Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

International Nuclear Information System (INIS)

Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

1994-01-01

In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

Hydrogen bonds as molecular timers for slow inactivation in voltage-gated potassium channels

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

2013-01-01

Voltage-gated potassium (Kv) channels enable potassium efflux and membrane repolarization in excitable tissues. Many Kv channels undergo a progressive loss of ion conductance in the presence of a prolonged voltage stimulus, termed slow inactivation, but the atomic determinants that regulate the k...... subunit(s). DOI: http://dx.doi.org/10.7554/eLife.01289.001....

Mechanism of electromechanical coupling in voltage-gated potassium channels

Directory of Open Access Journals (Sweden)

Rikard eBlunck

2012-09-01

Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

Voltage-Gated Potassium Channels: A Structural Examination of Selectivity and Gating

Science.gov (United States)

Kim, Dorothy M.; Nimigean, Crina M.

2016-01-01

Voltage-gated potassium channels play a fundamental role in the generation and propagation of the action potential. The discovery of these channels began with predictions made by early pioneers, and has culminated in their extensive functional and structural characterization by electrophysiological, spectroscopic, and crystallographic studies. With the aid of a variety of crystal structures of these channels, a highly detailed picture emerges of how the voltage-sensing domain reports changes in the membrane electric field and couples this to conformational changes in the activation gate. In addition, high-resolution structural and functional studies of K+ channel pores, such as KcsA and MthK, offer a comprehensive picture on how selectivity is achieved in K+ channels. Here, we illustrate the remarkable features of voltage-gated potassium channels and explain the mechanisms used by these machines with experimental data. PMID:27141052

Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.

Science.gov (United States)

Wang, Jia-Zeng; Wang, Rui-Zhen

2018-02-01

Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel

Science.gov (United States)

Wang, Jia-Zeng; Wang, Rui-Zhen

2018-02-01

Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

Voltage-dependent gating in a "voltage sensor-less" ion channel.

Directory of Open Access Journals (Sweden)

Harley T Kurata

2010-02-01

Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

International Nuclear Information System (INIS)

Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

2005-01-01

The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

Grafting voltage and pharmacological sensitivity in potassium channels.

Science.gov (United States)

Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

2016-08-01

A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

Directory of Open Access Journals (Sweden)

Salvador Valle-Reyes

2018-05-01

Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Science.gov (United States)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

The voltage-gated potassium channel subunit, Kv1.3, is expressed in epithelia

DEFF Research Database (Denmark)

Grunnet, Morten; Rasmussen, Hanne B; Hay-Schmidt, Anders

2003-01-01

The Shaker-type voltage-gated potassium channel, Kv1.3, is believed to be restricted in distribution to lymphocytes and neurons. In lymphocytes, this channel has gained intense attention since it has been proven that inhibition of Kv1.3 channels compromise T lymphocyte activation. To investigate...

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Directory of Open Access Journals (Sweden)

Alicia Lundby

2008-06-01

Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

Science.gov (United States)

Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

2010-09-15

Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

Science.gov (United States)

Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

2008-01-01

In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

Reversible Dementia: Two Nursing Home Patients With Voltage-Gated Potassium Channel Antibody-Associated Limbic Encephalitis

NARCIS (Netherlands)

Reintjes, W.; Romijn, M.D.M.; den Hollander, D.; ter Bruggen, J.P.; van Marum, R.J.

2015-01-01

Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable

Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies

OpenAIRE

Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick

2017-01-01

Objectives Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, ...

Voltage Dependence of Supercapacitor Capacitance

Directory of Open Access Journals (Sweden)

Szewczyk Arkadiusz

2016-09-01

Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

Science.gov (United States)

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-23

Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

Voltage Dependence of a Neuromodulator-Activated Ionic Current123

Science.gov (United States)

2016-01-01

Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis

OpenAIRE

Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L

2017-01-01

We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggress...

Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

Directory of Open Access Journals (Sweden)

Rajeev Gupta

2017-06-01

Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

Science.gov (United States)

Gupta, Rajeev; Ghosh, Subhendu

2017-06-01

Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

Science.gov (United States)

Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

1993-06-01

Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

Science.gov (United States)

Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

2018-02-21

Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

Science.gov (United States)

Kajma, Anna; Szewczyk, Adam

2012-10-01

Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

Hyperpolarization moves S4 sensors inward to open MVP, a methanococcal voltage-gated potassium channel.

Science.gov (United States)

Sesti, Federico; Rajan, Sindhu; Gonzalez-Colaso, Rosana; Nikolaeva, Natalia; Goldstein, Steve A N

2003-04-01

MVP, a Methanococcus jannaschii voltage-gated potassium channel, was cloned and shown to operate in eukaryotic and prokaryotic cells. Like pacemaker channels, MVP opens on hyperpolarization using S4 voltage sensors like those in classical channels activated by depolarization. The MVP S4 span resembles classical sensors in sequence, charge, topology and movement, traveling inward on hyperpolarization and outward on depolarization (via canaliculi in the protein that bring the extracellular and internal solutions into proximity across a short barrier). Thus, MVP opens with sensors inward indicating a reversal of S4 position and pore state compared to classical channels. Homologous channels in mammals and plants are expected to function similarly.

KV7 potassium channels

DEFF Research Database (Denmark)

Stott, Jennifer B; Jepps, Thomas Andrew; Greenwood, Iain A

2014-01-01

Potassium channels are key regulators of smooth muscle tone, with increases in activity resulting in hyperpolarisation of the cell membrane, which acts to oppose vasoconstriction. Several potassium channels exist within smooth muscle, but the KV7 family of voltage-gated potassium channels have been...

Sleep disturbances in voltage-gated potassium channel antibody syndrome.

Science.gov (United States)

Barone, Daniel A; Krieger, Ana C

2016-05-01

Voltage-gated potassium channels (VGKCs) are a family of membrane proteins responsible for controlling cell membrane potential. The presence of antibodies (Ab) against neuronal VGKC complexes aids in the diagnosis of idiopathic and paraneoplastic autoimmune neurologic disorders. The diagnosis of VGKC Ab-associated encephalopathy (VCKC Ab syndrome) should be suspected in patients with subacute onset of disorientation, confusion, and memory loss in the presence of seizures or a movement disorder. VGKC Ab syndrome may present with sleep-related symptoms, and the purpose of this communication is to alert sleep and neurology clinicians of this still-under-recognized condition. In this case, we are presenting the VGKC Ab syndrome which improved after treatment with solumedrol. The prompt recognition and treatment of this condition may prevent the morbidity associated with cerebral atrophy and the mortality associated with intractable seizures and electrolyte disturbances. Copyright © 2016. Published by Elsevier B.V.

Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

Science.gov (United States)

Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

2014-07-01

Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

Intracellular mediators of potassium-induced aldosterone secretion

International Nuclear Information System (INIS)

Ganguly, A.; Chiou, S.; Davis, J.S.

1990-01-01

We have investigated the intracellular messengers of potassium in eliciting aldosterone secretion in calf adrenal glomerulosa cells since there were unresolved issues relating to the role of phosphoinositides, cAMP and protein kinases. We observed no evidence of hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP 2 ) in 3 H-inositol labeled alf adrenal cells or increase of cAMP in response to potassium. Addition of calcium channel blocker, nitrendipine after stimulating adrenal glomerulosa cells with potassium, markedly inhibited aldosterone secretion. A calmodulin inhibitor (W-7) produced greater reduction of aldosterone secretion than an inhibitor of protein kinase C (H-7). These results suggest that a rise in cytosolic free calcium concentration through voltage-dependent calcium channel and calmodulin are the critical determinants of aldosterone secretion stimulated by potassium

Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

Directory of Open Access Journals (Sweden)

Salmela Iikka

2012-08-01

Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

Excessive blinking and ataxia in a child with occult neuroblastoma and voltage-gated potassium channel antibodies.

LENUS (Irish Health Repository)

Allen, Nicholas M

2012-05-01

A previously healthy 9-year-old girl presented with a 10-day history of slowly progressive unsteadiness, slurred speech, and behavior change. On examination there was cerebellar ataxia and dysarthria, excessive blinking, subtle perioral myoclonus, and labile mood. The finding of oligoclonal bands in the cerebrospinal fluid prompted paraneoplastic serological evaluation and search for an occult neural crest tumor. Antineuronal nuclear autoantibody type 1 (anti-Hu) and voltage-gated potassium channel complex antibodies were detected in serum. Metaiodobenzylguanidine scan and computed tomography scan of the abdomen showed a localized abdominal mass in the region of the porta hepatis. A diagnosis of occult neuroblastoma was made. Resection of the stage 1 neuroblastoma and treatment with pulsed corticosteroids resulted in resolution of all symptoms and signs. Excessive blinking has rarely been described with neuroblastoma, and, when it is not an isolated finding, it may be a useful clue to this paraneoplastic syndrome. Although voltage-gated potassium channel complex autoimmunity has not been described previously in the setting of neuroblastoma, it is associated with a spectrum of paraneoplastic neurologic manifestations in adults, including peripheral nerve hyperexcitability disorders.

Induced voltage due to time-dependent magnetisation textures

International Nuclear Information System (INIS)

Kudtarkar, Santosh Kumar; Dhadwal, Renu

2010-01-01

We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

OpenAIRE

Cyrus S.H. Ho; Roger C.M. Ho; Amy M.L. Quek

2018-01-01

Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic ence...

Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager

OpenAIRE

Langille, Megan M.; Desai, Jay

2015-01-01

Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum ...

Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

International Nuclear Information System (INIS)

Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

2016-01-01

We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

Does Autoimmunity have a Role in Myoclonic Astatic Epilepsy? A Case Report of Voltage Gated Potassium Channel Mediated Seizures.

Science.gov (United States)

Sirsi, Deepa; Dolce, Alison; Greenberg, Benjamin M; Thodeson, Drew

2016-01-01

There is expanding knowledge about the phenotypic variability of patients with voltage gated potassium channel complex (VGKC) antibody mediated neurologic disorders. The phenotypes are diverse and involve disorders of the central and peripheral nervous systems. The central nervous system manifestations described in the literature include limbic encephalitis, status epilepticus, and acute encephalitis. We report a 4.5 year-old boy who presented with intractable Myoclonic Astatic Epilepsy (MAE) or Doose syndrome and positive VGKC antibodies in serum. Treatment with steroids led to resolution of seizures and electrographic normalization. This case widens the spectrum of etiologies for MAE to include autoimmunity, in particular VGKC auto-antibodies and CNS inflammation, as a primary or contributing factor. There is an evolving understanding of voltage gated potassium channel complex mediated autoimmunity in children and the role of inflammation and autoimmunity in MAE and other intractable pediatric epilepsy syndromes remains to be fully defined. A high index of suspicion is required for diagnosis and appropriate management of antibody mediated epilepsy syndromes.

Bickerstaff's encephalitis and Miller Fisher syndrome associated with voltage-gated potassium channel and novel anti-neuronal antibodies.

Science.gov (United States)

Tüzün, E; Kürtüncü, M; Lang, B; Içöz, S; Akman-Demir, G; Eraksoy, M; Vincent, A

2010-10-01

GQ1b antibody (GQ1b-Ab) is detected in approximately two-thirds of sera of patients with Bickerstaffs encephalitis (BE). Whilst some of the remaining patients have antibodies to other gangliosides, many patients with BE are reported to be seronegative. Voltage-gated potassium channel antibody (VGKC-Ab) at high titer was detected during the diagnostic work-up of one patient with BE. Sera of an additional patient with BE and nine patients with Miller Fisher syndrome (MF) (all GQ1b-Ab positive) were investigated for VGKC-Ab and other anti-neuronal antibodies by radioimmunoprecipitation using 125I-dendrotoxin-VGKC and immunohistochemistry, respectively. Two patients with MF exhibited moderate titer VGKC-Abs. Regardless of positivity for VGKC or GQ1b antibodies, serum IgG of all patients with BE and MF reacted with the molecular layer and Purkinje cells of the cerebellum in a distinctive pattern. Voltage-gated potassium channel antibodies might be involved in some cases of BE or MF. The common staining pattern despite different antibody results suggests that there might be other, as yet unidentified, antibodies associated with BE and MF.

Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager.

Science.gov (United States)

Langille, Megan M; Desai, Jay

2015-01-01

Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

Encephalitis due to antibodies to voltage gated potassium channel (VGKC with cerebellar involvement in a teenager

Directory of Open Access Journals (Sweden)

Megan M Langille

2015-01-01

Full Text Available Encephalitis due to antibodies to voltage gated potassium channel (VGKC typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

Voltage-gated potassium channel-complex autoimmunity and associated clinical syndromes.

Science.gov (United States)

Irani, Sarosh R; Vincent, Angela

2016-01-01

Voltage-gated potassium channel (VGKC)-complex antibodies are defined by the radioimmunoprecipitation of Kv1 potassium channel subunits from brain tissue extracts and were initially discovered in patients with peripheral nerve hyperexcitability (PNH). Subsequently, they were found in patients with PNH plus psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) with prominent amnesia and frequent seizures. Most recently, they have been described in patients with pure epilepsies, especially in patients with the novel and distinctive semiology termed faciobrachial dystonic seizures (FBDS). In each of these conditions, there is a close correlation between clinical measures and antibody levels. The VGKC-complex is a group of proteins that are strongly associated in situ and after extraction in mild detergent. Two major targets of the autoantibodies are leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein 2 (CASPR2). The patients with PNH or MoS are most likely to have CASPR2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. Crucially, each of these conditions has a good response to immunotherapies, often corticosteroids and plasma exchange, although optimal regimes require further study. VGKC-complex antibodies have also been described in neuropathic pain syndromes, chronic epilepsies, a polyradiculopathy in porcine abattoir workers, and some children with status epilepticus. Increasingly, however, the antigenic targets in these patients are not defined and in some cases the antibodies may be secondary rather than the primary cause. Future serologic studies should define all the antigenic components of the VGKC-complex, and further inform mechanisms of antibody pathogenicity and related inflammation. © 2016 Elsevier B.V. All rights reserved.

Clinical utility of seropositive voltage-gated potassium channel-complex antibody.

Science.gov (United States)

Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander; Li, Yuebing

2016-10-01

Antibodies against voltage-gated potassium channel (VGKC)-complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group ( p 0.25 nM) VGKC-complex antibody levels ( p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy.

Clinical utility of seropositive voltage-gated potassium channel–complex antibody

Science.gov (United States)

Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander

2016-01-01

Abstract Background: Antibodies against voltage-gated potassium channel (VGKC)–complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. Methods: We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Results: Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group (p 0.25 nM) VGKC-complex antibody levels (p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy. PMID:27847683

The role of voltage-gated potassium channels in the regulation of mouse uterine contractility

Directory of Open Access Journals (Sweden)

Abel Peter W

2007-11-01

Full Text Available Abstract Background Uterine smooth muscle cells exhibit ionic currents that appear to be important in the control of uterine contractility, but how these currents might produce the changes in contractile activity seen in pregnant myometrium has not been established. There are conflicting reports concerning the role of voltage-gated potassium (Kv channels and large-conductance, calcium-activated potassium (BK channels in the regulation of uterine contractility. In this study we provide molecular and functional evidence for a role for Kv channels in the regulation of spontaneous contractile activity in mouse myometrium, and also demonstrate a change in Kv channel regulation of contractility in pregnant mouse myometrium. Methods Functional assays which evaluated the effects of channel blockers and various contractile agonists were accomplished by quantifying contractility of isolated uterine smooth muscle obtained from nonpregnant mice as well as mice at various stages of pregnancy. Expression of Kv channel proteins in isolated uterine smooth muscle was evaluated by Western blots. Results The Kv channel blocker 4-aminopyridine (4-AP caused contractions in nonpregnant mouse myometrium (EC50 = 54 micromolar, maximal effect at 300 micromolar but this effect disappeared in pregnant mice; similarly, the Kv4.2/Kv4.3 blocker phrixotoxin-2 caused contractions in nonpregnant, but not pregnant, myometrium. Contractile responses to 4-AP were not dependent upon nerves, as neither tetrodotoxin nor storage of tissues at room temperature significantly altered these responses, nor were responses dependent upon the presence of the endometrium. Spontaneous contractions and contractions in response to 4-AP did not appear to be mediated by BK, as the BK channel-selective blockers iberiotoxin, verruculogen, or tetraethylammonium failed to affect either spontaneous contractions or 4-AP-elicited responses. A number of different Kv channel alpha subunit proteins were

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-01-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-07-05

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Modification of sodium and potassium channel kinetics by diethyl ether and studies on sodium channel inactivation in the crayfish giant axon membrane

Energy Technology Data Exchange (ETDEWEB)

Bean, Bruce Palmer [Univ. of Rochester, NY (United States)

1979-01-01

The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.

Leucine-rich glioma inactivated-1 and voltage gated potassium channel autoimmune encephalitis associated with ischemic stroke; A Case Report

Directory of Open Access Journals (Sweden)

Marisa Patryce McGinley

2016-05-01

Full Text Available Autoimmune encephalitis is associated with a wide variety of antibodies and clinical presentations. Voltage gated potassium channel (VGKC antibodies are a cause of autoimmune non-paraneoplastic encephalitis characterized by memory impairment, psychiatric symptoms, and seizures. We present a case of VGKC encephalitis likely preceding an ischemic stroke. Reports of autoimmune encephalitis associated with ischemic stroke are rare. Several hypothesizes linking these two disease processes are proposed.

