.; Auer, M.; Deisenhammer, F. [University Innsbruck, Department of Neurology, Innsbruck (Austria); Ufer, F. [University Medical Center, Department of Neurology, Hamburg (Germany); Bien, C.G. [Epilepsy Centre Bethel, Bielefeld-Bethel (Germany)

    2015-12-15

    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

  20. Afterdischarges following M waves in patients with voltage-gated potassium channels antibodies

    Directory of Open Access Journals (Sweden)

    Jingwen Niu

    Full Text Available Objective: To explore the correlation between afterdischarges in motor nerve conduction studies and clinical motor hyperexcitability in patients with voltage-gated potassium channels (VGKC antibodies. Methods: Six patients with positive serum antibodies to contactin-associated protein-like 2 (CASPR2 or/and leucine-rich glioma-inactivated protein 1 (LGI1 were recruited, including 5 with autoimmune encephalitis, and 1 with cramp-fasciculation syndrome. Electromyography (EMG, nerve conduction studies (NCS and F waves were performed, and afterdischarges were assessed. One patient was followed up. Results: Five patients had clinical evidence of peripheral motor nerve hyperexcitability (myokymia or cramp, and four of them had abnormal spontaneous firing in concentric needle electromyography (EMG. Prolonged afterdischarges following normal M waves were present in all six patients, including the two patients who had no EMG evidence of peripheral nerve hyperexcitability (PNH. Afterdischarges disappeared after treatment with intravenous immunoglobulin (IVIG. Conclusion: The afterdischarges in motor nerve conduction study might be a sensitive indicator of peripheral motor nerve hyperexcitability in patients with VGKC antibodies. Significance: Afterdischarges in motor nerve conduction study might be more sensitive than needle electromyography for detecting peripheral motor nerve hyperexcitability, and could disappear gradually in accordance with clinical improvement and reduction of antibodies. Keywords: Afterdischarges, VGKC, Autoimmune encephalitis, Peripheral nerve hyperexcitability, F wave, M wave

  1. Voltage-Gated Potassium Channel Antibody Paraneoplastic Limbic Encephalitis Associated with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Marion Alcantara

    2013-05-01

    Full Text Available Among paraneoplastic syndromes (PNS associated with malignant hemopathies, there are few reports of PNS of the central nervous system and most of them are associated with lymphomas. Limbic encephalitis is a rare neurological syndrome classically diagnosed in the context of PNS. We report the case of a 81-year-old man who presented with a relapsed acute myeloid leukemia (AML with minimal maturation. He was admitted for confusion with unfavorable evolution as he presented a rapidly progressive dementia resulting in death. A brain magnetic resonance imaging, performed 2 months after the onset, was considered normal. An electroencephalogram showed non-specific bilateral slow waves. We received the results of the blood screening of neuronal autoantibodies after the patient's death and detected the presence of anti-voltage-gated potassium channel (VGKC antibodies at 102 pmol/l (normal at <30 pmol/l. Other etiologic studies, including the screening for another cause of rapidly progressive dementia, were negative. To our knowledge, this is the first case of anti-VGKC paraneoplastic limbic encephalitis related to AML.

  2. Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis.

    Science.gov (United States)

    Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L

    2017-04-20

    We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggressive immunotherapy with methylprednisolone and plasmapheresis was started early in the course of his presentation. Following treatment with immunotherapy, the patient demonstrated clinical improvement. Repeat serum evaluation 4 months posthospitalisation remained seropositive for VGKC-complex antibodies, with development of LGI1 autoantibody seropositivity. VGKC-complex and LGI1 antibodies remained positive 12 months posthospitalisation. Our findings suggest that clinical symptoms can predate the detection of the antibody. We conclude that when suspicion for autoimmune encephalitis is high in the setting of VGKC autoantibody positivity, regardless of LGI1 or CASPR2 seropositivity, early immunotherapy and repeat testing should be considered. 2017 BMJ Publishing Group Ltd.

  3. The value of LGI1, Caspr2 and voltage-gated potassium channel antibodies in encephalitis.

    Science.gov (United States)

    van Sonderen, Agnes; Petit-Pedrol, Mar; Dalmau, Josep; Titulaer, Maarten J

    2017-05-01

    The discovery, in 2010, of autoantibodies against the extracellular proteins LGI1 and Caspr2 facilitated a change of view regarding the clinical importance of voltage-gated potassium channel (VGKC) antibodies. Currently, these antibodies are all classified as VGKC-complex antibodies, and are commonly considered to have a similar clinical value. However, studies from the past few years show that the immune responses mediated by these antibodies have differing clinical relevance. Here, we review the clinical importance of these immune responses in three settings: patients with anti-LGI1 antibodies, patients with anti-Caspr2 antibodies, and patients with antibodies against the VGKC complex that lack LGI1 and Caspr2 specificity. Antibodies against LGI1 and Caspr2 are associated with different but well-defined syndromes, whereas the clinical importance of VGKC-complex antibodies without LGI1 and Caspr2 specificity is questionable. We describe each of these syndromes, discuss the function of the target antigens and review the limited paediatric literature on the topic. The findings emphasize the importance of defining these disorders according to the molecular identity of the targets (LGI1 or Caspr2), and caution against the use of VGKC-complex antibodies for the diagnosis and treatment of patients without further definition of the antigen.

  4. Voltage-Gated Potassium Channel Antibodies in Slow-Progression Motor Neuron Disease.

    Science.gov (United States)

    Godani, Massimiliano; Zoccarato, Marco; Beronio, Alessandro; Zuliani, Luigi; Benedetti, Luana; Giometto, Bruno; Del Sette, Massimo; Raggio, Elisa; Baldi, Roberta; Vincent, Angela

    2017-01-01

    The spectrum of autoimmune neurological diseases associated with voltage-gated potassium channel (VGKC)-complex antibodies (Abs) ranges from peripheral nerve disorders to limbic encephalitis. Recently, low titers of VGKC-complex Abs have also been reported in neurodegenerative disorders, but their clinical relevance is unknown. The aim of the study was to explore the prevalence of VGKC-complex Abs in slow-progression motor neuron disease (MND). We compared 11 patients affected by slow-progression MND with 9 patients presenting typical progression illness. Sera were tested for VGKC-complex Abs by radioimmunoassay. The distribution of VGKC-complex Abs was analyzed with the Mann-Whitney U test. The statistical analysis showed a significant difference between the mean values in the study and control groups. A case with long-survival MND harboring VGKC-complex Abs and treated with intravenous immunoglobulins is described. Although VGKC-complex Abs are not likely to be pathogenic, these results could reflect the coexistence of an immunological activation in patients with slow disease progression. © 2016 S. Karger AG, Basel.

  5. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

    International Nuclear Information System (INIS)

    Urbach, H.; Mader, I.; Rauer, S.; Baumgartner, A.; Paus, S.; Wagner, J.; Malter, M.P.; Pruess, H.; Lewerenz, J.; Kassubek, J.; Hegen, H.; Auer, M.; Deisenhammer, F.; Ufer, F.; Bien, C.G.

    2015-01-01

    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

  6. [Voltage-Gated Potassium Channel-Complex Antibodies Associated Encephalopathy and Related Diseases].

    Science.gov (United States)

    Watanabe, Osamu

    2016-09-01

    Voltage-gated potassium channel (VGKC) complex antibodies are auto-antibodies, initially identified in acquired neuromyotonia (aNMT; Isaacs' syndrome), which cause muscle cramps and difficulty in opening the palm of the hands. Subsequently, these antibodies were found in patients presenting with aNMT along with psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) patient with prominent amnesia and frequent seizures. Typical LE cases have a distinctive adult-onset, frequent, brief dystonic seizure semiology that predominantly affects the arms and ipsilateral face. It has now been termed faciobrachial dystonic seizures (FBDS). The VGKC complex is a group of proteins that are strongly associated in situ and after extraction in the mild detergent digitonin. Recent studies indicated that the VGKC complex antibodies are mainly directed toward associated proteins (for example LGI1, Caspr2) that complex with VGKCs themselves. Patients with aNMT or MoS are most likely to have Caspr2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. We systematically identified and quantified autoantibodies in patient sera with VGKC-complex antibody associated encephalopathy and showed the relationship between individual antibodies and patient's symptoms. Furthermore, we revealed how autoantibodies disrupt the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, reducing the synaptic AMPA receptors.

  7. Clinical utility of seropositive voltage-gated potassium channel-complex antibody.

    Science.gov (United States)

    Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander; Li, Yuebing

    2016-10-01

    Antibodies against voltage-gated potassium channel (VGKC)-complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group ( p 0.25 nM) VGKC-complex antibody levels ( p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy.

  8. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis.

    Science.gov (United States)

    Urbach, H; Rauer, S; Mader, I; Paus, S; Wagner, J; Malter, M P; Prüss, H; Lewerenz, J; Kassubek, J; Hegen, H; Auer, M; Deisenhammer, F; Ufer, F; Bien, C G; Baumgartner, A

    2015-12-01

    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE.

  9. Clinical utility of seropositive voltage-gated potassium channel–complex antibody

    Science.gov (United States)

    Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander

    2016-01-01

    Abstract Background: Antibodies against voltage-gated potassium channel (VGKC)–complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. Methods: We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Results: Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group (p 0.25 nM) VGKC-complex antibody levels (p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy. PMID:27847683

  10. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

    OpenAIRE

    Cyrus S.H. Ho; Roger C.M. Ho; Amy M.L. Quek

    2018-01-01

    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic ence...

  11. Leucine-rich glioma inactivated-1 and voltage gated potassium channel autoimmune encephalitis associated with ischemic stroke; A Case Report

    Directory of Open Access Journals (Sweden)

    Marisa Patryce McGinley

    2016-05-01

    Full Text Available Autoimmune encephalitis is associated with a wide variety of antibodies and clinical presentations. Voltage gated potassium channel (VGKC antibodies are a cause of autoimmune non-paraneoplastic encephalitis characterized by memory impairment, psychiatric symptoms, and seizures. We present a case of VGKC encephalitis likely preceding an ischemic stroke. Reports of autoimmune encephalitis associated with ischemic stroke are rare. Several hypothesizes linking these two disease processes are proposed.

  12. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  13. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

    2016-01-01

    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  14. [Current Perspective on Voltage-gated Potassium Channel Complex Antibody Associated Diseases].

    Science.gov (United States)

    Watanabe, Osamu

    2018-04-01

    Voltage-gated potassium channel (VGKC) complex auto-antibodies were initially identified in Isaacs' syndrome (IS), which is characterized by muscle cramps and neuromyotonia. These antibodies were subsequently identified in patients with Morvan's syndrome (MoS), which includes IS in conjunction with psychosis, insomnia, and dysautonomia. The antibodies have also been detected in a patient with limbic encephalopathy (LE) presenting with prominent amnesia and frequent seizures. Typical cases of LE have adult-onset, with frequent, brief dystonic seizures that predominantly affect the arms and ipsilateral face, and has recently been termed faciobrachial dystonic seizures. Autoantibodies against the extracellular domains of VGKC complex proteins, leucine-rich glioma-inactivated 1 (LGI1), and contactin-associated protein-2 (Caspr2), occur in patients with IS, MoS, and LE. However, routine testing has detected VGKC complex antibodies without LGI1 or Caspr2 reactivities (double-negative) in patients with other diseases, such as Creutzfeldt-Jakob disease and amyotrophic lateral sclerosis. Furthermore, double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits. Therefore, these antibodies should no longer be classified as neuronal-surface antibodies and lacking pathogenic potential. Novel information has been generated regarding autoantibody disruption of the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, thereby reducing the synaptic AMPA receptors. It may be that the main action is on inhibitory neurons, explaining why the loss of AMPA receptors causes amnesia, neuronal excitability and seizures.

  15. Clinical relevance of voltage-gated potassium channel–complex antibodies in children.

    Science.gov (United States)

    Hacohen, Yael; Singh, Rahul; Rossi, Meghan; Lang, Bethan; Hemingway, Cheryl; Lim, Ming; Vincent, Angela

    2015-09-15

    To assess the clinical and immunologic findings in children with voltage-gated potassium channel (VGKC)-complex antibodies (Abs). Thirty-nine of 363 sera, referred from 2 pediatric centers from 2007 to 2013, had been reported positive (.100 pM) for VGKC-complex Abs. Medical records were reviewed retrospectively and the patients’ condition was independently classified as inflammatory (n 5 159) or noninflammatory (n 5 204). Positive sera (.100 pM) were tested/retested for the VGKC complex Ab–positive complex proteins LGI1 and CASPR2, screened for binding to live hippocampal neurons, and 12 high-titer sera (.400 pM) tested by radioimmunoassay for binding to VGKC Kv1 subunits with or without intracellular postsynaptic density proteins. VGKC-complex Abs were found in 39 children, including 20% of encephalopathies and 7.6% of other conditions (p 5 0.001). Thirty children had inflammatory conditions and 9 had noninflammatory etiologies but titers.400 pM (n512) were found only in inflammatory diseases (p , 0.0001). Four sera, including from 2 children with coexisting NMDA receptor Abs and one with Guillain-Barré syndrome and Abs to both LGI1 and CASPR2, bound to hippocampal neurons. None of the sera bound detectably to VGKC Kv1 subunits on live HEK cells, but 4 of 12 .400 pM sera immunoprecipitated VGKC Kv1 subunits, with or without postsynaptic densities, extracted from transfected cells. Positive VGKC-complex Abs cannot be taken to indicate a specific clinical syndrome in children, but appear to be a nonspecific biomarker of inflammatory neurologic diseases, particularly of encephalopathy. Some of the Abs may bind to intracellular epitopes on the VGKC subunits, or to the intracellular interacting proteins, but in many the targets remain undefined.

  16. Voltage-Gated Potassium Channel Autoimmunity Mimicking Creutzfeldt-Jakob Disease

    Science.gov (United States)

    Geschwind, Michael D.; Tan, K. Meng; Lennon, Vanda A.; Barajas, Ramon F.; Haman, Aissa; Klein, Christopher J.; Josephson, S. Andrew; Pittock, Sean J.

    2009-01-01

    Background Rapidly progressive dementia has a variety of causes, including Creutzfeldt-Jakob disease (CJD) and neuronal voltage-gated potassium channel (VGKC) autoantibody–associated encephalopathy. Objective To describe patients thought initially to have CJD but found subsequently to have immunotherapy-responsive VGKC autoimmunity. Design Observational, prospective case series. Setting Department of Neurology, Mayo Clinic, and the Memory and Aging Center, University of California, San Francisco. Patients A clinical serologic cohort of 15 patients referred for paraneoplastic autoantibody evaluation. Seven patients were evaluated clinically by at least one of us. Clinical information for the remaining patients was obtained by physician interview or medical record review. Main Outcome Measures Clinical features, magnetic resonance imaging abnormalities, electroencephalographic patterns, cerebrospinal fluid analyses, and responses to immunomodulatory therapy. Results All the patients presented subacutely with neurologic manifestations, including rapidly progressive dementia, myoclonus, extrapyramidal dysfunction, visual hallucinations, psychiatric disturbance, and seizures; most (60%) satisfied World Health Organization diagnostic criteria for CJD. Magnetic resonance imaging abnormalities included cerebral cortical diffusion-weighted imaging hyperintensities. Electroencephalographic abnormalities included diffuse slowing, frontal intermittent rhythmic delta activity, and focal epileptogenic activity but not periodic sharp wave complexes. Cerebrospinal fluid 14-3-3 protein or neuron-specific enolase levels were elevated in 5 of 8 patients. Hyponatremia was common (60%). Neoplasia was confirmed histologically in 5 patients (33%) and was suspected in another 5. Most patients’ conditions (92%) improved after immunomodulatory therapy. Conclusions Clinical, radiologic, electrophysiologic, and laboratory findings in VGKC autoantibody–associated encephalopathy may be

  17. Contributions of counter-charge in a potassium channel voltage-sensor domain

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

    2011-01-01

    Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

  18. Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel.

    Science.gov (United States)

    Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu

    2007-12-28

    Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.

  19. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  20. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  1. Complex N-Glycans Influence the Spatial Arrangement of Voltage Gated Potassium Channels in Membranes of Neuronal-Derived Cells.

    Directory of Open Access Journals (Sweden)

    M Kristen Hall

    Full Text Available The intrinsic electrical properties of a neuron depend on expression of voltage gated potassium (Kv channel isoforms, as well as their distribution and density in the plasma membrane. Recently, we showed that N-glycosylation site occupancy of Kv3.1b modulated its placement in the cell body and neurites of a neuronal-derived cell line, B35 neuroblastoma cells. To extrapolate this mechanism to other N-glycosylated Kv channels, we evaluated the impact of N-glycosylation occupancy of Kv3.1a and Kv1.1 channels. Western blots revealed that wild type Kv3.1a and Kv1.1 α-subunits had complex and oligomannose N-glycans, respectively, and that abolishment of the N-glycosylation site(s generated Kv proteins without N-glycans. Total internal reflection fluorescence microscopy images revealed that N-glycans of Kv3.1a contributed to its placement in the cell membrane while N-glycans had no effect on the distribution of Kv1.1. Based on particle analysis of EGFP-Kv proteins in the adhered membrane, glycosylated forms of Kv3.1a, Kv1.1, and Kv3.1b had differences in the number, size or density of Kv protein clusters in the cell membrane of neurites and cell body of B35 cells. Differences were also observed between the unglycosylated forms of the Kv proteins. Cell dissociation assays revealed that cell-cell adhesion was increased by the presence of complex N-glycans of Kv3.1a, like Kv3.1b, whereas cell adhesion was similar in the oligomannose and unglycosylated Kv1.1 subunit containing B35 cells. Our findings provide direct evidence that N-glycans of Kv3.1 splice variants contribute to the placement of these glycoproteins in the plasma membrane of neuronal-derived cells while those of Kv1.1 were absent. Further when the cell membrane distribution of the Kv channel was modified by N-glycans then the cell-cell adhesion properties were altered. Our study demonstrates that N-glycosylation of Kv3.1a, like Kv3.1b, provides a mechanism for the distribution of these

  2. Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies.

    Science.gov (United States)

    Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick; Irani, Sarosh R

    2017-04-01

    Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, the target(s) and clinical associations of double-negative antibodies need to be determined. Sera (n=1131) from several clinically defined cohorts were tested for IgG radioimmunoprecipitation of radioiodinated α-dendrotoxin ( 125 I-αDTX)-labelled VGKC complexes from mammalian brain extracts. Positive samples were systematically tested for live hippocampal neuron reactivity, IgG precipitation of 125 I-αDTX and 125 I-αDTX-labelled Kv1 subunits, and by cell-based assays which expressed Kv1 subunits, LGI1 and CASPR2. VGKC complex antibodies were found in 162 of 1131 (14%) sera. 90 of these (56%) had antibodies targeting the extracellular domains of LGI1 or CASPR2. Of the remaining 72 double-negative sera, 10 (14%) immunoprecipitated 125 I-αDTX itself, and 27 (38%) bound to solubilised co-expressed Kv1.1/1.2/1.6 subunits and/or Kv1.2 subunits alone, at levels proportionate to VGKC complex antibody levels (r=0.57, p=0.0017). The sera with LGI1 and CASPR2 antibodies immunoprecipitated neither preparation. None of the 27 Kv1-precipitating samples bound live hippocampal neurons or Kv1 extracellular domains, but 16 (59%) bound to permeabilised Kv1-expressing human embryonic kidney 293T cells. These intracellular Kv1 antibodies mainly associated with non-immune disease aetiologies, poor longitudinal clinical-serological correlations and a limited immunotherapy response. Double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits and occasionally against

  3. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  4. The Voltage-Gated Potassium Channel Subfamily KQT Member 4 (KCNQ4) Displays Parallel Evolution in Echolocating Bats

    Science.gov (United States)

    Liu, Yang; Han, Naijian; Franchini, Lucía F.; Xu, Huihui; Pisciottano, Francisco; Elgoyhen, Ana Belén; Rajan, Koilmani Emmanuvel; Zhang, Shuyi

    2012-01-01

    Bats are the only mammals that use highly developed laryngeal echolocation, a sensory mechanism based on the ability to emit laryngeal sounds and interpret the returning echoes to identify objects. Although this capability allows bats to orientate and hunt in complete darkness, endowing them with great survival advantages, the genetic bases underlying the evolution of bat echolocation are still largely unknown. Echolocation requires high-frequency hearing that in mammals is largely dependent on somatic electromotility of outer hair cells. Then, understanding the molecular evolution of outer hair cell genes might help to unravel the evolutionary history of echolocation. In this work, we analyzed the molecular evolution of two key outer hair cell genes: the voltage-gated potassium channel gene KCNQ4 and CHRNA10, the gene encoding the α10 nicotinic acetylcholine receptor subunit. We reconstructed the phylogeny of bats based on KCNQ4 and CHRNA10 protein and nucleotide sequences. A phylogenetic tree built using KCNQ4 amino acid sequences showed that two paraphyletic clades of laryngeal echolocating bats grouped together, with eight shared substitutions among particular lineages. In addition, our analyses indicated that two of these parallel substitutions, M388I and P406S, were probably fixed under positive selection and could have had a strong functional impact on KCNQ4. Moreover, our results indicated that KCNQ4 evolved under positive selection in the ancestral lineage leading to mammals, suggesting that this gene might have been important for the evolution of mammalian hearing. On the other hand, we found that CHRNA10, a gene that evolved adaptively in the mammalian lineage, was under strong purifying selection in bats. Thus, the CHRNA10 amino acid tree did not show echolocating bat monophyly and reproduced the bat species tree. These results suggest that only a subset of hearing genes could underlie the evolution of echolocation. The present work continues to

  5. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  6. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  7. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  8. Excessive blinking and ataxia in a child with occult neuroblastoma and voltage-gated potassium channel antibodies.

    LENUS (Irish Health Repository)

    Allen, Nicholas M

    2012-05-01

    A previously healthy 9-year-old girl presented with a 10-day history of slowly progressive unsteadiness, slurred speech, and behavior change. On examination there was cerebellar ataxia and dysarthria, excessive blinking, subtle perioral myoclonus, and labile mood. The finding of oligoclonal bands in the cerebrospinal fluid prompted paraneoplastic serological evaluation and search for an occult neural crest tumor. Antineuronal nuclear autoantibody type 1 (anti-Hu) and voltage-gated potassium channel complex antibodies were detected in serum. Metaiodobenzylguanidine scan and computed tomography scan of the abdomen showed a localized abdominal mass in the region of the porta hepatis. A diagnosis of occult neuroblastoma was made. Resection of the stage 1 neuroblastoma and treatment with pulsed corticosteroids resulted in resolution of all symptoms and signs. Excessive blinking has rarely been described with neuroblastoma, and, when it is not an isolated finding, it may be a useful clue to this paraneoplastic syndrome. Although voltage-gated potassium channel complex autoimmunity has not been described previously in the setting of neuroblastoma, it is associated with a spectrum of paraneoplastic neurologic manifestations in adults, including peripheral nerve hyperexcitability disorders.

  9. Bickerstaff's encephalitis and Miller Fisher syndrome associated with voltage-gated potassium channel and novel anti-neuronal antibodies.

    Science.gov (United States)

    Tüzün, E; Kürtüncü, M; Lang, B; Içöz, S; Akman-Demir, G; Eraksoy, M; Vincent, A

    2010-10-01

    GQ1b antibody (GQ1b-Ab) is detected in approximately two-thirds of sera of patients with Bickerstaffs encephalitis (BE). Whilst some of the remaining patients have antibodies to other gangliosides, many patients with BE are reported to be seronegative. Voltage-gated potassium channel antibody (VGKC-Ab) at high titer was detected during the diagnostic work-up of one patient with BE. Sera of an additional patient with BE and nine patients with Miller Fisher syndrome (MF) (all GQ1b-Ab positive) were investigated for VGKC-Ab and other anti-neuronal antibodies by radioimmunoprecipitation using 125I-dendrotoxin-VGKC and immunohistochemistry, respectively. Two patients with MF exhibited moderate titer VGKC-Abs. Regardless of positivity for VGKC or GQ1b antibodies, serum IgG of all patients with BE and MF reacted with the molecular layer and Purkinje cells of the cerebellum in a distinctive pattern. Voltage-gated potassium channel antibodies might be involved in some cases of BE or MF. The common staining pattern despite different antibody results suggests that there might be other, as yet unidentified, antibodies associated with BE and MF.

  10. Does Autoimmunity have a Role in Myoclonic Astatic Epilepsy? A Case Report of Voltage Gated Potassium Channel Mediated Seizures.

    Science.gov (United States)

    Sirsi, Deepa; Dolce, Alison; Greenberg, Benjamin M; Thodeson, Drew

    2016-01-01

    There is expanding knowledge about the phenotypic variability of patients with voltage gated potassium channel complex (VGKC) antibody mediated neurologic disorders. The phenotypes are diverse and involve disorders of the central and peripheral nervous systems. The central nervous system manifestations described in the literature include limbic encephalitis, status epilepticus, and acute encephalitis. We report a 4.5 year-old boy who presented with intractable Myoclonic Astatic Epilepsy (MAE) or Doose syndrome and positive VGKC antibodies in serum. Treatment with steroids led to resolution of seizures and electrographic normalization. This case widens the spectrum of etiologies for MAE to include autoimmunity, in particular VGKC auto-antibodies and CNS inflammation, as a primary or contributing factor. There is an evolving understanding of voltage gated potassium channel complex mediated autoimmunity in children and the role of inflammation and autoimmunity in MAE and other intractable pediatric epilepsy syndromes remains to be fully defined. A high index of suspicion is required for diagnosis and appropriate management of antibody mediated epilepsy syndromes.

  11. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  12. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Excitation block in a nerve fibre model owing to potassium-dependent changes in myelin resistance

    DEFF Research Database (Denmark)

    Brazhe, Alexey; Maksimov, G. V.; Mosekilde, Erik

    2011-01-01

    . Uptake of potassium leads to Schwann cell swelling and myelin restructuring that impacts the electrical properties of the myelin. In order to further understand the dynamic interaction that takes place between the myelin and the axon, we have modelled submyelin potassium accumulation and related changes...... in myelin resistance during prolonged high-frequency stimulation. We predict that potassium-mediated decrease in myelin resistance leads to a functional excitation block with various patterns of altered spike trains. The patterns are found to depend on stimulation frequency and amplitude and to range from...

  15. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  16. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  17. NMR structural and dynamical investigation of the isolated voltage-sensing domain of the potassium channel KvAP: implications for voltage gating.

    Science.gov (United States)

    Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S

    2010-04-28

    The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.

  18. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

    Directory of Open Access Journals (Sweden)

    Cyrus S.H. Ho

    2018-04-01

    Full Text Available Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS.

  19. Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies

    DEFF Research Database (Denmark)

    Celicanin, Marko; Blaabjerg, M; Maersk-Moller, C

    2017-01-01

    BACKGROUND AND PURPOSE: The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2......, electroencephalography and (18) F-fluorodeoxyglucose positron emission tomography scans were re-evaluated by experts in the field. RESULTS: A total of 28/192 patients tested positive for VGKC-complex antibodies by radioimmunoassay and indirect immunofluorescence; 17 had antibodies to LGI1 and 6/7 of the available....... CONCLUSIONS: Patients diagnosed with anti-LGI1 autoimmune encephalitis increased significantly from 2009 to 2014, probably due to increased awareness. In contrast to seropositive anti-VGKC-complex patients, all anti-LGI1-positive patients presented with a classical limbic encephalitis. The majority...

  20. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder.

    Science.gov (United States)

    Ho, Cyrus S H; Ho, Roger C M; Quek, Amy M L

    2018-04-18

    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS).

  1. Persistent anterograde amnesia following limbic encephalitis associated with antibodies to the voltage-gated potassium channel complex.

    Science.gov (United States)

    Butler, Christopher R; Miller, Thomas D; Kaur, Manveer S; Baker, Ian W; Boothroyd, Georgie D; Illman, Nathan A; Rosenthal, Clive R; Vincent, Angela; Buckley, Camilla J

    2014-04-01

    Limbic encephalitis (LE) associated with antibodies to the voltage-gated potassium channel complex (VGKC) is a potentially reversible cause of cognitive impairment. Despite the prominence of cognitive dysfunction in this syndrome, little is known about patients' neuropsychological profile at presentation or their long-term cognitive outcome. We used a comprehensive neuropsychological test battery to evaluate cognitive function longitudinally in 19 patients with VGKC-LE. Before immunotherapy, the group had significant impairment of memory, processing speed and executive function, whereas language and perceptual organisation were intact. At follow-up, cognitive impairment was restricted to the memory domain, with processing speed and executive function having returned to the normal range. Residual memory function was predicted by the antibody titre at presentation. The results show that, despite broad cognitive dysfunction in the acute phase, patients with VGKC-LE often make a substantial recovery with immunotherapy but may be left with permanent anterograde amnesia.

  2. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

    Science.gov (United States)

    Ho, Cyrus S.H.; Quek, Amy M.L.