Leucine-Rich Glioma Inactivated-1 and Voltage-Gated Potassium Channel Autoimmune Encephalitis Associated with Ischemic Stroke: A Case Report

Science.gov (United States)

McGinley, Marisa; Morales-Vidal, Sarkis; Ruland, Sean

2016-01-01

Autoimmune encephalitis is associated with a wide variety of antibodies and clinical presentations. Voltage-gated potassium channel (VGKC) antibodies are a cause of autoimmune non-paraneoplastic encephalitis characterized by memory impairment, psychiatric symptoms, and seizures. We present a case of VGKC encephalitis likely preceding an ischemic stroke. Reports of autoimmune encephalitis associated with ischemic stroke are rare. Several hypotheses linking these two disease processes are proposed. PMID:27242653

The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

Science.gov (United States)

Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

2017-08-01

Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements

DEFF Research Database (Denmark)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar

2008-01-01

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...

The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

Science.gov (United States)

Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

2013-03-01

The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

Alcohol and the calcium-dependent potassium transport of human erythrocytes

International Nuclear Information System (INIS)

Harris, R.A.; Caldwell, K.K.

1985-01-01

In vitro exposure of human red blood cells to ethanol (100 and 400 mM) was found to increase the initial rate of calcium-dependent potassium efflux through the red cell membrane. This effect of ethanol was apparently not due to an elevation of the intracellular free calcium but rather to a direct action of the drug on the transport process as, (1) intracellular calcium concentrations were tightly buffered with EGTA, (2) ethanol did not alter the efflux of 45 Ca from the cells, and (3) dantrolene, which has been proposed to counteract the effect of ethanol on intracellular calcium levels in the erythrocyte, did not inhibit the stimulatory action of ethanol. The efflux of potassium from erythrocytes obtained from chronic alcoholics was not different from that of erythrocytes from non-alcoholic individuals. The relationship of these findings to neuronal potassium transport is discussed

Antibodies to voltage-gated potassium and calcium channels in epilepsy.

Science.gov (United States)

Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela

2006-10-01

To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.

Voltage-Gated Potassium Channel Antibodies in Slow-Progression Motor Neuron Disease.

Science.gov (United States)

Godani, Massimiliano; Zoccarato, Marco; Beronio, Alessandro; Zuliani, Luigi; Benedetti, Luana; Giometto, Bruno; Del Sette, Massimo; Raggio, Elisa; Baldi, Roberta; Vincent, Angela

2017-01-01

The spectrum of autoimmune neurological diseases associated with voltage-gated potassium channel (VGKC)-complex antibodies (Abs) ranges from peripheral nerve disorders to limbic encephalitis. Recently, low titers of VGKC-complex Abs have also been reported in neurodegenerative disorders, but their clinical relevance is unknown. The aim of the study was to explore the prevalence of VGKC-complex Abs in slow-progression motor neuron disease (MND). We compared 11 patients affected by slow-progression MND with 9 patients presenting typical progression illness. Sera were tested for VGKC-complex Abs by radioimmunoassay. The distribution of VGKC-complex Abs was analyzed with the Mann-Whitney U test. The statistical analysis showed a significant difference between the mean values in the study and control groups. A case with long-survival MND harboring VGKC-complex Abs and treated with intravenous immunoglobulins is described. Although VGKC-complex Abs are not likely to be pathogenic, these results could reflect the coexistence of an immunological activation in patients with slow disease progression. © 2016 S. Karger AG, Basel.

High Grade Glioma Mimicking Voltage Gated Potassium Channel Complex Associated Antibody Limbic Encephalitis

Directory of Open Access Journals (Sweden)

Dilan Athauda

2014-01-01

Full Text Available Though raised titres of voltage gated potassium channel (VGKC complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE. This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

High grade glioma mimicking voltage gated potassium channel complex associated antibody limbic encephalitis.

Science.gov (United States)

Athauda, Dilan; Delamont, R S; Pablo-Fernandez, E De

2014-01-01

Though raised titres of voltage gated potassium channel (VGKC) complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE). This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

International Nuclear Information System (INIS)

Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

2015-01-01

Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

Directory of Open Access Journals (Sweden)

Yukiko eMishina

2014-09-01

Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

Science.gov (United States)

Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

2014-01-01

Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

International Nuclear Information System (INIS)

Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

2014-01-01

Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

Autoantibodies against voltage-gated potassium channel and glutamic acid decarboxylase in psychosis: A systematic review, meta-analysis, and case series.

OpenAIRE

Grain, Rosemary; Lally, John; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy R; Murray, Robin M; Gaughran, Fiona

2017-01-01

Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

The Molecular Basis of Polyunsaturated Fatty Acid Interactions with the Shaker Voltage-Gated Potassium Channel.

Directory of Open Access Journals (Sweden)

Samira Yazdi

2016-01-01

Full Text Available Voltage-gated potassium (KV channels are membrane proteins that respond to changes in membrane potential by enabling K+ ion flux across the membrane. Polyunsaturated fatty acids (PUFAs induce channel opening by modulating the voltage-sensitivity, which can provide effective treatment against refractory epilepsy by means of a ketogenic diet. While PUFAs have been reported to influence the gating mechanism by electrostatic interactions to the voltage-sensor domain (VSD, the exact PUFA-protein interactions are still elusive. In this study, we report on the interactions between the Shaker KV channel in open and closed states and a PUFA-enriched lipid bilayer using microsecond molecular dynamics simulations. We determined a putative PUFA binding site in the open state of the channel located at the protein-lipid interface in the vicinity of the extracellular halves of the S3 and S4 helices of the VSD. In particular, the lipophilic PUFA tail covered a wide range of non-specific hydrophobic interactions in the hydrophobic central core of the protein-lipid interface, while the carboxylic head group displayed more specific interactions to polar/charged residues at the extracellular regions of the S3 and S4 helices, encompassing the S3-S4 linker. Moreover, by studying the interactions between saturated fatty acids (SFA and the Shaker KV channel, our study confirmed an increased conformational flexibility in the polyunsaturated carbon tails compared to saturated carbon chains, which may explain the specificity of PUFA action on channel proteins.

Reversible dementia: two nursing home patients with voltage-gated potassium channel antibody-associated limbic encephalitis.

Science.gov (United States)

Reintjes, Wesley; Romijn, Marloes D M; Hollander, Daan; Ter Bruggen, Jan P; van Marum, Rob J

2015-09-01

Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable cognitive and functional improvement enabling them to leave the psychogeriatric nursing homes they both were admitted to. Patients with VGKC-LE can have a major cognitive and functional improvement even after a diagnostic delay of more than 1 year. Medical practitioners who treat patients with unexplained cognitive decline, epileptic seizures, or psychiatric symptoms should be aware of LE as an underlying rare cause. Copyright © 2015 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.

Chloride is essential for contraction of afferent arterioles after agonists and potassium

DEFF Research Database (Denmark)

Jensen, B L; Ellekvist, Peter; Skøtt, O

1997-01-01

to norepinephrine, angiotensin II (ANG II), and potassium were measured after chloride depletion and compared with controls. Chloride depletion did not change arteriolar diameters, but the response to norepinephrine was markedly reduced when chloride was substituted with gluconate (n = 6) or isethionate (n = 6......). Reintroduction of chloride fully restored the sensitivity to norepinephrine. Contractions after ANG II and potassium were totally abolished in the absence of chloride (n = 6). In additional experiments (n = 7), the arteriolar contraction to 100 mM potassium was abolished only 1 min after removal of extracellular......A depolarizing chloride efflux has been suggested to activate voltage-dependent calcium channels in renal afferent arteriolar smooth muscle cells in response to vasoconstrictors. To test this proposal, rabbit afferent arterioles were microperfused, and the contractile dose responses...

Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

Science.gov (United States)

Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

2014-03-01

The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

Science.gov (United States)

Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

1988-08-01

Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

NMR structural and dynamical investigation of the isolated voltage-sensing domain of the potassium channel KvAP: implications for voltage gating.

Science.gov (United States)

Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S

2010-04-28

The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

Science.gov (United States)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

Excitation block in a nerve fibre model owing to potassium-dependent changes in myelin resistance

DEFF Research Database (Denmark)

Brazhe, Alexey; Maksimov, G. V.; Mosekilde, Erik

2011-01-01

. Uptake of potassium leads to Schwann cell swelling and myelin restructuring that impacts the electrical properties of the myelin. In order to further understand the dynamic interaction that takes place between the myelin and the axon, we have modelled submyelin potassium accumulation and related changes...... in myelin resistance during prolonged high-frequency stimulation. We predict that potassium-mediated decrease in myelin resistance leads to a functional excitation block with various patterns of altered spike trains. The patterns are found to depend on stimulation frequency and amplitude and to range from...

Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

Directory of Open Access Journals (Sweden)

Cyrus S.H. Ho

2018-04-01

Full Text Available Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS.

Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder.

Science.gov (United States)

Ho, Cyrus S H; Ho, Roger C M; Quek, Amy M L

2018-04-18

Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS).

Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

Science.gov (United States)

Ho, Cyrus S.H.; Quek, Amy M.L.

2018-01-01

Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS). PMID:29669989

Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

Directory of Open Access Journals (Sweden)

Sheyda R Frolova

Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

Presence of voltage-gated potassium channel complex antibody in a case of genetic prion disease.

Science.gov (United States)

Jammoul, Adham; Lederman, Richard J; Tavee, Jinny; Li, Yuebing

2014-06-05

Voltage-gated potassium channel (VGKC) complex antibody-mediated encephalitis is a recently recognised entity which has been reported to mimic the clinical presentation of Creutzfeldt-Jakob disease (CJD). Testing for the presence of this neuronal surface autoantibody in patients presenting with subacute encephalopathy is therefore crucial as it may both revoke the bleak diagnosis of prion disease and allow institution of potentially life-saving immunotherapy. Tempering this optimistic view is the rare instance when a positive VGKC complex antibody titre occurs in a definite case of prion disease. We present a pathologically and genetically confirmed case of CJD with elevated serum VGKC complex antibody titres. This case highlights the importance of interpreting the result of a positive VGKC complex antibody with caution and in the context of the overall clinical manifestation. 2014 BMJ Publishing Group Ltd.

Autoantibodies against voltage-gated potassium channel (VGKC) and glutamic acid decarboxylase (GAD) in psychosis: A systematic review, meta-analysis and case series.

OpenAIRE

Lally*, John; Grain*, Rosemary; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy RJ; Murray, Robin MacGregor; Gaughran, Fiona Patricia

2017-01-01

Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

Science.gov (United States)

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

4-Aminopyridine: a pan voltage-gated potassium channel inhibitor that enhances K7.4 currents and inhibits noradrenaline-mediated contraction of rat mesenteric small arteries

DEFF Research Database (Denmark)

Khammy, Makhala M; Kim, Sukhan; Bentzen, Bo H

2018-01-01

has not been systematically studied. The aim of this study was to investigate the pharmacological activity of 4-AP on Kv7.4 and Kv7.5 channels and characterize the effect of 4-AP on rat resistance arteries. EXPERIMENTAL APPROACH: Voltage clamp experiments were performed on Xenopus laevis oocytes......BACKGROUND AND PURPOSE: Kv7.4 and Kv7.5 channels are regulators of vascular tone. 4-Aminopyridine (4-AP) is considered a broad inhibitor of voltage-gated potassium (KV) channels, with little inhibitory effect on Kv7 family members at mmol concentrations. However, the effect of 4-AP on Kv7 channels...

Voltage-Gated Potassium Channel Antibody Paraneoplastic Limbic Encephalitis Associated with Acute Myeloid Leukemia

Directory of Open Access Journals (Sweden)

Marion Alcantara

2013-05-01

Full Text Available Among paraneoplastic syndromes (PNS associated with malignant hemopathies, there are few reports of PNS of the central nervous system and most of them are associated with lymphomas. Limbic encephalitis is a rare neurological syndrome classically diagnosed in the context of PNS. We report the case of a 81-year-old man who presented with a relapsed acute myeloid leukemia (AML with minimal maturation. He was admitted for confusion with unfavorable evolution as he presented a rapidly progressive dementia resulting in death. A brain magnetic resonance imaging, performed 2 months after the onset, was considered normal. An electroencephalogram showed non-specific bilateral slow waves. We received the results of the blood screening of neuronal autoantibodies after the patient's death and detected the presence of anti-voltage-gated potassium channel (VGKC antibodies at 102 pmol/l (normal at <30 pmol/l. Other etiologic studies, including the screening for another cause of rapidly progressive dementia, were negative. To our knowledge, this is the first case of anti-VGKC paraneoplastic limbic encephalitis related to AML.

Voltage-Gated Potassium Channel Autoimmunity Mimicking Creutzfeldt-Jakob Disease

Science.gov (United States)

Geschwind, Michael D.; Tan, K. Meng; Lennon, Vanda A.; Barajas, Ramon F.; Haman, Aissa; Klein, Christopher J.; Josephson, S. Andrew; Pittock, Sean J.

2009-01-01

Background Rapidly progressive dementia has a variety of causes, including Creutzfeldt-Jakob disease (CJD) and neuronal voltage-gated potassium channel (VGKC) autoantibody–associated encephalopathy. Objective To describe patients thought initially to have CJD but found subsequently to have immunotherapy-responsive VGKC autoimmunity. Design Observational, prospective case series. Setting Department of Neurology, Mayo Clinic, and the Memory and Aging Center, University of California, San Francisco. Patients A clinical serologic cohort of 15 patients referred for paraneoplastic autoantibody evaluation. Seven patients were evaluated clinically by at least one of us. Clinical information for the remaining patients was obtained by physician interview or medical record review. Main Outcome Measures Clinical features, magnetic resonance imaging abnormalities, electroencephalographic patterns, cerebrospinal fluid analyses, and responses to immunomodulatory therapy. Results All the patients presented subacutely with neurologic manifestations, including rapidly progressive dementia, myoclonus, extrapyramidal dysfunction, visual hallucinations, psychiatric disturbance, and seizures; most (60%) satisfied World Health Organization diagnostic criteria for CJD. Magnetic resonance imaging abnormalities included cerebral cortical diffusion-weighted imaging hyperintensities. Electroencephalographic abnormalities included diffuse slowing, frontal intermittent rhythmic delta activity, and focal epileptogenic activity but not periodic sharp wave complexes. Cerebrospinal fluid 14-3-3 protein or neuron-specific enolase levels were elevated in 5 of 8 patients. Hyponatremia was common (60%). Neoplasia was confirmed histologically in 5 patients (33%) and was suspected in another 5. Most patients’ conditions (92%) improved after immunomodulatory therapy. Conclusions Clinical, radiologic, electrophysiologic, and laboratory findings in VGKC autoantibody–associated encephalopathy may be

VEGF attenuated increase of outward delayed-rectifier potassium currents in hippocampal neurons induced by focal ischemia via PI3-K pathway.

Science.gov (United States)

Wu, K W; Yang, P; Li, S S; Liu, C W; Sun, F Y

2015-07-09

We recently indicated that the vascular endothelial growth factor (VEGF) protects neurons against hypoxic death via enhancement of tyrosine phosphorylation of Kv1.2, an isoform of the delayed-rectifier potassium channels through activation of the phosphatidylinositol 3-kinase (PI3-K) signaling pathway. The present study investigated whether VEGF could attenuate ischemia-induced increase of the potassium currents in the hippocampal pyramidal neurons of rats after ischemic injury. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion (MCAO) to induce brain ischemia. The whole-cell patch-clamp technique was used to record the potassium currents of hippocampal neurons in brain slices from the ischemically injured brains of the rats 24h after MCAO. We detected that transient MCAO caused a significant increase of voltage-gated potassium currents (Kv) and outward delayed-rectifier potassium currents (IK), but not outward transient potassium currents (IA), in the ipsilateral hippocampus compared with the sham. Moreover, we found that VEGF could acutely, reversibly and voltage-dependently inhibit the ischemia-induced IK increase. This inhibitory effect of VEGF could be completely abolished by wortmannin, an inhibitor of PI3-K. Our data indicate that VEGF attenuates the ischemia-induced increase of IK via activation of the PI3-K signaling pathway. Published by Elsevier Ltd.

Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

Directory of Open Access Journals (Sweden)

Aldo A Rodríguez Menchaca

2012-09-01

Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies

DEFF Research Database (Denmark)

Celicanin, Marko; Blaabjerg, M; Maersk-Moller, C

2017-01-01

BACKGROUND AND PURPOSE: The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2......, electroencephalography and (18) F-fluorodeoxyglucose positron emission tomography scans were re-evaluated by experts in the field. RESULTS: A total of 28/192 patients tested positive for VGKC-complex antibodies by radioimmunoassay and indirect immunofluorescence; 17 had antibodies to LGI1 and 6/7 of the available....... CONCLUSIONS: Patients diagnosed with anti-LGI1 autoimmune encephalitis increased significantly from 2009 to 2014, probably due to increased awareness. In contrast to seropositive anti-VGKC-complex patients, all anti-LGI1-positive patients presented with a classical limbic encephalitis. The majority...