    2018-01-01

    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS). PMID:29669989

  3. Reversible dementia: two nursing home patients with voltage-gated potassium channel antibody-associated limbic encephalitis.

    Science.gov (United States)

    Reintjes, Wesley; Romijn, Marloes D M; Hollander, Daan; Ter Bruggen, Jan P; van Marum, Rob J

    2015-09-01

    Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable cognitive and functional improvement enabling them to leave the psychogeriatric nursing homes they both were admitted to. Patients with VGKC-LE can have a major cognitive and functional improvement even after a diagnostic delay of more than 1 year. Medical practitioners who treat patients with unexplained cognitive decline, epileptic seizures, or psychiatric symptoms should be aware of LE as an underlying rare cause. Copyright © 2015 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.

  4. Voltage gated potassium channels expressed in Xenopus laevis(AMPHIBIA oocytes

    Directory of Open Access Journals (Sweden)

    Hedna Chaves

    2003-01-01

    Full Text Available Heterologous expression has been an important tool for structural and functionalcharacterization of proteins. The study of biophysical properties of ion channels,pumps and transporters has been possible thanks to their expression in Xenopuslaevisoocytes. Here we report the expression of two voltage gated channels, Kv1.1and Shaker, in X. laevisoocytes using a method for oocyte extraction, isolation, cul-ture, and microinjection adapted to the latitude and altitude conditions of Bogotá,Colombia.

  5. Excitation block in a nerve fibre model owing to potassium-dependent changes in myelin resistance.

    Science.gov (United States)

    Brazhe, A R; Maksimov, G V; Mosekilde, E; Sosnovtseva, O V

    2011-02-06

    The myelinated nerve fibre is formed by an axon and Schwann cells or oligodendrocytes that sheath the axon by winding around it in tight myelin layers. Repetitive stimulation of a fibre is known to result in accumulation of extracellular potassium ions, especially between the axon and the myelin. Uptake of potassium leads to Schwann cell swelling and myelin restructuring that impacts the electrical properties of the myelin. In order to further understand the dynamic interaction that takes place between the myelin and the axon, we have modelled submyelin potassium accumulation and related changes in myelin resistance during prolonged high-frequency stimulation. We predict that potassium-mediated decrease in myelin resistance leads to a functional excitation block with various patterns of altered spike trains. The patterns are found to depend on stimulation frequency and amplitude and to range from no block (less than 100 Hz) to a complete block (greater than 500 Hz). The transitional patterns include intermittent periodic block with interleaved spiking and non-spiking intervals of different relative duration as well as an unstable regime with chaotic switching between the spiking and non-spiking states. Intermittent conduction blocks are accompanied by oscillations of extracellular potassium. The mechanism of conductance block based on myelin restructuring complements the already known and modelled block via hyperpolarization mediated by the axonal sodium pump and potassium depolarization.

  6. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  7. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  8. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  9. Voltage-Gated Potassium Channels Kv1.3--Potentially New Molecular Target in Cancer Diagnostics and Therapy.

    Science.gov (United States)

    Teisseyre, Andrzej; Gąsiorowska, Justyna; Michalak, Krystyna

    2015-01-01

    Voltage-gated potassium channels, Kv1.3, which were discovered in 1984, are integral membrane proteins which are activated ("open") upon change of the cell membrane potential, enabling a passive flux of potassium ions across the cell membrane. The channels are expressed in many different tissues, both normal and cancer. Since 2005 it has been known that the channels are expressed not only in the plasma membrane, but also in the inner mitochondrial membrane. The activity of Kv1.3 channels plays an important role, among others, in setting the cell resting membrane potential, cell proliferation, apoptosis and volume regulation. For some years, these channels have been considered a potentially new molecular target in both the diagnostics and therapy of some cancer diseases. This review article focuses on: 1) changes of expression of the channels in cancer disorders with special regard to correlations between the channels' expression and stage of the disease, 2) influence of inhibitors of Kv1.3 channels on proliferation and apoptosis of cancer cells, 3) possible future applications of Kv1.3 channels' inhibitors in therapy of some cancer diseases. In the last section, the results of studies performed in our Laboratory of Bioelectricity on the influence of selected biologically active plant-derived compounds from the groups of flavonoids and stilbenes and their natural and synthetic derivatives on the activity of Kv1.3 channels in normal and cancer cells are reviewed. A possible application of some compounds from these groups to support therapy of cancer diseases, such as breast, colon and lymph node cancer, and melanoma or chronic lymphocytic leukemia (B-CLL), is announced.

  10. Differential expression of the Kv1 voltage-gated potassium channel family in the rat nephron.

    Science.gov (United States)

    Carrisoza-Gaytán, Rolando; Salvador, Carolina; Diaz-Bello, Beatriz; Escobar, Laura I

    2014-10-01

    Several potassium (K(+)) channels contribute to maintaining the resting membrane potential of renal epithelial cells. Apart from buffering the cell membrane potential and cell volume, K(+) channels allow sodium reabsorption in the proximal tubule (PT), K(+) recycling and K(+) reabsorption in the thick ascending limb (TAL) and K(+) secretion and K(+) reabsorption in the distal convoluted tubule (DCT), connecting tubule (CNT) and collecting duct. Previously, we identified Kv.1.1, Kv1.3 and Kv1.6 channels in collecting ducts of the rat inner medulla. We also detected intracellular Kv1.3 channel in the acid secretory intercalated cells, which is trafficked to the apical membrane in response to dietary K(+) to function as a secretory K(+) channel. In this work we sought to characterize the expression of all members of the Kv1 family in the rat nephron. mRNA and protein expression were detected for all Kv1 channels. Immunoblots identified differential expression of each Kv1 in the cortex, outer and inner medulla. Immunofluorescence labeling detected Kv1.5 in Bowman´s capsule and endothelial cells and Kv1.7 in podocytes, endothelial cells and macula densa in glomeruli; Kv1.4, Kv1.5 and Kv1.7 in PT; Kv1.2, Kv1.4 and Kv1.6 in TAL; Kv1.1, Kv1.4 and Kv1.6 in DCT and CNT and Kv1.3 in DCT, and all the Kv1 family in the cortical and medullary collecting ducts. Recently, some hereditary renal syndromes have been attributed to mutations in K(+) channels. Our results expand the repertoire of K(+) channels that contribute to K(+) homeostasis to include the Kv1 family.

  11. Alcohol and the calcium-dependent potassium transport of human erythrocytes

    International Nuclear Information System (INIS)

    Harris, R.A.; Caldwell, K.K.

    1985-01-01

    In vitro exposure of human red blood cells to ethanol (100 and 400 mM) was found to increase the initial rate of calcium-dependent potassium efflux through the red cell membrane. This effect of ethanol was apparently not due to an elevation of the intracellular free calcium but rather to a direct action of the drug on the transport process as, (1) intracellular calcium concentrations were tightly buffered with EGTA, (2) ethanol did not alter the efflux of 45 Ca from the cells, and (3) dantrolene, which has been proposed to counteract the effect of ethanol on intracellular calcium levels in the erythrocyte, did not inhibit the stimulatory action of ethanol. The efflux of potassium from erythrocytes obtained from chronic alcoholics was not different from that of erythrocytes from non-alcoholic individuals. The relationship of these findings to neuronal potassium transport is discussed

  12. Interactions between bicarbonate, potassium, and magnesium, and sulfur-dependent induction of luminescence in Vibrio fischeri.

    Science.gov (United States)

    Tabei, Yosuke; Era, Mariko; Ogawa, Akane; Morita, Hiroshi

    2012-06-01

    In spite of its central importance in research efforts, the relationship between seawater compounds and bacterial luminescence has not previously been investigated in detail. Thus, in this study, we investigated the effect of cations (Na(+) , K(+) , NH(4) (+) , Mg(2+) , and Ca(2+) ) and anions (Cl(-) , HCO(3) (-) , CO(3) (2-) , and NO(3) (-) ) on the induction of both inorganic (sulfate, sulfite, and thiosulfate) and organic (L-cysteine and L-cystine) sulfur-dependent luminescence in Vibrio fischeri. We found that HCO(3) (-) (bicarbonate) and CO(3) (2-) (carbonate), in the form of various compounds, had a stimulatory effect on sulfur-dependent luminescence. The luminescence induced by bicarbonate was further promoted by the addition of magnesium. Potassium also increased sulfur-dependent luminescence when sulfate or thiosulfate was supplied as the sole sulfur source, but not when sulfite, L-cysteine, or L-cystine was supplied. The positive effect of potassium was accelerated by the addition of magnesium and/or calcium. Furthermore, the additional supply of magnesium improved the induction of sulfite- or L-cysteine-dependent luminescence, but not the l-cystine-dependent type. These results suggest that sulfur-dependent luminescence of V. fischeri under nutrient-starved conditions is mainly controlled by bicarbonate, carbonate, and potassium. In addition, our results indicate that an additional supply of magnesium is effective for increasing V. fischeri luminescence. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Clinical-pathologic correlations in voltage-gated Kv1 potassium channel complex-subtyped autoimmune painful polyneuropathy.

    Science.gov (United States)

    Lahoria, Rajat; Pittock, Sean J; Gadoth, Avi; Engelstad, Janean K; Lennon, Vanda A; Klein, Christopher J

    2017-04-01

    Voltage-gated Kv1 potassium channel complex (VGKC) autoantibodies subtyped for leucine-rich glioma-inactivated 1 (LGI1), contactin-associated-proteinlike 2 (CASPR2), and Kv IgGs have a spectrum of neurological presentations. Painful polyneuropathy is seen in some patients, but nerve pathology descriptions are lacking. Clinicopathologic features were studied in subtyped VGKC-autoantibody-seropositive patients who had undergone nerve biopsies. Five patients were identified, 1 LGI1 IgG positive and 1 CASPR2 IgG positive, but all negative for Kv1.1-, 1.2-, 1.6-subtyped IgG autoantibodies. Median symptom duration was 17 months. Pain was the predominant symptom; 3 had mild sensory loss and/or weakness. Histopathological abnormalities were limited to axonal loss in 3. None had mononuclear cellular infiltrates. Electron micrographs revealed no interstitial abnormalities. Three patients reported marked improvement in pain with immunotherapy. The nerve biopsy histopathology of patients subtyped for LGI1 and CASPR2 IgGs within the VGKC-complex spectrum disorders shows either normal density or axonal fiber loss without inflammatory infiltrates. A reversible neural hyperexcitable mechanism is considered to be the cause of this painful polyneuropathy. Muscle Nerve 55: 520-525, 2017. © 2016 Wiley Periodicals, Inc.

  14. Voltage-gated potassium channel-associated limbic encephalitis in the West of Scotland: case reports and literature review.

    Science.gov (United States)

    Reid, J M; Foley, P; Willison, H J

    2009-11-01

    The syndrome of limbic encephalitis (LE) associated with antibodies against voltage-gated potassium channels (VGKC-LE) has recently been described. The number of published cases is however small. We therefore aimed to review all cases seen at our centre and compare with published cases. Retrospective cases of VGKC-LE were identified using a questionnaire to Neurologists at the Southern General hospital, Glasgow, and by reviewing patients with a positive VGKC antibody test (2002-2007). Case-note review of identified cases and a literature review of all published cases of VGKC-LE were performed. Seven cases were identified (four female, age range 51-81). Patients presented sub-acutely with seizures and anterograde memory loss. Five patients had medial temporal lobe change on cranial imaging. No paraneoplastic cases were identified. 5/7 patients made some improvement with immunotherapy. In 2006, 3/18 (17%) patients with a coded discharge of encephalitis were diagnosed with VGKC-LE. The literature review revealed 40 patients with VGKC-LE. Age, gender or VGKC level did not predict likelihood for a significant recovery. Patients treated VGKC-LE is being increasingly diagnosed and is best identified early and treated with immunotherapy to offer the greatest chance of recovery. This series and literature review expands the current published evidence in VGKC-LE.

  15. Development of Isaacs' syndrome following complete recovery of voltage-gated potassium channel antibody-associated limbic encephalitis.

    Science.gov (United States)

    Takahashi, Hirokatsu; Mori, Masahiro; Sekiguchi, Yukari; Misawa, Sonoko; Sawai, Setsu; Hattori, Takamichi; Kuwabara, Satoshi

    2008-12-15

    Autoantibodies against voltage-gated potassium channels (VGKC-Abs) are associated with acquired neuromyotonia (Isaacs' syndrome) and related disorders such as Morvan's syndrome and some cases of limbic encephalitis. The mechanisms underlying the various phenotypes induced by VGKC-Abs are not fully understood. Recently, we reported a case of LE with VGKC-Abs accompanied by severe intestinal pseudo-obstruction and thymoma. Thymectomy and immunosuppressive therapy induced dramatic clinical improvement of LE symptoms, and VGKC-Abs titers decreased from 1254 pM to 549 pM (normal>100 pM). Seventeen months later, the patient developed progressive generalized muscle cramping, paresthesias in his lower extremities, excessive sweating, and severe constipation. There was no recurrence of the LE. Electromyography showed fasciculation potentials and myokymic discharges, and the plasma VGKC-Abs titer was again elevated to 879 pM. Here we report a case of Isaacs' syndrome after complete remission of LE with VGKC-Abs that may provide an insight into a possible link among VGKC-Abs associated syndromes.

  16. 4-Aminopyridine: a pan voltage-gated potassium channel inhibitor that enhances K7.4 currents and inhibits noradrenaline-mediated contraction of rat mesenteric small arteries

    DEFF Research Database (Denmark)

    Khammy, Makhala M; Kim, Sukhan; Bentzen, Bo H

    2018-01-01

    has not been systematically studied. The aim of this study was to investigate the pharmacological activity of 4-AP on Kv7.4 and Kv7.5 channels and characterize the effect of 4-AP on rat resistance arteries. EXPERIMENTAL APPROACH: Voltage clamp experiments were performed on Xenopus laevis oocytes......BACKGROUND AND PURPOSE: Kv7.4 and Kv7.5 channels are regulators of vascular tone. 4-Aminopyridine (4-AP) is considered a broad inhibitor of voltage-gated potassium (KV) channels, with little inhibitory effect on Kv7 family members at mmol concentrations. However, the effect of 4-AP on Kv7 channels...

  17. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  18. Autoantibodies against voltage-gated potassium channel and glutamic acid decarboxylase in psychosis: A systematic review, meta-analysis, and case series.

    OpenAIRE

    Grain, Rosemary; Lally, John; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy R; Murray, Robin M; Gaughran, Fiona

    2017-01-01

    Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

  19. Autoantibodies against voltage-gated potassium channel (VGKC) and glutamic acid decarboxylase (GAD) in psychosis: A systematic review, meta-analysis and case series.

    OpenAIRE

    Lally*, John; Grain*, Rosemary; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy RJ; Murray, Robin MacGregor; Gaughran, Fiona Patricia

    2017-01-01

    Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

  20. Leucine-Rich Glioma Inactivated-1 and Voltage-Gated Potassium Channel Autoimmune Encephalitis Associated with Ischemic Stroke: A Case Report

    Science.gov (United States)

    McGinley, Marisa; Morales-Vidal, Sarkis; Ruland, Sean

    2016-01-01

    Autoimmune encephalitis is associated with a wide variety of antibodies and clinical presentations. Voltage-gated potassium channel (VGKC) antibodies are a cause of autoimmune non-paraneoplastic encephalitis characterized by memory impairment, psychiatric symptoms, and seizures. We present a case of VGKC encephalitis likely preceding an ischemic stroke. Reports of autoimmune encephalitis associated with ischemic stroke are rare. Several hypotheses linking these two disease processes are proposed. PMID:27242653

  1. When should we test for voltage-gated potassium channel complex antibodies? A retrospective case control study.

    Science.gov (United States)

    O'Sullivan, B J; Steele, T; Ellul, M A; Kirby, E; Duale, A; Kier, G; Crooks, D; Jacob, A; Solomon, T; Michael, B D

    2016-11-01

    Patients with voltage-gated potassium channel (VGKC)-complex antibodies are increasingly recognized as having central, peripheral or combined phenotypes. With increasing awareness, more patients are tested and the clinical spectrum is expanding. Consequently, clinicians may be uncertain as to which patients should or should not be tested. Previous studies have identified common clinical features, but none has looked at the usefulness of these in predicting seropositive disease. We conducted a case-control study of patients tested for VGKC-complex antibodies over 10years at a regional tertiary neurology centre determining which clinical/biochemical features were associated with antibody-positive disease. We found a marked increase in the numbers tested, although the percentage positive remained low. Antibody titre was highest in central disease (pVGKC-disease (p=0.01). Seizures were present in 11 (69%) of those with VGKC-disease versus three (18%) without (odds ratio [OR] 10.3, 95% confidence interval [CI]: 2.0-52.7, p=0.005). There was an inverse correlation between the antibody titre and serum sodium. A multivariate model selected seizures and hyponatraemia as predictive of VGKC disease (sensitivity 75% and specificity 82%); faciobrachial dystonic movements were specific but insensitive. Interestingly serum alkaline phosphatase was higher in those with VGKC-disease (p=0.016) and highest in those with peripheral disease (p=0.015). An ALP>70u/L was strongly associated with antibody positivity (OR 4.11 95% CI: 1.43-11.8, p=0.007) with a sensitivity of 74.2%. The presence of seizures, faciobrachial movements, and hyponatraemia should raise suspicion of VGKC-disease; alkaline phosphatase may represent a novel biomarker, particularly in those with peripheral disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Suspected limbic encephalitis and seizure in cats associated with voltage-gated potassium channel (VGKC) complex antibody.

    Science.gov (United States)

    Pakozdy, A; Halasz, P; Klang, A; Bauer, J; Leschnik, M; Tichy, A; Thalhammer, J G; Lang, B; Vincent, A

    2013-01-01

    Treatment-resistant complex partial seizures (CPS) with orofacial involvement recently were reported in cats in association with hippocampal pathology. The features had some similarity to those described in humans with limbic encephalitis and voltage-gated potassium channel (VGKC) complex antibody. The purpose of this pilot study was to evaluate cats with CPS and orofacial involvement for the presence of VGKC-complex antibody. Client-owned cats with acute orofacial CPS and control cats were investigated. Prospective study. Serum was collected from 14 cats in the acute stage of the disease and compared with 19 controls. VGKC-complex antibodies were determined by routine immunoprecipitation and by binding to leucine-rich glioma inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2), the 2 main targets of VGKC-complex antibodies in humans. Five of the 14 affected cats, but none of the 19 controls, had VGKC-complex antibody concentrations above the cut-off concentration (>100 pmol/L) based on control samples and similar to those found in humans. Antibodies in 4 cats were directed against LGI1, and none were directed against CASPR2. Follow-up sera were available for 5 cats in remission and all antibody concentrations were within the reference range. Our study suggests that an autoimmune limbic encephalitis exists in cats and that VGKC-complex/LGI1 antibodies may play a role in this disorder, as they are thought to in humans. Copyright © 2012 by the American College of Veterinary Internal Medicine.

  3. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  4. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  5. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  6. Clinical relevance of positive voltage-gated potassium channel (VGKC)-complex antibodies: experience from a tertiary referral centre.

    Science.gov (United States)

    Paterson, Ross W; Zandi, Michael S; Armstrong, Richard; Vincent, Angela; Schott, Jonathan M

    2014-06-01

    Voltage-gated potassium channel (VGKC)-complex antibodies can be associated with a range of immunotherapy-responsive clinical presentations including limbic encephalitis, Morvan's syndrome and acquired neuromyotonia. However, there are patients with positive levels in whom the significance is uncertain. To evaluate the clinical significance associated with positive (>100 pM) VGKC-complex antibodies. Over a 4-year period, 1053 samples were sent for testing of which 55 were positive. The clinical presentations, final diagnoses and responses to immunotherapies, when given, were assessed retrospectively and the likelihood of autoimmunity was categorised as definite, possible, unlikely or undetermined (modified from Zuliani et al 2012). Only 4 of the 32 patients with low-positive (100-400 pM) levels were considered definitely autoimmune, 3 with peripheral nerve hyperexcitability and 1 with a thymoma; 3 were given immunotherapies. Of the remaining 28 with low-positive levels, 13 (3 of whom had tumours) were considered possibly autoimmune, and 15 were unlikely or undetermined; 1 was given immunotherapy unsuccessfully. Of the 23 patients with high-positive (>400 pM) levels, 12 were given immunotherapies, 11 of whom showed a good response. 11 were considered definitely autoimmune, 10 with limbic encephalitis (antibody specificity: 5 LGI1, 1 contactin2, 2 negative, 2 untested) and 1 with a tumour. In the remaining 12, autoimmunity was considered possible (n=9; most had not received immunotherapies), or unlikely (n=3). As antibody testing becomes more widely available, and many samples are referred from patients with less clear-cut diagnoses, it is important to assess the utility of the results. VGKC-complex antibodies in the range of 100-400 pM (0.1-0.4 nM) were considered clinically relevant in rare conditions with peripheral nerve hyperexcitability and appeared to associate with tumours (12.5%). By contrast high-positive (>400 pM; >0.4 nM) levels were considered definitely

  7. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    OpenAIRE

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  8. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  9. Distinct white matter integrity in glutamic acid decarboxylase and voltage-gated potassium channel-complex antibody-associated limbic encephalitis.

    Science.gov (United States)

    Wagner, Jan; Schoene-Bake, Jan-Christoph; Witt, Juri-Alexander; Helmstaedter, Christoph; Malter, Michael P; Stoecker, Winfried; Probst, Christian; Weber, Bernd; Elger, Christian E

    2016-03-01

    Autoantibodies against glutamic acid decarboxylase (GAD) and the voltage-gated potassium channel (VGKC) complex are associated with distinct subtypes of limbic encephalitis regarding clinical presentation, response to therapy, and outcome. The aim of this study was to investigate white matter changes in these two limbic encephalitis subtypes by means of diffusion tensor imaging (DTI). Diffusion data were obtained in 14 patients with GAD antibodies and 16 patients with VGKC-complex antibodies and compared with age- and gender-matched control groups. Voxelwise statistical analysis was carried out using tract-based spatial statistics. The results were furthermore compared with those of 15 patients with unilateral histologically confirmed hippocampal sclerosis and correlated with verbal and figural memory performance. We found widespread changes of fractional anisotropy and all diffusivity parameters in GAD-associated limbic encephalitis, whereas no changes were found in VGKC-complex-associated limbic encephalitis. The changes observed in the GAD group were even more extensive when compared against those of the hippocampal sclerosis group, although the disease duration was markedly shorter in patients with GAD antibodies. Correlation analysis revealed areas with a trend toward a negative correlation of diffusivity parameters with figural memory performance located mainly in the right temporal lobe in the GAD group as well. The present study provides further evidence that, depending on the associated antibody, limbic encephalitis features clearly distinct imaging characteristics by showing widespread white matter changes in GAD-associated limbic encephalitis and preserved white matter integrity in VGKC-complex-associated limbic encephalitis. Furthermore, our results contribute to a better understanding of the specific pathophysiologic properties in these two subforms of limbic encephalitis by revealing that patients with GAD antibodies show widespread affections of

  10. Potassium conductances mediate bidirectional state-dependent modulation of action potential evoked dendritic calcium signals in dentate gyrus granule cells

    Directory of Open Access Journals (Sweden)

    János Brunner

    2014-03-01

    Full Text Available Backpropagating action potentials (bAPs and local calcium signals that they trigger are fundamental for dendritic functions. Here we addressed the question what extent the changes of local dendritic membrane properties can contribute to the shaping of the coupling between dendritic action potentials and the local calcium responses. Using a combination of in vitro electrophysiological and confocal imaging techniques we found that activation of dendritic GIRK channels via mGlu2 or GABAB receptors enhanced the bAP¬-triggered calcium signals in the dendrites of dentate gyrus granule cells (GCs. The enhancement of calcium signals was significant only in those dendritic regions, where these receptors are predominantly expressed. Similarly to GIRK channel activation, somatic hyperpolarization by DC current injection (from -64 mV to -77 mV, significantly increased bAP-associated calcium signals in the proximal dendrites. The hyperpolarization was associated with a decrease in the input resistance due to the rectification of the membrane potential of GCs. The effect of hyperpolarization on the calcium signals was maintained when T-type calcium currents were blocked but it decreased when GIRK channels were inhibited. Simultaneous dual somato-dendritic recordings from GCs showed that somatic hyperpolarization accelerated the repolarization phase of dendritic bAP in the proximal region whereas the rising phase and peak amplitude was not affected. We hypothesize that the larger driving force for calcium ions during the faster repolarization can contribute to the increasing in calcium signals. Employment of previously recorded dendritic bAP waveforms from hyperpolarized membrane potential as voltage command evoked larger calcium currents in nucleated patches compared to bAP waveform from the same recording at depolarized membrane potential. Furthermore, addition of native, high-voltage activated, inactivating potassium conductance by somatic dynamic clamp

  11. Role of the activation gate in determining the extracellular potassium dependency of block of HERG by trapped drugs.

    Science.gov (United States)

    Pareja, Kristeen; Chu, Elaine; Dodyk, Katrina; Richter, Kristofer; Miller, Alan

    2013-01-01

    Drug induced long QT syndrome (diLQTS) results primarily from block of the cardiac potassium channel HERG (human-ether-a-go-go related gene). In some cases long QT syndrome can result in the lethal arrhythmia torsade de pointes, an arrhythmia characterized by a rapid heart rate and severely compromised cardiac output. Many patients requiring medication present with serum potassium abnormalities due to a variety of conditions including gastrointestinal dysfunction, renal and endocrine disorders, diuretic use, and aging. Extracellular potassium influences HERG channel inactivation and can alter block of HERG by some drugs. However, block of HERG by a number of drugs is not sensitive to extracellular potassium. In this study, we show that block of WT HERG by bepridil and terfenadine, two drugs previously shown to be trapped inside the HERG channel after the channel closes, is insensitive to extracellular potassium over the range of 0 mM to 20 mM. We also show that bepridil block of the HERG mutant D540K, a mutant channel that is unable to trap drugs, is dependent on extracellular potassium, correlates with the permeant ion, and is independent of HERG inactivation. These results suggest that the lack of extracellular potassium dependency of block of HERG by some drugs may in part be related to the ability of these drugs to be trapped inside the channel after the channel closes.

  12. Modeling the concentration-dependent permeation modes of the KcsA potassium ion channel.

    Science.gov (United States)

    Nelson, Peter Hugo

    2003-12-01

    The potassium channel from Streptomyces lividans (KcsA) is an integral membrane protein with sequence similarity to all known potassium channels, particularly in the selectivity filter region. A recently proposed model for ion channels containing either n or (n-1) single-file ions in their selectivity filters [P. H. Nelson, J. Chem. Phys. 177, 11396 (2002)] is applied to published KcsA channel K+ permeation data that exhibit a high-affinity process at low concentrations and a low-affinity process at high concentrations [M. LeMasurier et al., J. Gen. Physiol. 118, 303 (2001)]. The kinetic model is shown to provide a reasonable first-order explanation for both the high- and low-concentration permeation modes observed experimentally. The low-concentration mode ([K+]200 mM) has a 200-mV dissociation constant of 1100 mM and a conductance of 500 pS. Based on the permeation model, and x-ray analysis [J. H. Morais-Cabral et al., Nature (London) 414, 37 (2001)], it is suggested that the experimentally observed K+ permeation modes correspond to an n=3 mechanism at high concentrations and an n=2 mechanism at low concentrations. The ratio of the electrical dissociation distances for the high- and low-concentration modes is 3:2, also consistent with the proposed n=3 and n=2 modes. Model predictions for K+ channels that exhibit asymmetric current-voltage (I-V) curves are presented, and further validation of the kinetic model via molecular simulation and experiment is discussed. The qualitatively distinct I-V characteristics exhibited experimentally by Tl+, NH+4, and Rb+ ions at 100 mM concentration can also be explained using the model, but more extensive experimental tests are required for quantitative validation of the model predictions.

  13. Voltage gated potassium channel antibodies positive autoimmune encephalopathy in a child: A case report and literature review of an under-recognized condition

    Directory of Open Access Journals (Sweden)

    Subramanian Ganesan

    2013-01-01

    Full Text Available Autoimmune limbic encephalitis (LE associated with voltage gated potassium channel antibodies (VGKC-Abs in children is more common than previously thought and is not always paraneoplastic. Non-neoplastic, autoimmune LE associated with VGKC-Abs has been described recently. However, only few case reports in children as the disease is predominantly described in the adult population. It is likely that this type of autoimmune encephalitis is currently under-diagnosed and hence, under-treated, especially in children. We present a 13-year-old previously fit and healthy African girl diagnosed with LE and we reviewed the literature for its current management.

  14. Morvan's syndrome with anti contactin associated protein like 2 – voltage gated potassium channel antibody presenting with syndrome of inappropriate antidiuretic hormone secretion

    Directory of Open Access Journals (Sweden)

    Anjani Kumar Sharma

    2016-01-01

    Full Text Available Morvan's syndrome is a rare autoimmune disorder characterized by triad of peripheral nerve hyperexcitability, autonomic dysfunction, and central nervous system symptoms. Antibodies against contactin-associated protein-like 2 (CASPR2, a subtype of voltage-gated potassium channel (VGKC complex, are found in a significant proportion of patients with Morvan's syndrome and are thought to play a key role in peripheral as well as central clinical manifestations. We report a patient of Morvan's syndrome with positive CASPR2–anti-VGKC antibody having syndrome of inappropriate antidiuretic hormone as a cause of persistent hyponatremia.

  15. Voltage gated potassium channel antibodies positive autoimmune encephalopathy in a child: A case report and literature review of an under-recognized condition

    Science.gov (United States)

    Ganesan, Subramanian; Beri, Sushil; Khan, Beri; Hussain, Nahin

    2013-01-01

    Autoimmune limbic encephalitis (LE) associated with voltage gated potassium channel antibodies (VGKC-Abs) in children is more common than previously thought and is not always paraneoplastic. Non-neoplastic, autoimmune LE associated with VGKC-Abs has been described recently. However, only few case reports in children as the disease is predominantly described in the adult population. It is likely that this type of autoimmune encephalitis is currently under-diagnosed and hence, under-treated, especially in children. We present a 13-year-old previously fit and healthy African girl diagnosed with LE and we reviewed the literature for its current management. PMID:24339586

  16. [An autopsy case of amyotrophic lateral sclerosis with prominent muscle cramps, fasciculation, and high titer of anti-voltage gated potassium channel (VGKC) complex antibody].

    Science.gov (United States)

    Sato, Aki; Sakai, Naoko; Shinbo, Junsuke; Hashidate, Hideki; Igarashi, Shuichi; Kakita, Akiyoshi; Yamazaki, Motoyoshi

    2014-01-01

    The patient was a 55-year-old male who had prominent fasciculation and muscle cramps. Muscle weakness and atrophy of the trunk, respiratory system, and extremities gradually progressed. On the basis of these features, we diagnosed this patient as having amyotrophic lateral sclerosis (ALS), however, the upper motor neuron signs were not significant. Following the detection of the anti-voltage gated potassium channel (VGKC) complex antibody at 907.5 pM (normal VGKC complex antibody in the development of cramp-fasciculation syndrome has been speculated. In this ALS patient, the antibodies might be associated with pathomechanisms underlying the characteristic symptoms.

  17. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  18. Pressure dependence of the interfacial structure of potassium chloride films on iron

    International Nuclear Information System (INIS)

    Olson, Dustin; Gao, Hongyu; Tang, Chun; Tysoe, Wilfred T.; Martini, Ashlie

    2015-01-01

    Potassium chloride films on a clean iron surface are used as a model system to explore the interfacial structure of the films and the dependence of that structure on film thickness and pressure. The interfacial structure of one-, two-, three- and four-layer films is measured experimentally using low-energy electron diffraction. Those findings are then complemented by molecular dynamics simulations in which the atomic interaction between the film and substrate is tuned to match film thickness-dependent sublimation activation energy obtained from temperature-programmed desorption measurements. The resultant simulation reliably predicts the structure of thicker films and is then used to study the effect of pressure on the distribution of the lattice constant within and between each layer of the potassium chloride films. Findings indicate that both film thickness and pressure affect the structure within the films as well as the degree of registry between the film and adjacent substrate. - Highlights: • KCl films on an Fe surface are used as a model system to explore interfacial structure • Thin film structure is measured using low-energy electron diffraction • An empirical potential is tuned to match sublimation activation energy • Simulations reveal the effect of pressure on the lattice constant within the KCl films • Pressure affects the film structure and registry between film and substrate

  19. Pressure dependence of the interfacial structure of potassium chloride films on iron

    Energy Technology Data Exchange (ETDEWEB)

    Olson, Dustin [Department of Chemistry and Laboratory for Surface Studies, University of Wisconsin—Milwaukee, Milwaukee, WI 53211 (United States); Gao, Hongyu; Tang, Chun [School of Engineering, University of California Merced, Merced CA 95343 (United States); Tysoe, Wilfred T. [Department of Chemistry and Laboratory for Surface Studies, University of Wisconsin—Milwaukee, Milwaukee, WI 53211 (United States); Martini, Ashlie [School of Engineering, University of California Merced, Merced CA 95343 (United States)

    2015-10-30

    Potassium chloride films on a clean iron surface are used as a model system to explore the interfacial structure of the films and the dependence of that structure on film thickness and pressure. The interfacial structure of one-, two-, three- and four-layer films is measured experimentally using low-energy electron diffraction. Those findings are then complemented by molecular dynamics simulations in which the atomic interaction between the film and substrate is tuned to match film thickness-dependent sublimation activation energy obtained from temperature-programmed desorption measurements. The resultant simulation reliably predicts the structure of thicker films and is then used to study the effect of pressure on the distribution of the lattice constant within and between each layer of the potassium chloride films. Findings indicate that both film thickness and pressure affect the structure within the films as well as the degree of registry between the film and adjacent substrate. - Highlights: • KCl films on an Fe surface are used as a model system to explore interfacial structure • Thin film structure is measured using low-energy electron diffraction • An empirical potential is tuned to match sublimation activation energy • Simulations reveal the effect of pressure on the lattice constant within the KCl films • Pressure affects the film structure and registry between film and substrate.

  20. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  1. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.

    2013-01-01

    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  2. KV7 potassium channels

    DEFF Research Database (Denmark)

    Stott, Jennifer B; Jepps, Thomas Andrew; Greenwood, Iain A

    2014-01-01

    Potassium channels are key regulators of smooth muscle tone, with increases in activity resulting in hyperpolarisation of the cell membrane, which acts to oppose vasoconstriction. Several potassium channels exist within smooth muscle, but the KV7 family of voltage-gated potassium channels have been...

  3. Substrate bias voltage and deposition temperature dependence on ...

    Indian Academy of Sciences (India)

    Thin films or a coating of any sort prior to its application into real world has to be studied for the dependence of ..... For line focusing, incident beam mask was employed with ..... org/content/avs/journal/jvst/11/4/10.1116/1.1312732. Thornton J A ...

  4. Voltage-dependent potassium currents in hypertrophied rat astrocytes after a cortical stab wound

    Czech Academy of Sciences Publication Activity Database

    Anděrová, Miroslava; Antonova, Tatiana; Petřík, David; Neprašová, Helena; Chvátal, Alexandr; Syková, Eva

    2004-01-01

    Roč. 48, - (2004), s. 311-326 ISSN 0894-1491 R&D Projects: GA ČR GA305/03/1172; GA ČR GA305/02/1528; GA MŠk LN00A065 Institutional research plan: CEZ:AV0Z5039906 Keywords : CNS injury * astrogliosis Subject RIV: FH - Neurology Impact factor: 4.781, year: 2004

  5. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  6. Large-conductance calcium-dependent potassium channels prevent dendritic excitability in neocortical pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2009-03-01

    Large-conductance calcium-dependent potassium channels (BK channels) are homogeneously distributed along the somatodendritic axis of layer 5 pyramidal neurons of the rat somatosensory cortex. The relevance of this conductance for dendritic calcium electrogenesis was studied in acute brain slices using somatodendritic patch clamp recordings and calcium imaging. BK channel activation reduces the occurrence of dendritic calcium spikes. This is reflected in an increased critical frequency of somatic spikes necessary to activate the distal initiation zone. Whilst BK channels repolarise the somatic spike, they dampen it only in the distal dendrite. Their activation reduces dendritic calcium influx via glutamate receptors. Furthermore, they prevent dendritic calcium electrogenesis and subsequent somatic burst discharges. However, the time window for coincident somatic action potential and dendritic input to elicit dendritic calcium events is not influenced by BK channels. Thus, BK channel activation in layer 5 pyramidal neurons affects cellular excitability primarily by establishing a high threshold at the distal action potential initiation zone.

  7. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    Science.gov (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  8. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  9. Age and sex dependence of body potassium based on studies of 40K under Indian conditions

    International Nuclear Information System (INIS)

    Ranganathan, S.; Someswara Rao, M.; Nagaratnam, A.; Mishra, U.C.

    2002-01-01

    Potassium plays an important role in human life 40 K is a naturally occurring radioisotope of potassium (K) with an abundance of 0.0118%. The measurement of body 40 K in a whole-body counter (WBC) provides a sensitive technique to estimate the total body potassium (TBK). Information on TBK of Indians with age and sex is scanty. Therefore, a systematic study was taken up to generate this information using a sensitive WBC

  10. A novel mechanism for fine-tuning open-state stability in a voltage-gated potassium channel

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Niciforovic, Ana P; Galpin, Jason D

    2013-01-01

    stabilization is the consequence of the amelioration of an inherently repulsive open-state interaction between the partial negative charge on the face of Phe481 and a highly co-evolved acidic side chain, Glu395, and this interaction is potentially modulated through the Tyr485 hydroxyl. We propose...... fluorinated derivatives of aromatic residues previously implicated in the gating of Shaker potassium channels. Here we show that stepwise dispersion of the negative electrostatic surface potential of only one site, Phe481, stabilizes the channel open state. Furthermore, these data suggest that this apparent...

  11. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  12. Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies - a national cohort study

    DEFF Research Database (Denmark)

    Celicanin, M; Blaabjerg, Morten; Maersk-Moller, C

    2017-01-01

    BACKGROUND AND PURPOSE: The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2...... antibodies in the serum/cerebrospinal fluid between 2009 and 2013 with follow-up interviews in 2015 and 2016. METHODS: We evaluated antibody status, symptoms leading to testing, course of disease, suspected diagnosis and time of admission as well as diagnosis and treatment. All magnetic resonance imaging......-Barré syndrome, Creutzfeldt-Jakob disease, neuromyotonia and anti-N-methyl-D-aspartate receptor encephalitis. Magnetic resonance imaging abnormalities were demonstrated in 69% of the LGI1-positive patients. Two patients with normal magnetic resonance imaging demonstrated temporal lobe hypermetabolism using (18...

  13. High-resolution orientation and depth of insertion of the voltage-sensing S4 helix of a potassium channel in lipid bilayers.

    Science.gov (United States)

    Doherty, Tim; Su, Yongchao; Hong, Mei

    2010-08-27

    The opening and closing of voltage-gated potassium (Kv) channels are controlled by several conserved Arg residues in the S4 helix of the voltage-sensing domain. The interaction of these positively charged Arg residues with the lipid membrane has been of intense interest for understanding how membrane proteins fold to allow charged residues to insert into lipid bilayers against free-energy barriers. Using solid-state NMR, we have now determined the orientation and insertion depth of the S4 peptide of the KvAP channel in lipid bilayers. Two-dimensional (15)N correlation experiments of macroscopically oriented S4 peptide in phospholipid bilayers revealed a tilt angle of 40 degrees and two possible rotation angles differing by 180 degrees around the helix axis. Remarkably, the tilt angle and one of the two rotation angles are identical to those of the S4 helix in the intact voltage-sensing domain, suggesting that interactions between the S4 segment and other helices of the voltage-sensing domain are not essential for the membrane topology of the S4 helix. (13)C-(31)P distances between the S4 backbone and the lipid (31)P indicate a approximately 9 A local thinning and 2 A average thinning of the DMPC (1,2-dimyristoyl-sn-glycero-3-phosphochloline)/DMPG (1,2-dimyristoyl-sn-glycero-3-phosphatidylglycerol) bilayer, consistent with neutron diffraction data. Moreover, a short distance of 4.6 A from the guanidinium C(zeta) of the second Arg to (31)P indicates the existence of guanidinium phosphate hydrogen bonding and salt bridges. These data suggest that the structure of the Kv gating helix is mainly determined by protein-lipid interactions instead of interhelical protein-protein interactions, and the S4 amino acid sequence encodes sufficient information for the membrane topology of this crucial gating helix. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  14. Molecular interactions involved in proton-dependent gating in KcsA potassium channels

    Science.gov (United States)

    Posson, David J.; Thompson, Ameer N.; McCoy, Jason G.

    2013-01-01

    The bacterial potassium channel KcsA is gated open by the binding of protons to amino acids on the intracellular side of the channel. We have identified, via channel mutagenesis and x-ray crystallography, two pH-sensing amino acids and a set of nearby residues involved in molecular interactions that influence gating. We found that the minimal mutation of one histidine (H25) and one glutamate (E118) near the cytoplasmic gate completely abolished pH-dependent gating. Mutation of nearby residues either alone or in pairs altered the channel’s response to pH. In addition, mutations of certain pairs of residues dramatically increased the energy barriers between the closed and open states. We proposed a Monod–Wyman–Changeux model for proton binding and pH-dependent gating in KcsA, where H25 is a “strong” sensor displaying a large shift in pKa between closed and open states, and E118 is a “weak” pH sensor. Modifying model parameters that are involved in either the intrinsic gating equilibrium or the pKa values of the pH-sensing residues was sufficient to capture the effects of all mutations. PMID:24218397

  15. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  16. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  17. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  18. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  19. Dependence of radiocaesium biological half-life in freshwater fish on water potassium concentration and temperature

    International Nuclear Information System (INIS)

    Carreiro, M.C.V.; Corisco, J.A.G.

    1998-01-01

    Short-term experiments (35-49 days) showed that the rate of cesium elimination from fish increases with increasing potassium concentration in water (the biological half-life decreases); this, however, is only true of the potassium concentration range of 0.35 to 3.5 ppm, whereas higher potassium concentrations do not seem to affect the elimination rate. Decrease in water temperature within the 20 degC to 5 degC range slows down the cesium elimination process. (P.A.)

  20. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  1. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  2. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  3. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  4. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  6. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  7. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  8. Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo.

    Science.gov (United States)

    Koo, G C; Blake, J T; Talento, A; Nguyen, M; Lin, S; Sirotina, A; Shah, K; Mulvany, K; Hora, D; Cunningham, P; Wunderler, D L; McManus, O B; Slaughter, R; Bugianesi, R; Felix, J; Garcia, M; Williamson, J; Kaczorowski, G; Sigal, N H; Springer, M S; Feeney, W

    1997-06-01

    The voltage activated K+ channel (Kv1.3) has recently been identified as the molecule that sets the resting membrane potential of peripheral human T lymphoid cells. In vitro studies indicate that blockage of Kv1.3 inhibits T cell activation, suggesting that Kv1.3 may be a target for immunosuppression. However, despite the in vitro evidence, there has been no in vivo demonstration that blockade of Kv1.3 will attenuate an immune response. The difficulty is due to species differences, as the channel does not set the membrane potential in rodent peripheral T cells. In this study, we show that the channel is present on peripheral T cells of miniswine. Using the peptidyl Kv1.3 inhibitor, margatoxin, we demonstrate that Kv1.3 also regulates the resting membrane potential, and that blockade of Kv1.3 inhibits, in vivo, both a delayed-type hypersensitivity reaction and an Ab response to an allogeneic challenge. In addition, prolonged Kv1.3 blockade causes reduced thymic cellularity and inhibits the thymic development of T cell subsets. These results provide in vivo evidence that Kv1.3 is a novel target for immunomodulation.

  9. Shaping charge excitations in chiral edge states with a time-dependent gate voltage

    Science.gov (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

    2018-02-01

    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  10. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  11. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  12. Identification of an evolutionarily conserved extracellular threonine residue critical for surface expression and its potential coupling of adjacent voltage-sensing and gating domains in voltage-gated potassium channels.

    Science.gov (United States)

    Mckeown, Lynn; Burnham, Matthew P; Hodson, Charlotte; Jones, Owen T

    2008-10-31

    The dynamic expression of voltage-gated potassium channels (Kvs) at the cell surface is a fundamental factor controlling membrane excitability. In exploring possible mechanisms controlling Kv surface expression, we identified a region in the extracellular linker between the first and second of the six (S1-S6) transmembrane-spanning domains of the Kv1.4 channel, which we hypothesized to be critical for its biogenesis. Using immunofluorescence microscopy, flow cytometry, patch clamp electrophysiology, and mutagenesis, we identified a single threonine residue at position 330 within the Kv1.4 S1-S2 linker that is absolutely required for cell surface expression. Mutation of Thr-330 to an alanine, aspartate, or lysine prevented surface expression. However, surface expression occurred upon co-expression of mutant and wild type Kv1.4 subunits or mutation of Thr-330 to a serine. Mutation of the corresponding residue (Thr-211) in Kv3.1 to alanine also caused intracellular retention, suggesting that the conserved threonine plays a generalized role in surface expression. In support of this idea, sequence comparisons showed conservation of the critical threonine in all Kv families and in organisms across the evolutionary spectrum. Based upon the Kv1.2 crystal structure, further mutagenesis, and the partial restoration of surface expression in an electrostatic T330K bridging mutant, we suggest that Thr-330 hydrogen bonds to equally conserved outer pore residues, which may include a glutamate at position 502 that is also critical for surface expression. We propose that Thr-330 serves to interlock the voltage-sensing and gating domains of adjacent monomers, thereby yielding a structure competent for the surface expression of functional tetramers.

  13. Regulation of voltage-gated potassium channels attenuates resistance of side-population cells to gefitinib in the human lung cancer cell line NCI-H460.

    Science.gov (United States)

    Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong

    2017-02-21

    Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.

  14. Common variants in the hERG (KCNH2) voltage-gated potassium channel are associated with altered fasting and glucose-stimulated plasma incretin and glucagon responses

    DEFF Research Database (Denmark)

    Engelbrechtsen, Line; Mahendran, Yuvaraj; Jonsson, Anna

    2018-01-01

    BACKGROUND: Patients with long QT syndrome due to rare loss-of-function mutations in the human ether-á-go-go-related gene (hERG) have prolonged QT interval, risk of arrhythmias, increased secretion of insulin and incretins and impaired glucagon response to hypoglycemia. This is caused by a dysfun......BACKGROUND: Patients with long QT syndrome due to rare loss-of-function mutations in the human ether-á-go-go-related gene (hERG) have prolonged QT interval, risk of arrhythmias, increased secretion of insulin and incretins and impaired glucagon response to hypoglycemia. This is caused...... by a dysfunctional Kv11.1 voltage-gated potassium channel. Based on these findings in patients with rare variants in hERG, we hypothesized that common variants in hERG may also lead to alterations in glucose homeostasis. Subsequently, we aimed to evaluate the effect of two common gain-of-function variants in hERG...... in hERG on QT-interval and circulation levels of incretins, insulin and glucagon. The Danish population-based Inter99 cohort (n = 5895) was used to assess the effect of common variants on QT-interval. The Danish ADDITION-PRO cohort was used (n = 1329) to study genetic associations with levels of GLP-1...

  15. Serum Starvation-Induced Voltage-Gated Potassium Channel Kv7.5 Expression and Its Regulation by Sp1 in Canine Osteosarcoma Cells

    Directory of Open Access Journals (Sweden)

    Bo Hyung Lee

    2014-01-01

    Full Text Available The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy.

  16. EEG Differences in Two Clinically Similar Rapid Dementias: Voltage-Gated Potassium Channel Complex-Associated Autoimmune Encephalitis and Creutzfeldt-Jakob Disease.

    Science.gov (United States)

    Freund, Brin; Probasco, John C; Cervenka, Mackenzie C; Sutter, Raoul; Kaplan, Peter W

    2018-05-01

    Distinguishing treatable causes for rapidly progressive dementia from those that are incurable is vital. Creutzfeldt-Jakob disease (CJD) and voltage-gated potassium channel complex-associated autoimmune encephalitis (VGKC AE) are 2 such conditions with disparate outcomes and response to treatment. To determine the differences in electroencephalography between CJD and VGKC AE, we performed a retrospective review of medical records and examined clinical data, neuroimaging, and electroencephalographs performed in patients admitted for evaluation for rapidly progressive dementia diagnosed with CJD and VGKC AE at the Johns Hopkins Hospital and Bayview Medical Center between January 1, 2007 and December 31, 2015. More patients in the VGKC AE group had seizures (12/17) than those with CJD (3/14; P = .008). Serum sodium levels were lower in those with VGKC AE ( P = .001). Cerebrospinal fluid (CSF) white blood cell count was higher in VGKC AE ( P = .008). CSF protein 14-3-3 ( P = .018) was more commonly detected in CJD, and tau levels were higher in those with CJD ( P VGKC AE, and electroencephalography can aid in their diagnoses. Performing serial EEGs better delineates these conditions.

  17. Mutation in the kv3.3 voltage-gated potassium channel causing spinocerebellar ataxia 13 disrupts sound-localization mechanisms.

    Directory of Open Access Journals (Sweden)

    John C Middlebrooks

    Full Text Available Normal sound localization requires precise comparisons of sound timing and pressure levels between the two ears. The primary localization cues are interaural time differences, ITD, and interaural level differences, ILD. Voltage-gated potassium channels, including Kv3.3, are highly expressed in the auditory brainstem and are thought to underlie the exquisite temporal precision and rapid spike rates that characterize brainstem binaural pathways. An autosomal dominant mutation in the gene encoding Kv3.3 has been demonstrated in a large Filipino kindred manifesting as spinocerebellar ataxia type 13 (SCA13. This kindred provides a rare opportunity to test in vivo the importance of a specific channel subunit for human hearing. Here, we demonstrate psychophysically that individuals with the mutant allele exhibit profound deficits in both ITD and ILD sensitivity, despite showing no obvious impairment in pure-tone sensitivity with either ear. Surprisingly, several individuals exhibited the auditory deficits even though they were pre-symptomatic for SCA13. We would expect that impairments of binaural processing as great as those observed in this family would result in prominent deficits in localization of sound sources and in loss of the "spatial release from masking" that aids in understanding speech in the presence of competing sounds.

  18. IgG and complement deposition and neuronal loss in cats and humans with epilepsy and voltage-gated potassium channel complex antibodies.

    Science.gov (United States)

    Klang, Andrea; Schmidt, Peter; Kneissl, Sibylle; Bagó, Zoltán; Vincent, Angela; Lang, Bethan; Moloney, Teresa; Bien, Christian G; Halász, Péter; Bauer, Jan; Pákozdy, Akos

    2014-05-01

    Voltage-gated potassium channel complex (VGKC-complex) antibody (Ab) encephalitis is a well-recognized form of limbic encephalitis in humans, usually occurring in the absence of an underlying tumor. The patients have a subacute onset of seizures, magnetic resonance imaging findings suggestive of hippocampal inflammation, and high serum titers of Abs against proteins of the VGKC-complex, particularly leucine-rich, glioma-inactivated 1 (LGI1). Most patients are diagnosed promptly and recover substantially with immunotherapies; consequently, neuropathological data are limited. We have recently shown that feline complex partial cluster seizures with orofacial involvement (FEPSO) in cats can also be associated with Abs against VGKC-complexes/LGI1. Here we examined the brains of cats with FEPSO and compared the neuropathological findings with those in a human with VGKC-complex-Ab limbic encephalitis. Similar to humans, cats with VGKC-complex-Ab and FEPSO have hippocampal lesions with only moderate T-cell infiltrates but with marked IgG infiltration and complement C9neo deposition on hippocampal neurons, associated with neuronal loss. These findings provide further evidence that FEPSO is a feline form of VGKC-complex-Ab limbic encephalitis and provide a model for increasing understanding of the human disease.

  19. Limbic encephalitis associated with anti-voltage-gated potassium channel complex antibodies as a cause of adult-onset mesial temporal lobe epilepsy.

    Science.gov (United States)

    Toyota, Tomoko; Akamatsu, Naoki; Tsuji, Sadatoshi; Nishizawa, Shigeru

    2014-06-01

    Recently, some reports have indicated that limbic encephalitis associated with anti-voltage-gated potassium channel complex antibodies (VGKC-Ab) is a cause of adult-onset mesial temporal lobe epilepsy (MTLE). We report a 53-year-old woman who had her first epileptic seizure at the age of 50 years old. Examination by 3-Tesla brain MRI revealed left hippocampal high signal intensity and swelling on fluid-attenuated inversion recovery (FLAIR) and T2-weighted imaging at 2 months after her first seizure. The patient received intravenous methylprednisolone and carbamazepine 300 mg/day. One month later, MRI revealed improvement of her left hippocampal abnormalities. Thereafter, she had no seizures, however, three years after her first seizure, EEG revealed a seizure pattern in the left temporal region. Brain MRI revealed left hippocampal high signal intensity and brain fluorodeoxyglucose positron emission tomography revealed hypermetabolism. Her serum VGKC-Ab levels were 118 pM(normal VGKC-Ab levels decreased to 4.4 pM. Remission of the epileptic seizures was also observed. This MTLE in the middle age was considered as limbic encephalitis associated with anti- VGKC-Ab. In cases of unexplained adult-onset MTLE, limbic encephalitis associated with anti-VGKC-Ab, which responds well to immunotherapy, should be considered in the differential diagnosis.

  20. T-dependent B-cell activation is signalled by an early increase in potassium influx

    DEFF Research Database (Denmark)

    Owens, T; Kaplan, J G

    1982-01-01

    both by incorporation of 3H-thymidine after 48 h of culture and by uptake of potassium (measured as 86Rb) after 15 h. Analysis of metaphase chromosomes stained with Hoechst dye 33258 from co-cultured T-enriched and nude lymphocytes (from female and male donors, respectively) mixed in the proportion 1...

  1. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  2. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  3. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    Science.gov (United States)

    Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

    2016-03-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

  4. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    International Nuclear Information System (INIS)

    Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

    2016-01-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

  5. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

    Science.gov (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

    2010-01-01

    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  6. Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

    Science.gov (United States)

    Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

    2013-01-01

    Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

  7. Inward rectifier potassium (Kir2.1) channels as end-stage boosters of endothelium-dependent vasodilators.

    Science.gov (United States)

    Sonkusare, Swapnil K; Dalsgaard, Thomas; Bonev, Adrian D; Nelson, Mark T

    2016-06-15

    Increase in endothelial cell (EC) calcium activates calcium-sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium-dependent vasodilatation. Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium-dependent vasodilatation is not clear. In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform. Endothelium-dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown. These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Endothelium-dependent vasodilators, such as acetylcholine, increase intracellular Ca(2+) through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca(2+) -sensitive intermediate and small conductance K(+) (IK and SK, respectively) channels. Although strong inward rectifier K(+) (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC-dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC-dependent vasodilatation of resistance-sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC-specific Kir2.1 knockdown (EC-Kir2.1(-/-) ) mice. Elevation of extracellular K(+) to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial denudation and Kir channel

  8. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  9. Clinical presentation of anti-N-methyl-d-aspartate receptor and anti-voltage-gated potassium channel complex antibodies in children: A series of 24 cases.

    Science.gov (United States)

    Konuskan, Bahadir; Yildirim, Mirac; Topaloglu, Haluk; Erol, Ilknur; Oztoprak, Ulkuhan; Tan, Huseyin; Gocmen, Rahsan; Anlar, Banu

    2018-01-01

    The symptomatology and paraclinical findings of antibody-mediated encephalitis, a relatively novel disorder, are still being characterized in adults and children. A high index of suspicion is needed in order to identify these cases among children presenting with various neurological symptoms. The aim of this study is to examine the clinical, demographic and laboratory findings and outcome of children with anti-NMDAR and anti-VGKC encephalitis for any typical or distinctive features. Cases diagnosed with anti-N-Methyl d-aspartate receptor (NMDAR) and anti-voltage gated potassium channel (VGKC) antibody-mediated encephalopathy in four major child neurology centers are described. In four years, 16 children with NMDAR and 8 children with VGKC antibody-associated disease were identified in the participating centers. The most frequent initial manifestation consisted of generalized seizures and cognitive symptoms in both groups. Movement abnormalities were frequent in anti-NMDAR patients and autonomic symptoms, in anti-VGKC patients. Cerebrospinal fluid (CSF) protein, cell count and IgG index were normal in 9/15 anti-NMDAR and 5/8 anti-VGKC patients tested. EEG and MRI findings were usually nonspecific and non-contributory. The rate and time of recovery was not related to age, sex, acute or subacute onset, antibody type, MRI, EEG or CSF results. Treatment within 3 months of onset was associated with normal neurological outcome. Our results suggest anti-NMDAR and VGKC encephalopathies mostly present with non-focal neurological symptoms longer than 3 weeks. In contrast with adult cases, routine CSF testing, MRI and EEG did not contribute to the diagnosis in this series. Copyright © 2017 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  10. Expression of the voltage-gated potassium channel KCNQ1 in mammalian taste bud cells and the effect of its null-mutation on taste preferences.