Interactions between bicarbonate, potassium, and magnesium, and sulfur-dependent induction of luminescence in Vibrio fischeri.

Science.gov (United States)

Tabei, Yosuke; Era, Mariko; Ogawa, Akane; Morita, Hiroshi

2012-06-01

In spite of its central importance in research efforts, the relationship between seawater compounds and bacterial luminescence has not previously been investigated in detail. Thus, in this study, we investigated the effect of cations (Na(+) , K(+) , NH(4) (+) , Mg(2+) , and Ca(2+) ) and anions (Cl(-) , HCO(3) (-) , CO(3) (2-) , and NO(3) (-) ) on the induction of both inorganic (sulfate, sulfite, and thiosulfate) and organic (L-cysteine and L-cystine) sulfur-dependent luminescence in Vibrio fischeri. We found that HCO(3) (-) (bicarbonate) and CO(3) (2-) (carbonate), in the form of various compounds, had a stimulatory effect on sulfur-dependent luminescence. The luminescence induced by bicarbonate was further promoted by the addition of magnesium. Potassium also increased sulfur-dependent luminescence when sulfate or thiosulfate was supplied as the sole sulfur source, but not when sulfite, L-cysteine, or L-cystine was supplied. The positive effect of potassium was accelerated by the addition of magnesium and/or calcium. Furthermore, the additional supply of magnesium improved the induction of sulfite- or L-cysteine-dependent luminescence, but not the l-cystine-dependent type. These results suggest that sulfur-dependent luminescence of V. fischeri under nutrient-starved conditions is mainly controlled by bicarbonate, carbonate, and potassium. In addition, our results indicate that an additional supply of magnesium is effective for increasing V. fischeri luminescence. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Voltage-Gated Potassium Channel-Complex Antibodies Associated Encephalopathy and Related Diseases].

Science.gov (United States)

Watanabe, Osamu

2016-09-01

Voltage-gated potassium channel (VGKC) complex antibodies are auto-antibodies, initially identified in acquired neuromyotonia (aNMT; Isaacs' syndrome), which cause muscle cramps and difficulty in opening the palm of the hands. Subsequently, these antibodies were found in patients presenting with aNMT along with psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) patient with prominent amnesia and frequent seizures. Typical LE cases have a distinctive adult-onset, frequent, brief dystonic seizure semiology that predominantly affects the arms and ipsilateral face. It has now been termed faciobrachial dystonic seizures (FBDS). The VGKC complex is a group of proteins that are strongly associated in situ and after extraction in the mild detergent digitonin. Recent studies indicated that the VGKC complex antibodies are mainly directed toward associated proteins (for example LGI1, Caspr2) that complex with VGKCs themselves. Patients with aNMT or MoS are most likely to have Caspr2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. We systematically identified and quantified autoantibodies in patient sera with VGKC-complex antibody associated encephalopathy and showed the relationship between individual antibodies and patient's symptoms. Furthermore, we revealed how autoantibodies disrupt the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, reducing the synaptic AMPA receptors.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

Science.gov (United States)

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Role of the activation gate in determining the extracellular potassium dependency of block of HERG by trapped drugs.

Science.gov (United States)

Pareja, Kristeen; Chu, Elaine; Dodyk, Katrina; Richter, Kristofer; Miller, Alan

2013-01-01

Drug induced long QT syndrome (diLQTS) results primarily from block of the cardiac potassium channel HERG (human-ether-a-go-go related gene). In some cases long QT syndrome can result in the lethal arrhythmia torsade de pointes, an arrhythmia characterized by a rapid heart rate and severely compromised cardiac output. Many patients requiring medication present with serum potassium abnormalities due to a variety of conditions including gastrointestinal dysfunction, renal and endocrine disorders, diuretic use, and aging. Extracellular potassium influences HERG channel inactivation and can alter block of HERG by some drugs. However, block of HERG by a number of drugs is not sensitive to extracellular potassium. In this study, we show that block of WT HERG by bepridil and terfenadine, two drugs previously shown to be trapped inside the HERG channel after the channel closes, is insensitive to extracellular potassium over the range of 0 mM to 20 mM. We also show that bepridil block of the HERG mutant D540K, a mutant channel that is unable to trap drugs, is dependent on extracellular potassium, correlates with the permeant ion, and is independent of HERG inactivation. These results suggest that the lack of extracellular potassium dependency of block of HERG by some drugs may in part be related to the ability of these drugs to be trapped inside the channel after the channel closes.

Afterdischarges following M waves in patients with voltage-gated potassium channels antibodies

Directory of Open Access Journals (Sweden)

Jingwen Niu

Full Text Available Objective: To explore the correlation between afterdischarges in motor nerve conduction studies and clinical motor hyperexcitability in patients with voltage-gated potassium channels (VGKC antibodies. Methods: Six patients with positive serum antibodies to contactin-associated protein-like 2 (CASPR2 or/and leucine-rich glioma-inactivated protein 1 (LGI1 were recruited, including 5 with autoimmune encephalitis, and 1 with cramp-fasciculation syndrome. Electromyography (EMG, nerve conduction studies (NCS and F waves were performed, and afterdischarges were assessed. One patient was followed up. Results: Five patients had clinical evidence of peripheral motor nerve hyperexcitability (myokymia or cramp, and four of them had abnormal spontaneous firing in concentric needle electromyography (EMG. Prolonged afterdischarges following normal M waves were present in all six patients, including the two patients who had no EMG evidence of peripheral nerve hyperexcitability (PNH. Afterdischarges disappeared after treatment with intravenous immunoglobulin (IVIG. Conclusion: The afterdischarges in motor nerve conduction study might be a sensitive indicator of peripheral motor nerve hyperexcitability in patients with VGKC antibodies. Significance: Afterdischarges in motor nerve conduction study might be more sensitive than needle electromyography for detecting peripheral motor nerve hyperexcitability, and could disappear gradually in accordance with clinical improvement and reduction of antibodies. Keywords: Afterdischarges, VGKC, Autoimmune encephalitis, Peripheral nerve hyperexcitability, F wave, M wave

Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

Science.gov (United States)

Benhassine, Narimane; Berger, Thomas

2005-02-01

Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

Monitoring operating temperature and supply voltage in achieving high system dependability

NARCIS (Netherlands)

Khan, M.A.; Kerkhoff, Hans G.

2013-01-01

System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

Science.gov (United States)

White, William E.

2013-01-01

Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis.

Science.gov (United States)

Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L

2017-04-20

We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggressive immunotherapy with methylprednisolone and plasmapheresis was started early in the course of his presentation. Following treatment with immunotherapy, the patient demonstrated clinical improvement. Repeat serum evaluation 4 months posthospitalisation remained seropositive for VGKC-complex antibodies, with development of LGI1 autoantibody seropositivity. VGKC-complex and LGI1 antibodies remained positive 12 months posthospitalisation. Our findings suggest that clinical symptoms can predate the detection of the antibody. We conclude that when suspicion for autoimmune encephalitis is high in the setting of VGKC autoantibody positivity, regardless of LGI1 or CASPR2 seropositivity, early immunotherapy and repeat testing should be considered. 2017 BMJ Publishing Group Ltd.

[Current Perspective on Voltage-gated Potassium Channel Complex Antibody Associated Diseases].

Science.gov (United States)

Watanabe, Osamu

2018-04-01

Voltage-gated potassium channel (VGKC) complex auto-antibodies were initially identified in Isaacs' syndrome (IS), which is characterized by muscle cramps and neuromyotonia. These antibodies were subsequently identified in patients with Morvan's syndrome (MoS), which includes IS in conjunction with psychosis, insomnia, and dysautonomia. The antibodies have also been detected in a patient with limbic encephalopathy (LE) presenting with prominent amnesia and frequent seizures. Typical cases of LE have adult-onset, with frequent, brief dystonic seizures that predominantly affect the arms and ipsilateral face, and has recently been termed faciobrachial dystonic seizures. Autoantibodies against the extracellular domains of VGKC complex proteins, leucine-rich glioma-inactivated 1 (LGI1), and contactin-associated protein-2 (Caspr2), occur in patients with IS, MoS, and LE. However, routine testing has detected VGKC complex antibodies without LGI1 or Caspr2 reactivities (double-negative) in patients with other diseases, such as Creutzfeldt-Jakob disease and amyotrophic lateral sclerosis. Furthermore, double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits. Therefore, these antibodies should no longer be classified as neuronal-surface antibodies and lacking pathogenic potential. Novel information has been generated regarding autoantibody disruption of the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, thereby reducing the synaptic AMPA receptors. It may be that the main action is on inhibitory neurons, explaining why the loss of AMPA receptors causes amnesia, neuronal excitability and seizures.

Persistent anterograde amnesia following limbic encephalitis associated with antibodies to the voltage-gated potassium channel complex.

Science.gov (United States)

Butler, Christopher R; Miller, Thomas D; Kaur, Manveer S; Baker, Ian W; Boothroyd, Georgie D; Illman, Nathan A; Rosenthal, Clive R; Vincent, Angela; Buckley, Camilla J

2014-04-01

Limbic encephalitis (LE) associated with antibodies to the voltage-gated potassium channel complex (VGKC) is a potentially reversible cause of cognitive impairment. Despite the prominence of cognitive dysfunction in this syndrome, little is known about patients' neuropsychological profile at presentation or their long-term cognitive outcome. We used a comprehensive neuropsychological test battery to evaluate cognitive function longitudinally in 19 patients with VGKC-LE. Before immunotherapy, the group had significant impairment of memory, processing speed and executive function, whereas language and perceptual organisation were intact. At follow-up, cognitive impairment was restricted to the memory domain, with processing speed and executive function having returned to the normal range. Residual memory function was predicted by the antibody titre at presentation. The results show that, despite broad cognitive dysfunction in the acute phase, patients with VGKC-LE often make a substantial recovery with immunotherapy but may be left with permanent anterograde amnesia.

Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

Science.gov (United States)

Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

2018-04-01

Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

Excitation block in a nerve fibre model owing to potassium-dependent changes in myelin resistance.

Science.gov (United States)

Brazhe, A R; Maksimov, G V; Mosekilde, E; Sosnovtseva, O V

2011-02-06

The myelinated nerve fibre is formed by an axon and Schwann cells or oligodendrocytes that sheath the axon by winding around it in tight myelin layers. Repetitive stimulation of a fibre is known to result in accumulation of extracellular potassium ions, especially between the axon and the myelin. Uptake of potassium leads to Schwann cell swelling and myelin restructuring that impacts the electrical properties of the myelin. In order to further understand the dynamic interaction that takes place between the myelin and the axon, we have modelled submyelin potassium accumulation and related changes in myelin resistance during prolonged high-frequency stimulation. We predict that potassium-mediated decrease in myelin resistance leads to a functional excitation block with various patterns of altered spike trains. The patterns are found to depend on stimulation frequency and amplitude and to range from no block (less than 100 Hz) to a complete block (greater than 500 Hz). The transitional patterns include intermittent periodic block with interleaved spiking and non-spiking intervals of different relative duration as well as an unstable regime with chaotic switching between the spiking and non-spiking states. Intermittent conduction blocks are accompanied by oscillations of extracellular potassium. The mechanism of conductance block based on myelin restructuring complements the already known and modelled block via hyperpolarization mediated by the axonal sodium pump and potassium depolarization.

Contributions of counter-charge in a potassium channel voltage-sensor domain

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

2011-01-01

Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

Energy Technology Data Exchange (ETDEWEB)

Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

2011-07-29

Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

Expression, purification and functional reconstitution of slack sodium-activated potassium channels.

Science.gov (United States)

Yan, Yangyang; Yang, Youshan; Bian, Shumin; Sigworth, Fred J

2012-11-01

The slack (slo2.2) gene codes for a potassium-channel α-subunit of the 6TM voltage-gated channel family. Expression of slack results in Na(+)-activated potassium channel activity in various cell types. We describe the purification and reconstitution of Slack protein and show that the Slack α-subunit alone is sufficient for potassium channel activity activated by sodium ions as assayed in planar bilayer membranes and in membrane vesicles.

Chronic potassium depletion increases adrenal progesterone production that is necessary for efficient renal retention of potassium.

Science.gov (United States)

Elabida, Boutaïna; Edwards, Aurélie; Salhi, Amel; Azroyan, Anie; Fodstad, Heidi; Meneton, Pierre; Doucet, Alain; Bloch-Faure, May; Crambert, Gilles

2011-08-01

Modern dietary habits are characterized by high-sodium and low-potassium intakes, each of which was correlated with a higher risk for hypertension. In this study, we examined whether long-term variations in the intake of sodium and potassium induce lasting changes in the plasma concentration of circulating steroids by developing a mathematical model of steroidogenesis in mice. One finding of this model was that mice increase their plasma progesterone levels specifically in response to potassium depletion. This prediction was confirmed by measurements in both male mice and men. Further investigation showed that progesterone regulates renal potassium handling both in males and females under potassium restriction, independent of its role in reproduction. The increase in progesterone production by male mice was time dependent and correlated with decreased urinary potassium content. The progesterone-dependent ability to efficiently retain potassium was because of an RU486 (a progesterone receptor antagonist)-sensitive stimulation of the colonic hydrogen, potassium-ATPase (known as the non-gastric or hydrogen, potassium-ATPase type 2) in the kidney. Thus, in males, a specific progesterone concentration profile induced by chronic potassium restriction regulates potassium balance.

Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

Science.gov (United States)

Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

2012-01-01

The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

Science.gov (United States)

Held, Katharina; Voets, Thomas; Vriens, Joris

2016-01-01

Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

OpenAIRE

Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

2000-01-01

We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

Science.gov (United States)

Nicholson, Graham M.; Lewis, Richard J.

2006-01-01

Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

International Nuclear Information System (INIS)

Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

2006-01-01

An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

Science.gov (United States)

Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

2003-03-01

The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

Energy Technology Data Exchange (ETDEWEB)

Urbach, H.; Mader, I. [University Medical Center Freiburg, Department of Neuroradiology, Freiburg (Germany); Rauer, S.; Baumgartner, A. [University Medical Center Freiburg, Department of Neurology, Freiburg (Germany); Paus, S. [University Medical Center, Department of Neurology, Bonn (Germany); Wagner, J. [University Medical Center, Department of Epileptology, Bonn (Germany); Malter, M.P. [University of Cologne, Department of Neurology, Cologne (Germany); Pruess, H. [Charite - Universitaetsmedizin Berlin, Department of Neurology, Berlin (Germany); Lewerenz, J.; Kassubek, J. [Ulm University, Department of Neurology, Ulm (Germany); Hegen, H.; Auer, M.; Deisenhammer, F. [University Innsbruck, Department of Neurology, Innsbruck (Austria); Ufer, F. [University Medical Center, Department of Neurology, Hamburg (Germany); Bien, C.G. [Epilepsy Centre Bethel, Bielefeld-Bethel (Germany)

2015-12-15

Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

International Nuclear Information System (INIS)

Urbach, H.; Mader, I.; Rauer, S.; Baumgartner, A.; Paus, S.; Wagner, J.; Malter, M.P.; Pruess, H.; Lewerenz, J.; Kassubek, J.; Hegen, H.; Auer, M.; Deisenhammer, F.; Ufer, F.; Bien, C.G.

2015-01-01

Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis.

Science.gov (United States)

Urbach, H; Rauer, S; Mader, I; Paus, S; Wagner, J; Malter, M P; Prüss, H; Lewerenz, J; Kassubek, J; Hegen, H; Auer, M; Deisenhammer, F; Ufer, F; Bien, C G; Baumgartner, A

2015-12-01

Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE.

Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

International Nuclear Information System (INIS)

Yamacli, Serhan; Avci, Mutlu

2009-01-01

In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

Development of Isaacs' syndrome following complete recovery of voltage-gated potassium channel antibody-associated limbic encephalitis.

Science.gov (United States)

Takahashi, Hirokatsu; Mori, Masahiro; Sekiguchi, Yukari; Misawa, Sonoko; Sawai, Setsu; Hattori, Takamichi; Kuwabara, Satoshi

2008-12-15

Autoantibodies against voltage-gated potassium channels (VGKC-Abs) are associated with acquired neuromyotonia (Isaacs' syndrome) and related disorders such as Morvan's syndrome and some cases of limbic encephalitis. The mechanisms underlying the various phenotypes induced by VGKC-Abs are not fully understood. Recently, we reported a case of LE with VGKC-Abs accompanied by severe intestinal pseudo-obstruction and thymoma. Thymectomy and immunosuppressive therapy induced dramatic clinical improvement of LE symptoms, and VGKC-Abs titers decreased from 1254 pM to 549 pM (normal>100 pM). Seventeen months later, the patient developed progressive generalized muscle cramping, paresthesias in his lower extremities, excessive sweating, and severe constipation. There was no recurrence of the LE. Electromyography showed fasciculation potentials and myokymic discharges, and the plasma VGKC-Abs titer was again elevated to 879 pM. Here we report a case of Isaacs' syndrome after complete remission of LE with VGKC-Abs that may provide an insight into a possible link among VGKC-Abs associated syndromes.

Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

Science.gov (United States)

Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

2017-04-20

Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

Directory of Open Access Journals (Sweden)

Seok-Yong Lee

2009-03-01

Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Voltage gated potassium channel antibodies positive autoimmune encephalopathy in a child: A case report and literature review of an under-recognized condition

Directory of Open Access Journals (Sweden)

Subramanian Ganesan

2013-01-01

Full Text Available Autoimmune limbic encephalitis (LE associated with voltage gated potassium channel antibodies (VGKC-Abs in children is more common than previously thought and is not always paraneoplastic. Non-neoplastic, autoimmune LE associated with VGKC-Abs has been described recently. However, only few case reports in children as the disease is predominantly described in the adult population. It is likely that this type of autoimmune encephalitis is currently under-diagnosed and hence, under-treated, especially in children. We present a 13-year-old previously fit and healthy African girl diagnosed with LE and we reviewed the literature for its current management.

Voltage gated potassium channel antibodies positive autoimmune encephalopathy in a child: A case report and literature review of an under-recognized condition

Science.gov (United States)

Ganesan, Subramanian; Beri, Sushil; Khan, Beri; Hussain, Nahin

2013-01-01

Autoimmune limbic encephalitis (LE) associated with voltage gated potassium channel antibodies (VGKC-Abs) in children is more common than previously thought and is not always paraneoplastic. Non-neoplastic, autoimmune LE associated with VGKC-Abs has been described recently. However, only few case reports in children as the disease is predominantly described in the adult population. It is likely that this type of autoimmune encephalitis is currently under-diagnosed and hence, under-treated, especially in children. We present a 13-year-old previously fit and healthy African girl diagnosed with LE and we reviewed the literature for its current management. PMID:24339586

Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

Science.gov (United States)

Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

2012-06-06

Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

International Nuclear Information System (INIS)

Barchi, R.L.; Tanaka, J.C.

1984-01-01

In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

Complex N-Glycans Influence the Spatial Arrangement of Voltage Gated Potassium Channels in Membranes of Neuronal-Derived Cells.

Directory of Open Access Journals (Sweden)

M Kristen Hall

Full Text Available The intrinsic electrical properties of a neuron depend on expression of voltage gated potassium (Kv channel isoforms, as well as their distribution and density in the plasma membrane. Recently, we showed that N-glycosylation site occupancy of Kv3.1b modulated its placement in the cell body and neurites of a neuronal-derived cell line, B35 neuroblastoma cells. To extrapolate this mechanism to other N-glycosylated Kv channels, we evaluated the impact of N-glycosylation occupancy of Kv3.1a and Kv1.1 channels. Western blots revealed that wild type Kv3.1a and Kv1.1 α-subunits had complex and oligomannose N-glycans, respectively, and that abolishment of the N-glycosylation site(s generated Kv proteins without N-glycans. Total internal reflection fluorescence microscopy images revealed that N-glycans of Kv3.1a contributed to its placement in the cell membrane while N-glycans had no effect on the distribution of Kv1.1. Based on particle analysis of EGFP-Kv proteins in the adhered membrane, glycosylated forms of Kv3.1a, Kv1.1, and Kv3.1b had differences in the number, size or density of Kv protein clusters in the cell membrane of neurites and cell body of B35 cells. Differences were also observed between the unglycosylated forms of the Kv proteins. Cell dissociation assays revealed that cell-cell adhesion was increased by the presence of complex N-glycans of Kv3.1a, like Kv3.1b, whereas cell adhesion was similar in the oligomannose and unglycosylated Kv1.1 subunit containing B35 cells. Our findings provide direct evidence that N-glycans of Kv3.1 splice variants contribute to the placement of these glycoproteins in the plasma membrane of neuronal-derived cells while those of Kv1.1 were absent. Further when the cell membrane distribution of the Kv channel was modified by N-glycans then the cell-cell adhesion properties were altered. Our study demonstrates that N-glycosylation of Kv3.1a, like Kv3.1b, provides a mechanism for the distribution of these

Potassium channels in brain mitochondria.

Science.gov (United States)

Bednarczyk, Piotr

2009-01-01

Potassium channels are the most widely distributed class of ion channels. These channels are transmembrane proteins known to play important roles in both normal and pathophysiological functions in all cell types. Various potassium channels are recognised as potential therapeutic targets in the treatment of Parkinson's disease, Alzheimer's disease, brain/spinal cord ischaemia and sepsis. In addition to their importance as therapeutic targets, certain potassium channels are known for their beneficial roles in anaesthesia, cardioprotection and neuroprotection. Some types of potassium channels present in the plasma membrane of various cells have been found in the inner mitochondrial membrane as well. Potassium channels have been proposed to regulate mitochondrial membrane potential, respiration, matrix volume and Ca(+) ion homeostasis. It has been proposed that mitochondrial potassium channels mediate ischaemic preconditioning in various tissues. However, the specificity of a pharmacological agents and the mechanisms underlying their effects on ischaemic preconditioning remain controversial. The following potassium channels from various tissues have been identified in the inner mitochondrial membrane: ATP-regulated (mitoK(ATP)) channel, large conductance Ca(2+)-regulated (mitoBK(Ca)) channel, intermediate conductance Ca(2+)-regulated (mitoIK(Ca)) channel, voltage-gated (mitoKv1.3 type) channel, and twin-pore domain (mitoTASK-3) channel. It has been shown that increased potassium flux into brain mitochondria induced by either the mitoK(ATP) channel or mitoBK(Ca) channel affects the beneficial effects on neuronal cell survival under pathological conditions. Recently, differential distribution of mitoBK(Ca) channels has been observed in neuronal mitochondria. These findings may suggest a neuroprotective role for the mitoBK(Ca) channel in specific brain structures. This minireview summarises current data on brain mitochondrial potassium channels and the efforts to identify

Potassium-Based Dual Ion Battery with Dual-Graphite Electrode.

Science.gov (United States)

Fan, Ling; Liu, Qian; Chen, Suhua; Lin, Kairui; Xu, Zhi; Lu, Bingan

2017-08-01

A potassium ion battery has potential applications for large scale electric energy storage systems due to the abundance and low cost of potassium resources. Dual graphite batteries, with graphite as both anode and cathode, eliminate the use of transition metal compounds and greatly lower the overall cost. Herein, combining the merits of the potassium ion battery and dual graphite battery, a potassium-based dual ion battery with dual-graphite electrode is developed. It delivers a reversible capacity of 62 mA h g -1 and medium discharge voltage of ≈3.96 V. The intercalation/deintercalation mechanism of K + and PF 6 - into/from graphite is proposed and discussed in detail, with various characterizations to support. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

Directory of Open Access Journals (Sweden)

Richard J. Lewis

2006-04-01

Full Text Available Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

Voltage-Gated Potassium Channels Kv1.3--Potentially New Molecular Target in Cancer Diagnostics and Therapy.

Science.gov (United States)

Teisseyre, Andrzej; Gąsiorowska, Justyna; Michalak, Krystyna

2015-01-01

Voltage-gated potassium channels, Kv1.3, which were discovered in 1984, are integral membrane proteins which are activated ("open") upon change of the cell membrane potential, enabling a passive flux of potassium ions across the cell membrane. The channels are expressed in many different tissues, both normal and cancer. Since 2005 it has been known that the channels are expressed not only in the plasma membrane, but also in the inner mitochondrial membrane. The activity of Kv1.3 channels plays an important role, among others, in setting the cell resting membrane potential, cell proliferation, apoptosis and volume regulation. For some years, these channels have been considered a potentially new molecular target in both the diagnostics and therapy of some cancer diseases. This review article focuses on: 1) changes of expression of the channels in cancer disorders with special regard to correlations between the channels' expression and stage of the disease, 2) influence of inhibitors of Kv1.3 channels on proliferation and apoptosis of cancer cells, 3) possible future applications of Kv1.3 channels' inhibitors in therapy of some cancer diseases. In the last section, the results of studies performed in our Laboratory of Bioelectricity on the influence of selected biologically active plant-derived compounds from the groups of flavonoids and stilbenes and their natural and synthetic derivatives on the activity of Kv1.3 channels in normal and cancer cells are reviewed. A possible application of some compounds from these groups to support therapy of cancer diseases, such as breast, colon and lymph node cancer, and melanoma or chronic lymphocytic leukemia (B-CLL), is announced.

Inward rectifier potassium current IKir promotes intrinsic pacemaker activity of thalamocortical neurons.

Science.gov (United States)

Amarillo, Yimy; Tissone, Angela I; Mato, Germán; Nadal, Marcela S

2018-06-01

Slow repetitive burst firing by hyperpolarized thalamocortical (TC) neurons correlates with global slow rhythms (rectifier potassium current I Kir induces repetitive burst firing at slow and delta frequency bands. We demonstrate this in mouse TC neurons in brain slices by manipulating the Kir maximum conductance with dynamic clamp. We also performed a thorough theoretical analysis that explains how the unique properties of I Kir enable this current to induce slow periodic bursting in TC neurons. We describe a new ionic mechanism based on the voltage- and time-dependent interaction of I Kir and hyperpolarization-activated cationic current I h that endows TC neurons with the ability to oscillate spontaneously at very low frequencies, even below 0.5 Hz. Bifurcation analysis of conductance-based models of increasing complexity demonstrates that I Kir induces bistability of the membrane potential at the same time that it induces sustained oscillations in combination with I h and increases the robustness of low threshold-activated calcium current I T -mediated oscillations. NEW & NOTEWORTHY The strong inwardly rectifying potassium current I Kir of thalamocortical neurons displays a region of negative slope conductance in the current-voltage relationship that generates potassium currents activated by hyperpolarization. Bifurcation analysis shows that I Kir induces bistability of the membrane potential; generates sustained subthreshold oscillations by interacting with the hyperpolarization-activated cationic current I h ; and increases the robustness of oscillations mediated by the low threshold-activated calcium current I T . Upregulation of I Kir in thalamocortical neurons induces repetitive burst firing at slow and delta frequency bands (<4 Hz).

Functional identification of a GORK potassium channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f.

Science.gov (United States)

Li, Junlin; Zhang, Huanchao; Lei, Han; Jin, Man; Yue, Guangzhen; Su, Yanhua

2016-04-01

A GORK homologue K(+) channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. shows the functional conservation of the GORK channels among plant species. Guard cell K(+) release through the outward potassium channels eventually enables the closure of stomata which consequently prevents plant water loss from severe transpiration. Early patch-clamp studies with the guard cells have revealed many details of such outward potassium currents. However, genes coding for these potassium-release channels have not been sufficiently characterized from species other than the model plant Arabidopsis thaliana. We report here the functional identification of a GORK (for Gated or Guard cell Outward Rectifying K(+) channels) homologue from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. AmGORK was primary expressed in shoots, where the transcripts were regulated by stress factors simulated by PEG, NaCl or ABA treatments. Patch-clamp measurements on isolated guard cell protoplasts revealed typical depolarization voltage gated outward K(+) currents sensitive to the extracelluar K(+) concentration and pH, resembling the fundamental properties previously described in other species. Two-electrode voltage-clamp analysis in Xenopus lavies oocytes with AmGORK reconstituted highly similar characteristics as assessed in the guard cells, supporting that the function of AmGORK is consistent with a crucial role in mediating stomatal closure in Ammopiptanthus mongolicus. Furthermore, a single amino acid mutation D297N of AmGORK eventually abolishes both the voltage-gating and its outward rectification and converts the channel into a leak-like channel, indicating strong involvement of this residue in the gating and voltage dependence of AmGORK. Our results obtained from this anciently originated plant support a strong functional conservation of the GORK channels among plant species and maybe also along the progress of revolution.

The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations.

Science.gov (United States)

Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J

2017-10-01

Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

International Nuclear Information System (INIS)

Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

2012-01-01

Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

Potassium conductances mediate bidirectional state-dependent modulation of action potential evoked dendritic calcium signals in dentate gyrus granule cells

Directory of Open Access Journals (Sweden)

János Brunner

2014-03-01

Full Text Available Backpropagating action potentials (bAPs and local calcium signals that they trigger are fundamental for dendritic functions. Here we addressed the question what extent the changes of local dendritic membrane properties can contribute to the shaping of the coupling between dendritic action potentials and the local calcium responses. Using a combination of in vitro electrophysiological and confocal imaging techniques we found that activation of dendritic GIRK channels via mGlu2 or GABAB receptors enhanced the bAP¬-triggered calcium signals in the dendrites of dentate gyrus granule cells (GCs. The enhancement of calcium signals was significant only in those dendritic regions, where these receptors are predominantly expressed. Similarly to GIRK channel activation, somatic hyperpolarization by DC current injection (from -64 mV to -77 mV, significantly increased bAP-associated calcium signals in the proximal dendrites. The hyperpolarization was associated with a decrease in the input resistance due to the rectification of the membrane potential of GCs. The effect of hyperpolarization on the calcium signals was maintained when T-type calcium currents were blocked but it decreased when GIRK channels were inhibited. Simultaneous dual somato-dendritic recordings from GCs showed that somatic hyperpolarization accelerated the repolarization phase of dendritic bAP in the proximal region whereas the rising phase and peak amplitude was not affected. We hypothesize that the larger driving force for calcium ions during the faster repolarization can contribute to the increasing in calcium signals. Employment of previously recorded dendritic bAP waveforms from hyperpolarized membrane potential as voltage command evoked larger calcium currents in nucleated patches compared to bAP waveform from the same recording at depolarized membrane potential. Furthermore, addition of native, high-voltage activated, inactivating potassium conductance by somatic dynamic clamp

Morvan's syndrome with anti contactin associated protein like 2 – voltage gated potassium channel antibody presenting with syndrome of inappropriate antidiuretic hormone secretion

Directory of Open Access Journals (Sweden)

Anjani Kumar Sharma

2016-01-01

Full Text Available Morvan's syndrome is a rare autoimmune disorder characterized by triad of peripheral nerve hyperexcitability, autonomic dysfunction, and central nervous system symptoms. Antibodies against contactin-associated protein-like 2 (CASPR2, a subtype of voltage-gated potassium channel (VGKC complex, are found in a significant proportion of patients with Morvan's syndrome and are thought to play a key role in peripheral as well as central clinical manifestations. We report a patient of Morvan's syndrome with positive CASPR2–anti-VGKC antibody having syndrome of inappropriate antidiuretic hormone as a cause of persistent hyponatremia.

Slick (Kcnt2 Sodium-Activated Potassium Channels Limit Peptidergic Nociceptor Excitability and Hyperalgesia

Directory of Open Access Journals (Sweden)

Danielle L Tomasello

2017-09-01

Full Text Available The Slick (Kcnt2 sodium-activated potassium (K Na channel is a rapidly gating and weakly voltage-dependent and sodium-dependent potassium channel with no clearly defined physiological function. Within the dorsal root ganglia (DRGs, we show Slick channels are exclusively expressed in small-sized and medium-sized calcitonin gene–related peptide (CGRP-containing DRG neurons, and a pool of channels are localized to large dense-core vesicles (LDCV-containing CGRP. We stimulated DRG neurons for CGRP release and found Slick channels contained within CGRP-positive LDCV translocated to the neuronal membrane. Behavioral studies in Slick knockout (KO mice indicated increased basal heat detection and exacerbated thermal hyperalgesia compared with wild-type littermate controls during neuropathic and chronic inflammatory pain. Electrophysiologic recordings of DRG neurons from Slick KO mice revealed that Slick channels contribute to outward current, propensity to fire action potentials (APs, and to AP properties. Our data suggest that Slick channels restrain the excitability of CGRP-containing neurons, diminishing pain behavior after inflammation and injury.

Performance analysis of a potassium-base AMTEC cell

International Nuclear Information System (INIS)

Huang, C.; Hendricks, T.J.; Hunt, T.K.

1998-01-01

Sodium-BASE Alkali-Metal-Thermal-to-Electric-Conversion (AMTEC) cells have been receiving increased attention and funding from the Department of Energy, NASA and the United States Air Force. Recently, sodium-BASE (Na-BASE) AMTEC cells were selected for the Advanced Radioisotope Power System (ARPS) program for the next generation of deep-space missions and spacecraft. Potassium-BASE (K-BASE) AMTEC cells have not received as much attention to date, even though the vapor pressure of potassium is higher than that of sodium at the same temperature. So that, K-BASE AMTEC cells with potentially higher open circuit voltage and higher power output than Na-BASE AMTEC cells are possible. Because the surface tension of potassium is about half of the surface tension of sodium at the same temperature, the artery and evaporator design in a potassium AMTEC cell has much more challenging pore size requirements than designs using sodium. This paper uses a flexible thermal/fluid/electrical model to predict the performance of a K-BASE AMTEC cell. Pore sizes in the artery of K-BASE AMTEC cells must be smaller by an order of magnitude than in Na-BASE AMTEC cells. The performance of a K-BASE AMTEC cell was higher than a Na-BASE AMTEC cell at low voltages/high currents. K-BASE AMTEC cells also have the potential of much better electrode performance, thereby creating another avenue for potentially better performance in K-BASE AMTEC cells

Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

NARCIS (Netherlands)

Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

2002-01-01

Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

Reversible antisense inhibition of Shaker-like Kv1.1 potassium channel expression impairs associative memory in mouse and rat

Science.gov (United States)

Meiri, Noam; Ghelardini, Carla; Tesco, Giuseppina; Galeotti, Nicoletta; Dahl, Dennis; Tomsic, Daniel; Cavallaro, Sebastiano; Quattrone, Alessandro; Capaccioli, Sergio; Bartolini, Alessandro; Alkon, Daniel L.