    Science.gov (United States)

    Wang, Hong; Iguchi, Naoko; Rong, Qi; Zhou, Minliang; Ogunkorode, Martina; Inoue, Masashi; Pribitkin, Edmund A; Bachmanov, Alexander A; Margolskee, Robert F; Pfeifer, Karl; Huang, Liquan

    2009-01-20

    Vertebrate taste buds undergo continual cell turnover. To understand how the gustatory progenitor cells in the stratified lingual epithelium migrate and differentiate into different types of mature taste cells, we sought to identify genes that were selectively expressed in taste cells at different maturation stages. Here we report the expression of the voltage-gated potassium channel KCNQ1 in mammalian taste buds of mouse, rat, and human. Immunohistochemistry and nuclear staining showed that nearly all rodent and human taste cells express this channel. Double immunostaining with antibodies against type II and III taste cell markers validated the presence of KCNQ1 in these two types of cells. Co-localization studies with cytokeratin 14 indicated that KCNQ1 is also expressed in type IV basal precursor cells. Null mutation of the kcnq1 gene in mouse, however, did not alter the gross structure of taste buds or the expression of taste signaling molecules. Behavioral assays showed that the mutant mice display reduced preference to some umami substances, but not to any other taste compounds tested. Gustatory nerve recordings, however, were unable to detect any significant change in the integrated nerve responses of the mutant mice to umami stimuli. These results suggest that although it is expressed in nearly all taste bud cells, the function of KCNQ1 is not required for gross taste bud development or peripheral taste transduction pathways, and the reduced preference of kcnq1-null mice in the behavioral assays may be attributable to the deficiency in the central nervous system or other organs.

  11. Creutzfeldt-Jakob Disease-Like Periodic Sharp Wave Complexes in Voltage-Gated Potassium Channel-Complex Antibodies Encephalitis: A Case Report.

    Science.gov (United States)

    Savard, Martin; Irani, Sarosh R; Guillemette, Annie; Gosselin-Lefebvre, Stéphanie; Geschwind, Michael; Jansen, Gerard H; Gould, Peter V; Laforce, Robert

    2016-02-01

    Voltage-gated potassium channel-complex antibodies (VGKC-cAbs) encephalitis, a treatable autoantibody encephalopathy, has been previously reported to clinically mimic sporadic Creutzfeldt-Jakob disease. Among available clinical clues to distinguish them, periodic sharp wave complexes, a typical finding in sporadic Creutzfeldt-Jakob disease, have never been reported in association with VGKC-cAbs encephalitis. A 76-year-old man was transferred to a tertiary neurology center with a clinical history of 6-month weight loss, cognitive disturbance, and nonspecific generalized weakness. He had two seizures the month before transfer and then evolved to severe encephalopathy, requiring mechanical ventilation. Periodic sharp wave complexes every 1 to 2 seconds over slowed background were found on EEG, and MRI showed cerebellar and bifrontal cortical T2/FLAIR/DWI hypersignal without restricted diffusion on ADC mapping. Pancorporal positron emission tomography scan was negative. An immunotherapy trial did not improve the patient condition. Therefore, he died after life support withdrawal. Brain autopsy revealed mononuclear neocortex infiltrate without significant spongiosis, and the anti-VGKC test showed a seropositivity of 336 pmol/L (normal, 0-31), 3 month after the patient deceased. This is the first reported case of VGKC-cAbs encephalitis associated with periodic sharp wave complexes on EEG, which further confuse the differential diagnosis with sporadic Creutzfeldt-Jakob disease. However, the cortical DWI hypersignal without restriction seems to remain a way to discriminate these two entities appropriately, when present. These clues are of paramount importance because VGKC-cAbs encephalitis is a treatable disease.

  12. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  13. Porosity Dependence of Piezoelectric Properties for Porous Potassium Niobate System Ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Wada, S; Mase, Y; Shimizu, S; Maeda, K; Fujii, I; Nakashima, K; Pulpan, P; Miyajima, N, E-mail: swada@yamanashi.ac.jp [Interdisciplinary Graduate School of Medical and Engineering, University of Yamanashi, 4-4-37 Takeda, Kofu, Yamanashi 400-8510 (Japan)

    2011-10-29

    Porous potassium niobate (KNbO{sub 3}, KN) system ceramics were prepared by a conventional sintering method using carbon black (CB) nanoparticles. First, KN nanoparticles with a size of 100 nm was mixed with CB nanoparticles and binder using ball milling with ethanol. The mixture was dried, and pressed into pellets using uniaxial pressing. After binder burnout, these ceramics was sintered in air. Their piezoelectric properties were measured and discussed a relationship between porosity and piezoelectric properties. As the results, with increasing porosity, piezoelectric g33 constant increased significantly, which suggested that porous ceramics were effective for stress sensor application.

  14. Porosity Dependence of Piezoelectric Properties for Porous Potassium Niobate System Ceramics

    International Nuclear Information System (INIS)

    Wada, S; Mase, Y; Shimizu, S; Maeda, K; Fujii, I; Nakashima, K; Pulpan, P; Miyajima, N

    2011-01-01

    Porous potassium niobate (KNbO 3 , KN) system ceramics were prepared by a conventional sintering method using carbon black (CB) nanoparticles. First, KN nanoparticles with a size of 100 nm was mixed with CB nanoparticles and binder using ball milling with ethanol. The mixture was dried, and pressed into pellets using uniaxial pressing. After binder burnout, these ceramics was sintered in air. Their piezoelectric properties were measured and discussed a relationship between porosity and piezoelectric properties. As the results, with increasing porosity, piezoelectric g33 constant increased significantly, which suggested that porous ceramics were effective for stress sensor application.

  15. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  16. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  17. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  18. Aldosterone downregulates delayed rectifier potassium currents through an angiotensin type 1 receptor-dependent mechanism.

    Science.gov (United States)

    Lv, Yankun; Wang, Yanjun; Zhu, Xiaoran; Zhang, Hua

    2018-01-01

    We have previously shown that aldosterone downregulates delayed rectifier potassium currents (I Ks ) via activation of the mineralocorticoid receptor (MR) in adult guinea pig cardiomyocytes. Here, we investigate whether angiotensin II/angiotensin type 1 receptor (AngII/AT1R) and intracellular calcium also play a role in these effects. Ventricular cardiomyocytes were isolated from adult guinea pigs and incubated with aldosterone (1 μmol·L -1 ) either alone or in combination with enalapril (1 μmol·L -1 ), losartan (1 μmol·L -1 ), nimodipine (1 μmol·L -1 ), or BAPTA-AM (2.5 μmol·L -1 ) for 24 h. We used the conventional whole cell patch-clamp technique to record the I Ks component. In addition, we evaluated expression of the I Ks subunits KCNQ1 and KCNE1 using Western blotting. Our results showed that both enalapril and losartan, but not nimodipine or BAPTA-AM, completely reversed the aldosterone-induced inhibition of I Ks and its effects on KCNQ1/KCNE1 protein levels. Furthermore, we found that AngII/AT1R mediates the inhibitory effects of aldosterone on I Ks . Finally, the downregulation of I Ks induced by aldosterone did not occur secondarily to a change in intracellular calcium concentrations. Taken together, our findings demonstrate that crosstalk between MR and AT1R underlies the effects of aldosterone, and provide new insights into the mechanism underlying potassium channels.

  19. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  20. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    International Nuclear Information System (INIS)

    Miah, M. Idrish

    2008-01-01

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

  1. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

    2008-10-15

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

  2. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

    2010-01-01

    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  3. Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

    International Nuclear Information System (INIS)

    Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

    1993-01-01

    The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

  4. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  5. A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

    Science.gov (United States)

    Kajma, Anna; Szewczyk, Adam

    2012-10-01

    Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

  6. The dependence of orange-red IRSL decay curves of potassium feldspars on sample temperature

    International Nuclear Information System (INIS)

    Fattahi, Morteza

    2004-01-01

    This paper presents the effects of stimulation temperature on the infrared stimulated orange-red (600-650 nm) luminescence emission (orange-red infrared simulated luminescence (IRSL)) in potassium feldspar. Investigations explore the relationship between initial (0-2 s), integral (0-100 s), net initial (0-2 s less background over 2 s), net integral (0-100 s less background over 100 s) and last 2 s of the orange-red IRSL signals obtained for 100 s versus stimulation temperature (20-460 degree sign C) on both unpreheated and preheated samples. In the potassium feldspar sample examined, competition effects, including thermal enhancement, depletion and possibly quenching affect the orange-red IRSL signals measured. Observed effects (e.g., thermal enhancement, thermal activation energy and the decay rate) over the temperature range 20-120 degree sign C may be explained by tunnelling luminescence processes, IR transitions to the conduction band following excitations from ground state of electron trap by acquiring thermal energy from the lattice and or the random-walk band-tail model. Preheating prior to orange-red IRSL and Thermoluminescence (TL) measurements provides evidence that there are both shallow and deep traps responsible for low- and high-temperature orange-red IRSL and TL peaks. The effects of both preheating and IR bleaching on the orange-red thermally stimulated luminescence (red emission during thermoluminescence, RTL) provide evidence that bleached RTL traps have no significant contribution in the production of orange-red IRSL signals

  7. Autoantibodies against voltage-gated potassium channel and glutamic acid decarboxylase in psychosis: A systematic review, meta-analysis, and case series.

    Science.gov (United States)

    Grain, Rosemary; Lally, John; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy R; Murray, Robin M; Gaughran, Fiona

    2017-10-01

    Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevalence of 1.5% (25/1720) compared to 0.7% in healthy controls (12/1753). Meta-analysis established that the pooled prevalence of GAD65 autoantibodies was 5.8% (95% confidence interval [CI]: 2.0-15.6%; I 2  = 91%; nine studies) in psychotic disorders, with a prevalence of 4.6% (95%CI: 1.2-15.9%; nine studies; I 2  = 89%) and 6.2% (95%CI: 1.2-27.0%; two studies; I 2  = 69%) in schizophrenia and bipolar disorder, respectively. People with psychosis were more likely to have GAD65 antibodies than controls (odds ratio [OR], 2.24; 95%CI: 1.28-3.92%; P = 0.005; eight studies; I 2  = 0%). Among 21 participants with treatment-resistant psychosis, none had VGKC antibodies. The prevalence of VGKC antibodies is low in psychosis. Our preliminary meta-analysis suggests that GAD autoantibodies are more common in people with psychosis than in controls, although few studies accounted for the possibility of co-existing type 1 diabetes mellitus and the clinical significance of reported GAD titers remains unclear. The paucity of studies reporting thresholds for defining GAD abnormality and rates of comorbid type 1 diabetes mellitus precludes interpretations regarding the influence of GAD antibodies on the development of psychotic disorders and may have led to an overestimate of the prevalence of GAD. Our case series fails to support the hypothesis that VGKC antibodies are linked to treatment resistance in psychosis, but the literature to date is remarkably sparse. © 2017 The

  8. Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies - a national cohort study.

    Science.gov (United States)

    Celicanin, M; Blaabjerg, M; Maersk-Moller, C; Beniczky, S; Marner, L; Thomsen, C; Bach, F W; Kondziella, D; Andersen, H; Somnier, F; Illes, Z; Pinborg, L H

    2017-08-01

    The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2 antibodies in the serum/cerebrospinal fluid between 2009 and 2013 with follow-up interviews in 2015 and 2016. We evaluated antibody status, symptoms leading to testing, course of disease, suspected diagnosis and time of admission as well as diagnosis and treatment. All magnetic resonance imaging, electroencephalography and 18 F-fluorodeoxyglucose positron emission tomography scans were re-evaluated by experts in the field. A total of 28/192 patients tested positive for VGKC-complex antibodies by radioimmunoassay and indirect immunofluorescence; 17 had antibodies to LGI1 and 6/7 of the available cerebrospinal fluids from these patients were seropositive. These 17 patients all had a clinical phenotype appropriate to LGI1 antibodies. The remaining 11 were LGI1 negative (n = 4) or not tested (n = 7). Of these, two had a phenotype consistent with limbic encephalitis. The remaining phenotypes were Guillain-Barré syndrome, Creutzfeldt-Jakob disease, neuromyotonia and anti-N-methyl-D-aspartate receptor encephalitis. Magnetic resonance imaging abnormalities were demonstrated in 69% of the LGI1-positive patients. Two patients with normal magnetic resonance imaging demonstrated temporal lobe hypermetabolism using 18 F-fluorodeoxyglucose positron emission tomography. Abnormal electroencephalography recordings were found in 86% of the patients. Upon follow-up (median 3.2 years), the median modified Rankin Scale score of anti-LGI1-positive patients was 2 and only two patients reported seizures in the past year. Patients diagnosed with anti-LGI1 autoimmune encephalitis increased significantly from 2009 to 2014, probably due to increased awareness. In contrast to seropositive anti-VGKC-complex patients, all anti-LGI1

  9. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  10. Diadenosine pentaphosphate affects electrical activity in guinea pig atrium via activation of potassium acetylcholine-dependent inward rectifier.

    Science.gov (United States)

    Abramochkin, Denis V; Karimova, Viktoria M; Filatova, Tatiana S; Kamkin, Andre

    2017-07-01

    Diadenosine pentaphosphate (Ap5A) belongs to the family of diadenosine polyphosphates, endogenously produced compounds that affect vascular tone and cardiac performance when released from platelets. The previous findings indicate that Ap5A shortens action potentials (APs) in rat myocardium via activation of purine P2 receptors. The present study demonstrates alternative mechanism of Ap5A electrophysiological effects found in guinea pig myocardium. Ap5A (10 -4  M) shortens APs in guinea pig working atrial myocardium and slows down pacemaker activity in the sinoatrial node. P1 receptors antagonist DPCPX (10 -7  M) or selective GIRK channels blocker tertiapin (10 -6  M) completely abolished all Ap5A effects, while P2 blocker PPADS (10 -4  M) was ineffective. Patch-clamp experiments revealed potassium inward rectifier current activated by Ap5A in guinea pig atrial myocytes. The current was abolished by DPCPX or tertiapin and therefore was considered as potassium acetylcholine-dependent inward rectifier (I KACh ). Thus, unlike rat, in guinea pig atrium Ap5A produces activation of P1 receptors and subsequent opening of KACh channels leading to negative effects on cardiac electrical activity.

  11. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.

    1993-01-01

    We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

  12. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  13. Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

    Science.gov (United States)

    Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

    2014-01-01

    The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

  14. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  15. A Novel Reconfigurable Logic Unit Based on the DNA-Templated Potassium-Concentration-Dependent Supramolecular Assembly.

    Science.gov (United States)

    Yang, Chunrong; Zou, Dan; Chen, Jianchi; Zhang, Linyan; Miao, Jiarong; Huang, Dan; Du, Yuanyuan; Yang, Shu; Yang, Qianfan; Tang, Yalin

    2018-03-15

    Plenty of molecular circuits with specific functions have been developed; however, logic units with reconfigurability, which could simplify the circuits and speed up the information process, are rarely reported. In this work, we designed a novel reconfigurable logic unit based on a DNA-templated, potassium-concentration-dependent, supramolecular assembly, which could respond to the input stimuli of H + and K + . By inputting different concentrations of K + , the logic unit could implement three significant functions, including a half adder, a half subtractor, and a 2-to-4 decoder. Considering its reconfigurable ability and good performance, the novel prototypes developed here may serve as a promising proof of principle in molecular computers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Alteration of sodium, potassium-adenosine triphosphatase activity in rabbit ciliary processes by cyclic adenosine monophosphate-dependent protein kinase

    International Nuclear Information System (INIS)

    Delamere, N.A.; Socci, R.R.; King, K.L.

    1990-01-01

    The response of sodium, potassium-adenosine triphosphatase (Na,K-ATPase) to cyclic adenosine monophosphate (cAMP)-dependent protein kinase was examined in membranes obtained from rabbit iris-ciliary body. In the presence of the protein kinase together with 10(-5) M cAMP, Na,K-ATPase activity was reduced. No change in Na,K-ATPase activity was detected in response to the protein kinase without added cAMP. Likewise cAMP alone did not alter Na,K-ATPase activity. Reduction of Na,K-ATPase activity was also observed in the presence of the cAMP-dependent protein kinase catalytic subunit. The response of the enzyme to the kinase catalytic subunit was also examined in membranes obtained from rabbit ciliary processes. In the presence of 8 micrograms/ml of the catalytic subunit, ciliary process Na,K-ATPase activity was reduced by more than 50%. To examine whether other ATPases were suppressed by the protein kinase, calcium-stimulated ATPase activity was examined; its activity was stimulated by the catalytic subunit. To test whether the response of the ciliary process Na,K-ATPase is unique, experiments were also performed using membrane preparations from rabbit lens epithelium or rabbit kidney; the catalytic subunit significantly reduced the activity of Na,K-ATPase from the kidney but not the lens. These Na,K-ATPase studies suggest that in the iris-ciliary body, cAMP may alter sodium pump activity. In parallel 86Rb uptake studies, we observed that ouabain-inhibitable potassium uptake by intact pieces of iris-ciliary body was reduced by exogenous dibutryl cAMP or by forskolin

  17. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  18. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  19. Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

    DEFF Research Database (Denmark)

    Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

    2003-01-01

    The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

  20. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D

    1987-05-01

    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  1. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  2. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  3. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  4. Characterization of bicarbonate-dependent potassium uptake in cultured corneal endothelial cells

    International Nuclear Information System (INIS)

    Savion, N.; Farzame, N.; Berlin, H.B.

    1989-01-01

    Bovine corneal endothelial (BCE) cells in culture demonstrated 86Rb+ uptake which was mostly ouabain-sensitive with some (15 to 50%) ouabain-insensitive uptake that was dependent on the presence of bicarbonate in the incubation medium. Bovine smooth muscle (SM) cells demonstrated ouabain-sensitive 86Rb+ uptake but the ouabain-insensitive 86Rb+ uptake was not bicarbonate-dependent. Although omission of bicarbonate from the incubation buffer resulted in some reduction in the pH, this change was not responsible for the reduction in the ouabain-insensitive 86Rb+ uptake. Furthermore, the removal of bicarbonate decreased the 86Rb+ influx but not its efflux. This ouabain-insensitive and bicarbonate-dependent 86Rb+ influx in BCE cells proceeded at a linear rate for at least 60 min and increased as a function of bicarbonate concentration such that almost maximal uptake was observed at a concentration of about 10 to 15 mM. Saturation of the bicarbonate-dependent 86Rb+ pump in BCE cells occurred at a concentration of 2 mM Rb+ in the incubation buffer, similar to the previously observed value for the Na+, K+-ATPase. Competition experiments with both unlabeled Rb+ and K+ demonstrated that likewise in the Na+, K+-ATPase the 86Rb+ influx represented physiological influx of K+. Furthermore, the energy requirements of the bicarbonate-dependent 86Rb+ uptake were similar to those of the 86Rb+ uptake via the Na+, K+-ATPase. The results described in this work demonstrated a novel bicarbonate-dependent K+ pump in addition to the Na+, K+-ATPase pump.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  6. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  7. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  8. Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor

    Science.gov (United States)

    Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko

    2013-01-01

    In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752

  9. Inward rectifier potassium (Kir2.1) channels as end‐stage boosters of endothelium‐dependent vasodilators

    Science.gov (United States)

    Dalsgaard, Thomas; Bonev, Adrian D.; Nelson, Mark T.

    2016-01-01

    Key points Increase in endothelial cell (EC) calcium activates calcium‐sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium‐dependent vasodilatation.Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium‐dependent vasodilatation is not clear.In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform.Endothelium‐dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown.These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Abstract Endothelium‐dependent vasodilators, such as acetylcholine, increase intracellular Ca2+ through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca2+‐sensitive intermediate and small conductance K+ (IK and SK, respectively) channels. Although strong inward rectifier K+ (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC‐dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC‐dependent vasodilatation of resistance‐sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC‐specific Kir2.1 knockdown (EC‐Kir2.1 −/−) mice. Elevation of extracellular K+ to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial

  10. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    International Nuclear Information System (INIS)

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  11. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  12. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  13. Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

    DEFF Research Database (Denmark)

    Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

    1999-01-01

    bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

  14. Voltage-gated potassium channel (K(v) 1) autoantibodies in patients with chagasic gut dysmotility and distribution of K(v) 1 channels in human enteric neuromusculature (autoantibodies in GI dysmotility).

    Science.gov (United States)

    Hubball, A W; Lang, B; Souza, M A N; Curran, O D; Martin, J E; Knowles, C H

    2012-08-01

    Autoantibodies directed against specific neuronal antigens are found in a significant number of patients with gastrointestinal neuromuscular diseases (GINMDs) secondary to neoplasia. This study examined the presence of antineuronal antibodies in idiopathic GINMD and GINMD secondary to South American Trypanosomiasis. The GI distribution of voltage-gated potassium channels (VGKCs) was also investigated. Seventy-three patients were included in the study with diagnoses of primary achalasia, enteric dysmotility, chronic intestinal pseudo-obstruction, esophageal or colonic dysmotility secondary to Chagas' disease. Sera were screened for specific antibodies to glutamic acid decarboxylase, voltage-gated calcium channels (VGCCs; P/Q subtype), nicotinic acetylcholine receptors (nAChRs; α3 subtype), and voltage-gated potassium channels (VGKCs, K(V) 1 subtype) using validated immunoprecipitation assays. The distribution of six VGKC subunits (K(V) 1.1-1.6), including those known to be antigenic targets of anti-VGKC antibodies was immunohistochemically investigated in all main human GI tract regions. Three patients (14%) with chagasic GI dysmotility were found to have positive anti-VGKC antibody titers. No antibodies were detected in patients with idiopathic GINMD. The VGKCs were found in enteric neurons at every level of the gut in unique yet overlapping distributions. The VGKC expression in GI smooth muscle was found to be limited to the esophagus. A small proportion of patients with GI dysfunction secondary to Chagas' disease have antibodies against VGKCs. The presence of these channels in the human enteric nervous system may have pathological relevance to the growing number of GINMDs with which anti-VGKC antibodies have been associated. © 2012 Blackwell Publishing Ltd.

  15. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  16. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  17. Intracellular mediators of potassium-induced aldosterone secretion

    International Nuclear Information System (INIS)

    Ganguly, A.; Chiou, S.; Davis, J.S.

    1990-01-01

    We have investigated the intracellular messengers of potassium in eliciting aldosterone secretion in calf adrenal glomerulosa cells since there were unresolved issues relating to the role of phosphoinositides, cAMP and protein kinases. We observed no evidence of hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP 2 ) in 3 H-inositol labeled alf adrenal cells or increase of cAMP in response to potassium. Addition of calcium channel blocker, nitrendipine after stimulating adrenal glomerulosa cells with potassium, markedly inhibited aldosterone secretion. A calmodulin inhibitor (W-7) produced greater reduction of aldosterone secretion than an inhibitor of protein kinase C (H-7). These results suggest that a rise in cytosolic free calcium concentration through voltage-dependent calcium channel and calmodulin are the critical determinants of aldosterone secretion stimulated by potassium

  18. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  19. Measurement of the energy dependence of X-ray-induced decomposition of potassium chlorate.

    Science.gov (United States)

    Pravica, Michael; Bai, Ligang; Sneed, Daniel; Park, Changyong

    2013-03-21

    We report the first measurements of the X-ray induced decomposition of KClO3 as a function of energy in two experiments. KClO3 was pressurized to 3.5 GPa and irradiated with monochromatic synchrotron X-rays ranging in energy from 15 to 35 keV in 5 keV increments. A systematic increase in the decomposition rate as the energy was decreased was observed, which agrees with the 1/E(3) trend for the photoelectric process, except at the lowest energy studied. A second experiment was performed to access lower energies (10 and 12 keV) using a beryllium gasket; suggesting an apparent resonance near 15 keV or 0.83 Ǻ maximizing the chemical decomposition rate. A third experiment was performed using KIO3 to ascertain the anionic dependence of the decomposition rate, which was observed to be far slower than in KClO3, suggesting that the O-O distance is the critical factor in chemical reactions. These results will be important for more efficiently initiating chemical decomposition in materials using selected X-ray wavelengths that maximize decomposition to aid useful hard X-ray-induced chemistry and contribute understanding of the mechanism of X-ray-induced decomposition of the chlorates.

  20. Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

    International Nuclear Information System (INIS)

    Pe, T.; McDonald, J.; Clem, J.R.

    1995-01-01

    The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

  1. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  2. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  3. Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

    International Nuclear Information System (INIS)

    Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

    2015-01-01

    The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

  4. Dependence of the concentrations of "1"3"7Cs and potassium in extracted soil solutions on soil humidity before centrifugation

    International Nuclear Information System (INIS)

    Prorok, V.V.; Datsenko, O.Yi.; Bulavyin, L.A.; Zlens'kij, S.Je.; Melnichenko, L.Yu.; Rozuvan, S.G.; Poperenko, L.V.; White, P.J.

    2017-01-01

    Concentrations of 137Cs and potassium in solutions extracted by centrifugation from soils selected at some experimental sites in the 10-km Exclusion Zone of Chornobyl Nuclear Plant were determined. The results showed that for the majority of investigated soils, the concentration of 137Cs in soil solution depends on the humidity of the soil before centrifugation. It is possible to explain the dependence of the concentration of 137Cs in the soil solution on soil humidity from the dependence of the concentrations of molecules of different molecular-gravimetric fractions in soil solution on soil humidity. Considerable amount of 137Cs in soil solution is associated with these molecules, that is why the concentration of 137Cs in the extracted soil solution changes with the humidity of soil. These dependences differ between soils. For the majority of investigated soils the concentration of 137Cs in the extracted soil solution increases with increasing humidity of the soil. By contrast, soil humidity had no effect on the potassium concentration in the extracted soil solution for any soil investigated. It is concluded, that potassium is practically not associated with molecules of different molecular-gravimetric fractions in the extracted soil solutions

  5. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  6. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  7. Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

    Science.gov (United States)

    Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

    2017-08-01

    This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

  8. Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

    DEFF Research Database (Denmark)

    Fuchs, W; Larsen, Erik Hviid; Lindemann, B

    1977-01-01

    1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

  9. E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

    Science.gov (United States)

    Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

    2018-04-17

    E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

  10. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  11. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  12. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  13. Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

    International Nuclear Information System (INIS)

    Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

    2002-01-01

    The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

  14. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  15. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  16. Temperature dependence of current–voltage characteristics of Au/n ...

    Indian Academy of Sciences (India)

    Unknown

    2000-05-05

    May 5, 2000 ... factor with temperature has been explained considering lateral inhomogeneities in the Schottky barrier height ... The dependence of SBH on temperature can give ... effect in MS contacts, Tung has modeled the influence.

  17. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  18. Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

    2016-01-01

    Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

  19. Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter

    Science.gov (United States)

    Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.; hide

    2012-01-01

    At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.

  20. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  1. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua [Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 and Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States); NRE, 202 Nuclear Science Building, University of Florida, P.O. Box 118300, Gainesville, Florida 32611-8300 and Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); ViewRay Inc., 2 Thermo Fisher Way, Oakwood Village, Ohio 44146 (United States); Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States)

    2010-02-15

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm{sup 3} and a diode of surface area 0.64 mm{sup 2}. The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm{sup 2} field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a {+-}0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping

  2. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    International Nuclear Information System (INIS)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua

    2010-01-01

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm 3 and a diode of surface area 0.64 mm 2 . The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm 2 field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a ±0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping parameter between in

  3. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.

    1990-01-01

    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  4. Cell-type-dependent action potentials and voltage-gated currents in mouse fungiform taste buds.

    Science.gov (United States)

    Kimura, Kenji; Ohtubo, Yoshitaka; Tateno, Katsumi; Takeuchi, Keita; Kumazawa, Takashi; Yoshii, Kiyonori

    2014-01-01

    Taste receptor cells fire action potentials in response to taste substances to trigger non-exocytotic neurotransmitter release in type II cells and exocytotic release in type III cells. We investigated possible differences between these action potentials fired by mouse taste receptor cells using in situ whole-cell recordings, and subsequently we identified their cell types immunologically with cell-type markers, an IP3 receptor (IP3 R3) for type II cells and a SNARE protein (SNAP-25) for type III cells. Cells not immunoreactive to these antibodies were examined as non-IRCs. Here, we show that type II cells and type III cells fire action potentials using different ionic mechanisms, and that non-IRCs also fire action potentials with either of the ionic mechanisms. The width of action potentials was significantly narrower and their afterhyperpolarization was deeper in type III cells than in type II cells. Na(+) current density was similar in type II cells and type III cells, but it was significantly smaller in non-IRCs than in the others. Although outwardly rectifying current density was similar between type II cells and type III cells, tetraethylammonium (TEA) preferentially suppressed the density in type III cells and the majority of non-IRCs. Our mathematical model revealed that the shape of action potentials depended on the ratio of TEA-sensitive current density and TEA-insensitive current one. The action potentials of type II cells and type III cells under physiological conditions are discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  5. Autoimmune encephalitis with anti-leucine-rich glioma-inactivated 1 or anti-contactin-associated protein-like 2 antibodies (formerly called voltage-gated potassium channel-complex antibodies).

    Science.gov (United States)

    Bastiaansen, Anna E M; van Sonderen, Agnes; Titulaer, Maarten J

    2017-06-01

    Twenty years since the discovery of voltage-gated potassium channel (VGKC)-related autoimmunity; it is currently known that the antibodies are not directed at the VGKC itself but to two closely associated proteins, anti-leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (Caspr2). Antibodies to LGI1 and Caspr2 give well-described clinical phenotypes. Anti-LGI1 encephalitis patients mostly have limbic symptoms, and anti-Caspr2 patients have variable syndromes with both central and peripheral symptoms. A large group of patients with heterogeneous symptoms are VGKC positive but do not have antibodies against LGI1 or Caspr2. The clinical relevance of VGKC positivity in these 'double-negative' patients is questionable. This review focusses on these three essentially different subgroups. The clinical phenotypes of anti-LGI1 encephalitis and anti-Caspr2 encephalitis have been described in more detail including data on treatment and long-term follow-up. A specific human leukocyte antigen (HLA) association was found in nontumor anti-LGI1 encephalitis, but not clearly in those with tumors. There has been increasing interest in the VGKC patients without LGI1/Caspr2 antibodies questioning its relevance in clinical practice. Anti-LGI1 encephalitis and anti-Caspr2 encephalitis are separate clinical entities. Early recognition and treatment is necessary and rewarding. The term VGKC-complex antibodies, lumping patients with anti-LGI1, anti-Caspr2 antibodies or lacking both, should be considered obsolete.

  6. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  7. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  8. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  9. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  10. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

    Directory of Open Access Journals (Sweden)

    Yukiko eMishina

    2014-09-01

    Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  11. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

    Science.gov (United States)

    Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

    2014-01-01

    Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  12. Potassium test

    Science.gov (United States)

    ... hyperkalemia ) may be due to: Addison disease (rare) Blood transfusion Certain medicines Crushed tissue injury Hyperkalemic periodic paralysis ... released. This may cause a falsely high result. Alternative Names Hypokalemia test; K+ Images Blood test References Mount DB. Disorders of potassium balance. ...

  13. Potassium Iodide

    Science.gov (United States)

    ... certain other liquids including low-fat white or chocolate milk, flat soda, orange juice, raspberry syrup, or ... Potassium iodide may cause side effects. Tell your doctor if any of these symptoms are severe or do not go away: swollen glands metallic taste in the ...

  14. Potassium channels in brain mitochondria.

    Science.gov (United States)

    Bednarczyk, Piotr

    2009-01-01

    Potassium channels are the most widely distributed class of ion channels. These channels are transmembrane proteins known to play important roles in both normal and pathophysiological functions in all cell types. Various potassium channels are recognised as potential therapeutic targets in the treatment of Parkinson's disease, Alzheimer's disease, brain/spinal cord ischaemia and sepsis. In addition to their importance as therapeutic targets, certain potassium channels are known for their beneficial roles in anaesthesia, cardioprotection and neuroprotection. Some types of potassium channels present in the plasma membrane of various cells have been found in the inner mitochondrial membrane as well. Potassium channels have been proposed to regulate mitochondrial membrane potential, respiration, matrix volume and Ca(+) ion homeostasis. It has been proposed that mitochondrial potassium channels mediate ischaemic preconditioning in various tissues. However, the specificity of a pharmacological agents and the mechanisms underlying their effects on ischaemic preconditioning remain controversial. The following potassium channels from various tissues have been identified in the inner mitochondrial membrane: ATP-regulated (mitoK(ATP)) channel, large conductance Ca(2+)-regulated (mitoBK(Ca)) channel, intermediate conductance Ca(2+)-regulated (mitoIK(Ca)) channel, voltage-gated (mitoKv1.3 type) channel, and twin-pore domain (mitoTASK-3) channel. It has been shown that increased potassium flux into brain mitochondria induced by either the mitoK(ATP) channel or mitoBK(Ca) channel affects the beneficial effects on neuronal cell survival under pathological conditions. Recently, differential distribution of mitoBK(Ca) channels has been observed in neuronal mitochondria. These findings may suggest a neuroprotective role for the mitoBK(Ca) channel in specific brain structures. This minireview summarises current data on brain mitochondrial potassium channels and the efforts to identify

  15. Low Potassium (Hypokalemia)

    Science.gov (United States)

    Symptoms Low potassium (hypokalemia) By Mayo Clinic Staff Low potassium (hypokalemia) refers to a lower than normal potassium level ... 2 millimoles per liter (mmol/L). A very low potassium level (less than 2.5 mmol/L) ...

  16. Sex-dependent differences in the in vivo respiratory phenotype of the TASK-1 potassium channel knockout mouse.

    Science.gov (United States)

    Jungbauer, Stefan; Buehler, Philipp Karl; Neubauer, Jacqueline; Haas, Cordula; Heitzmann, Dirk; Tegtmeier, Ines; Sterner, Christina; Barhanin, Jacques; Georgieff, Michael; Warth, Richard; Thomas, Jörg

    2017-11-01

    TASK-1 potassium channels have been implicated in central and peripheral chemoreception; however, the precise contribution of TASK-1 for the control of respiration is still under debate. Here, we investigated the respiration of unrestrained adult and neonatal TASK-1 knockout mice (TASK-1 -/- ) using a plethysmographic device. Respiration in adult female TASK-1 -/- mice under control (21% O 2 ), hypoxia and hypercapnia was unaffected. Under acute hypoxia male TASK-1 -/- mice exhibited a reduced increase of the respiratory frequency (f R ) compared to wildtypes. However, the tidal volume (V T ) of male TASK-1 -/- mice was strongly enhanced. The volatile anesthetic isoflurane induced in male TASK-1 -/- and male wild type mice (TASK-1 +/+ ) a similar respiratory depression. Neonatal TASK-1 -/- mice demonstrated a 30-40% decrease of the minute volume, caused by a reduction of the f R under control condition (21% O 2 ). Under hypoxia, neonatal TASK-1 -/- mice more frequently stopped breathing (apnea>3s) suggesting an increased hypoxia-sensitivity. As reported before, this increased hypoxia sensitivity had no influence on the survival rate of neonatal TASK-1 -/- mice. In adult and neonatal mice, TASK-1 gene deletion induced a significant prolongation of the relaxation time (R T ), which is a parameter for expiration kinetics. Additionally, screening for mutations in the human TASK-1 gene in 155 cases of sudden infant death syndrome (SIDS) was inconclusive. In conclusion, these data are suggestive for an increased hypoxia-sensitivity of neonatal TASK-1 -/- mice, however, without causing an increase in neonatal lethality. In adult female TASK-1 -/- mice respiration was unaffected, whereas adult male TASK-1 -/- mice showed a modified breathing pattern. These results are suggestive for sex-specific mechanisms for compensating the inactivation of TASK-1 in mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  18. Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

    Science.gov (United States)

    Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

    2018-04-01

    Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

  19. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  20. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  1. Dependences of the geometrical parameters of cell community on stimulation voltage and frequency in chick embryonic cardiomyocytes

    Science.gov (United States)

    Fujii, Koki; Nomura, Fumimasa; Kaneko, Tomoyuki

    2018-03-01

    To investigate the optimal conditions for electrical stimulation, communities of lined-up chick embryonic cardiomyocytes were evaluated in terms of their threshold voltage for pacing (PVMin) and the half-maximum paced frequency (PF50), with a focus on the following factors: (1) the orientation of the major axis of cell communities to the electric field (EF) direction as the external factor; (2) the number of cells in a cell community, the length of the cell community, and the mean length of cells comprising the community as the internal factors. Firstly, PVMin decreased with increasing length of the cell network oriented parallel to the EF. PVMin was approximately 0.041 ± 0.025 V/mm when the community was sufficiently long. On the other hand, PVMin in the orthogonal orientation was constant at 1.7 ± 0.047 V/mm with no dependence on the length of the cell network. Secondly, we found that PF50 increased with increasing length of the cell network or the number of cells in the network; the PF50 values were 2.03 ± 0.05 and 3.39 ± 0.05 Hz when the respective cell network lengths were 100 µm (n = 43) and more than 300 µm (n = 6) and the cells were oriented parallel to the EF. These findings indicate that it is important to suppress ventricular fibrillation with minimal efficient stimulation by considering the EF direction with respect to the orientation of cardiomyocytes. Furthermore, expanded cells showed the loss of ability to respond to stimulation at higher frequencies. Cardiomyocytes combined with seeded fibroblasts as a cell network at a low density are a possible model of a ventricular remodeling heart.

  2. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  4. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

    2017-01-01

    Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

  6. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  7. Changes by short-term hypoxia in the membrane properties of pyramidal cells and the levels of purine and pyrimidine nucleotides in slices of rat neocortex; effects of agonists and antagonists of ATP-dependent potassium channels.

    Science.gov (United States)

    Pissarek, M; Garcia de Arriba, S; Schäfer, M; Sieler, D; Nieber, K; Illes, P

    1998-10-01

    In a first series of experiments, intracellular recordings were made from pyramidal cells in layers II-III of the rat primary somatosensory cortex. Superfusion of the brain slice preparations with hypoxic medium (replacement of 95%O2-5%CO2 with 95%N2-5%CO2) for up to 30 min led to a time-dependent depolarization (HD) without a major change in input resistance. Short periods of hypoxia (5 min) induced reproducible depolarizations which were concentration-dependently depressed by an agonist of ATP-dependent potassium (K(ATP)) channels, diazoxide (3-300 microM). The effect of 30 but not 300 microM diazoxide was reversed by washout. Tolbutamide (300 microM), an antagonist of K(ATP) channels, did not alter the HD when given alone. It did, however, abolish the inhibitory effect of diazoxide (30 microM) on the HD. Neither diazoxide (3-300 microM) nor tolbutamide (300 microM) influenced the membrane potential or the apparent input resistance of the neocortical pyramidal cells. Current-voltage (I-V) curves constructed at a membrane potential of -90 mV by injecting both de- and hyperpolarizing current pulses were not altered by diazoxide (30 microM) or tolbutamide (300 microM). Moreover, normoxic and hypoxic I-V curves did not cross each other, excluding a reversal of the HD at any membrane potential between -130 and -50 mV. The hypoxia-induced change of the I-V relation was the same both in the absence and presence of tolbutamide (300 microM). In a second series of experiments, nucleoside di- and triphosphates separated with anion exchange HPLC were measured in the neocortical slices. After 5 min of hypoxia, levels of nucleoside triphosphates declined by 29% (GTP), 34% (ATP), 44% (UTP) and 58% (CTP). By contrast, the levels of nucleoside diphosphates either did not change (UDP) or increased by 13% (GDP) and 40% (ADP). In slices subjected to 30 min of hypoxia the triphosphate levels continued to decrease, while the levels of GDP and ADP returned to control values. The tri

  8. Total inelastic cross sections for potassium ion--atom collisions: Oscillations in the velocity dependence and correlation with molecular structure

    International Nuclear Information System (INIS)

    Aquilanti, V.; Casavecchia, P.

    1976-01-01

    Electronic excitation leading to light emission in the wavelength range 350--800 nm has been studied by a crossed ion--atom beam technique for (K + , K) collisions, and the results are interpreted in terms of properties of the potential energy curves for the molecular ion K + 2 . The investigated velocity range is (1.3--12) x10 6 cm s -1 . The total cross section for the process K + (3p 6 1 S 0 ) +K(4s 2 S 1 / 2 ) →K + (3p 6 1 S 0 ) +K(4p 2 P 3 / 2 , 1 / 2 ) increases from threshold up to approx.10 -15 cm 2 at a velocity of approx.4.5x10 6 cm s -1 , and shows an oscillatory structure. The magnitude and over-all velocity dependence are attributed to a Σ--Pi curve crossing, and the oscillations to an interference effect, which is treated as an inelastic ''glory'' phenomenon. Cross sections for production of each of the fine structure components of K(4p), 2 P 3 / 2 , and 2 P 1 / 2 , have also been measured. Their ratio, which in the investigated velocity range is different from the statistical value, shows additional oscillations, which are discussed in terms of long range interference between alternate semiclassical paths

  9. Discrimination Voltage and Overdrive Bias Dependent Performance Evaluation of Passively Quenched SiC Single-Photon-Counting Avalanche Photodiodes

    International Nuclear Information System (INIS)

    Liu Fei; Yang Sen; Zhou Dong; Lu Hai; Zhang Rong; Zheng You-Dou

    2015-01-01

    In many critical civil and emerging military applications, low-level UV detection, sometimes at single photon level, is highly desired. In this work, a mesa-type 4H-SiC UV avalanche photodiode (APD) is designed and fabricated, which exhibits low leakage current and high avalanche gain. When studied by using a passive quenching circuit, the APD exhibits self-quenching characteristics due to its high differential resistance in the avalanche region. The single photon detection efficiency and dark count rate of the APD are evaluated as functions of discrimination voltage and over-drive voltage. The optimized operation conditions of the single photon counting APD are discussed. (paper)

  10. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  11. Chloride is essential for contraction of afferent arterioles after agonists and potassium

    DEFF Research Database (Denmark)

    Jensen, B L; Ellekvist, Peter; Skøtt, O

    1997-01-01

    to norepinephrine, angiotensin II (ANG II), and potassium were measured after chloride depletion and compared with controls. Chloride depletion did not change arteriolar diameters, but the response to norepinephrine was markedly reduced when chloride was substituted with gluconate (n = 6) or isethionate (n = 6......). Reintroduction of chloride fully restored the sensitivity to norepinephrine. Contractions after ANG II and potassium were totally abolished in the absence of chloride (n = 6). In additional experiments (n = 7), the arteriolar contraction to 100 mM potassium was abolished only 1 min after removal of extracellular......A depolarizing chloride efflux has been suggested to activate voltage-dependent calcium channels in renal afferent arteriolar smooth muscle cells in response to vasoconstrictors. To test this proposal, rabbit afferent arterioles were microperfused, and the contractile dose responses...

  12. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  14. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

    International Nuclear Information System (INIS)

    Roos, M.; Derikum, K.

    2000-01-01

    Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

  16. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  17. Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

    Science.gov (United States)

    Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

    2016-04-01

    We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

  18. Chronic potassium depletion increases adrenal progesterone production that is necessary for efficient renal retention of potassium.

    Science.gov (United States)

    Elabida, Boutaïna; Edwards, Aurélie; Salhi, Amel; Azroyan, Anie; Fodstad, Heidi; Meneton, Pierre; Doucet, Alain; Bloch-Faure, May; Crambert, Gilles

    2011-08-01

    Modern dietary habits are characterized by high-sodium and low-potassium intakes, each of which was correlated with a higher risk for hypertension. In this study, we examined whether long-term variations in the intake of sodium and potassium induce lasting changes in the plasma concentration of circulating steroids by developing a mathematical model of steroidogenesis in mice. One finding of this model was that mice increase their plasma progesterone levels specifically in response to potassium depletion. This prediction was confirmed by measurements in both male mice and men. Further investigation showed that progesterone regulates renal potassium handling both in males and females under potassium restriction, independent of its role in reproduction. The increase in progesterone production by male mice was time dependent and correlated with decreased urinary potassium content. The progesterone-dependent ability to efficiently retain potassium was because of an RU486 (a progesterone receptor antagonist)-sensitive stimulation of the colonic hydrogen, potassium-ATPase (known as the non-gastric or hydrogen, potassium-ATPase type 2) in the kidney. Thus, in males, a specific progesterone concentration profile induced by chronic potassium restriction regulates potassium balance.

  19. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  20. Membrane Potential-dependent Uptake of 18F-triphenylphosphonium - A New Voltage Sensor as an Imaging Agent for Detecting Burn-induced Apoptosis

    Science.gov (United States)

    Zhao, Gaofeng; Yu, Yong-Ming; Shoup, Timothy M.; Elmaleh, David R.; Bonab, Ali A.; Tompkins, Ronald G.; Fischman, Alan J.

    2014-01-01

    Background Mitochondrial dysfunction has been closely related to many pathological processes, such as cellular apoptosis. Alterations in organelle membrane potential are associated with mitochondrial dysfunction. A fluorine -18 labeled phosphonium compound: 18F-triphenylphosphonium (18F-TPP) was prepared to determine its potential use as a mitochondria-targeting radiopharmaceutical to evaluate cellular apoptosis. Methods Studies were conducted in both ex vivo cell lines and in vivo using a burned animal model. Uptake of 18F-TPP was assessed in PC-3 cells by gamma counting under the following conditions: graded levels of extra-cellular potassium concentrations, incubation with carbonyl cyanide m-chlorophenylhydrazone (CCCP) and staurosporine. Apoptosis was studied in a burn animal model using TUNEL staining and simultaneous assessment of 18F-TPP uptake by biodistribution. Results We found that stepwise membrane depolarization by potassium (K) resulted in a linear decrease in 18F-TPP uptake, with a slope of 0.62+/−0.08 and a correlation coefficient of 0.936+/−0.11. Gradually increased concentrations of CCCP lead to decreased uptakes of 18F-TPP. Staurosporine significantly decreased the uptake of 18F-TPP in PC-3 cells from 14.2+/−3.8% to 5.6+/−1.3% (P<0.001). Burn induced significant apoptosis (sham: 4.4 +/−1.8% vs. burn: 24.6+/− 6.7 %; p<0.005) and a reduced uptake of tracer in the spleens of burn injured animals as compared to sham burn controls (burn: 1.13+/−0.24% vs. sham: 3.28+/−0.67%; p<0.005). Biodistribution studies demonstrated that burn induced significant reduction in 18F-TPP uptake in spleen, heart, lung, and liver, which were associated with significantly increased apoptosis. Conclusions 18F-TPP is a promising new voltage sensor for detecting mitochondrial dysfunction and apoptosis in various tissues. PMID:24582214

  1. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  2. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  3. Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

    International Nuclear Information System (INIS)

    Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

    2014-01-01

    Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

  4. Influence of calcium-dependent potassium channel blockade and nitric oxide inhibition on norepinephrine-induced contractions in two forms of genetic hypertension

    Czech Academy of Sciences Publication Activity Database

    Líšková, Silvia; Petrová, M.; Karen, Petr; Kuneš, Jaroslav; Zicha, Josef

    2010-01-01

    Roč. 4, č. 3 (2010), s. 128-134 ISSN 1933-1711 R&D Projects: GA AV ČR(CZ) IAA500110902 Institutional research plan: CEZ:AV0Z50110509 Keywords : potassium channels * nitric oxide * norepinephrine Subject RIV: ED - Physiology Impact factor: 0.931, year: 2010

  5. Effects of allocryptopine on outward potassium current and slow delayed rectifier potassium current in rabbit myocardium.

    Science.gov (United States)

    Fu, Yi-Cheng; Zhang, Yu; Tian, Liu-Yang; Li, Nan; Chen, Xi; Cai, Zhong-Qi; Zhu, Chao; Li, Yang

    2016-05-01

    Allocryptopine (ALL) is an effective alkaloid of Corydalis decumbens (Thunb.) Pers. Papaveraceae and has proved to be anti-arrhythmic. The purpose of our study is to investigate the effects of ALL on transmural repolarizing ionic ingredients of outward potassium current (I to) and slow delayed rectifier potassium current (I Ks). The monophasic action potential (MAP) technique was used to record the MAP duration of the epicardium (Epi), myocardium (M) and endocardium (Endo) of the rabbit heart and the whole cell patch clamp was used to record I to and I Ks in cardiomyocytes of Epi, M and Endo layers that were isolated from rabbit ventricles. The effects of ALL on MAP of Epi, M and Endo layers were disequilibrium. ALL could effectively reduce the transmural dispersion of repolarization (TDR) in rabbit transmural ventricular wall. ALL decreased the current densities of I to and I Ks in a voltage and concentration dependent way and narrowed the repolarizing differences among three layers. The analysis of gating kinetics showed ALL accelerated the channel activation of I to in M layers and partly inhibit the channel openings of I to in Epi, M and Endo cells. On the other hand, ALL mainly slowed channel deactivation of I Ks channel in Epi and Endo layers without affecting its activation. Our study gives partially explanation about the mechanisms of transmural inhibition of I to and I Ks channels by ALL in rabbit myocardium. These findings provide novel perspective regarding the anti-arrhythmogenesis application of ALL in clinical settings.

  6. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  7. VEGF attenuated increase of outward delayed-rectifier potassium currents in hippocampal neurons induced by focal ischemia via PI3-K pathway.

    Science.gov (United States)

    Wu, K W; Yang, P; Li, S S; Liu, C W; Sun, F Y

    2015-07-09

    We recently indicated that the vascular endothelial growth factor (VEGF) protects neurons against hypoxic death via enhancement of tyrosine phosphorylation of Kv1.2, an isoform of the delayed-rectifier potassium channels through activation of the phosphatidylinositol 3-kinase (PI3-K) signaling pathway. The present study investigated whether VEGF could attenuate ischemia-induced increase of the potassium currents in the hippocampal pyramidal neurons of rats after ischemic injury. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion (MCAO) to induce brain ischemia. The whole-cell patch-clamp technique was used to record the potassium currents of hippocampal neurons in brain slices from the ischemically injured brains of the rats 24h after MCAO. We detected that transient MCAO caused a significant increase of voltage-gated potassium currents (Kv) and outward delayed-rectifier potassium currents (IK), but not outward transient potassium currents (IA), in the ipsilateral hippocampus compared with the sham. Moreover, we found that VEGF could acutely, reversibly and voltage-dependently inhibit the ischemia-induced IK increase. This inhibitory effect of VEGF could be completely abolished by wortmannin, an inhibitor of PI3-K. Our data indicate that VEGF attenuates the ischemia-induced increase of IK via activation of the PI3-K signaling pathway. Published by Elsevier Ltd.

  8. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  9. Modification of sodium and potassium channel kinetics by diethyl ether and studies on sodium channel inactivation in the crayfish giant axon membrane

    Energy Technology Data Exchange (ETDEWEB)

    Bean, Bruce Palmer [Univ. of Rochester, NY (United States)

    1979-01-01

    The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.

  10. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  11. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  12. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  13. Penicillin V Potassium

    Science.gov (United States)

    Penicillin V potassium is used to treat certain infections caused by bacteria such as pneumonia and other ... heart valves and other symptoms) from coming back. Penicillin V potassium is in a class of medications ...

  14. Potassium maldistribution revisited

    African Journals Online (AJOL)

    Background:This study investigated maldistribution of concentrated 15% potassium chloride after injection into .... and latter experiments referred to for example as “Control 1” ..... be further investigated as a reliable, simple method of potassium.

  15. Commensal Bacteria-Induced Inflammasome Activation in Mouse and Human Macrophages Is Dependent on Potassium Efflux but Does Not Require Phagocytosis or Bacterial Viability.

    Directory of Open Access Journals (Sweden)

    Kejie Chen

    Full Text Available Gut commensal bacteria contribute to the pathogenesis of inflammatory bowel disease, in part by activating the inflammasome and inducing secretion of interleukin-1ß (IL-1ß. Although much has been learned about inflammasome activation by bacterial pathogens, little is known about how commensals carry out this process. Accordingly, we investigated the mechanism of inflammasome activation by representative commensal bacteria, the Gram-positive Bifidobacterium longum subspecies infantis and the Gram-negative Bacteroides fragilis. B. infantis and B. fragilis induced IL-1ß secretion by primary mouse bone marrow-derived macrophages after overnight incubation. IL-1ß secretion also occurred in response to heat-killed bacteria and was only partly reduced when phagocytosis was inhibited with cytochalasin D. Similar results were obtained with a wild-type immortalized mouse macrophage cell line but neither B. infantis nor B. fragilis induced IL-1ß secretion in a mouse macrophage line lacking the nucleotide-binding/leucine-rich repeat pyrin domain containing 3 (NLRP3 inflammasome. IL-1ß secretion in response to B. infantis and B. fragilis was significantly reduced when the wild-type macrophage line was treated with inhibitors of potassium efflux, either increased extracellular potassium concentrations or the channel blocker ruthenium red. Both live and heat-killed B. infantis and B. fragilis also induced IL-1ß secretion by human macrophages (differentiated THP-1 cells or primary monocyte-derived macrophages after 4 hours of infection, and the secretion was inhibited by raised extracellular potassium and ruthenium red but not by cytochalasin D. Taken together, our findings indicate that the commensal bacteria B. infantis and B. fragilis activate the NLRP3 inflammasome in both mouse and human macrophages by a mechanism that involves potassium efflux and that does not require bacterial viability or phagocytosis.

  16. Temperature Dependency and Alpha Response of Semi-Insulating GaAs Schottky Radiation Detector at Low Bias Voltage

    International Nuclear Information System (INIS)

    Kang, Sang Mook; Ha, Jang Ho; Park, Se Hwan; Kim, Han Soo; Kim, Yong Kyun

    2009-01-01

    The last decade has seen a growing interest in semiconductor radiation detectors operated at room or nearly room temperature. Great efforts have been invested in the development of radiation detectors based on semi-insulating (SI) GaAs. The main reasons are as follows: (i) high resistance against radiation damage; (ii) it possesses a good energy resolution, which relates to its active volume; (iii) such a detector also exhibits fast signal rise times, which results from a high mobility and drift velocity of charge carriers; (iv) its large band gap energy allows a SI GaAs detector to operate at room temperature. Other important features are a good technology base and low production and operating costs. An alpha particle monitoring method for the detection of Pu-238 and U-235 is becoming important in homeland security. Alpha measurement in a vacuum is known to provide a good resolution sufficient to separate an isotope abundance in nuclear materials. However, in order to apply it to a high radiation field like a spent fuel treatment facility, a nuclear material loading and unloading process in a vacuum is one of the great disadvantages. Therefore, the main technical issue is to develop a detector for alpha detection at air condition and low power operation for integration type device. In this study we fabricated GaAs Schottky detector by using semi-insulating (SI) wafer and measured current-voltage characteristic curve and alpha response with 5.5 MeV Am-241 source

  17. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements

    DEFF Research Database (Denmark)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar

    2008-01-01

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...

  18. Bias voltage dependence of molecular orientation of dialkyl ketone and fatty acid alkyl ester at the liquid–graphite interface

    Energy Technology Data Exchange (ETDEWEB)

    Hibino, Masahiro, E-mail: hibino@mmm.muroran-it.ac.jp [Department of Applied Sciences, Muroran Institute of Technology, 27-1 Mizumoto-cho, Muroran 050-8585 (Japan); Tsuchiya, Hiroshi [Department of Applied Physics, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan)

    2014-10-30

    Graphical abstract: - Highlights: • Self-assembled monolayers (SAMs) of 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) were formed on a graphite surface at the liquid–solid interface. • Orientations of the molecules in SAMs on the substrate were studied by scanning tunneling microscopy. • A perpendicular carbon skeleton-plane orientation with the CO pointing up on the surface is favorable for a substrate with negative charge and vice versa. - Abstract: Molecular orientations of self-assembled 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) monolayers adsorbed on a graphite surface were studied by scanning tunneling microscopy (STM) at the liquid–solid interface. At a positive sample bias, the central areas of the dialkyl ketone and fatty acid alkyl ester molecules in the STM images appeared as two bright regions on both sides of a dim spot and a bright region on one side of a dim spot, whereas at a negative sample bias, the areas appeared dim. This contrast variation indicates that a perpendicular carbon skeleton-plane orientation with the CO pointing down on the surface is favorable for a substrate with positive charge and vice versa because of the greater electronegativity of the oxygen atom. Upon the bias voltage reversal, the delay time for the STM image contrast change in the region was observed on a time scale of minutes. The difference between the delay time lengths for the direction of bias polarity change indicates that the perpendicular configuration with CO pointing up is more stable than that with CO pointing down. These results indicate that the use of an electric field along a direction vertical to the monolayer on the substrate provides control over the orientations of the molecules between two stable states at the liquid–solid interface.

  19. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  20. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung; Park, Seung Young; Manchon, Aurelien; Chshiev, Mairbek; Han, Jae Ho; Lee, Hyun Woo; Lee, Jang Eun; Nam, Kyung Tae; Jo, Younghun; Kong, Yo Chan; Dieny, Bernard; Lee, Kyung Jin

    2009-01-01

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  1. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung

    2009-10-25

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  2. Potassium fluorotitanate preparation

    International Nuclear Information System (INIS)

    Perillo, Patricia; Ares, Osvaldo; Botbol, Jose.

    1989-01-01

    In order to determine the best conditions for potassium fluotitanate preparation as intermediate step in the electrolytic production of metalic titanium, the effects of a number of experimental variables have been studied. This method is a process of sintering titanium dioxide with potassium fluosilicate and potassium chloride, followed by leaching with boiling water and further crystallization by cooling the solution. An overall yield of 90% has been attained under the following conditions: working temperature: 750 deg C; heating time for sintering: 3 hours; molar ratio: titanium dioxide: potassium fluosilicate: potassium chloride: 1 : 2 : 0.4; number of leachings: 6. (Author) [es

  3. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  4. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  5. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  7. Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

    International Nuclear Information System (INIS)

    Sen, A.K.; Bhattacharya, S.

    2006-12-01

    In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

  8. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  9. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  10. Large time-dependent coercivity and resistivity modification under sustained voltage application in a Pt/Co/AlOx/Pt junction.

    NARCIS (Netherlands)

    Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.