1997-01-01

Long-term memory is thought to be subserved by functional remodeling of neuronal circuits. Changes in the weights of existing synapses in networks might depend on voltage-gated potassium currents. We therefore studied the physiological role of potassium channels in memory, concentrating on the Shaker-like Kv1.1, a late rectifying potassium channel that is highly localized within dendrites of hippocampal CA3 pyramidal and dentate gyrus granular cells. Repeated intracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of its particular intracellular mRNA target, decreases late rectifying K+ current(s) in dentate granule cells, and impairs memory but not other motor or sensory behaviors, in two different learning paradigms, mouse passive avoidance and rat spatial memory. The latter, hippocampal-dependent memory loss occurred in the absence of long-term potentiation changes recorded both from the dentate gyrus or CA1. The specificity of the reversible antisense targeting of mRNA in adult animal brains may avoid irreversible developmental and genetic background effects that accompany transgenic “knockouts”. PMID:9114006

Reversible antisense inhibition of Shaker-like Kv1.1 potassium channel expression impairs associative memory in mouse and rat.

Science.gov (United States)

Meiri, N; Ghelardini, C; Tesco, G; Galeotti, N; Dahl, D; Tomsic, D; Cavallaro, S; Quattrone, A; Capaccioli, S; Bartolini, A; Alkon, D L

1997-04-29

Long-term memory is thought to be subserved by functional remodeling of neuronal circuits. Changes in the weights of existing synapses in networks might depend on voltage-gated potassium currents. We therefore studied the physiological role of potassium channels in memory, concentrating on the Shaker-like Kv1.1, a late rectifying potassium channel that is highly localized within dendrites of hippocampal CA3 pyramidal and dentate gyrus granular cells. Repeated intracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of its particular intracellular mRNA target, decreases late rectifying K+ current(s) in dentate granule cells, and impairs memory but not other motor or sensory behaviors, in two different learning paradigms, mouse passive avoidance and rat spatial memory. The latter, hippocampal-dependent memory loss occurred in the absence of long-term potentiation changes recorded both from the dentate gyrus or CA1. The specificity of the reversible antisense targeting of mRNA in adult animal brains may avoid irreversible developmental and genetic background effects that accompany transgenic "knockouts".

Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

Science.gov (United States)

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-01

Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

Energy Technology Data Exchange (ETDEWEB)

Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

2014-03-31

This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

Pressure dependence of the interfacial structure of potassium chloride films on iron

International Nuclear Information System (INIS)

Olson, Dustin; Gao, Hongyu; Tang, Chun; Tysoe, Wilfred T.; Martini, Ashlie

2015-01-01

Potassium chloride films on a clean iron surface are used as a model system to explore the interfacial structure of the films and the dependence of that structure on film thickness and pressure. The interfacial structure of one-, two-, three- and four-layer films is measured experimentally using low-energy electron diffraction. Those findings are then complemented by molecular dynamics simulations in which the atomic interaction between the film and substrate is tuned to match film thickness-dependent sublimation activation energy obtained from temperature-programmed desorption measurements. The resultant simulation reliably predicts the structure of thicker films and is then used to study the effect of pressure on the distribution of the lattice constant within and between each layer of the potassium chloride films. Findings indicate that both film thickness and pressure affect the structure within the films as well as the degree of registry between the film and adjacent substrate. - Highlights: • KCl films on an Fe surface are used as a model system to explore interfacial structure • Thin film structure is measured using low-energy electron diffraction • An empirical potential is tuned to match sublimation activation energy • Simulations reveal the effect of pressure on the lattice constant within the KCl films • Pressure affects the film structure and registry between film and substrate

Pressure dependence of the interfacial structure of potassium chloride films on iron

Energy Technology Data Exchange (ETDEWEB)

Olson, Dustin [Department of Chemistry and Laboratory for Surface Studies, University of Wisconsin—Milwaukee, Milwaukee, WI 53211 (United States); Gao, Hongyu; Tang, Chun [School of Engineering, University of California Merced, Merced CA 95343 (United States); Tysoe, Wilfred T. [Department of Chemistry and Laboratory for Surface Studies, University of Wisconsin—Milwaukee, Milwaukee, WI 53211 (United States); Martini, Ashlie [School of Engineering, University of California Merced, Merced CA 95343 (United States)

2015-10-30

Potassium chloride films on a clean iron surface are used as a model system to explore the interfacial structure of the films and the dependence of that structure on film thickness and pressure. The interfacial structure of one-, two-, three- and four-layer films is measured experimentally using low-energy electron diffraction. Those findings are then complemented by molecular dynamics simulations in which the atomic interaction between the film and substrate is tuned to match film thickness-dependent sublimation activation energy obtained from temperature-programmed desorption measurements. The resultant simulation reliably predicts the structure of thicker films and is then used to study the effect of pressure on the distribution of the lattice constant within and between each layer of the potassium chloride films. Findings indicate that both film thickness and pressure affect the structure within the films as well as the degree of registry between the film and adjacent substrate. - Highlights: • KCl films on an Fe surface are used as a model system to explore interfacial structure • Thin film structure is measured using low-energy electron diffraction • An empirical potential is tuned to match sublimation activation energy • Simulations reveal the effect of pressure on the lattice constant within the KCl films • Pressure affects the film structure and registry between film and substrate.

Clinical relevance of voltage-gated potassium channel–complex antibodies in children.

Science.gov (United States)

Hacohen, Yael; Singh, Rahul; Rossi, Meghan; Lang, Bethan; Hemingway, Cheryl; Lim, Ming; Vincent, Angela

2015-09-15

To assess the clinical and immunologic findings in children with voltage-gated potassium channel (VGKC)-complex antibodies (Abs). Thirty-nine of 363 sera, referred from 2 pediatric centers from 2007 to 2013, had been reported positive (.100 pM) for VGKC-complex Abs. Medical records were reviewed retrospectively and the patients’ condition was independently classified as inflammatory (n 5 159) or noninflammatory (n 5 204). Positive sera (.100 pM) were tested/retested for the VGKC complex Ab–positive complex proteins LGI1 and CASPR2, screened for binding to live hippocampal neurons, and 12 high-titer sera (.400 pM) tested by radioimmunoassay for binding to VGKC Kv1 subunits with or without intracellular postsynaptic density proteins. VGKC-complex Abs were found in 39 children, including 20% of encephalopathies and 7.6% of other conditions (p 5 0.001). Thirty children had inflammatory conditions and 9 had noninflammatory etiologies but titers.400 pM (n512) were found only in inflammatory diseases (p , 0.0001). Four sera, including from 2 children with coexisting NMDA receptor Abs and one with Guillain-Barré syndrome and Abs to both LGI1 and CASPR2, bound to hippocampal neurons. None of the sera bound detectably to VGKC Kv1 subunits on live HEK cells, but 4 of 12 .400 pM sera immunoprecipitated VGKC Kv1 subunits, with or without postsynaptic densities, extracted from transfected cells. Positive VGKC-complex Abs cannot be taken to indicate a specific clinical syndrome in children, but appear to be a nonspecific biomarker of inflammatory neurologic diseases, particularly of encephalopathy. Some of the Abs may bind to intracellular epitopes on the VGKC subunits, or to the intracellular interacting proteins, but in many the targets remain undefined.

Dependence of the concentrations of "1"3"7Cs and potassium in extracted soil solutions on soil humidity before centrifugation

International Nuclear Information System (INIS)

Prorok, V.V.; Datsenko, O.Yi.; Bulavyin, L.A.; Zlens'kij, S.Je.; Melnichenko, L.Yu.; Rozuvan, S.G.; Poperenko, L.V.; White, P.J.

2017-01-01

Concentrations of 137Cs and potassium in solutions extracted by centrifugation from soils selected at some experimental sites in the 10-km Exclusion Zone of Chornobyl Nuclear Plant were determined. The results showed that for the majority of investigated soils, the concentration of 137Cs in soil solution depends on the humidity of the soil before centrifugation. It is possible to explain the dependence of the concentration of 137Cs in the soil solution on soil humidity from the dependence of the concentrations of molecules of different molecular-gravimetric fractions in soil solution on soil humidity. Considerable amount of 137Cs in soil solution is associated with these molecules, that is why the concentration of 137Cs in the extracted soil solution changes with the humidity of soil. These dependences differ between soils. For the majority of investigated soils the concentration of 137Cs in the extracted soil solution increases with increasing humidity of the soil. By contrast, soil humidity had no effect on the potassium concentration in the extracted soil solution for any soil investigated. It is concluded, that potassium is practically not associated with molecules of different molecular-gravimetric fractions in the extracted soil solutions

Josephson tunneling current in the presence of a time-dependent voltage

International Nuclear Information System (INIS)

Harris, R.E.

1975-01-01

The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

Science.gov (United States)

Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

2011-04-18

Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

International Nuclear Information System (INIS)

Hahlbohm, H.D.; Luebbig, H.; Luther, H.

1975-01-01

Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies - a national cohort study

DEFF Research Database (Denmark)

Celicanin, M; Blaabjerg, Morten; Maersk-Moller, C

2017-01-01

BACKGROUND AND PURPOSE: The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2...... antibodies in the serum/cerebrospinal fluid between 2009 and 2013 with follow-up interviews in 2015 and 2016. METHODS: We evaluated antibody status, symptoms leading to testing, course of disease, suspected diagnosis and time of admission as well as diagnosis and treatment. All magnetic resonance imaging......-Barré syndrome, Creutzfeldt-Jakob disease, neuromyotonia and anti-N-methyl-D-aspartate receptor encephalitis. Magnetic resonance imaging abnormalities were demonstrated in 69% of the LGI1-positive patients. Two patients with normal magnetic resonance imaging demonstrated temporal lobe hypermetabolism using (18...

[An autopsy case of amyotrophic lateral sclerosis with prominent muscle cramps, fasciculation, and high titer of anti-voltage gated potassium channel (VGKC) complex antibody].

Science.gov (United States)

Sato, Aki; Sakai, Naoko; Shinbo, Junsuke; Hashidate, Hideki; Igarashi, Shuichi; Kakita, Akiyoshi; Yamazaki, Motoyoshi

2014-01-01

The patient was a 55-year-old male who had prominent fasciculation and muscle cramps. Muscle weakness and atrophy of the trunk, respiratory system, and extremities gradually progressed. On the basis of these features, we diagnosed this patient as having amyotrophic lateral sclerosis (ALS), however, the upper motor neuron signs were not significant. Following the detection of the anti-voltage gated potassium channel (VGKC) complex antibody at 907.5 pM (normal VGKC complex antibody in the development of cramp-fasciculation syndrome has been speculated. In this ALS patient, the antibodies might be associated with pathomechanisms underlying the characteristic symptoms.

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

Science.gov (United States)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Voltage-gated potassium channel (K(v) 1) autoantibodies in patients with chagasic gut dysmotility and distribution of K(v) 1 channels in human enteric neuromusculature (autoantibodies in GI dysmotility).

Science.gov (United States)

Hubball, A W; Lang, B; Souza, M A N; Curran, O D; Martin, J E; Knowles, C H

2012-08-01

Autoantibodies directed against specific neuronal antigens are found in a significant number of patients with gastrointestinal neuromuscular diseases (GINMDs) secondary to neoplasia. This study examined the presence of antineuronal antibodies in idiopathic GINMD and GINMD secondary to South American Trypanosomiasis. The GI distribution of voltage-gated potassium channels (VGKCs) was also investigated. Seventy-three patients were included in the study with diagnoses of primary achalasia, enteric dysmotility, chronic intestinal pseudo-obstruction, esophageal or colonic dysmotility secondary to Chagas' disease. Sera were screened for specific antibodies to glutamic acid decarboxylase, voltage-gated calcium channels (VGCCs; P/Q subtype), nicotinic acetylcholine receptors (nAChRs; α3 subtype), and voltage-gated potassium channels (VGKCs, K(V) 1 subtype) using validated immunoprecipitation assays. The distribution of six VGKC subunits (K(V) 1.1-1.6), including those known to be antigenic targets of anti-VGKC antibodies was immunohistochemically investigated in all main human GI tract regions. Three patients (14%) with chagasic GI dysmotility were found to have positive anti-VGKC antibody titers. No antibodies were detected in patients with idiopathic GINMD. The VGKCs were found in enteric neurons at every level of the gut in unique yet overlapping distributions. The VGKC expression in GI smooth muscle was found to be limited to the esophagus. A small proportion of patients with GI dysfunction secondary to Chagas' disease have antibodies against VGKCs. The presence of these channels in the human enteric nervous system may have pathological relevance to the growing number of GINMDs with which anti-VGKC antibodies have been associated. © 2012 Blackwell Publishing Ltd.

Regulation of KV channel voltage-dependent activation by transmembrane β subunits

Directory of Open Access Journals (Sweden)

Xiaohui eSun

2012-04-01

Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Directory of Open Access Journals (Sweden)

Sameera Dharia

2011-02-01

Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Science.gov (United States)

Dharia, Sameera; Rabbitt, Richard D

2011-02-28

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

Crystallization and preliminary X-ray diffraction studies of the tetramerization domain derived from the human potassium channel Kv1.3

International Nuclear Information System (INIS)

Winklmeier, Andreas; Weyand, Michael; Schreier, Christina; Kalbitzer, Hans Robert; Kremer, Werner

2009-01-01

The tetramerization domain of human Kv1.3 was cloned, expressed, purified and crystallized. The crystals belonged to space group I4 and diffracted to 1.2 Å resolution using synchrotron radiation. The tetramerization domain (T1 domain) derived from the voltage-dependent potassium channel Kv1.3 of Homo sapiens was recombinantly expressed in Escherichia coli and purified. The crystals were first grown in an NMR tube in 150 mM potassium phosphate pH 6.5 in the absence of additional precipitants. The crystals showed I4 symmetry characteristic of the naturally occurring tetrameric assembly of the single subunits. A complete native data set was collected to 1.2 Å resolution at 100 K using synchrotron radiation

Clinical-pathologic correlations in voltage-gated Kv1 potassium channel complex-subtyped autoimmune painful polyneuropathy.

Science.gov (United States)

Lahoria, Rajat; Pittock, Sean J; Gadoth, Avi; Engelstad, Janean K; Lennon, Vanda A; Klein, Christopher J

2017-04-01

Voltage-gated Kv1 potassium channel complex (VGKC) autoantibodies subtyped for leucine-rich glioma-inactivated 1 (LGI1), contactin-associated-proteinlike 2 (CASPR2), and Kv IgGs have a spectrum of neurological presentations. Painful polyneuropathy is seen in some patients, but nerve pathology descriptions are lacking. Clinicopathologic features were studied in subtyped VGKC-autoantibody-seropositive patients who had undergone nerve biopsies. Five patients were identified, 1 LGI1 IgG positive and 1 CASPR2 IgG positive, but all negative for Kv1.1-, 1.2-, 1.6-subtyped IgG autoantibodies. Median symptom duration was 17 months. Pain was the predominant symptom; 3 had mild sensory loss and/or weakness. Histopathological abnormalities were limited to axonal loss in 3. None had mononuclear cellular infiltrates. Electron micrographs revealed no interstitial abnormalities. Three patients reported marked improvement in pain with immunotherapy. The nerve biopsy histopathology of patients subtyped for LGI1 and CASPR2 IgGs within the VGKC-complex spectrum disorders shows either normal density or axonal fiber loss without inflammatory infiltrates. A reversible neural hyperexcitable mechanism is considered to be the cause of this painful polyneuropathy. Muscle Nerve 55: 520-525, 2017. © 2016 Wiley Periodicals, Inc.

The value of LGI1, Caspr2 and voltage-gated potassium channel antibodies in encephalitis.

Science.gov (United States)

van Sonderen, Agnes; Petit-Pedrol, Mar; Dalmau, Josep; Titulaer, Maarten J

2017-05-01

The discovery, in 2010, of autoantibodies against the extracellular proteins LGI1 and Caspr2 facilitated a change of view regarding the clinical importance of voltage-gated potassium channel (VGKC) antibodies. Currently, these antibodies are all classified as VGKC-complex antibodies, and are commonly considered to have a similar clinical value. However, studies from the past few years show that the immune responses mediated by these antibodies have differing clinical relevance. Here, we review the clinical importance of these immune responses in three settings: patients with anti-LGI1 antibodies, patients with anti-Caspr2 antibodies, and patients with antibodies against the VGKC complex that lack LGI1 and Caspr2 specificity. Antibodies against LGI1 and Caspr2 are associated with different but well-defined syndromes, whereas the clinical importance of VGKC-complex antibodies without LGI1 and Caspr2 specificity is questionable. We describe each of these syndromes, discuss the function of the target antigens and review the limited paediatric literature on the topic. The findings emphasize the importance of defining these disorders according to the molecular identity of the targets (LGI1 or Caspr2), and caution against the use of VGKC-complex antibodies for the diagnosis and treatment of patients without further definition of the antigen.

High-resolution orientation and depth of insertion of the voltage-sensing S4 helix of a potassium channel in lipid bilayers.

Science.gov (United States)

Doherty, Tim; Su, Yongchao; Hong, Mei

2010-08-27

The opening and closing of voltage-gated potassium (Kv) channels are controlled by several conserved Arg residues in the S4 helix of the voltage-sensing domain. The interaction of these positively charged Arg residues with the lipid membrane has been of intense interest for understanding how membrane proteins fold to allow charged residues to insert into lipid bilayers against free-energy barriers. Using solid-state NMR, we have now determined the orientation and insertion depth of the S4 peptide of the KvAP channel in lipid bilayers. Two-dimensional (15)N correlation experiments of macroscopically oriented S4 peptide in phospholipid bilayers revealed a tilt angle of 40 degrees and two possible rotation angles differing by 180 degrees around the helix axis. Remarkably, the tilt angle and one of the two rotation angles are identical to those of the S4 helix in the intact voltage-sensing domain, suggesting that interactions between the S4 segment and other helices of the voltage-sensing domain are not essential for the membrane topology of the S4 helix. (13)C-(31)P distances between the S4 backbone and the lipid (31)P indicate a approximately 9 A local thinning and 2 A average thinning of the DMPC (1,2-dimyristoyl-sn-glycero-3-phosphochloline)/DMPG (1,2-dimyristoyl-sn-glycero-3-phosphatidylglycerol) bilayer, consistent with neutron diffraction data. Moreover, a short distance of 4.6 A from the guanidinium C(zeta) of the second Arg to (31)P indicates the existence of guanidinium phosphate hydrogen bonding and salt bridges. These data suggest that the structure of the Kv gating helix is mainly determined by protein-lipid interactions instead of interhelical protein-protein interactions, and the S4 amino acid sequence encodes sufficient information for the membrane topology of this crucial gating helix. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Inward rectifier potassium (Kir2.1) channels as end-stage boosters of endothelium-dependent vasodilators.

Science.gov (United States)

Sonkusare, Swapnil K; Dalsgaard, Thomas; Bonev, Adrian D; Nelson, Mark T

2016-06-15

Increase in endothelial cell (EC) calcium activates calcium-sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium-dependent vasodilatation. Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium-dependent vasodilatation is not clear. In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform. Endothelium-dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown. These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Endothelium-dependent vasodilators, such as acetylcholine, increase intracellular Ca(2+) through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca(2+) -sensitive intermediate and small conductance K(+) (IK and SK, respectively) channels. Although strong inward rectifier K(+) (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC-dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC-dependent vasodilatation of resistance-sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC-specific Kir2.1 knockdown (EC-Kir2.1(-/-) ) mice. Elevation of extracellular K(+) to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial denudation and Kir channel

Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

Science.gov (United States)

Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

2010-01-01

In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

DEFF Research Database (Denmark)

Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

2002-01-01

The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

Directory of Open Access Journals (Sweden)

Mohamad Khairul Anuar

2017-01-01

Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles

DEFF Research Database (Denmark)

Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L

2011-01-01

Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...

Cloning and functional expression of a plant voltage-dependent chloride channel.

Science.gov (United States)

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

Field effects in graphene in an interface contact with aqueous solutions of acetic acid and potassium hydroxide

Science.gov (United States)

Butko, A. V.; Butko, V. Yu.; Lebedev, S. P.; Lebedev, A. A.; Kumzerov, Yu. A.

2017-10-01

For the creation of new promising chemical sensors, it is very important to study the influence of the interface between graphene and aqueous solutions of acids and alkalis on the transistor characteristics of graphene. Transistor structures on the basis of graphene grown by thermal decomposition of silicon carbide were created and studied. For the interface of graphene with aqueous solutions of acetic acid and potassium hydroxide in the transistor geometry, with a variation in the gate-to-source voltage, the field effect corresponding to the hole type of charge carriers in graphene was observed. It is established that an increase in the concentration of molecular ions in these solutions leads to an increase in the dependence of the resistance of the transistor on the gate voltage.

Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

DEFF Research Database (Denmark)

Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

2001-01-01

The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

OpenAIRE

Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

2013-01-01

In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

Science.gov (United States)

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

Modeling the concentration-dependent permeation modes of the KcsA potassium ion channel.

Science.gov (United States)

Nelson, Peter Hugo

2003-12-01

The potassium channel from Streptomyces lividans (KcsA) is an integral membrane protein with sequence similarity to all known potassium channels, particularly in the selectivity filter region. A recently proposed model for ion channels containing either n or (n-1) single-file ions in their selectivity filters [P. H. Nelson, J. Chem. Phys. 177, 11396 (2002)] is applied to published KcsA channel K+ permeation data that exhibit a high-affinity process at low concentrations and a low-affinity process at high concentrations [M. LeMasurier et al., J. Gen. Physiol. 118, 303 (2001)]. The kinetic model is shown to provide a reasonable first-order explanation for both the high- and low-concentration permeation modes observed experimentally. The low-concentration mode ([K+]200 mM) has a 200-mV dissociation constant of 1100 mM and a conductance of 500 pS. Based on the permeation model, and x-ray analysis [J. H. Morais-Cabral et al., Nature (London) 414, 37 (2001)], it is suggested that the experimentally observed K+ permeation modes correspond to an n=3 mechanism at high concentrations and an n=2 mechanism at low concentrations. The ratio of the electrical dissociation distances for the high- and low-concentration modes is 3:2, also consistent with the proposed n=3 and n=2 modes. Model predictions for K+ channels that exhibit asymmetric current-voltage (I-V) curves are presented, and further validation of the kinetic model via molecular simulation and experiment is discussed. The qualitatively distinct I-V characteristics exhibited experimentally by Tl+, NH+4, and Rb+ ions at 100 mM concentration can also be explained using the model, but more extensive experimental tests are required for quantitative validation of the model predictions.

The orientation and molecular movement of a k(+) channel voltage-sensing domain.

Science.gov (United States)

Gandhi, Chris S; Clark, Eliana; Loots, Eli; Pralle, Arnd; Isacoff, Ehud Y

2003-10-30

Voltage-gated channels operate through the action of a voltage-sensing domain (membrane segments S1-S4) that controls the conformation of gates located in the pore domain (membrane segments S5-S6). Recent structural studies on the bacterial K(v)AP potassium channel have led to a new model of voltage sensing in which S4 lies in the lipid at the channel periphery and moves through the membrane as a unit with a portion of S3. Here we describe accessibility probing and disulfide scanning experiments aimed at determining how well the K(v)AP model describes the Drosophila Shaker potassium channel. We find that the S1-S3 helices have one end that is externally exposed, S3 does not undergo a transmembrane motion, and S4 lies in close apposition to the pore domain in the resting and activated state.

Transport properties of a potassium-doped single-wall carbon nanotube rope

International Nuclear Information System (INIS)

Lee, R. S.; Kim, H. J.; Fischer, J. E.; Lefebvre, J.; Radosavljevic, M.; Hone, J.; Johnson, A. T.

2000-01-01

Four-probe resistance vs temperature and gate voltage are reported for an individual single-wall carbon nanotube rope before and after doping in situ with potassium. All the features in R(T) from unoriented bulk material, before and after doping, are qualitatively reproduced by the rope data. The 5.3 K conductance of the pristine rope decreases with positive gate voltage, while G vs V g becomes featureless after K doping. (c) 2000 The American Physical Society

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

Shaping charge excitations in chiral edge states with a time-dependent gate voltage

Science.gov (United States)

Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

2018-02-01

We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

The Arabidopsis guard cell outward potassium channel GORK is regulated by CPK33.

Science.gov (United States)

Corratgé-Faillie, Claire; Ronzier, Elsa; Sanchez, Frédéric; Prado, Karine; Kim, Jeong-Hyeon; Lanciano, Sophie; Leonhardt, Nathalie; Lacombe, Benoît; Xiong, Tou Cheu

2017-07-01

A complex signaling network involving voltage-gated potassium channels from the Shaker family contributes to the regulation of stomatal aperture. Several kinases and phosphatases have been shown to be crucial for ABA-dependent regulation of the ion transporters. To date, the Ca 2+ -dependent regulation of Shaker channels by Ca 2+ -dependent protein kinases (CPKs) is still elusive. A functional screen in Xenopus oocytes was launched to identify such CPKs able to regulate the three main guard cell Shaker channels KAT1, KAT2, and GORK. Seven guard cell CPKs were tested and multiple CPK/Shaker couples were identified. Further work on CPK33 indicates that GORK activity is enhanced by CPK33 and unaffected by a nonfunctional CPK33 (CPK33-K102M). Furthermore, Ca 2+ -induced stomatal closure is impaired in two cpk33 mutant plants. © 2017 Federation of European Biochemical Societies.

Modulation of voltage-gated channel currents by harmaline and harmane.

Science.gov (United States)

Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

2005-01-01

Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

Directory of Open Access Journals (Sweden)

Mesbahus Saleheen

2016-05-01

Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

PKC and AMPK regulation of Kv1.5 potassium channels

DEFF Research Database (Denmark)

Andersen, Martin Nybo; Skibsbye, Lasse; Tang, Chuyi

2015-01-01

The voltage-gated Kv1.5 potassium channel, conducting the ultra-rapid rectifier K(+) current (IKur), is regulated through several pathways. Here we investigate if Kv1.5 surface expression is controlled by the 2 kinases PKC and AMPK, using Xenopus oocytes, MDCK cells and atrial derived HL-1 cells....

Effects of allocryptopine on outward potassium current and slow delayed rectifier potassium current in rabbit myocardium.

Science.gov (United States)

Fu, Yi-Cheng; Zhang, Yu; Tian, Liu-Yang; Li, Nan; Chen, Xi; Cai, Zhong-Qi; Zhu, Chao; Li, Yang

2016-05-01

Allocryptopine (ALL) is an effective alkaloid of Corydalis decumbens (Thunb.) Pers. Papaveraceae and has proved to be anti-arrhythmic. The purpose of our study is to investigate the effects of ALL on transmural repolarizing ionic ingredients of outward potassium current (I to) and slow delayed rectifier potassium current (I Ks). The monophasic action potential (MAP) technique was used to record the MAP duration of the epicardium (Epi), myocardium (M) and endocardium (Endo) of the rabbit heart and the whole cell patch clamp was used to record I to and I Ks in cardiomyocytes of Epi, M and Endo layers that were isolated from rabbit ventricles. The effects of ALL on MAP of Epi, M and Endo layers were disequilibrium. ALL could effectively reduce the transmural dispersion of repolarization (TDR) in rabbit transmural ventricular wall. ALL decreased the current densities of I to and I Ks in a voltage and concentration dependent way and narrowed the repolarizing differences among three layers. The analysis of gating kinetics showed ALL accelerated the channel activation of I to in M layers and partly inhibit the channel openings of I to in Epi, M and Endo cells. On the other hand, ALL mainly slowed channel deactivation of I Ks channel in Epi and Endo layers without affecting its activation. Our study gives partially explanation about the mechanisms of transmural inhibition of I to and I Ks channels by ALL in rabbit myocardium. These findings provide novel perspective regarding the anti-arrhythmogenesis application of ALL in clinical settings.

Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

International Nuclear Information System (INIS)

Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

2009-01-01

Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel.

Science.gov (United States)

Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu

2007-12-28

Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.

Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

Directory of Open Access Journals (Sweden)

Wei Xia

2015-01-01

Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

Identification of an evolutionarily conserved extracellular threonine residue critical for surface expression and its potential coupling of adjacent voltage-sensing and gating domains in voltage-gated potassium channels.

Science.gov (United States)

Mckeown, Lynn; Burnham, Matthew P; Hodson, Charlotte; Jones, Owen T

2008-10-31

The dynamic expression of voltage-gated potassium channels (Kvs) at the cell surface is a fundamental factor controlling membrane excitability. In exploring possible mechanisms controlling Kv surface expression, we identified a region in the extracellular linker between the first and second of the six (S1-S6) transmembrane-spanning domains of the Kv1.4 channel, which we hypothesized to be critical for its biogenesis. Using immunofluorescence microscopy, flow cytometry, patch clamp electrophysiology, and mutagenesis, we identified a single threonine residue at position 330 within the Kv1.4 S1-S2 linker that is absolutely required for cell surface expression. Mutation of Thr-330 to an alanine, aspartate, or lysine prevented surface expression. However, surface expression occurred upon co-expression of mutant and wild type Kv1.4 subunits or mutation of Thr-330 to a serine. Mutation of the corresponding residue (Thr-211) in Kv3.1 to alanine also caused intracellular retention, suggesting that the conserved threonine plays a generalized role in surface expression. In support of this idea, sequence comparisons showed conservation of the critical threonine in all Kv families and in organisms across the evolutionary spectrum. Based upon the Kv1.2 crystal structure, further mutagenesis, and the partial restoration of surface expression in an electrostatic T330K bridging mutant, we suggest that Thr-330 hydrogen bonds to equally conserved outer pore residues, which may include a glutamate at position 502 that is also critical for surface expression. We propose that Thr-330 serves to interlock the voltage-sensing and gating domains of adjacent monomers, thereby yielding a structure competent for the surface expression of functional tetramers.

The Voltage-Gated Potassium Channel Subfamily KQT Member 4 (KCNQ4) Displays Parallel Evolution in Echolocating Bats

Science.gov (United States)

Liu, Yang; Han, Naijian; Franchini, Lucía F.; Xu, Huihui; Pisciottano, Francisco; Elgoyhen, Ana Belén; Rajan, Koilmani Emmanuvel; Zhang, Shuyi

2012-01-01

Bats are the only mammals that use highly developed laryngeal echolocation, a sensory mechanism based on the ability to emit laryngeal sounds and interpret the returning echoes to identify objects. Although this capability allows bats to orientate and hunt in complete darkness, endowing them with great survival advantages, the genetic bases underlying the evolution of bat echolocation are still largely unknown. Echolocation requires high-frequency hearing that in mammals is largely dependent on somatic electromotility of outer hair cells. Then, understanding the molecular evolution of outer hair cell genes might help to unravel the evolutionary history of echolocation. In this work, we analyzed the molecular evolution of two key outer hair cell genes: the voltage-gated potassium channel gene KCNQ4 and CHRNA10, the gene encoding the α10 nicotinic acetylcholine receptor subunit. We reconstructed the phylogeny of bats based on KCNQ4 and CHRNA10 protein and nucleotide sequences. A phylogenetic tree built using KCNQ4 amino acid sequences showed that two paraphyletic clades of laryngeal echolocating bats grouped together, with eight shared substitutions among particular lineages. In addition, our analyses indicated that two of these parallel substitutions, M388I and P406S, were probably fixed under positive selection and could have had a strong functional impact on KCNQ4. Moreover, our results indicated that KCNQ4 evolved under positive selection in the ancestral lineage leading to mammals, suggesting that this gene might have been important for the evolution of mammalian hearing. On the other hand, we found that CHRNA10, a gene that evolved adaptively in the mammalian lineage, was under strong purifying selection in bats. Thus, the CHRNA10 amino acid tree did not show echolocating bat monophyly and reproduced the bat species tree. These results suggest that only a subset of hearing genes could underlie the evolution of echolocation. The present work continues to

Investigation of iodine liberation process in redox titration of potassium iodate with sodium thiosulfate

International Nuclear Information System (INIS)

Asakai, Toshiaki; Hioki, Akiharu

2011-01-01

Potassium iodate is often used as a reference material to standardize a sodium thiosulfate solution which is a familiar titrant for redox titrations. In the standardization, iodine (triiodide) liberated by potassium iodate in an acidic potassium iodide solution is titrated with a sodium thiosulfate solution. The iodine liberation process is significantly affected by the amount of acid, that of potassium iodide added, the waiting time for the liberation, and light; therefore, the process plays a key role for the accuracy of the titration results. Constant-voltage biamperometry with a modified dual platinum-chip electrode was utilized to monitor the amount of liberated iodine under several liberation conditions. Coulometric titration was utilized to determine the concentration of a sodium thiosulfate solution on an absolute basis. Potassium iodate was assayed by gravimetric titration with the sodium thiosulfate solution under several iodine liberation conditions. The liberation process was discussed from the changes in the apparent assay of potassium iodate. The information of the appropriate titration procedure obtained in the present study is useful for any analysts utilizing potassium iodate to standardize a thiosulfate solution.

Investigation of iodine liberation process in redox titration of potassium iodate with sodium thiosulfate

Energy Technology Data Exchange (ETDEWEB)

Asakai, Toshiaki, E-mail: t-asakai@aist.go.jp [National Metrology Institute of Japan (NMIJ), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 3-9, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8563 (Japan); Hioki, Akiharu [National Metrology Institute of Japan (NMIJ), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 3-9, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8563 (Japan)

2011-03-09

Potassium iodate is often used as a reference material to standardize a sodium thiosulfate solution which is a familiar titrant for redox titrations. In the standardization, iodine (triiodide) liberated by potassium iodate in an acidic potassium iodide solution is titrated with a sodium thiosulfate solution. The iodine liberation process is significantly affected by the amount of acid, that of potassium iodide added, the waiting time for the liberation, and light; therefore, the process plays a key role for the accuracy of the titration results. Constant-voltage biamperometry with a modified dual platinum-chip electrode was utilized to monitor the amount of liberated iodine under several liberation conditions. Coulometric titration was utilized to determine the concentration of a sodium thiosulfate solution on an absolute basis. Potassium iodate was assayed by gravimetric titration with the sodium thiosulfate solution under several iodine liberation conditions. The liberation process was discussed from the changes in the apparent assay of potassium iodate. The information of the appropriate titration procedure obtained in the present study is useful for any analysts utilizing potassium iodate to standardize a thiosulfate solution.