    2015-01-01

    The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic

  11. Investigation of p-n-junctions in n-InP based on voltage dependence of differential capacity

    International Nuclear Information System (INIS)

    Agaev, Ja.; Atabaev, Kh.; Gazakov, O.; Sadykov, K.B.

    1976-01-01

    The barrier capacity of alloyed p-n transitions on n-InP crystals grown by the crystallization method has been investigated. The transitions have been obtained by fusing In + 3 - 10% Zn. Step-by-step distribution of the impurity concentration in the space charge layer takes place in the alloyed diodes under investigation. The coefficient characterizing the impurity distribution in the space charge layer has been determined. The well-expressed dependence of I/C 2 =f/u) observed both at a room temperature and at the temperature of liquid nitrogen indicates that the density of ground carriers in the p-n regions are constant at a definite distance from the p-n transition. The main parameters of p-n transitions have been determined

  12. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  13. Handling of potassium

    International Nuclear Information System (INIS)

    Schwarz, N.; Komurka, M.

    1983-03-01

    As a result for the Fast Breeder Development extensive experience is available worldwide with respect to Sodium technology. Due to the extension of the research program to topping cycles with Potassium as the working medium, test facilities with Potassium have been designed and operated in the Institute of Reactor Safety. The different chemical properties of Sodium and Potassium give rise in new safety concepts and operating procedures. The handling problems of Potassium are described in the light of theoretical properties and own experiences. Selected literature on main safety and operating problems complete this report. (Author) [de

  14. Temperature dependent current-voltage characteristics of Au/n-Si Schottky barrier diodes and the effect of transition metal oxides as an interface layer

    Science.gov (United States)

    Mahato, Somnath; Puigdollers, Joaquim

    2018-02-01

    Temperature dependent current-voltage (I‒V) characteristics of Au/n-type silicon (n-Si) Schottky barrier diodes have been investigated. Three transition metal oxides (TMO) are used as an interface layer between gold and silicon. The basic Schottky diode parameters such as ideality factor (n), barrier height (ϕb 0) and series resistance (Rs) are calculated and successfully explained by the thermionic emission (TE) theory. It has been found that ideality factor decreased and barrier height increased with increased of temperature. The conventional Richardson plot of ln(I0/T2) vs. 1000/T is determined the activation energy (Ea) and Richardson constant (A*). Whereas value of 'A*' is much smaller than the known theoretical value of n-type Si. The temperature dependent I-V characteristics obtained the mean value of barrier height (ϕb 0 bar) and standard deviation (σs) from the linear plot of ϕap vs. 1000/T. From the modified Richardson plot of ln(I0/T2) ˗ (qσ)2/2(kT)2 vs. 1000/T gives Richardson constant and homogeneous barrier height of Schottky diodes. Main observation in this present work is the barrier height and ideality factor shows a considerable change but the series resistance value exhibits negligible change due to TMO as an interface layer.

  15. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  16. Potassium and Your CKD Diet

    Science.gov (United States)

    ... vegetable in your diet, leach them before using. Leaching is a process by which some potassium can be pulled out ... out of my favorite high-potassium vegetables? The process of leaching will help pull potassium out of some high- ...

  17. Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

    Directory of Open Access Journals (Sweden)

    Richard J. Lewis

    2006-04-01

    Full Text Available Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

  18. Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

    Science.gov (United States)

    Nicholson, Graham M.; Lewis, Richard J.

    2006-01-01

    Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

  19. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Venter, A., E-mail: andre.venter@nmmu.ac.za [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Murape, D.M.; Botha, J.R. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Auret, F.D. [Department of Physics, University of the Pretoria, Lynnwood Road, Pretoria 0002 (South Africa)

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ{sub b} vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ{sub b,mean} assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact.

  20. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    International Nuclear Information System (INIS)

    Venter, A.; Murape, D.M.; Botha, J.R.; Auret, F.D.

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ b vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ b,mean assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact

  1. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Charybdotoxin and Margatoxin Acting on the Human Voltage-Gated Potassium Channel hKv1.3 and Its H399N Mutant. An Experimental and Computational Comparison

    Czech Academy of Sciences Publication Activity Database

    Nikouee, A.; Khabiri, Morteza; Grissmer, S.; Ettrich, Rüdiger

    2012-01-01

    Roč. 116, č. 17 (2012), s. 5132-5140 ISSN 1520-6106 Institutional support: RVO:67179843 Keywords : Charbydotoxin * dependent k + channel * constant-pressure * molecular dynamics simulations * scorpion toxin * force-field Subject RIV: CE - Biochemistry Impact factor: 3.607, year: 2012

  3. Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Sheyda R Frolova

    Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

  4. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  5. Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

    Science.gov (United States)

    Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

    2017-04-20

    Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

  6. Expression, purification and functional reconstitution of slack sodium-activated potassium channels.

    Science.gov (United States)

    Yan, Yangyang; Yang, Youshan; Bian, Shumin; Sigworth, Fred J

    2012-11-01

    The slack (slo2.2) gene codes for a potassium-channel α-subunit of the 6TM voltage-gated channel family. Expression of slack results in Na(+)-activated potassium channel activity in various cell types. We describe the purification and reconstitution of Slack protein and show that the Slack α-subunit alone is sufficient for potassium channel activity activated by sodium ions as assayed in planar bilayer membranes and in membrane vesicles.

  7. Potassium Blood Test

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Potassium, Serum; 426–27 p. Lab ...

  8. High potassium level

    Science.gov (United States)

    ... level is very high, or if you have danger signs, such as changes in an ECG . Emergency ... Seifter JL. Potassium disorders. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: ...

  9. Low potassium level

    Science.gov (United States)

    ... treat and prevent low level of potassium. These foods include: Avocados Baked potato Bananas Bran Carrots Cooked lean beef Milk Oranges Peanut butter Peas and beans Salmon Seaweed Spinach Tomatoes Wheat germ

  10. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  11. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  12. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  13. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  14. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-01

    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  15. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  16. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca

    2012-09-01

    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  17. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  18. The Arabidopsis guard cell outward potassium channel GORK is regulated by CPK33.

    Science.gov (United States)

    Corratgé-Faillie, Claire; Ronzier, Elsa; Sanchez, Frédéric; Prado, Karine; Kim, Jeong-Hyeon; Lanciano, Sophie; Leonhardt, Nathalie; Lacombe, Benoît; Xiong, Tou Cheu

    2017-07-01

    A complex signaling network involving voltage-gated potassium channels from the Shaker family contributes to the regulation of stomatal aperture. Several kinases and phosphatases have been shown to be crucial for ABA-dependent regulation of the ion transporters. To date, the Ca 2+ -dependent regulation of Shaker channels by Ca 2+ -dependent protein kinases (CPKs) is still elusive. A functional screen in Xenopus oocytes was launched to identify such CPKs able to regulate the three main guard cell Shaker channels KAT1, KAT2, and GORK. Seven guard cell CPKs were tested and multiple CPK/Shaker couples were identified. Further work on CPK33 indicates that GORK activity is enhanced by CPK33 and unaffected by a nonfunctional CPK33 (CPK33-K102M). Furthermore, Ca 2+ -induced stomatal closure is impaired in two cpk33 mutant plants. © 2017 Federation of European Biochemical Societies.

  19. Functional identification of a GORK potassium channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f.

    Science.gov (United States)

    Li, Junlin; Zhang, Huanchao; Lei, Han; Jin, Man; Yue, Guangzhen; Su, Yanhua

    2016-04-01

    A GORK homologue K(+) channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. shows the functional conservation of the GORK channels among plant species. Guard cell K(+) release through the outward potassium channels eventually enables the closure of stomata which consequently prevents plant water loss from severe transpiration. Early patch-clamp studies with the guard cells have revealed many details of such outward potassium currents. However, genes coding for these potassium-release channels have not been sufficiently characterized from species other than the model plant Arabidopsis thaliana. We report here the functional identification of a GORK (for Gated or Guard cell Outward Rectifying K(+) channels) homologue from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. AmGORK was primary expressed in shoots, where the transcripts were regulated by stress factors simulated by PEG, NaCl or ABA treatments. Patch-clamp measurements on isolated guard cell protoplasts revealed typical depolarization voltage gated outward K(+) currents sensitive to the extracelluar K(+) concentration and pH, resembling the fundamental properties previously described in other species. Two-electrode voltage-clamp analysis in Xenopus lavies oocytes with AmGORK reconstituted highly similar characteristics as assessed in the guard cells, supporting that the function of AmGORK is consistent with a crucial role in mediating stomatal closure in Ammopiptanthus mongolicus. Furthermore, a single amino acid mutation D297N of AmGORK eventually abolishes both the voltage-gating and its outward rectification and converts the channel into a leak-like channel, indicating strong involvement of this residue in the gating and voltage dependence of AmGORK. Our results obtained from this anciently originated plant support a strong functional conservation of the GORK channels among plant species and maybe also along the progress of revolution.

  20. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  1. Imaging responses of on-site CsI and Gd2O2S flat-panel detectors: Dependence on the tube voltage

    Science.gov (United States)

    Jeon, Hosang; Chung, Myung Jin; Youn, Seungman; Nam, Jiho; Lee, Jayoung; Park, Dahl; Kim, Wontaek; Ki, Yongkan; Kim, Ho Kyung

    2015-07-01

    One of the emerging issues in radiography is low-dose imaging to minimize patient's exposure. The scintillating materials employed in most indirect flat-panel detectors show a drastic change of X-ray photon absorption efficiency around their K-edge energies that consequently affects image quality. Using various tube voltages, we investigated the imaging performance of most popular scintillators: cesium iodide (CsI) and gadolinium oxysulfide (Gd2O2S). The integrated detective quantum efficiencies (iDQE) of four detectors installed in the same hospital were evaluated according to the standardized procedure IEC 62220-1 at tube voltages of 40 - 120 kVp. The iDQE values of the Gd2O2S detectors were normalized by those of CsI detectors to exclude the effects of image postprocessing. The contrast-to-noise ratios (CNR) were also evaluated by using an anthropomorphic chest phantom. The iDQE of the CsI detector outperformed that of the Gd2O2S detector over all tube voltages. Moreover, we noted that the iDQE of the Gd2O2S detectors quickly rolled off with decreasing tube voltage under 70 kVp. The CNRs of the two scintillators were similar at 120 kVp. At 60 kVp, however, the CNR of Gd2O2S was about half that of CsI. Compared to the Gd2O2S detectors, variations in the DQE performance of the CsI detectors were relatively immune to variations in the applied tube voltages. Therefore, we claim that Gd2O2S detectors are inappropriate for use in low-tube-voltage imaging (e.g., extremities and pediatrics) with low patient exposure.

  2. High-field quench behavior and dependence of hot spot temperature on quench detection voltage threshold in a Bi2Sr2CaCu2Ox coil

    International Nuclear Information System (INIS)

    Shen, Tengming; Ye, Liyang; Turrioni, Daniele; Li, Pei

    2015-01-01

    Small insert solenoids have been built using a multifilamentary Ag/Bi 2 Sr 2 CaCu 2 O x round wire insulated with a mullite sleeve (∼100 μm in thickness) and characterized in background fields to explore the quench behaviors and limits of Bi 2 Sr 2 CaCu 2 O x superconducting magnets, with an emphasis on assessing the impact of slow normal zone propagation on quench detection. Using heaters of various lengths to initiate a small normal zone, a coil was quenched safely more than 70 times without degradation, with the maximum coil temperature reaching 280 K. Coils withstood a resistive voltage of tens of mV for seconds without quenching, showing the high stability of these coils and suggesting that the quench detection voltage should be greater than 50 mV in order not to falsely trigger protection. The hot spot temperature for the resistive voltage of the normal zone to reach 100 mV increased from ∼40–∼80 K while increasing the operating wire current density J o from 89 A mm −2 to 354 A mm −2 , whereas for the voltage to reach 1 V, it increased from ∼60–∼140 K. This shows the increasing negative impact of slow normal zone propagation on quench detection with increasing J o and the need to limit the quench detection voltage to <1 V. These measurements, coupled with an analytical quench model, were used to assess the impact of the maximum allowable detection voltage and temperature upon quench detection on the quench protection, assuming a limit of the hot spot temperature to <300 K. (paper)

  3. Pharmacological Conversion of a Cardiac Inward Rectifier into an Outward Rectifier Potassium Channel.

    Science.gov (United States)

    Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A

    2016-09-01

    Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  4. Errors in potassium balance

    International Nuclear Information System (INIS)

    Forbes, G.B.; Lantigua, R.; Amatruda, J.M.; Lockwood, D.H.

    1981-01-01

    Six overweight adult subjects given a low calorie diet containing adequate amounts of nitrogen but subnormal amounts of potassium (K) were observed on the Clinical Research Center for periods of 29 to 40 days. Metabolic balance of potassium was measured together with frequent assays of total body K by 40 K counting. Metabolic K balance underestimated body K losses by 11 to 87% (average 43%): the intersubject variability is such as to preclude the use of a single correction value for unmeasured losses in K balance studies

  5. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  6. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  7. Electrical properties of the potassium polytitanate compacts

    International Nuclear Information System (INIS)

    Goffman, V.G.; Gorokhovsky, A.V.; Kompan, M.M.; Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V.; Fedorov, F.S.

    2014-01-01

    Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10 4 –10 5 . • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10 −2 to 10 −6 –10 −7 Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10 −2 Sm/m (high frequencies, ion conductivity) up to 10 −6 –10 −7 Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10 4 –10 5 . This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures

  8. Inward rectifier potassium current IKir promotes intrinsic pacemaker activity of thalamocortical neurons.

    Science.gov (United States)

    Amarillo, Yimy; Tissone, Angela I; Mato, Germán; Nadal, Marcela S

    2018-06-01

    Slow repetitive burst firing by hyperpolarized thalamocortical (TC) neurons correlates with global slow rhythms (rectifier potassium current I Kir induces repetitive burst firing at slow and delta frequency bands. We demonstrate this in mouse TC neurons in brain slices by manipulating the Kir maximum conductance with dynamic clamp. We also performed a thorough theoretical analysis that explains how the unique properties of I Kir enable this current to induce slow periodic bursting in TC neurons. We describe a new ionic mechanism based on the voltage- and time-dependent interaction of I Kir and hyperpolarization-activated cationic current I h that endows TC neurons with the ability to oscillate spontaneously at very low frequencies, even below 0.5 Hz. Bifurcation analysis of conductance-based models of increasing complexity demonstrates that I Kir induces bistability of the membrane potential at the same time that it induces sustained oscillations in combination with I h and increases the robustness of low threshold-activated calcium current I T -mediated oscillations. NEW & NOTEWORTHY The strong inwardly rectifying potassium current I Kir of thalamocortical neurons displays a region of negative slope conductance in the current-voltage relationship that generates potassium currents activated by hyperpolarization. Bifurcation analysis shows that I Kir induces bistability of the membrane potential; generates sustained subthreshold oscillations by interacting with the hyperpolarization-activated cationic current I h ; and increases the robustness of oscillations mediated by the low threshold-activated calcium current I T . Upregulation of I Kir in thalamocortical neurons induces repetitive burst firing at slow and delta frequency bands (<4 Hz).

  9. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  10. Comment on 'Temperature dependence of the current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions'

    Energy Technology Data Exchange (ETDEWEB)

    Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt

    2008-02-27

    Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)

  11. Angular dependence of Si3N4 etch rates and the etch selectivity of SiO2 to Si3N4 at different bias voltages in a high-density C4F8 plasma

    International Nuclear Information System (INIS)

    Lee, Jin-Kwan; Lee, Gyeo-Re; Min, Jae-Ho; Moon, Sang Heup

    2007-01-01

    The dependence of Si 3 N 4 etch rates and the etch selectivity of SiO 2 to Si 3 N 4 on ion-incident angles was studied for different bias voltages in a high-density C 4 F 8 plasma. A Faraday cage and specially designed substrate holders were used to accurately control the angles of incident ions on the substrate surface. The normalized etch yield (NEY), defined as the etch yield obtained at a given ion-incident angle normalized to that obtained on a horizontal surface, was unaffected by the bias voltage in Si 3 N 4 etching, but it increased with the bias voltage in SiO 2 etching in the range of -100 to -300 V. The NEY changed showing a maximum with an increase in the ion-incident angle in the etching of both substrates. In the Si 3 N 4 etching, a maximum NEY of 1.7 was obtained at 70 deg. in the above bias voltage range. However, an increase in the NEY at high ion-incident angles was smaller for SiO 2 than for Si 3 N 4 and, consequently, the etch selectivity of SiO 2 to Si 3 N 4 decreased with an increase in the ion-incident angle. The etch selectivity decreased to a smaller extent at high bias voltage because the NEY of SiO 2 had increased. The characteristic changes in the NEY for different substrates could be correlated with the thickness of a steady-state fluorocarbon (CF x ) film formed on the substrates

  12. Field effects in graphene in an interface contact with aqueous solutions of acetic acid and potassium hydroxide

    Science.gov (United States)

    Butko, A. V.; Butko, V. Yu.; Lebedev, S. P.; Lebedev, A. A.; Kumzerov, Yu. A.

    2017-10-01

    For the creation of new promising chemical sensors, it is very important to study the influence of the interface between graphene and aqueous solutions of acids and alkalis on the transistor characteristics of graphene. Transistor structures on the basis of graphene grown by thermal decomposition of silicon carbide were created and studied. For the interface of graphene with aqueous solutions of acetic acid and potassium hydroxide in the transistor geometry, with a variation in the gate-to-source voltage, the field effect corresponding to the hole type of charge carriers in graphene was observed. It is established that an increase in the concentration of molecular ions in these solutions leads to an increase in the dependence of the resistance of the transistor on the gate voltage.

  13. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  14. Piezoelectric excitation of elastic waves in centrosymmetrical potassium tantalate crystal

    International Nuclear Information System (INIS)

    Smolenskij, G.A.; Lemanov, V.V.; Sotnikov, A.V.; Syrnikov, P.P.; Yushin, N.K.

    1981-01-01

    Experiment results on excitation of elastic oscillations in potassium tantalate crystals are considered. The experiment has been conducted by usual for supersonic measurements technique: an impulse of the variable electric field has been applied to one of plane-parallel sample end-faces, at the same end-face signals corresponding to elastic pulses propagating in the crystal have been detected. Basic radiopulses parameters: basic frequency 30 MHz, duration 1-2 μs, pulse recurrence frequency 500 Hz, power 10 W. The investigation carried out has shown that the application to the sample at T=80 K temperature of constant external electrical field parallel to direction of elastic wave propagation leads to hysteresis dependence of elastic waves amplitude on the external voltage value. With temperature increase the hysteresis loop is deformed. It has been found when investigating temperature dependence of elastic wave amplitude that in the absence of external constant electrical field in short-circuited by constant current samples the oxillation excitation effect disappears at T approximately equal to 200 K. An essential influence on the elastic wave amplitude value is exerted by illumination of the crystal surface by light with 360-630 nm wave length. At T 130 K bacaee of photovoltaic effect in illuminated samples [ru

  15. Linkage study of voltage-gated potassium channels in familial mesial temporal lobe epilepsy Análise de ligação dos canais de potássio voltagem-dependente na epilepsia de lobo temporal mesial familiar

    Directory of Open Access Journals (Sweden)

    Cláudia Vianna Maurer-Morelli

    2007-03-01

    Full Text Available Voltage-gated potassium channels (VGKCs play a critical role in the regulation of neuronal excitability and have been implicated in some types of epilepsies. Recently, autoimmune limbic encephalitis (LE was associated with antibodies against VGKC. In addition, patients with LE showed partial epilepsy and increased T2 signal abnormalities in limbic structures. We have reported familial mesial temporal lobe epilepsy (FMTLE associated with hippocampal atrophy (HA and other signs of mesial temporal sclerosis detected by magnetic resonance imaging (MRI. In order to investigate whether VGKC may be associated to HA present in FMTLE, we perform linkage study in these candidate genes. Seventy-three microsatellites markers were genotyped in different human autosomal chromosome. Two-point LOD scores did not show evidence for linkage with any of the microsatellite markers genotyped (Zmax ranging from 0.11to-9.53 at theta=0.00. In the present study, linkage data showed no evidence that VGKC are involved in the determination of HA in FMTLE.Canais de potássio voltagem-dependentes (CPVD desempenham importante papel na excitabilidade neuronal e estão associados a determinados tipos de epilepsia. Recentemente, um tipo de encefalite límbica autoimune (EL foi associado com anticorpos contra CPVD. Além disso, há relatos de pacientes com EL e epilepsia parcial, além de hipersinal em regiões límbicas detectadas em imagens de ressonância magnética (IRM. Nós temos descrito a epilepsia de lobo temporal mesial familial (ELTMF associada à atrofia hipocampal (AH e outros sinais de esclerose mesial temporal observadas em IRM. Para investigar se os CPVD podem estar associados com a AH identificada na ELTMF, empregamos o estudo de ligação genética nesses genes candidatos. Setenta e três marcadores microssatélites foram genotipados e o LOD score de dois pontos mostrou Zmax variando de 0.11 a -9.53 para teta=0.00. No presente estudo, os dados obtidos com a an

  16. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  17. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  18. Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

    Science.gov (United States)

    Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

    2018-04-01

    The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

  19. Moderate hypoxia influences potassium outward currents in adipose-derived stem cells.

    Directory of Open Access Journals (Sweden)

    Mayuri Prasad

    Full Text Available Moderate hypoxic preconditioning of adipose-derived stem cells (ASCs enhances properties such as proliferation and secretion of growth factors, representing a valuable strategy to increase the efficiency of cell-based therapies. In a wide variety of cells potassium (K+ channels are key elements involved in the cellular responses to hypoxia, suggesting that ASCs cultured under low oxygen conditions may display altered electrophysiological properties. Here, the effects of moderate hypoxic culture on proliferation, whole-cell currents, and ion channel expression were investigated using human ASCs cultured at 5% and 20% oxygen. Although cell proliferation was greatly enhanced, the dose-dependent growth inhibition by the K+ channel blocker tetraethylammonium (TEA was not significantly affected by hypoxia. Under both normoxic and hypoxic conditions, ASCs displayed outward K+ currents composed by Ca2+-activated, delayed rectifier, and transient components. Hypoxic culture reduced the slope of the current-voltage curves and caused a negative shift in the voltage activation threshold of the whole-cell currents. However, the TEA-mediated shift of voltage activation threshold was not affected by hypoxia. Semiquantitative real-time RT-PCR revealed that expression of genes encoding for various ion channels subunits related to oxygen sensing and proliferation remained unchanged after hypoxic culture. In conclusion, outward currents are influenced by moderate hypoxia in ASCs through a mechanism that is not likely the result of modulation of TEA-sensitive K+ channels.

  20. Slick (Kcnt2 Sodium-Activated Potassium Channels Limit Peptidergic Nociceptor Excitability and Hyperalgesia

    Directory of Open Access Journals (Sweden)

    Danielle L Tomasello

    2017-09-01

    Full Text Available The Slick (Kcnt2 sodium-activated potassium (K Na channel is a rapidly gating and weakly voltage-dependent and sodium-dependent potassium channel with no clearly defined physiological function. Within the dorsal root ganglia (DRGs, we show Slick channels are exclusively expressed in small-sized and medium-sized calcitonin gene–related peptide (CGRP-containing DRG neurons, and a pool of channels are localized to large dense-core vesicles (LDCV-containing CGRP. We stimulated DRG neurons for CGRP release and found Slick channels contained within CGRP-positive LDCV translocated to the neuronal membrane. Behavioral studies in Slick knockout (KO mice indicated increased basal heat detection and exacerbated thermal hyperalgesia compared with wild-type littermate controls during neuropathic and chronic inflammatory pain. Electrophysiologic recordings of DRG neurons from Slick KO mice revealed that Slick channels contribute to outward current, propensity to fire action potentials (APs, and to AP properties. Our data suggest that Slick channels restrain the excitability of CGRP-containing neurons, diminishing pain behavior after inflammation and injury.

  1. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  2. Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

    2015-07-07

    Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

  3. Potassium toxicity at low serum potassium levels with refeeding syndrome.

    Science.gov (United States)

    Vemula, Praveen; Abela, Oliver G; Narisetty, Keerthy; Rhine, David; Abela, George S

    2015-01-01

    Refeeding syndrome is a life-threatening condition occurring in severely malnourished patients after initiating feeding. Severe hypophosphatemia with reduced adenosine triphosphate production has been implicated, but little data are available regarding electrolyte abnormalities. In this case, we report electrocardiographic changes consistent with hyperkalemia during potassium replacement after a serum level increase from 1.9 to 2.9 mEq/L. This was reversed by lowering serum potassium back to 2.0 mEq/L. In conclusion, the patient with prolonged malnutrition became adapted to low potassium levels and developed potassium toxicity with replacement. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Inward rectifier potassium currents in mammalian skeletal muscle fibres

    Science.gov (United States)

    DiFranco, Marino; Yu, Carl; Quiñonez, Marbella; Vergara, Julio L

    2015-01-01

    Inward rectifying potassium (Kir) channels play a central role in maintaining the resting membrane potential of skeletal muscle fibres. Nevertheless their role has been poorly studied in mammalian muscles. Immunohistochemical and transgenic expression were used to assess the molecular identity and subcellular localization of Kir channel isoforms. We found that Kir2.1 and Kir2.2 channels were targeted to both the surface andthe transverse tubular system membrane (TTS) compartments and that both isoforms can be overexpressed up to 3-fold 2 weeks after transfection. Inward rectifying currents (IKir) had the canonical features of quasi-instantaneous activation, strong inward rectification, depended on the external [K+], and could be blocked by Ba2+ or Rb+. In addition, IKir records show notable decays during large 100 ms hyperpolarizing pulses. Most of these properties were recapitulated by model simulations of the electrical properties of the muscle fibre as long as Kir channels were assumed to be present in the TTS. The model also simultaneously predicted the characteristics of membrane potential changes of the TTS, as reported optically by a fluorescent potentiometric dye. The activation of IKir by large hyperpolarizations resulted in significant attenuation of the optical signals with respect to the expectation for equal magnitude depolarizations; blocking IKir with Ba2+ (or Rb+) eliminated this attenuation. The experimental data, including the kinetic properties of IKir and TTS voltage records, and the voltage dependence of peak IKir, while measured at widely dissimilar bulk [K+] (96 and 24 mm), were closely predicted by assuming Kir permeability (PKir) values of ∼5.5 × 10−6 cm s−1 and equal distribution of Kir channels at the surface and TTS membranes. The decay of IKir records and the simultaneous increase in TTS voltage changes were mostly explained by K+ depletion from the TTS lumen. Most importantly, aside from allowing an accurate estimation of

  5. Temperature dependent quasi-static capacitance-voltage characterization of SiO2/β-Ga2O3 interface on different crystal orientations

    Science.gov (United States)

    Zeng, Ke; Singisetti, Uttam

    2017-09-01

    The interface trap density (Dit) of the SiO2/β-Ga2O3 interface in ( 2 ¯ 01), (010), and (001) orientations is obtained by the Hi-Lo method with the low frequency capacitance measured using the Quasi-Static Capacitance-Voltage (QSCV) technique. QSCV measurements are carried out at higher temperatures to increase the measured energy range of Dit in the bandgap. At room temperature, higher Dit is observed near the band edge for all three orientations. The measurement at higher temperatures led to an annealing effect that reduced the Dit value for all samples. Comparison with the conductance method and frequency dispersion of the capacitance suggests that the traps at the band edge are slow traps which respond to low frequency signals.

  6. Thickness dependence of the poling and current-voltage characteristics of paint films made up of lead zirconate titanate ceramic powder and epoxy resin

    Science.gov (United States)

    Egusa, Shigenori; Iwasawa, Naozumi

    1995-11-01

    A specially prepared paint made up of lead zirconate titanate (PZT) ceramic powder and epoxy resin was coated on an aluminum plate and was cured at room temperature, thus forming the paint film of 25-300 μm thickness with a PZT volume fraction of 53%. The paint film was then poled at room temperature, and the poling behavior was determined by measuring the piezoelectric activity as a function of poling field. The poling behavior shows that the piezoelectric activity obtained at a given poling field increases with an increase in the film thickness from 25 to 300 μm. The current-voltage characteristic of the paint film, on the other hand, shows that the increase in the film thickness leads not only to an increase in the magnitude of the current density at a given electric field but also to an increase in the critical electric field at which the transition from the ohmic to space-charge-limited conduction takes place. This fact indicates that the amount of the space charge of electrons injected into the paint film decreases as the film thickness increases. Furthermore, comparison of the current-voltage characteristic of the paint film with that of a pure epoxy film reveals that the space charge is accumulated largely at the interface between the PZT and epoxy phases in the paint film. On the basis of this finding, a model is developed for the poling behavior of the paint film by taking into account a possible effect of the space-charge accumulation and a broad distribution of the electric field in the PZT phase. This model is shown to give an excellent fit to the experimental data of the piezoelectric activity obtained here as a function of poling field and film thickness.