Pharmacological Conversion of a Cardiac Inward Rectifier into an Outward Rectifier Potassium Channel.

Science.gov (United States)

Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A

2016-09-01

Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

Voltage-gated potassium channel-associated limbic encephalitis in the West of Scotland: case reports and literature review.

Science.gov (United States)

Reid, J M; Foley, P; Willison, H J

2009-11-01

The syndrome of limbic encephalitis (LE) associated with antibodies against voltage-gated potassium channels (VGKC-LE) has recently been described. The number of published cases is however small. We therefore aimed to review all cases seen at our centre and compare with published cases. Retrospective cases of VGKC-LE were identified using a questionnaire to Neurologists at the Southern General hospital, Glasgow, and by reviewing patients with a positive VGKC antibody test (2002-2007). Case-note review of identified cases and a literature review of all published cases of VGKC-LE were performed. Seven cases were identified (four female, age range 51-81). Patients presented sub-acutely with seizures and anterograde memory loss. Five patients had medial temporal lobe change on cranial imaging. No paraneoplastic cases were identified. 5/7 patients made some improvement with immunotherapy. In 2006, 3/18 (17%) patients with a coded discharge of encephalitis were diagnosed with VGKC-LE. The literature review revealed 40 patients with VGKC-LE. Age, gender or VGKC level did not predict likelihood for a significant recovery. Patients treated VGKC-LE is being increasingly diagnosed and is best identified early and treated with immunotherapy to offer the greatest chance of recovery. This series and literature review expands the current published evidence in VGKC-LE.

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

Science.gov (United States)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

Moderate hypoxia influences potassium outward currents in adipose-derived stem cells.

Directory of Open Access Journals (Sweden)

Mayuri Prasad

Full Text Available Moderate hypoxic preconditioning of adipose-derived stem cells (ASCs enhances properties such as proliferation and secretion of growth factors, representing a valuable strategy to increase the efficiency of cell-based therapies. In a wide variety of cells potassium (K+ channels are key elements involved in the cellular responses to hypoxia, suggesting that ASCs cultured under low oxygen conditions may display altered electrophysiological properties. Here, the effects of moderate hypoxic culture on proliferation, whole-cell currents, and ion channel expression were investigated using human ASCs cultured at 5% and 20% oxygen. Although cell proliferation was greatly enhanced, the dose-dependent growth inhibition by the K+ channel blocker tetraethylammonium (TEA was not significantly affected by hypoxia. Under both normoxic and hypoxic conditions, ASCs displayed outward K+ currents composed by Ca2+-activated, delayed rectifier, and transient components. Hypoxic culture reduced the slope of the current-voltage curves and caused a negative shift in the voltage activation threshold of the whole-cell currents. However, the TEA-mediated shift of voltage activation threshold was not affected by hypoxia. Semiquantitative real-time RT-PCR revealed that expression of genes encoding for various ion channels subunits related to oxygen sensing and proliferation remained unchanged after hypoxic culture. In conclusion, outward currents are influenced by moderate hypoxia in ASCs through a mechanism that is not likely the result of modulation of TEA-sensitive K+ channels.

Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features.

Science.gov (United States)

Kasimova, M A; Granata, D; Carnevale, V

2016-01-01

Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.

EEG Differences in Two Clinically Similar Rapid Dementias: Voltage-Gated Potassium Channel Complex-Associated Autoimmune Encephalitis and Creutzfeldt-Jakob Disease.

Science.gov (United States)

Freund, Brin; Probasco, John C; Cervenka, Mackenzie C; Sutter, Raoul; Kaplan, Peter W

2018-05-01

Distinguishing treatable causes for rapidly progressive dementia from those that are incurable is vital. Creutzfeldt-Jakob disease (CJD) and voltage-gated potassium channel complex-associated autoimmune encephalitis (VGKC AE) are 2 such conditions with disparate outcomes and response to treatment. To determine the differences in electroencephalography between CJD and VGKC AE, we performed a retrospective review of medical records and examined clinical data, neuroimaging, and electroencephalographs performed in patients admitted for evaluation for rapidly progressive dementia diagnosed with CJD and VGKC AE at the Johns Hopkins Hospital and Bayview Medical Center between January 1, 2007 and December 31, 2015. More patients in the VGKC AE group had seizures (12/17) than those with CJD (3/14; P = .008). Serum sodium levels were lower in those with VGKC AE ( P = .001). Cerebrospinal fluid (CSF) white blood cell count was higher in VGKC AE ( P = .008). CSF protein 14-3-3 ( P = .018) was more commonly detected in CJD, and tau levels were higher in those with CJD ( P VGKC AE, and electroencephalography can aid in their diagnoses. Performing serial EEGs better delineates these conditions.

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

Distinct white matter integrity in glutamic acid decarboxylase and voltage-gated potassium channel-complex antibody-associated limbic encephalitis.

Science.gov (United States)

Wagner, Jan; Schoene-Bake, Jan-Christoph; Witt, Juri-Alexander; Helmstaedter, Christoph; Malter, Michael P; Stoecker, Winfried; Probst, Christian; Weber, Bernd; Elger, Christian E

2016-03-01

Autoantibodies against glutamic acid decarboxylase (GAD) and the voltage-gated potassium channel (VGKC) complex are associated with distinct subtypes of limbic encephalitis regarding clinical presentation, response to therapy, and outcome. The aim of this study was to investigate white matter changes in these two limbic encephalitis subtypes by means of diffusion tensor imaging (DTI). Diffusion data were obtained in 14 patients with GAD antibodies and 16 patients with VGKC-complex antibodies and compared with age- and gender-matched control groups. Voxelwise statistical analysis was carried out using tract-based spatial statistics. The results were furthermore compared with those of 15 patients with unilateral histologically confirmed hippocampal sclerosis and correlated with verbal and figural memory performance. We found widespread changes of fractional anisotropy and all diffusivity parameters in GAD-associated limbic encephalitis, whereas no changes were found in VGKC-complex-associated limbic encephalitis. The changes observed in the GAD group were even more extensive when compared against those of the hippocampal sclerosis group, although the disease duration was markedly shorter in patients with GAD antibodies. Correlation analysis revealed areas with a trend toward a negative correlation of diffusivity parameters with figural memory performance located mainly in the right temporal lobe in the GAD group as well. The present study provides further evidence that, depending on the associated antibody, limbic encephalitis features clearly distinct imaging characteristics by showing widespread white matter changes in GAD-associated limbic encephalitis and preserved white matter integrity in VGKC-complex-associated limbic encephalitis. Furthermore, our results contribute to a better understanding of the specific pathophysiologic properties in these two subforms of limbic encephalitis by revealing that patients with GAD antibodies show widespread affections of

Suspected limbic encephalitis and seizure in cats associated with voltage-gated potassium channel (VGKC) complex antibody.

Science.gov (United States)

Pakozdy, A; Halasz, P; Klang, A; Bauer, J; Leschnik, M; Tichy, A; Thalhammer, J G; Lang, B; Vincent, A

2013-01-01

Treatment-resistant complex partial seizures (CPS) with orofacial involvement recently were reported in cats in association with hippocampal pathology. The features had some similarity to those described in humans with limbic encephalitis and voltage-gated potassium channel (VGKC) complex antibody. The purpose of this pilot study was to evaluate cats with CPS and orofacial involvement for the presence of VGKC-complex antibody. Client-owned cats with acute orofacial CPS and control cats were investigated. Prospective study. Serum was collected from 14 cats in the acute stage of the disease and compared with 19 controls. VGKC-complex antibodies were determined by routine immunoprecipitation and by binding to leucine-rich glioma inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2), the 2 main targets of VGKC-complex antibodies in humans. Five of the 14 affected cats, but none of the 19 controls, had VGKC-complex antibody concentrations above the cut-off concentration (>100 pmol/L) based on control samples and similar to those found in humans. Antibodies in 4 cats were directed against LGI1, and none were directed against CASPR2. Follow-up sera were available for 5 cats in remission and all antibody concentrations were within the reference range. Our study suggests that an autoimmune limbic encephalitis exists in cats and that VGKC-complex/LGI1 antibodies may play a role in this disorder, as they are thought to in humans. Copyright © 2012 by the American College of Veterinary Internal Medicine.

Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

Energy Technology Data Exchange (ETDEWEB)

Arora, N D

1987-05-01

A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

Mutation in the kv3.3 voltage-gated potassium channel causing spinocerebellar ataxia 13 disrupts sound-localization mechanisms.

Directory of Open Access Journals (Sweden)

John C Middlebrooks

Full Text Available Normal sound localization requires precise comparisons of sound timing and pressure levels between the two ears. The primary localization cues are interaural time differences, ITD, and interaural level differences, ILD. Voltage-gated potassium channels, including Kv3.3, are highly expressed in the auditory brainstem and are thought to underlie the exquisite temporal precision and rapid spike rates that characterize brainstem binaural pathways. An autosomal dominant mutation in the gene encoding Kv3.3 has been demonstrated in a large Filipino kindred manifesting as spinocerebellar ataxia type 13 (SCA13. This kindred provides a rare opportunity to test in vivo the importance of a specific channel subunit for human hearing. Here, we demonstrate psychophysically that individuals with the mutant allele exhibit profound deficits in both ITD and ILD sensitivity, despite showing no obvious impairment in pure-tone sensitivity with either ear. Surprisingly, several individuals exhibited the auditory deficits even though they were pre-symptomatic for SCA13. We would expect that impairments of binaural processing as great as those observed in this family would result in prominent deficits in localization of sound sources and in loss of the "spatial release from masking" that aids in understanding speech in the presence of competing sounds.

Voltage-sensing domain of voltage-gated proton channel Hv1 shares mechanism of block with pore domains.

Science.gov (United States)

Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco

2013-01-23

Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.

Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

Science.gov (United States)

Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

2014-01-01

The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

Ancient Systems of Sodium/Potassium Homeostasis as Predecessors of Membrane Bioenergetics.

Science.gov (United States)

Dibrova, D V; Galperin, M Y; Koonin, E V; Mulkidjanian, A Y

2015-05-01

Cell cytoplasm of archaea, bacteria, and eukaryotes contains substantially more potassium than sodium, and potassium cations are specifically required for many key cellular processes, including protein synthesis. This distinct ionic composition and requirements have been attributed to the emergence of the first cells in potassium-rich habitats. Different, albeit complementary, scenarios have been proposed for the primordial potassium-rich environments based on experimental data and theoretical considerations. Specifically, building on the observation that potassium prevails over sodium in the vapor of inland geothermal systems, we have argued that the first cells could emerge in the pools and puddles at the periphery of primordial anoxic geothermal fields, where the elementary composition of the condensed vapor would resemble the internal milieu of modern cells. Marine and freshwater environments generally contain more sodium than potassium. Therefore, to invade such environments, while maintaining excess of potassium over sodium in the cytoplasm, primordial cells needed means to extrude sodium ions. The foray into new, sodium-rich habitats was the likely driving force behind the evolution of diverse redox-, light-, chemically-, or osmotically-dependent sodium export pumps and the increase of membrane tightness. Here we present a scenario that details how the interplay between several, initially independent sodium pumps might have triggered the evolution of sodium-dependent membrane bioenergetics, followed by the separate emergence of the proton-dependent bioenergetics in archaea and bacteria. We also discuss the development of systems that utilize the sodium/potassium gradient across the cell membranes.

The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

Directory of Open Access Journals (Sweden)

Ting-Feng Lin

Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

DEFF Research Database (Denmark)

Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

2016-01-01

This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

Pharmacological dissection of K(v)7.1 channels in systemic and pulmonary arteries

DEFF Research Database (Denmark)

Chadha, Preet S; Zunke, Friederike; Davis, Alison J

2012-01-01

The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature.......The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature....

Serum Starvation-Induced Voltage-Gated Potassium Channel Kv7.5 Expression and Its Regulation by Sp1 in Canine Osteosarcoma Cells

Directory of Open Access Journals (Sweden)

Bo Hyung Lee

2014-01-01

Full Text Available The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy.

Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

International Nuclear Information System (INIS)

Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

2008-01-01

Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Data on electrical properties of nickel modified potassium polytitanates compacted powders.

Science.gov (United States)

Goffman, V G; Gorokhovsky, A V; Gorshkov, N V; Fedorov, F S; Tretychenko, E V; Sevrugin, A V

2015-09-01

Potassium polytitanates are new promising type of ferroelectric ceramic materials with high ionic conductivity, highly polarizable structure and extremely high permittivity. Its structure is formed by [TiO6] octahedral units to layers with mobile potassium and hydroxonium ions in-between. The treatment in solutions containing nickel ions allows forming heterostructured materials which consist of potassium polytitanate particles intercalated by Ni(2+) ions and/or decorated by nickel oxides NiO x . This modification route is fully dependant on solution pH, i.e. in acidic solutions the intercalation process prevails, in alkaline solutions potassium polytitanate is mostly decorated by the oxides. Therefore, electronic structure and electrical properties can be regulated depending on modification conditions, pH and ions concentration. Here we report the data on electric properties of potassium titanate modified in nickel sulfate solutions at different pH.

Data on electrical properties of nickel modified potassium polytitanates compacted powders

Directory of Open Access Journals (Sweden)

V.G. Goffman

2015-09-01

Full Text Available Potassium polytitanates are new promising type of ferroelectric ceramic materials with high ionic conductivity, highly polarizable structure and extremely high permittivity. Its structure is formed by [TiO6] octahedral units to layers with mobile potassium and hydroxonium ions in-between. The treatment in solutions containing nickel ions allows forming heterostructured materials which consist of potassium polytitanate particles intercalated by Ni2+ ions and/or decorated by nickel oxides NiOx. This modification route is fully dependant on solution pH, i.e. in acidic solutions the intercalation process prevails, in alkaline solutions potassium polytitanate is mostly decorated by the oxides. Therefore, electronic structure and electrical properties can be regulated depending on modification conditions, pH and ions concentration. Here we report the data on electric properties of potassium titanate modified in nickel sulfate solutions at different pH.

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

International Nuclear Information System (INIS)

Miah, M. Idrish

2008-01-01

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

Inward rectifier potassium (Kir2.1) channels as end‐stage boosters of endothelium‐dependent vasodilators

Science.gov (United States)

Dalsgaard, Thomas; Bonev, Adrian D.; Nelson, Mark T.

2016-01-01

Key points Increase in endothelial cell (EC) calcium activates calcium‐sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium‐dependent vasodilatation.Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium‐dependent vasodilatation is not clear.In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform.Endothelium‐dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown.These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Abstract Endothelium‐dependent vasodilators, such as acetylcholine, increase intracellular Ca2+ through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca2+‐sensitive intermediate and small conductance K+ (IK and SK, respectively) channels. Although strong inward rectifier K+ (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC‐dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC‐dependent vasodilatation of resistance‐sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC‐specific Kir2.1 knockdown (EC‐Kir2.1 −/−) mice. Elevation of extracellular K+ to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial

Molecular interactions involved in proton-dependent gating in KcsA potassium channels

Science.gov (United States)

Posson, David J.; Thompson, Ameer N.; McCoy, Jason G.

2013-01-01

The bacterial potassium channel KcsA is gated open by the binding of protons to amino acids on the intracellular side of the channel. We have identified, via channel mutagenesis and x-ray crystallography, two pH-sensing amino acids and a set of nearby residues involved in molecular interactions that influence gating. We found that the minimal mutation of one histidine (H25) and one glutamate (E118) near the cytoplasmic gate completely abolished pH-dependent gating. Mutation of nearby residues either alone or in pairs altered the channel’s response to pH. In addition, mutations of certain pairs of residues dramatically increased the energy barriers between the closed and open states. We proposed a Monod–Wyman–Changeux model for proton binding and pH-dependent gating in KcsA, where H25 is a “strong” sensor displaying a large shift in pKa between closed and open states, and E118 is a “weak” pH sensor. Modifying model parameters that are involved in either the intrinsic gating equilibrium or the pKa values of the pH-sensing residues was sufficient to capture the effects of all mutations. PMID:24218397

Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

DEFF Research Database (Denmark)

Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

2006-01-01

Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

OpenAIRE

Dharia, Sameera; Rabbitt, Richard D.

2011-01-01

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

Molecular mechanism of voltage sensing in voltage-gated proton channels

Science.gov (United States)

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Electrolytic coloration and spectral properties of hydroxyl-doped potassium chloride single crystals

International Nuclear Information System (INIS)

Gu Hongen; Wu Yanru

2011-01-01

Hydroxyl-doped potassium chloride single crystals are colored electrolytically at various temperatures and voltages using a pointed cathode and a flat anode. Characteristic OH - spectral band is observed in the absorption spectrum of uncolored single crystal. Characteristic O - , OH - , U, V 2 , V 3 , O 2- -V a + , F, R 2 and M spectral bands are observed simultaneously in absorption spectra of colored single crystals. Current-time curve for electrolytic coloration of hydroxyl-doped potassium chloride single crystal and its relationship with electrolytic coloration process are given. Production and conversion of color centers are explained. - Highlights: → Expanded the traditional electrolysis method. → Hydroxyl-doped potassium chloride crystals were colored electrolytically for the first time. → Useful V, F and F-aggregate color centers were produced in colored crystals. → V color centers were produced directly and F and F-aggregate color centers indirectly.