  7. Crystallization and preliminary X-ray diffraction studies of the tetramerization domain derived from the human potassium channel Kv1.3

    International Nuclear Information System (INIS)

    Winklmeier, Andreas; Weyand, Michael; Schreier, Christina; Kalbitzer, Hans Robert; Kremer, Werner

    2009-01-01

    The tetramerization domain of human Kv1.3 was cloned, expressed, purified and crystallized. The crystals belonged to space group I4 and diffracted to 1.2 Å resolution using synchrotron radiation. The tetramerization domain (T1 domain) derived from the voltage-dependent potassium channel Kv1.3 of Homo sapiens was recombinantly expressed in Escherichia coli and purified. The crystals were first grown in an NMR tube in 150 mM potassium phosphate pH 6.5 in the absence of additional precipitants. The crystals showed I4 symmetry characteristic of the naturally occurring tetrameric assembly of the single subunits. A complete native data set was collected to 1.2 Å resolution at 100 K using synchrotron radiation

  8. Dielectric properties of a potassium nitrate–ammonium nitrate system

    OpenAIRE

    Alexey Yu. Milinskiy; Anton A. Antonov

    2015-01-01

    Potassium nitrate has a rectangular hysteresis loop and is thought to be a promising material for non-volatile ferroelectric memory. However, its polar phase is observed in a narrow temperature range. This paper deals with an effect of ammonium nitrate NH4NO3 on the dielectric properties of potassium nitrate. Thermal dependencies of the linear dielectric permittivity ε and the third-harmonic coefficient g3 for potassium nitrate and polycrystalline binary (KNO3)1–x(NH4NO3)x system (x = 0.025, ...

  9. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  10. 21 CFR 184.1619 - Potassium carbonate.

    Science.gov (United States)

    2010-04-01

    ... solution of potassium hydroxide with excess carbon dioxide to produce potassium carbonate; (3) By treating a solution of potassium hydroxide with carbon dioxide to produce potassium bicarbonate, which is... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium carbonate. 184.1619 Section 184.1619 Food...

  11. Potassium in milk and milk products

    International Nuclear Information System (INIS)

    Sombrito, E.Z.; Nuguid, Z.F.S.; Tangonan, M.C.

    1989-01-01

    The amount of potassium in imported processed milk was determined by gamma spectral analysis. The results show that the potassium content of diluted infant formula milk is closest to the reported mean concentration of potassium in human milk while other milk types have potassium values similar to the potassium content of cow milk. (Auth.). 2 figs., 5 refs

  12. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  13. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  14. Mechanism of cesium sorption on potassium titanium hexacyanoferrate

    International Nuclear Information System (INIS)

    Sun Yongxia; Xu Shiping; Song Chongli

    1998-01-01

    The mechanism of cesium sorption on potassium titanium hexacyanoferrate is described. The dependence of the sorption speed on temperature, particle granule size, and the stirring speed is studied. The results show that the sorption process is controlled by liquid film diffusion and particle diffusion. An exchange reaction occurs mainly between K + in the exchanger and Cs + in the solution, i.e. potassium titanium hexacyanoferrate, and Cs + of simulated high-level liquid waste

  15. Electrical properties of the potassium polytitanate compacts

    Energy Technology Data Exchange (ETDEWEB)

    Goffman, V.G.; Gorokhovsky, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Kompan, M.M. [Physico-Technical Institute of the Russian Academy of Science, St. Petersburg (Russian Federation); Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Fedorov, F.S., E-mail: fedorov_fs@daad-alumni.de [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation)

    2014-12-05

    Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10{sup 4}–10{sup 5}. • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10{sup −2} to 10{sup −6}–10{sup −7} Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10{sup −2} Sm/m (high frequencies, ion conductivity) up to 10{sup −6}–10{sup −7} Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10{sup 4}–10{sup 5}. This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures.

  16. Analysis of temperature-dependant current–voltage characteristics and extraction of series resistance in Pd/ZnO Schottky barrier diodes

    Energy Technology Data Exchange (ETDEWEB)

    Mayimele, M A, E-mail: meehleketo@gmail.com; Rensburg, J P van. Janse; Auret, F D; Diale, M

    2016-01-01

    We report on the analysis of current voltage (I–V) measurements performed on Pd/ZnO Schottky barrier diodes (SBDs) in the 80–320 K temperature range. Assuming thermionic emission (TE) theory, the forward bias I–V characteristics were analysed to extract Pd/ZnO Schottky diode parameters. Comparing Cheung’s method in the extraction of the series resistance with Ohm’s law, it was observed that at lower temperatures (T<180 K) the series resistance decreased with increasing temperature, the absolute minimum was reached near 180 K and increases linearly with temperature at high temperatures (T>200 K). The barrier height and the ideality factor decreased and increased, respectively, with decrease in temperature, attributed to the existence of barrier height inhomogeneity. Such inhomogeneity was explained based on TE with the assumption of Gaussian distribution of barrier heights with a mean barrier height of 0.99 eV and a standard deviation of 0.02 eV. A mean barrier height of 0.11 eV and Richardson constant value of 37 A cm{sup −2} K{sup −2} were determined from the modified Richardson plot that considers the Gaussian distribution of barrier heights.

  17. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  18. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  19. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  20. Dietary reference values for potassium

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for potassium. The Panel decides to set DRVs on the basis of the relationships between potassium intake and blood pressure and stroke...

  1. Neural synchronization via potassium signaling

    DEFF Research Database (Denmark)

    Postnov, Dmitry E; Ryazanova, Ludmila S; Mosekilde, Erik

    2006-01-01

    Using a relatively simple model we examine how variations of the extracellular potassium concentration can give rise to synchronization of two nearby pacemaker cells. With the volume of the extracellular space and the rate of potassium diffusion as control parameters, the dual nature of this reso...

  2. Can Diuretics Decrease Your Potassium Level?

    Science.gov (United States)

    ... of low potassium? Can diuretics decrease your potassium level? Answers from Sheldon G. Sheps, M.D. Yes, ... your urine. This can lead to low potassium levels in your blood (hypokalemia). Signs and symptoms of ...

  3. Transverse thermal magnetoresistance of potassium

    International Nuclear Information System (INIS)

    Newrock, R.S.; Maxfield, B.W.

    1976-01-01

    Results are presented of extensive thermal magnetoresistance measurements on single-crystal and polycrystalline specimens of potassium having residual resistance ratios (RRR) ranging from 1100 to 5300. Measurements were made between 2 and 9 0 K for magnetic fields up to 1.8 T. The observed thermal magnetoresistance cannot be understood on the basis of either semiclassical theories or from the electrical magnetoresistance and the Wiedemann-Franz law. A number of relationships are observed between the thermal and electrical magnetoresistances, many of which are not immediately obvious when comparing direct experimental observations. The thermal magnetoresistance W(T,H) is given reasonably well by W(T,H)T = W(T,0)T + AH + BH 2 , where both A and B are temperature-dependent coefficients. Results show that A = A 0 + A 1 T 3 , while B(T) cannot be expressed as any simple power law. A 0 is dependent on the RRR, while A 1 is independent of the RRR. Two relationships are found between corresponding coefficients in the electrical and thermal magnetoresistance: (i) the Wiedmann--Franz law relates A 0 to the Kohler slope of the electrical magnetoresistance and (ii) the temperature-dependent portions of the electrical and thermal Kohler slopes are both proportional to the electron--phonon scattering contribution to the corresponding zero-field resistance. The latter provides evidence that inelastic scattering is very important in determining the temperature-dependent linear magnetoresistances. Part, but by no means all, of the quadratic thermal resistance is accounted for by lattice thermal conduction. It is concluded that at least a portion of the anomalous electrical and thermal magnetoresistances is due to intrinsic causes and not inhomogeneities or other macroscopic defects

  4. Potassium iodide stockpiling

    International Nuclear Information System (INIS)

    Krimm, R.W.

    1983-01-01

    After examination by the Federal Emergency Management Agency (FEMA) and other federal agencies of federal policy on the use and distribution of potassium iodide (KI) as a thyroid-blocking agent for use in off-site preparedness around commercial nuclear powerplants, FEMA believes the present shelf life of KI is too short, that the minimum ordering quantities are an obstacle to efficient procurement, and that the packaging format offered by the drug industry does not meet the wishes of state and local government officials. FEMA has asked assistance from the Food and Drug Administration in making it possible for those states wishing to satisfy appropriate requirements to do so at the minimum cost to the public. Given an appropriate packaging and drug form, there appears to be no reason for the federal government to have further involvement in the stockpiling of KI

  5. Potassium-argon technology

    International Nuclear Information System (INIS)

    Cassignol, Charles; Cornette, Yves; David, Benjamin; Gillot, P.-Y.

    1978-04-01

    The main features of the method of processing rocks and minerals and measuring the extracted argon, for the purpose of potassium-argon dating are described. It differs in several respects from the conventional one, as described, f.i., in Dalrymple and Lanphere's monography. Principally it was established that the continual purification of the gases in the mass spectrometer cell during the measurement, stops the peaks of current drift, and renders them representative of the introduced argon. This allows on the one hand to improve the reliability and accuracy of measurements, on the other hand to get rid of the isotopic dilution method, with 38 A as a spike. Moreover the reliability of the radiogenic argon is improved by taking into account the mislinearness of the M.S. response. All this results in a higher performance of the K/Ar dating method, especially in the recent ages range. The technological side of the problem was only dealt with [fr

  6. Cardiac potassium channel subtypes

    DEFF Research Database (Denmark)

    Schmitt, Nicole; Grunnet, Morten; Olesen, Søren-Peter

    2014-01-01

    About 10 distinct potassium channels in the heart are involved in shaping the action potential. Some of the K(+) channels are primarily responsible for early repolarization, whereas others drive late repolarization and still others are open throughout the cardiac cycle. Three main K(+) channels...... drive the late repolarization of the ventricle with some redundancy, and in atria this repolarization reserve is supplemented by the fairly atrial-specific KV1.5, Kir3, KCa, and K2P channels. The role of the latter two subtypes in atria is currently being clarified, and several findings indicate...... that they could constitute targets for new pharmacological treatment of atrial fibrillation. The interplay between the different K(+) channel subtypes in both atria and ventricle is dynamic, and a significant up- and downregulation occurs in disease states such as atrial fibrillation or heart failure...

  7. Sound velocity in potassium hydroxide aqueous solution

    International Nuclear Information System (INIS)

    Tsapuryan, Kh.D.; Aleksandrov, A.A.; Kochetkov, A.I.

    1992-01-01

    Measurements of ultrasonic velocities in potassium hydroxide aqueous solutions are carried out within the frames of studies on improvement of water chemistry in NPP cooling systems. Method of echo pulses superposition with acoustic path length of 41.447 mm is used for measurements. The measurements are performed at 2.6 MHz frequency. Complex temperature dependence of ultrasonic velocity is determined. Ultrasonic velocity dependence on pressure is close to linear one. The formula for calculation of thermodynamic properties of the studied solutions on the basis of experimental data obtained is proposed

  8. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  9. The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations.

    Science.gov (United States)

    Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J

    2017-10-01

    Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Modulation of voltage-gated channel currents by harmaline and harmane.

    Science.gov (United States)

    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

    2005-01-01

    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

  11. Sterically screened halogenocyclobutanones. I. Transformations of cyclopropyl-substituted 2,2-dichlorocyclobutanones under the influence of potassium hydroxide

    International Nuclear Information System (INIS)

    Donskaya, N.A.; Bessmertnykh, A.G.; Drobysh, V.A.; Shabarov, Yu.S.

    1987-01-01

    The reaction of 2,2-dichloro-3-cyclopropylcyclobutanones with potassium hydroxide was studied. The direction of the reaction depends on the concentration of the potassium hydroxide; with a 2% solution of potassium hydroxide 4,4-dichlorobutyric acids are formed with yields of up to 80%, and with a 15% solution of potassium hydroxide 5-hydroxydihydro-2-furanones are formed with yields of up to 80%. Proposals are made about the mechanism of formation of 5-hydroxydihydro-2-furanones

  12. Oral potassium supplementation in surgical patients.

    Science.gov (United States)

    Hainsworth, Alison J; Gatenby, Piers A

    2008-08-01

    Hospital inpatients are frequently hypokalaemic. Low plasma potassium levels may cause life threatening complications, such as cardiac arrhythmias. Potassium supplementation may be administered parenterally or enterally. Oral potassium supplements have been associated with oesophageal ulceration, strictures and gastritis. An alternative to potassium salt tablets or solution is dietary modification with potassium rich food stuffs, which has been proven to be a safe and effective method for potassium supplementation. The potassium content of one medium banana is equivalent to a 12 mmol potassium salt tablet. Potassium supplementation by dietary modification has been shown to be equally efficacious to oral potassium salt supplementation and is preferred by the majority of patients. Subsequently, it is our practice to replace potassium using dietary modification, particularly in surgical patients having undergone oesophagogastrectomy or in those with peptic ulcer disease.

  13. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  14. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    Science.gov (United States)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  15. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  16. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3-δ thin films investigated by chemical capacitance measurements.

    Science.gov (United States)

    Schmid, Alexander; Rupp, Ghislain M; Fleig, Jürgen

    2018-05-03

    La0.6Sr0.4FeO3-δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to -600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions.

  17. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3–δ thin films investigated by chemical capacitance measurements

    Science.gov (United States)

    Rupp, Ghislain M.; Fleig, Jürgen

    2018-01-01

    La0.6Sr0.4FeO3–δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to –600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions. PMID:29671421

  18. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  19. Transport properties of a potassium-doped single-wall carbon nanotube rope

    International Nuclear Information System (INIS)

    Lee, R. S.; Kim, H. J.; Fischer, J. E.; Lefebvre, J.; Radosavljevic, M.; Hone, J.; Johnson, A. T.

    2000-01-01

    Four-probe resistance vs temperature and gate voltage are reported for an individual single-wall carbon nanotube rope before and after doping in situ with potassium. All the features in R(T) from unoriented bulk material, before and after doping, are qualitatively reproduced by the rope data. The 5.3 K conductance of the pristine rope decreases with positive gate voltage, while G vs V g becomes featureless after K doping. (c) 2000 The American Physical Society

  20. Reversible antisense inhibition of Shaker-like Kv1.1 potassium channel expression impairs associative memory in mouse and rat

    Science.gov (United States)

    Meiri, Noam; Ghelardini, Carla; Tesco, Giuseppina; Galeotti, Nicoletta; Dahl, Dennis; Tomsic, Daniel; Cavallaro, Sebastiano; Quattrone, Alessandro; Capaccioli, Sergio; Bartolini, Alessandro; Alkon, Daniel L.

    1997-01-01

    Long-term memory is thought to be subserved by functional remodeling of neuronal circuits. Changes in the weights of existing synapses in networks might depend on voltage-gated potassium currents. We therefore studied the physiological role of potassium channels in memory, concentrating on the Shaker-like Kv1.1, a late rectifying potassium channel that is highly localized within dendrites of hippocampal CA3 pyramidal and dentate gyrus granular cells. Repeated intracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of its particular intracellular mRNA target, decreases late rectifying K+ current(s) in dentate granule cells, and impairs memory but not other motor or sensory behaviors, in two different learning paradigms, mouse passive avoidance and rat spatial memory. The latter, hippocampal-dependent memory loss occurred in the absence of long-term potentiation changes recorded both from the dentate gyrus or CA1. The specificity of the reversible antisense targeting of mRNA in adult animal brains may avoid irreversible developmental and genetic background effects that accompany transgenic “knockouts”. PMID:9114006

  1. Reversible antisense inhibition of Shaker-like Kv1.1 potassium channel expression impairs associative memory in mouse and rat.

    Science.gov (United States)

    Meiri, N; Ghelardini, C; Tesco, G; Galeotti, N; Dahl, D; Tomsic, D; Cavallaro, S; Quattrone, A; Capaccioli, S; Bartolini, A; Alkon, D L

    1997-04-29

    Long-term memory is thought to be subserved by functional remodeling of neuronal circuits. Changes in the weights of existing synapses in networks might depend on voltage-gated potassium currents. We therefore studied the physiological role of potassium channels in memory, concentrating on the Shaker-like Kv1.1, a late rectifying potassium channel that is highly localized within dendrites of hippocampal CA3 pyramidal and dentate gyrus granular cells. Repeated intracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of its particular intracellular mRNA target, decreases late rectifying K+ current(s) in dentate granule cells, and impairs memory but not other motor or sensory behaviors, in two different learning paradigms, mouse passive avoidance and rat spatial memory. The latter, hippocampal-dependent memory loss occurred in the absence of long-term potentiation changes recorded both from the dentate gyrus or CA1. The specificity of the reversible antisense targeting of mRNA in adult animal brains may avoid irreversible developmental and genetic background effects that accompany transgenic "knockouts".

  2. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  3. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  4. Reaction of lithium, sodium and potassium polyphosphates with potassium permanganate at elevated temperatures

    International Nuclear Information System (INIS)

    Paderova, L.V.; Onuchina, T.V.; Kochergin, V.P.

    1996-01-01

    A study was made on destruction of molten polyphosphates of alkaline metals by potassium permanganate during change of KMnO 4 content, test time and temperature. Ortho-, di, tri- and tetraphosphate-anions, as well as manganese compounds with different oxidation degree were revealed in products of component interaction. Empirical equations of the dependence of the value of average molecular mass on change of melt temperature were derived. 11 refs.; 2 figs.; 2 tabs

  5. 21 CFR 184.1631 - Potassium hydroxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium hydroxide. 184.1631 Section 184.1631 Food... Specific Substances Affirmed as GRAS § 184.1631 Potassium hydroxide. (a) Potassium hydroxide (KOH, CAS Reg... pellets, flakes, sticks, lumps, and powders. Potassium hydroxide is obtained commercially from the...

  6. 21 CFR 184.1643 - Potassium sulfate.

    Science.gov (United States)

    2010-04-01

    ... hydroxide or potassium carbonate. (b) The ingredient meets the specifications of the “Food Chemicals Codex... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium sulfate. 184.1643 Section 184.1643 Food... Specific Substances Affirmed as GRAS § 184.1643 Potassium sulfate. (a) Potassium sulfate (K2SO4, CAS Reg...

  7. 21 CFR 184.1622 - Potassium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium chloride. 184.1622 Section 184.1622 Food... Specific Substances Affirmed as GRAS § 184.1622 Potassium chloride. (a) Potassium chloride (KCl, CAS Reg... levels not to exceed current good manufacturing practice. Potassium chloride may be used in infant...

  8. Potassium distribution in sugar cane

    International Nuclear Information System (INIS)

    Medina, N.H.

    2014-01-01

    In this work the distribution of potassium in sugarcane has been studied during its growth in two different conditions. In the first one the sugarcane soil was prepared with natural fertilizers, using sugarcane bagasse and, in another plantation the soil was prepared with commercial fertilizer NPK with a proportion of 10-10-10. For the measurement of potassium concentration in each part of the plant, gamma ray spectrometry techniques have been used to measure gamma-rays emitted from the radioisotope 40 K present in the sugarcane samples. The concentration of potassium in roots, stems and leaves were measured periodically. The results for sugarcane cultivated in soil with natural fertilizer show a higher concentration of potassium at the beginning of plant development and over time there is an oscillatory behavior in this concentration in each part of the plant, reaching a lower concentration in the adult plant. The results for the plant grown in soil with NPK fertilizer, indicate that the potassium concentration is higher in the stem at the beginning of cultivation and remained practically constant over time in various parts of the plant, with higher values in the leaves and stem than at the root. On the other hand, the results obtained using fertilizer NPK shows a lower potassium concentration, since the fertilizer provoked a much higher growth rate. (author)

  9. Potassium supplements for oral diarrhoea regimens.

    Science.gov (United States)

    Clements, M L; Levine, M M; Black, R E; Hughes, T P; Rust, J; Tome, F C

    1980-10-18

    A study is proposed for supplementing potassium loss from diarrhea in rehydration therapies with fresh fruit and other naturally potassium-rich foods. Bananas contain .1 mol of potassium per gm. Freshly squeezed lemon or orange juices were tested for potassium and sodium content and found to have very low potassium concentration. Therefore, the banana was chosen for an upcoming study that will determine if infants and children suffering from diarrhea can ingest the amounts of the fruit necessary to elevate the potassium level sufficiently. Bananas as the potassium source are thought to be well-accepted in developing areas.

  10. 21 CFR 184.1625 - Potassium citrate.

    Science.gov (United States)

    2010-04-01

    ... acid with potassium hydroxide or potassium carbonate. It occurs as transparent crystals or a white... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium citrate. 184.1625 Section 184.1625 Food... Specific Substances Affirmed as GRAS § 184.1625 Potassium citrate. (a) Potassium citrate (C6H5K3O7·H2O, CAS...

  11. PKC and AMPK regulation of Kv1.5 potassium channels

    DEFF Research Database (Denmark)

    Andersen, Martin Nybo; Skibsbye, Lasse; Tang, Chuyi

    2015-01-01

    The voltage-gated Kv1.5 potassium channel, conducting the ultra-rapid rectifier K(+) current (IKur), is regulated through several pathways. Here we investigate if Kv1.5 surface expression is controlled by the 2 kinases PKC and AMPK, using Xenopus oocytes, MDCK cells and atrial derived HL-1 cells....

  12. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  13. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  14. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  15. Performance analysis of a potassium-base AMTEC cell

    International Nuclear Information System (INIS)

    Huang, C.; Hendricks, T.J.; Hunt, T.K.

    1998-01-01

    Sodium-BASE Alkali-Metal-Thermal-to-Electric-Conversion (AMTEC) cells have been receiving increased attention and funding from the Department of Energy, NASA and the United States Air Force. Recently, sodium-BASE (Na-BASE) AMTEC cells were selected for the Advanced Radioisotope Power System (ARPS) program for the next generation of deep-space missions and spacecraft. Potassium-BASE (K-BASE) AMTEC cells have not received as much attention to date, even though the vapor pressure of potassium is higher than that of sodium at the same temperature. So that, K-BASE AMTEC cells with potentially higher open circuit voltage and higher power output than Na-BASE AMTEC cells are possible. Because the surface tension of potassium is about half of the surface tension of sodium at the same temperature, the artery and evaporator design in a potassium AMTEC cell has much more challenging pore size requirements than designs using sodium. This paper uses a flexible thermal/fluid/electrical model to predict the performance of a K-BASE AMTEC cell. Pore sizes in the artery of K-BASE AMTEC cells must be smaller by an order of magnitude than in Na-BASE AMTEC cells. The performance of a K-BASE AMTEC cell was higher than a Na-BASE AMTEC cell at low voltages/high currents. K-BASE AMTEC cells also have the potential of much better electrode performance, thereby creating another avenue for potentially better performance in K-BASE AMTEC cells

  16. Potassium-Based Dual Ion Battery with Dual-Graphite Electrode.

    Science.gov (United States)

    Fan, Ling; Liu, Qian; Chen, Suhua; Lin, Kairui; Xu, Zhi; Lu, Bingan

    2017-08-01

    A potassium ion battery has potential applications for large scale electric energy storage systems due to the abundance and low cost of potassium resources. Dual graphite batteries, with graphite as both anode and cathode, eliminate the use of transition metal compounds and greatly lower the overall cost. Herein, combining the merits of the potassium ion battery and dual graphite battery, a potassium-based dual ion battery with dual-graphite electrode is developed. It delivers a reversible capacity of 62 mA h g -1 and medium discharge voltage of ≈3.96 V. The intercalation/deintercalation mechanism of K + and PF 6 - into/from graphite is proposed and discussed in detail, with various characterizations to support. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  18. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  19. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  20. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  1. Mechanism of inhibition of mouse Slo3 (KCa 5.1) potassium channels by quinine, quinidine and barium.

    Science.gov (United States)

    Wrighton, David C; Muench, Stephen P; Lippiat, Jonathan D

    2015-09-01

    The Slo3 (KCa 5.1) channel is a major component of mammalian KSper (sperm potassium conductance) channels and inhibition of these channels by quinine and barium alters sperm motility. The aim of this investigation was to determine the mechanism by which these drugs inhibit Slo3 channels. Mouse (m) Slo3 (KCa 5.1) channels or mutant forms were expressed in Xenopus oocytes and currents recorded with 2-electrode voltage-clamp. Gain-of-function mSlo3 mutations were used to explore the state-dependence of the inhibition. The interaction between quinidine and mSlo3 channels was modelled by in silico docking. Several drugs known to block KSper also affected mSlo3 channels with similar levels of inhibition. The inhibition induced by extracellular barium was prevented by increasing the extracellular potassium concentration. R196Q and F304Y mutations in the mSlo3 voltage sensor and pore, respectively, both increased channel activity. The F304Y mutation did not alter the effects of barium, but increased the potency of inhibition by both quinine and quinidine approximately 10-fold; this effect was not observed with the R196Q mutation. Block of mSlo3 channels by quinine, quinidine and barium is not state-dependent. Barium inhibits mSlo3 outside the cell by interacting with the selectivity filter, whereas quinine and quinidine act from the inside, by binding in a hydrophobic pocket formed by the S6 segment of each subunit. Furthermore, we propose that the Slo3 channel activation gate lies deep within the pore between F304 in the S6 segment and the selectivity filter. © 2015 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.

  2. Investigation of iodine liberation process in redox titration of potassium iodate with sodium thiosulfate

    Energy Technology Data Exchange (ETDEWEB)

    Asakai, Toshiaki, E-mail: t-asakai@aist.go.jp [National Metrology Institute of Japan (NMIJ), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 3-9, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8563 (Japan); Hioki, Akiharu [National Metrology Institute of Japan (NMIJ), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 3-9, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8563 (Japan)

    2011-03-09

    Potassium iodate is often used as a reference material to standardize a sodium thiosulfate solution which is a familiar titrant for redox titrations. In the standardization, iodine (triiodide) liberated by potassium iodate in an acidic potassium iodide solution is titrated with a sodium thiosulfate solution. The iodine liberation process is significantly affected by the amount of acid, that of potassium iodide added, the waiting time for the liberation, and light; therefore, the process plays a key role for the accuracy of the titration results. Constant-voltage biamperometry with a modified dual platinum-chip electrode was utilized to monitor the amount of liberated iodine under several liberation conditions. Coulometric titration was utilized to determine the concentration of a sodium thiosulfate solution on an absolute basis. Potassium iodate was assayed by gravimetric titration with the sodium thiosulfate solution under several iodine liberation conditions. The liberation process was discussed from the changes in the apparent assay of potassium iodate. The information of the appropriate titration procedure obtained in the present study is useful for any analysts utilizing potassium iodate to standardize a thiosulfate solution.

  3. Investigation of iodine liberation process in redox titration of potassium iodate with sodium thiosulfate

    International Nuclear Information System (INIS)

    Asakai, Toshiaki; Hioki, Akiharu

    2011-01-01

    Potassium iodate is often used as a reference material to standardize a sodium thiosulfate solution which is a familiar titrant for redox titrations. In the standardization, iodine (triiodide) liberated by potassium iodate in an acidic potassium iodide solution is titrated with a sodium thiosulfate solution. The iodine liberation process is significantly affected by the amount of acid, that of potassium iodide added, the waiting time for the liberation, and light; therefore, the process plays a key role for the accuracy of the titration results. Constant-voltage biamperometry with a modified dual platinum-chip electrode was utilized to monitor the amount of liberated iodine under several liberation conditions. Coulometric titration was utilized to determine the concentration of a sodium thiosulfate solution on an absolute basis. Potassium iodate was assayed by gravimetric titration with the sodium thiosulfate solution under several iodine liberation conditions. The liberation process was discussed from the changes in the apparent assay of potassium iodate. The information of the appropriate titration procedure obtained in the present study is useful for any analysts utilizing potassium iodate to standardize a thiosulfate solution.

  4. Ancient Systems of Sodium/Potassium Homeostasis as Predecessors of Membrane Bioenergetics.

    Science.gov (United States)

    Dibrova, D V; Galperin, M Y; Koonin, E V; Mulkidjanian, A Y

    2015-05-01

    Cell cytoplasm of archaea, bacteria, and eukaryotes contains substantially more potassium than sodium, and potassium cations are specifically required for many key cellular processes, including protein synthesis. This distinct ionic composition and requirements have been attributed to the emergence of the first cells in potassium-rich habitats. Different, albeit complementary, scenarios have been proposed for the primordial potassium-rich environments based on experimental data and theoretical considerations. Specifically, building on the observation that potassium prevails over sodium in the vapor of inland geothermal systems, we have argued that the first cells could emerge in the pools and puddles at the periphery of primordial anoxic geothermal fields, where the elementary composition of the condensed vapor would resemble the internal milieu of modern cells. Marine and freshwater environments generally contain more sodium than potassium. Therefore, to invade such environments, while maintaining excess of potassium over sodium in the cytoplasm, primordial cells needed means to extrude sodium ions. The foray into new, sodium-rich habitats was the likely driving force behind the evolution of diverse redox-, light-, chemically-, or osmotically-dependent sodium export pumps and the increase of membrane tightness. Here we present a scenario that details how the interplay between several, initially independent sodium pumps might have triggered the evolution of sodium-dependent membrane bioenergetics, followed by the separate emergence of the proton-dependent bioenergetics in archaea and bacteria. We also discuss the development of systems that utilize the sodium/potassium gradient across the cell membranes.

  5. A FAST study of quasi-static structure ("Inverted-V") potential drops and their latitudinal dependence in the premidnight sector and ramifications for the current-voltage relationship

    Science.gov (United States)

    Dombeck, J.; Cattell, C.; McFadden, J.

    2013-09-01

    Utilizing FAST satellite electron measurements, we present the first reported investigation of the dependency on latitude of quasi-static structure ("inverted-V") potential drop magnitude (Φ). A trend of lower Φ at lower latitudes in the premidnight sector on field lines with dark foot points was observed. This trend is supported both statistically and in individual satellite crossings. The existence of two distinct peaks in occurrence probability for Φ was also observed: one between ~2 kV and 10 kV and the other at somewhat less than 1 kV. The relative occurrence of structures with Φ in the higher (>2 kV) peak is significantly reduced with decreasing latitude. This partially accounts for the statistical trend of lower potential drop magnitudes at lower latitudes. The two Φ occurrence frequency peaks correspond to two different regimes (one with eΦ/kTe ~ or > 1 and one with eΦ/kTe current-voltage relation where source electron density rather than Φ is most directly controlled by the field-aligned current density. These observations and their ramifications represent a significant step forward in the understanding of field-aligned currents, auroral acceleration, and magnetospheric-ionospheric coupling.

  6. Dependence of open-circuit voltage of SnO2-nSi solar cells; SnO2-nSi taiyo denchi no sanka ondo menhoi izonsei

    Energy Technology Data Exchange (ETDEWEB)

    Shinoda, S; Shimizu, A; Yano, K; Kasuga, M [Yamanashi University, Yamanashi (Japan). Faculty of Engineering

    1997-11-25

    Although metal(or semiconductor)-semiconductor solar cells, SnO2-nSi solar cell for example, are superior in cost and efficiency, its barrier height and open-circuit voltage V(oc) are lower than those of p-n junctions. To improve these defects, study was made on the dependence of V(oc) on oxidation temperature and surface orientation using various solar cells prepared from (100)Si and (111)Si under various oxidation conditions. As a result, the density of surface states increases with a decrease in oxidation temperature of Si substrates, resulting in an increase in diode factor and V(oc). In this case, since oxide films are extremely thin and contribution of non-terminated bonds is large in the initial oxidation stage, the quantity of dangling bonds is larger in (100) plane than (111) plane, resulting in an increase in diode factor and V(oc). Since the surface energy level (the degree of electrons dominated by acceptor-like surface state from this level to the top of a valence band) of (100) Si is lower than that of (111) Si, the effective barrier height and V(oc) increase. 28 refs., 6 figs., 2 tabs.

  7. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  8. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  9. Extrarenal potassium adaptation: role of skeletal muscle

    International Nuclear Information System (INIS)

    Blachley, J.D.; Crider, B.P.; Johnson, J.H.

    1986-01-01

    Following the ingestion of a high-potassium-content diet for only a few days, the plasma potassium of rats rises only modestly in response to a previously lethal dose of potassium salts. This acquired tolerance, termed potassium adaptation, is principally the result of increased capacity to excrete potassium into the urine. However, a substantial portion of the acute potassium dose is not immediately excreted and is apparently translocated into cells. Previous studies have failed to show an increase in the content of potassium of a variety of tissues from such animals. Using 86 Rb as a potassium analogue, we have shown that the skeletal muscle of potassium-adapted rats takes up significantly greater amounts of potassium in vivo in response to an acute challenge than does that of control animals. Furthermore, the same animals exhibit greater efflux of 86 Rb following the termination of the acute infusion. We have also shown that the Na+-K+-ATPase activity and ouabain-binding capacity of skeletal muscle microsomes are increased by the process of potassium adaptation. We conclude that skeletal muscle is an important participant in potassium adaptation and acts to temporarily buffer acute increases in the extracellular concentration of potassium

  10. Mass-spectrometric study of thermodynamics of molybdate potassium evaporation

    International Nuclear Information System (INIS)

    Kazenas, E.K.; Tsvetkov, Yu.V.; Samojlova, I.O.; Astakhova, G.K.; Petrov, A.A.

    2002-01-01

    One investigated into evaporation of potassium molybdate within 1170-1310 K temperature range using platinum effusion chambers. Evaporation of potassium molybdate within 1170-1310 K temperature range may be described as follows: K 2 MoO 4(s,l) = K 2 MoO 4(g) . Based on method of least squares one calculated equation of K 2 MoO 4(g) vapor pressure (pressure in millimeters of mercury column) dependence on temperature for 1200-1320 K range. One evaluated value of K 2 MoO 4(g) molecule atomization energy [ru

  11. Data on electrical properties of nickel modified potassium polytitanates compacted powders.

    Science.gov (United States)

    Goffman, V G; Gorokhovsky, A V; Gorshkov, N V; Fedorov, F S; Tretychenko, E V; Sevrugin, A V

    2015-09-01

    Potassium polytitanates are new promising type of ferroelectric ceramic materials with high ionic conductivity, highly polarizable structure and extremely high permittivity. Its structure is formed by [TiO6] octahedral units to layers with mobile potassium and hydroxonium ions in-between. The treatment in solutions containing nickel ions allows forming heterostructured materials which consist of potassium polytitanate particles intercalated by Ni(2+) ions and/or decorated by nickel oxides NiO x . This modification route is fully dependant on solution pH, i.e. in acidic solutions the intercalation process prevails, in alkaline solutions potassium polytitanate is mostly decorated by the oxides. Therefore, electronic structure and electrical properties can be regulated depending on modification conditions, pH and ions concentration. Here we report the data on electric properties of potassium titanate modified in nickel sulfate solutions at different pH.

  12. Data on electrical properties of nickel modified potassium polytitanates compacted powders

    Directory of Open Access Journals (Sweden)

    V.G. Goffman

    2015-09-01

    Full Text Available Potassium polytitanates are new promising type of ferroelectric ceramic materials with high ionic conductivity, highly polarizable structure and extremely high permittivity. Its structure is formed by [TiO6] octahedral units to layers with mobile potassium and hydroxonium ions in-between. The treatment in solutions containing nickel ions allows forming heterostructured materials which consist of potassium polytitanate particles intercalated by Ni2+ ions and/or decorated by nickel oxides NiOx. This modification route is fully dependant on solution pH, i.e. in acidic solutions the intercalation process prevails, in alkaline solutions potassium polytitanate is mostly decorated by the oxides. Therefore, electronic structure and electrical properties can be regulated depending on modification conditions, pH and ions concentration. Here we report the data on electric properties of potassium titanate modified in nickel sulfate solutions at different pH.

  13. Genetics Home Reference: potassium-aggravated myotonia

    Science.gov (United States)

    ... aggravated by eating potassium-rich foods such as bananas and potatoes. Stiffness occurs in skeletal muscles throughout the body. Potassium-aggravated myotonia ranges in severity from mild episodes ...

  14. The heart and potassium: a banana republic.

    Science.gov (United States)

    Khan, Ehsan; Spiers, Christine; Khan, Maria

    2013-03-01

    The importance of potassium in maintaining stable cardiac function is a clinically understood phenomenon. Physiologically the importance of potassium in cardiac function is described by the large number of different kinds of potassium ions channels found in the heart compared to channels and membrane transport mechanisms for other ions such as sodium and calcium. Potassium is important in physiological homeostatic control of cardiac function, but is also of relevance to the diseased state, as potassium-related effects may stabilize or destabilize cardiac function. This article aims to provide a detailed understanding of potassium-mediated cardiac function. This will help the clinical practitioner evaluate how modulation of potassium ion channels by disease and pharmacological manipulation affect the cardiac patient, thus aiding in decision making when faced with clinical problems related to potassium.

  15. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    IAS Admin

    CLASSROOM. 285. RESONANCE | March 2016. Qualitative Carbohydrate Analysis using Alkaline. Potassium Ferricyanide. Keywords. Alkaline potassium ferricyanide, qualitative ... Carbohydrates form a distinct class of organic compounds often .... Laboratory Techniques: A contemporary Approach, W B Saunders Com-.

  16. Status of potassium permanganate - 2008

    Science.gov (United States)

    This is a brief overview of the Technical Sections completed and being worked on for the New Animal Drug Application (NADA) for potassium permanganate will be presented. Initial Label Claim (Columnaris on catfish/HSB): 1) Human Food Safety - Complete for all fin fish (June 1999). A hazard charac...

  17. Increased serum potassium affects renal outcomes

    DEFF Research Database (Denmark)

    Miao, Y; Dobre, D; Heerspink, H J Lambers

    2011-01-01

    To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy.......To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy....

  18. Bag1 Co-chaperone Promotes TRC8 E3 Ligase-dependent Degradation of Misfolded Human Ether a Go-Go-related Gene (hERG) Potassium Channels.

    Science.gov (United States)

    Hantouche, Christine; Williamson, Brittany; Valinsky, William C; Solomon, Joshua; Shrier, Alvin; Young, Jason C

    2017-02-10

    Cardiac long QT syndrome type 2 is caused by mutations in the human ether a go-go-related gene (hERG) potassium channel, many of which cause misfolding and degradation at the endoplasmic reticulum instead of normal trafficking to the cell surface. The Hsc70/Hsp70 chaperones assist the folding of the hERG cytosolic domains. Here, we demonstrate that the Hsp70 nucleotide exchange factor Bag1 promotes hERG degradation by the ubiquitin-proteasome system at the endoplasmic reticulum to regulate hERG levels and channel activity. Dissociation of hERG complexes containing Hsp70 and the E3 ubiquitin ligase CHIP requires the interaction of Bag1 with Hsp70, but this does not involve the Bag1 ubiquitin-like domain. The interaction with Bag1 then shifts hERG degradation to the membrane-anchored E3 ligase TRC8 and its E2-conjugating enzyme Ube2g2, as determined by siRNA screening. TRC8 interacts through the transmembrane region with hERG and decreases hERG functional expression. TRC8 also mediates degradation of the misfolded hERG-G601S disease mutant, but pharmacological stabilization of the mutant structure prevents degradation. Our results identify TRC8 as a previously unknown Hsp70-independent quality control E3 ligase for hERG. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Rearrangement of potassium ions and Kv1.1/Kv1.2 potassium channels in regenerating axons following end-to-end neurorrhaphy: ionic images from TOF-SIMS.

    Science.gov (United States)

    Liu, Chiung-Hui; Chang, Hung-Ming; Wu, Tsung-Huan; Chen, Li-You; Yang, Yin-Shuo; Tseng, To-Jung; Liao, Wen-Chieh

    2017-10-01

    The voltage-gated potassium channels Kv1.1 and Kv1.2 that cluster at juxtaparanodal (JXP) regions are essential in the regulation of nerve excitability and play a critical role in axonal conduction. When demyelination occurs, Kv1.1/Kv1.2 activity increases, suppressing the membrane potential nearly to the equilibrium potential of K + , which results in an axonal conduction blockade. The recovery of K + -dependent communication signals and proper clustering of Kv1.1/Kv1.2 channels at JXP regions may directly reflect nerve regeneration following peripheral nerve injury. However, little is known about potassium channel expression and its relationship with the dynamic potassium ion distribution at the node of Ranvier during the regenerative process of peripheral nerve injury (PNI). In the present study, end-to-end neurorrhaphy (EEN) was performed using an in vivo model of PNI. The distribution of K + at regenerating axons following EEN was detected by time-of-flight secondary-ion mass spectrometry. The specific localization and expression of Kv1.1/Kv1.2 channels were examined by confocal microscopy and western blotting. Our data showed that the re-establishment of K + distribution and intensity was correlated with the functional recovery of compound muscle action potential morphology in EEN rats. Furthermore, the re-clustering of Kv1.1/1.2 channels 1 and 3 months after EEN at the nodal region of the regenerating nerve corresponded to changes in the K + distribution. This study provided direct evidence of K + distribution in regenerating axons for the first time. We proposed that the Kv1.1/Kv1.2 channels re-clustered at the JXP regions of regenerating axons are essential for modulating the proper patterns of K + distribution in axons for maintaining membrane potential stability after EEN.

  20. Obtaining of potassium dicyan-argentate

    International Nuclear Information System (INIS)

    Sattarova, M.A.; Solojenkin, P.M.

    1997-01-01

    This work is devoted to obtaining of potassium dicyan-argentate. By means of exchange reaction between silver nitrate and potassium cyanide the potassium dicyan-argentate was synthesized. The analysis of obtained samples was carried out by means of titration and potentiometry.

  1. 21 CFR 172.160 - Potassium nitrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium nitrate. 172.160 Section 172.160 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Preservatives § 172.160 Potassium nitrate. The food additive potassium nitrate may be safely used as a curing...

  2. 21 CFR 582.1631 - Potassium hydroxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium hydroxide. 582.1631 Section 582.1631 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1631 Potassium hydroxide. (a) Product. Potassium hydroxide. (b) Conditions of use. This...

  3. 21 CFR 582.5622 - Potassium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium chloride. 582.5622 Section 582.5622 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5622 Potassium chloride. (a) Product. Potassium chloride. (b) Conditions of use. This...

  4. Level of radioactive strontium-90, potassium-40 in bone tissues of sheep

    International Nuclear Information System (INIS)

    Bandi, D.; Andrei, S.; Ehnkhtuya, Ts.

    1992-01-01

    We have studied the level of strontium-90 and potassium-40 in bone tissues of sheep. Level of the radioactive elements in its bone tissues decreases depending on its ripeness, but a strong decrease was observable in its old ages

  5. [Effects of allitridum on rapidly delayed rectifier potassium current in HEK293 cell line].

    Science.gov (United States)

    Zhang, Jiancheng; Lin, Kun; Wei, Zhixiong; Chen, Qian; Liu, Li; Zhao, Xiaojing; Zhao, Ying; Xu, Bin; Chen, Xi; Li, Yang

    2015-08-01

    To study the effect of allitridum on rapidly delayed rectifier potassium current (IKr) in HEK293 cell line. HEK293 cells were transiently transfected with HERG channel cDNA plasmid pcDNA3.1 via Lipofectamine. Allitridum was added to the extracellular solution by partial perfusion after giga seal at the final concentration of 30 µmol/L. Whole-cell patch clamp technique was used to record the HERG currents and gating kinetics before and after allitridum exposure at room temperature. The amplitude and density of IHERG were both suppressed by allitridum in a voltage-dependent manner. In the presence of allitridum, the peak current of IHERG was reduced from 73.5∓4.3 pA/pF to 42.1∓3.6 pA/pF at the test potential of +50 mV (P<0.01). Allitridum also concentration-dependently decreased the density of the IHERG. The IC50 of allitridum was 34.74 µmol/L with a Hill coefficient of 1.01. Allitridum at 30 µmol/L caused a significant positive shift of the steady-state activation curve of IHERG and a markedly negative shift of the steady-state inactivation of IHERG, and significantly shortened the slow time constants of IHERG deactivation. Allitridum can potently block IHERG in HEK293 cells, which might be the electrophysiological basis for its anti-arrhythmic action.

  6. The inhibitory effects of potassium chloride versus potassium silicate application on 137Cs uptake by rice

    International Nuclear Information System (INIS)

    Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

    2016-01-01

    After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of 137 Cs by rice plants in two pot experiments. The 137 Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K + ) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K + concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K + for rice plants in the soil, which led to a greater uptake of 137 Cs after the potassium silicate application than after the application of potassium chloride. The 137 Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. - Highlights: • Potassium application reduced 137 Cs uptake by rice grown in pot experiments. • Readily available K fertilizer more effectively decreased brown rice 137 Cs concentration. • Potassium should be applied before heading to reduce brown rice 137 Cs concentration.

  7. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  8. Charge carrier transport in Cu(In,Ga)Se2 thin-film solar-cells studied by electron beam induced current and temperature and illumination dependent current voltage analysis

    International Nuclear Information System (INIS)

    Nichterwitz, Melanie

    2012-01-01

    This work contributes to the understanding of generation dependent charge-carrier transport properties in Cu(In,Ga)Se 2 (CIGSe)/ CdS/ ZnO solar cells and a consistent model for the electronic band diagram of the heterojunction region of the device is developed. Cross section electron-beam induced current (EBIC) and temperature and illumination dependent current voltage (IV) measurements are performed on CIGSe solar cells with varying absorber layer compositions and CdS thickness. For a better understanding of possibilities and limitations of EBIC measurements applied on CIGSe solar cells, detailed numerical simulations of cross section EBIC profiles for varying electron beam and solar cell parameters are performed and compared to profiles obtained from an analytical description. Especially the effects of high injection conditions are considered. Even though the collection function of the solar cell is not independent of the generation function of the electron beam, the local electron diffusion length in CIGSe can still be extracted. Grain specific values ranging from (480±70) nm to (2.3±0.2) μm are determined for a CuInSe 2 absorber layer and a value of (2.8±0.3) μm for CIGSe with a Ga-content of 0.3. There are several models discussed in literature to explain generation dependent charge carrier transport, all assuming a high acceptor density either located in the CIGSe layer close to the CIGSe/CdS interface (p + layer), within the CdS layer or at the CdS/ZnO interface. In all models, a change in charge carrier collection properties is caused by a generation dependent occupation probability of the acceptor type defect state and the resulting potential distribution throughout the device. Numerical simulations of EBIC and IV data are performed with parameters according to these models. The model that explains the experimental data best is that of a p + layer at the CIGSe/CdS interface and acceptor type defect states at the CdS/ZnO interface. The p + layer leads

  9. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  10. Preparation of potassium-reduced tantalum powders

    International Nuclear Information System (INIS)

    Kolosov, V.N.; Miroshnichenko, M.N.; Orlov, V.M.; Prokhorova, T.Yu.

    2005-01-01

    Characteristics of tantalum powders prepared by reduction of molten potassium heptafluorotantalate with liquid potassium are studied in a temperature range of 750 - 850 deg C using potassium chloride as a flux at a ratio of K 2 TaF 7 : KCl = 1, 2, and 3. The use of potassium as a reducing agent facilitates washing of tantalum powders for impurity salt removal, reduces sodium content and leakage currents in the anodes. As compared to sodium process, the potassium reduction results in a high yield of sponge material, a decrease in the specific surface area and yield of tantalum powder suitable for manufacture of capacitor anodes [ru

  11. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels

    Science.gov (United States)

    Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.

    2005-01-01

    All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

  12. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  14. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  15. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  16. Multi-objective optimization of distributed generation with voltage ...

    African Journals Online (AJOL)

    DR OKE

    1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

  17. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  18. Effects of water soaking and/or sodium polystyrene sulfonate addition on potassium content of foods.

    Science.gov (United States)

    Picq, Christian; Asplanato, Marion; Bernillon, Noémie; Fabre, Claudie; Roubeix, Mathilde; Ricort, Jean-Marc

    2014-09-01

    In this study, we determined, by atomic absorption spectrophotometry, the potassium amount leached by soaking or boiling foods identified by children suffering from chronic renal failure as "pleasure food" and that they cannot eat because of their low-potassium diet, and evaluated whether addition of sodium polystyrene sulfonate resin (i.e. Kayexalate®) during soaking or boiling modulated potassium loss. A significant amount of potassium content was removed by soaking (16% for chocolate and potato, 26% for apple, 37% for tomato and 41% for banana) or boiling in a large amount of water (73% for potato). Although Kayexalate® efficiently dose-dependently removed potassium from drinks (by 48% to 73%), resin addition during soaking or boiling did not eliminate more potassium from solid foods. Our results therefore provide useful information for dietitians who elaborate menus for people on potassium-restricted diets and would give an interesting alternative to the systematic elimination of all potassium-rich foods from their diet.

  19. The inhibitory effects of potassium chloride versus potassium silicate application on (137)Cs uptake by rice.

    Science.gov (United States)

    Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

    2016-03-01

    After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of (137)Cs by rice plants in two pot experiments. The (137)Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K(+)) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K(+) concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K(+) for rice plants in the soil, which led to a greater uptake of (137)Cs after the potassium silicate application than after the application of potassium chloride. The (137)Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Potassium Intake, Bioavailability, Hypertension, and Glucose Control

    Directory of Open Access Journals (Sweden)

    Michael S. Stone

    2016-07-01

    Full Text Available Potassium is an essential nutrient. It is the most abundant cation in intracellular fluid where it plays a key role in maintaining cell function. The gradient of potassium across the cell membrane determines cellular membrane potential, which is maintained in large part by the ubiquitous ion channel the sodium-potassium (Na+-K+ ATPase pump. Approximately 90% of potassium consumed (60–100 mEq is lost in the urine, with the other 10% excreted in the stool, and a very small amount lost in sweat. Little is known about the bioavailability of potassium, especially from dietary sources. Less is understood on how bioavailability may affect health outcomes. Hypertension (HTN is the leading cause of cardiovascular disease (CVD and a major financial burden ($50.6 billion to the US public health system, and has a significant impact on all-cause morbidity and mortality worldwide. The relationship between increased potassium supplementation and a decrease in HTN is relatively well understood, but the effect of increased potassium intake from dietary sources on blood pressure overall is less clear. In addition, treatment options for hypertensive individuals (e.g., thiazide diuretics may further compound chronic disease risk via impairments in potassium utilization and glucose control. Understanding potassium bioavailability from various sources may help to reveal how specific compounds and tissues influence potassium movement, and further the understanding of its role in health.

  1. Evaluation of the potassium adsorption capacity of a potassium adsorption filter during rapid blood transfusion.

    Science.gov (United States)

    Matsuura, H; Akatsuka, Y; Muramatsu, C; Isogai, S; Sugiura, Y; Arakawa, S; Murayama, M; Kurahashi, M; Takasuga, H; Oshige, T; Yuba, T; Mizuta, S; Emi, N

    2015-05-01

    The concentration of extracellular potassium in red blood cell concentrates (RCCs) increases during storage, leading to risk of hyperkalemia. A potassium adsorption filter (PAF) can eliminate the potassium at normal blood transfusion. This study aimed to investigate the potassium adsorption capacity of a PAF during rapid blood transfusion. We tested several different potassium concentrations under a rapid transfusion condition using a pressure bag. The adsorption rates of the 70-mEq/l model were 76·8%. The PAF showed good potassium adsorption capacity, suggesting that this filter may provide a convenient method to prevent hyperkalemia during rapid blood transfusion. © 2015 International Society of Blood Transfusion.

  2. Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels.

    Science.gov (United States)

    Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P

    2012-09-01

    Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

  3. T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles

    DEFF Research Database (Denmark)

    Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L

    2011-01-01

    Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...

  4. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  5. Electrolytic coloration and spectral properties of hydroxyl-doped potassium chloride single crystals

    International Nuclear Information System (INIS)

    Gu Hongen; Wu Yanru

    2011-01-01

    Hydroxyl-doped potassium chloride single crystals are colored electrolytically at various temperatures and voltages using a pointed cathode and a flat anode. Characteristic OH - spectral band is observed in the absorption spectrum of uncolored single crystal. Characteristic O - , OH - , U, V 2 , V 3 , O 2- -V a + , F, R 2 and M spectral bands are observed simultaneously in absorption spectra of colored single crystals. Current-time curve for electrolytic coloration of hydroxyl-doped potassium chloride single crystal and its relationship with electrolytic coloration process are given. Production and conversion of color centers are explained. - Highlights: → Expanded the traditional electrolysis method. → Hydroxyl-doped potassium chloride crystals were colored electrolytically for the first time. → Useful V, F and F-aggregate color centers were produced in colored crystals. → V color centers were produced directly and F and F-aggregate color centers indirectly.

  6. Intermediate state trapping of a voltage sensor

    DEFF Research Database (Denmark)

    Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

    2012-01-01

    Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

  7. Diclofenac distinguishes among homomeric and heteromeric potassium channels composed of KCNQ4 and KCNQ5 subunits.

    Science.gov (United States)

    Brueggemann, Lioubov I; Mackie, Alexander R; Martin, Jody L; Cribbs, Leanne L; Byron, Kenneth L

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V(0.5) values: -31, -44, and -38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels.

  8. Effect of ethanol at clinically relevant concentrations on atrial inward rectifier potassium current sensitive to acetylcholine.

    Science.gov (United States)

    Bébarová, Markéta; Matejovič, Peter; Pásek, Michal; Hořáková, Zuzana; Hošek, Jan; Šimurdová, Milena; Šimurda, Jiří

    2016-10-01

    Alcohol intoxication tends to induce arrhythmias, most often the atrial fibrillation. To elucidate arrhythmogenic mechanisms related to alcohol consumption, the effect of ethanol on main components of the ionic membrane current is investigated step by step. Considering limited knowledge, we aimed to examine the effect of clinically relevant concentrations of ethanol (0.8-80 mM) on acetylcholine-sensitive inward rectifier potassium current I K(Ach). Experiments were performed by the whole-cell patch clamp technique at 23 ± 1 °C on isolated rat and guinea-pig atrial myocytes, and on expressed human Kir3.1/3.4 channels. Ethanol induced changes of I K(Ach) in the whole range of concentrations applied; the effect was not voltage dependent. The constitutively active component of I K(Ach) was significantly increased by ethanol with the maximum effect (an increase by ∼100 %) between 8 and 20 mM. The changes were comparable in rat and guinea-pig atrial myocytes and also in expressed human Kir3.1/3.4 channels (i.e., structural correlate of I K(Ach)). In the case of the acetylcholine-induced component of I K(Ach), a dual ethanol effect was apparent with a striking heterogeneity of changes in individual cells. The effect correlated with the current magnitude in control: the current was increased by eth-anol in the cells showing small current in control and vice versa. The average effect peaked at 20 mM ethanol (an increase of the current by ∼20 %). Observed changes of action potential duration agreed well with the voltage clamp data. Ethanol significantly affected both components of I K(Ach) even in concentrations corresponding to light alcohol consumption.

  9. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  10. Potassium

    Science.gov (United States)

    ... confusion listlessness tingling, prickling, burning, tight, or pulling sensation of arms, hands, legs, or feet heaviness or weakness of legs cold, pale, gray skin stomach pain unusual stomach bulging ...

  11. A novel 13 residue acyclic peptide from the marine snail, Conus monile, targets potassium channels.

    Science.gov (United States)

    Sudarslal, Sadasivannair; Singaravadivelan, Govindaswamy; Ramasamy, Palanisamy; Ananda, Kuppanna; Sarma, Siddhartha P; Sikdar, Sujit K; Krishnan, K S; Balaram, Padmanabhan

    2004-05-07

    A novel 13-residue peptide Mo1659 has been isolated from the venom of a vermivorous cone snail, Conus monile. HPLC fractions of the venom extract yielded an intense UV absorbing fraction with a mass of 1659Da. De novo sequencing using both matrix assisted laser desorption and ionization and electrospray MS/MS methods together with analysis of proteolytic fragments successfully yielded the amino acid sequence, FHGGSWYRFPWGY-NH(2). This was further confirmed by comparison with the chemically synthesized peptide and by conventional Edman sequencing. Mo1659 has an unusual sequence with a preponderance of aromatic residues and the absence of apolar, aliphatic residues like Ala, Val, Leu, and Ile. Mo1659 has no disulfide bridges distinguishing it from the conotoxins and bears no sequence similarity with any of the acyclic peptides isolated thus far from the venom of cone snails. Electrophysiological studies on the effect of Mo1659 on measured currents in dorsal root ganglion neurons suggest that the peptide targets non-inactivating voltage-dependent potassium channels.

  12. Composition effect of potassium-borate glasses on their relaxation properties

    International Nuclear Information System (INIS)

    Lomovskoj, V.A.; Bartenev, G.M.

    1995-01-01

    Relaxation processes in potassium-borate glasses have been investigated in detail for the first time. It is shown that low-temperature β-process of relaxation relating to rotational mobility of the B-O bond is the same for all potassium-borate glasses and B 2 O 3 . The process of β k -relaxation related to diffusion mobility of potassium ions depends on the composition of the glasses in the same way as α-relaxation (glass formation).12 refs., 10 figs., 2 tabs

  13. Operating experience with potassium systems

    International Nuclear Information System (INIS)

    Schwarz, N.F.

    1984-04-01

    In an international cooperation R and D work for the realization of potassium topping cycles to increase the conversion efficiency of thermal power stations is going on. Feasibility studies show that the realization of such a process can be achieved under economic considerations with existing materials and today's technology. Nevertheless, it has to be shown that the assumptions with respect to material behaviour and component reliability are based on sound technical premises. Therefore, in continuation of design studies, a hardware programme has been initiated in the Austrian Research Centre Seibersdorf. First results with respect to component and material behaviour are described. (Author) [de

  14. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  15. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  16. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  17. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  18. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

  19. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  20. CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild

    2012-06-01

    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.