Dependence of radiocaesium biological half-life in freshwater fish on water potassium concentration and temperature

International Nuclear Information System (INIS)

Carreiro, M.C.V.; Corisco, J.A.G.

1998-01-01

Short-term experiments (35-49 days) showed that the rate of cesium elimination from fish increases with increasing potassium concentration in water (the biological half-life decreases); this, however, is only true of the potassium concentration range of 0.35 to 3.5 ppm, whereas higher potassium concentrations do not seem to affect the elimination rate. Decrease in water temperature within the 20 degC to 5 degC range slows down the cesium elimination process. (P.A.)

Mechanism of inhibition of mouse Slo3 (KCa 5.1) potassium channels by quinine, quinidine and barium.

Science.gov (United States)

Wrighton, David C; Muench, Stephen P; Lippiat, Jonathan D

2015-09-01

The Slo3 (KCa 5.1) channel is a major component of mammalian KSper (sperm potassium conductance) channels and inhibition of these channels by quinine and barium alters sperm motility. The aim of this investigation was to determine the mechanism by which these drugs inhibit Slo3 channels. Mouse (m) Slo3 (KCa 5.1) channels or mutant forms were expressed in Xenopus oocytes and currents recorded with 2-electrode voltage-clamp. Gain-of-function mSlo3 mutations were used to explore the state-dependence of the inhibition. The interaction between quinidine and mSlo3 channels was modelled by in silico docking. Several drugs known to block KSper also affected mSlo3 channels with similar levels of inhibition. The inhibition induced by extracellular barium was prevented by increasing the extracellular potassium concentration. R196Q and F304Y mutations in the mSlo3 voltage sensor and pore, respectively, both increased channel activity. The F304Y mutation did not alter the effects of barium, but increased the potency of inhibition by both quinine and quinidine approximately 10-fold; this effect was not observed with the R196Q mutation. Block of mSlo3 channels by quinine, quinidine and barium is not state-dependent. Barium inhibits mSlo3 outside the cell by interacting with the selectivity filter, whereas quinine and quinidine act from the inside, by binding in a hydrophobic pocket formed by the S6 segment of each subunit. Furthermore, we propose that the Slo3 channel activation gate lies deep within the pore between F304 in the S6 segment and the selectivity filter. © 2015 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

Energy Technology Data Exchange (ETDEWEB)

Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

2008-10-15

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

Science.gov (United States)

Shirokov, Roman E.

2018-01-01

Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

Voltage gated potassium channels expressed in Xenopus laevis(AMPHIBIA oocytes

Directory of Open Access Journals (Sweden)

Hedna Chaves

2003-01-01

Full Text Available Heterologous expression has been an important tool for structural and functionalcharacterization of proteins. The study of biophysical properties of ion channels,pumps and transporters has been possible thanks to their expression in Xenopuslaevisoocytes. Here we report the expression of two voltage gated channels, Kv1.1and Shaker, in X. laevisoocytes using a method for oocyte extraction, isolation, cul-ture, and microinjection adapted to the latitude and altitude conditions of Bogotá,Colombia.

Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies.

Science.gov (United States)

Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick; Irani, Sarosh R

2017-04-01

Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, the target(s) and clinical associations of double-negative antibodies need to be determined. Sera (n=1131) from several clinically defined cohorts were tested for IgG radioimmunoprecipitation of radioiodinated α-dendrotoxin ( 125 I-αDTX)-labelled VGKC complexes from mammalian brain extracts. Positive samples were systematically tested for live hippocampal neuron reactivity, IgG precipitation of 125 I-αDTX and 125 I-αDTX-labelled Kv1 subunits, and by cell-based assays which expressed Kv1 subunits, LGI1 and CASPR2. VGKC complex antibodies were found in 162 of 1131 (14%) sera. 90 of these (56%) had antibodies targeting the extracellular domains of LGI1 or CASPR2. Of the remaining 72 double-negative sera, 10 (14%) immunoprecipitated 125 I-αDTX itself, and 27 (38%) bound to solubilised co-expressed Kv1.1/1.2/1.6 subunits and/or Kv1.2 subunits alone, at levels proportionate to VGKC complex antibody levels (r=0.57, p=0.0017). The sera with LGI1 and CASPR2 antibodies immunoprecipitated neither preparation. None of the 27 Kv1-precipitating samples bound live hippocampal neurons or Kv1 extracellular domains, but 16 (59%) bound to permeabilised Kv1-expressing human embryonic kidney 293T cells. These intracellular Kv1 antibodies mainly associated with non-immune disease aetiologies, poor longitudinal clinical-serological correlations and a limited immunotherapy response. Double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits and occasionally against

Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

Science.gov (United States)

Cantrell, A R; Scheuer, T; Catterall, W A

1999-07-01

Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

Science.gov (United States)

Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

2018-03-24

Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

The role of entropic potential in voltage activation and K+ transport through Kv 1.2 channels

Science.gov (United States)

Wawrzkiewicz-Jałowiecka, Agata; Grzywna, Zbigniew J.

2018-03-01

We analyze the entropic effects of inner pore geometry changes of Kv 1.2 channel during membrane depolarization and their implications for the rate of transmembrane transport of potassium ions. We base this on the idea that spatial confinements within the channel pore give rise to entropic barriers which can both effectively affect the stability of open macroconformation and influence channel's ability to conduct the potassium ions through the membrane. First, we calculate the differences in entropy between voltage-activated and resting states of the channel. As a template, we take a set of structures of channel pore in an open state at different membrane potentials generated in our previous research. The obtained results indicate that tendency to occupy open states at membrane depolarization is entropy facilitated. Second, we describe the differences in rates of K+ transport through the channel pore at different voltages based on the results of appropriate random walk simulations in entropic and electric potentials. The simulated single channel currents (I) suggest that the geometry changes during membrane depolarization are an important factor contributing to the observed flow of potassium ions through the channel. Nevertheless, the charge distribution within the channel pore (especially at the extracellular entrance) seems most prominent for the observed I/Imax relation at a qualitative level at analyzed voltages.

The cooperative voltage sensor motion that gates a potassium channel.

Science.gov (United States)

Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

2005-01-01

The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

Inward rectifier potassium currents in mammalian skeletal muscle fibres

Science.gov (United States)

DiFranco, Marino; Yu, Carl; Quiñonez, Marbella; Vergara, Julio L

2015-01-01

Inward rectifying potassium (Kir) channels play a central role in maintaining the resting membrane potential of skeletal muscle fibres. Nevertheless their role has been poorly studied in mammalian muscles. Immunohistochemical and transgenic expression were used to assess the molecular identity and subcellular localization of Kir channel isoforms. We found that Kir2.1 and Kir2.2 channels were targeted to both the surface andthe transverse tubular system membrane (TTS) compartments and that both isoforms can be overexpressed up to 3-fold 2 weeks after transfection. Inward rectifying currents (IKir) had the canonical features of quasi-instantaneous activation, strong inward rectification, depended on the external [K+], and could be blocked by Ba2+ or Rb+. In addition, IKir records show notable decays during large 100 ms hyperpolarizing pulses. Most of these properties were recapitulated by model simulations of the electrical properties of the muscle fibre as long as Kir channels were assumed to be present in the TTS. The model also simultaneously predicted the characteristics of membrane potential changes of the TTS, as reported optically by a fluorescent potentiometric dye. The activation of IKir by large hyperpolarizations resulted in significant attenuation of the optical signals with respect to the expectation for equal magnitude depolarizations; blocking IKir with Ba2+ (or Rb+) eliminated this attenuation. The experimental data, including the kinetic properties of IKir and TTS voltage records, and the voltage dependence of peak IKir, while measured at widely dissimilar bulk [K+] (96 and 24 mm), were closely predicted by assuming Kir permeability (PKir) values of ∼5.5 × 10−6 cm s−1 and equal distribution of Kir channels at the surface and TTS membranes. The decay of IKir records and the simultaneous increase in TTS voltage changes were mostly explained by K+ depletion from the TTS lumen. Most importantly, aside from allowing an accurate estimation of

Rearrangement of potassium ions and Kv1.1/Kv1.2 potassium channels in regenerating axons following end-to-end neurorrhaphy: ionic images from TOF-SIMS.

Science.gov (United States)

Liu, Chiung-Hui; Chang, Hung-Ming; Wu, Tsung-Huan; Chen, Li-You; Yang, Yin-Shuo; Tseng, To-Jung; Liao, Wen-Chieh

2017-10-01

The voltage-gated potassium channels Kv1.1 and Kv1.2 that cluster at juxtaparanodal (JXP) regions are essential in the regulation of nerve excitability and play a critical role in axonal conduction. When demyelination occurs, Kv1.1/Kv1.2 activity increases, suppressing the membrane potential nearly to the equilibrium potential of K + , which results in an axonal conduction blockade. The recovery of K + -dependent communication signals and proper clustering of Kv1.1/Kv1.2 channels at JXP regions may directly reflect nerve regeneration following peripheral nerve injury. However, little is known about potassium channel expression and its relationship with the dynamic potassium ion distribution at the node of Ranvier during the regenerative process of peripheral nerve injury (PNI). In the present study, end-to-end neurorrhaphy (EEN) was performed using an in vivo model of PNI. The distribution of K + at regenerating axons following EEN was detected by time-of-flight secondary-ion mass spectrometry. The specific localization and expression of Kv1.1/Kv1.2 channels were examined by confocal microscopy and western blotting. Our data showed that the re-establishment of K + distribution and intensity was correlated with the functional recovery of compound muscle action potential morphology in EEN rats. Furthermore, the re-clustering of Kv1.1/1.2 channels 1 and 3 months after EEN at the nodal region of the regenerating nerve corresponded to changes in the K + distribution. This study provided direct evidence of K + distribution in regenerating axons for the first time. We proposed that the Kv1.1/Kv1.2 channels re-clustered at the JXP regions of regenerating axons are essential for modulating the proper patterns of K + distribution in axons for maintaining membrane potential stability after EEN.

Electrolytic coloration and spectral properties of hydroxyl-doped potassium bromide single crystals

International Nuclear Information System (INIS)

Qi, Lan; Song, Cuiying; Gu, Hongen

2013-01-01

Hydroxyl-doped potassium bromide single crystals are colored electrolytically at various temperatures and voltages by using a pointed cathode and a flat anode. The characteristic OH − spectral band is observed in absorption spectrum of uncolored single crystal. The characteristic O − , OH − , U, V 2 , O 2− −V a + , M L1 , F and M spectral bands are observed simultaneously in absorption spectra of colored single crystals. Current–time curve for electrolytic coloration of hydroxyl-doped potassium bromide single crystal and its relationship with electrolytic coloration processes are given. Production and conversion of color centers are explained. - Highlights: ► We expanded the traditional electrolysis method. ► Hydroxyl-doped potassium bromide crystals were colored electrolytically for the first time. ► Useful V, F and F-aggregate color centers were produced in colored crystals. ► V color centers were produced directly and F as well as F-aggregate color centers indirectly.

The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

DEFF Research Database (Denmark)

Bennekou, P.; Barksmann, T. L.; Christophersen, P.

2006-01-01

The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

Dielectric properties of a potassium nitrate–ammonium nitrate system

OpenAIRE

Alexey Yu. Milinskiy; Anton A. Antonov

2015-01-01

Potassium nitrate has a rectangular hysteresis loop and is thought to be a promising material for non-volatile ferroelectric memory. However, its polar phase is observed in a narrow temperature range. This paper deals with an effect of ammonium nitrate NH4NO3 on the dielectric properties of potassium nitrate. Thermal dependencies of the linear dielectric permittivity ε and the third-harmonic coefficient g3 for potassium nitrate and polycrystalline binary (KNO3)1–x(NH4NO3)x system (x = 0.025, ...

IgG and complement deposition and neuronal loss in cats and humans with epilepsy and voltage-gated potassium channel complex antibodies.

Science.gov (United States)

Klang, Andrea; Schmidt, Peter; Kneissl, Sibylle; Bagó, Zoltán; Vincent, Angela; Lang, Bethan; Moloney, Teresa; Bien, Christian G; Halász, Péter; Bauer, Jan; Pákozdy, Akos

2014-05-01

Voltage-gated potassium channel complex (VGKC-complex) antibody (Ab) encephalitis is a well-recognized form of limbic encephalitis in humans, usually occurring in the absence of an underlying tumor. The patients have a subacute onset of seizures, magnetic resonance imaging findings suggestive of hippocampal inflammation, and high serum titers of Abs against proteins of the VGKC-complex, particularly leucine-rich, glioma-inactivated 1 (LGI1). Most patients are diagnosed promptly and recover substantially with immunotherapies; consequently, neuropathological data are limited. We have recently shown that feline complex partial cluster seizures with orofacial involvement (FEPSO) in cats can also be associated with Abs against VGKC-complexes/LGI1. Here we examined the brains of cats with FEPSO and compared the neuropathological findings with those in a human with VGKC-complex-Ab limbic encephalitis. Similar to humans, cats with VGKC-complex-Ab and FEPSO have hippocampal lesions with only moderate T-cell infiltrates but with marked IgG infiltration and complement C9neo deposition on hippocampal neurons, associated with neuronal loss. These findings provide further evidence that FEPSO is a feline form of VGKC-complex-Ab limbic encephalitis and provide a model for increasing understanding of the human disease.

Neuronal trafficking of voltage-gated potassium channels

DEFF Research Database (Denmark)

Jensen, Camilla S; Rasmussen, Hanne Borger; Misonou, Hiroaki

2011-01-01

The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials is regul......The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials...

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Age and sex dependence of body potassium based on studies of 40K under Indian conditions

International Nuclear Information System (INIS)

Ranganathan, S.; Someswara Rao, M.; Nagaratnam, A.; Mishra, U.C.

2002-01-01

Potassium plays an important role in human life 40 K is a naturally occurring radioisotope of potassium (K) with an abundance of 0.0118%. The measurement of body 40 K in a whole-body counter (WBC) provides a sensitive technique to estimate the total body potassium (TBK). Information on TBK of Indians with age and sex is scanty. Therefore, a systematic study was taken up to generate this information using a sensitive WBC

Low Potassium (Hypokalemia)

Science.gov (United States)

Symptoms Low potassium (hypokalemia) By Mayo Clinic Staff Low potassium (hypokalemia) refers to a lower than normal potassium level ... 2 millimoles per liter (mmol/L). A very low potassium level (less than 2.5 mmol/L) ...

Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

International Nuclear Information System (INIS)

Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

2015-01-01

The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

Voltage Controlled Dynamic Demand Response

DEFF Research Database (Denmark)

Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

Composition effect of potassium-borate glasses on their relaxation properties

International Nuclear Information System (INIS)

Lomovskoj, V.A.; Bartenev, G.M.

1995-01-01

Relaxation processes in potassium-borate glasses have been investigated in detail for the first time. It is shown that low-temperature β-process of relaxation relating to rotational mobility of the B-O bond is the same for all potassium-borate glasses and B 2 O 3 . The process of β k -relaxation related to diffusion mobility of potassium ions depends on the composition of the glasses in the same way as α-relaxation (glass formation).12 refs., 10 figs., 2 tabs

Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

Science.gov (United States)

Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

2016-02-01

Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

When should we test for voltage-gated potassium channel complex antibodies? A retrospective case control study.

Science.gov (United States)

O'Sullivan, B J; Steele, T; Ellul, M A; Kirby, E; Duale, A; Kier, G; Crooks, D; Jacob, A; Solomon, T; Michael, B D

2016-11-01

Patients with voltage-gated potassium channel (VGKC)-complex antibodies are increasingly recognized as having central, peripheral or combined phenotypes. With increasing awareness, more patients are tested and the clinical spectrum is expanding. Consequently, clinicians may be uncertain as to which patients should or should not be tested. Previous studies have identified common clinical features, but none has looked at the usefulness of these in predicting seropositive disease. We conducted a case-control study of patients tested for VGKC-complex antibodies over 10years at a regional tertiary neurology centre determining which clinical/biochemical features were associated with antibody-positive disease. We found a marked increase in the numbers tested, although the percentage positive remained low. Antibody titre was highest in central disease (pVGKC-disease (p=0.01). Seizures were present in 11 (69%) of those with VGKC-disease versus three (18%) without (odds ratio [OR] 10.3, 95% confidence interval [CI]: 2.0-52.7, p=0.005). There was an inverse correlation between the antibody titre and serum sodium. A multivariate model selected seizures and hyponatraemia as predictive of VGKC disease (sensitivity 75% and specificity 82%); faciobrachial dystonic movements were specific but insensitive. Interestingly serum alkaline phosphatase was higher in those with VGKC-disease (p=0.016) and highest in those with peripheral disease (p=0.015). An ALP>70u/L was strongly associated with antibody positivity (OR 4.11 95% CI: 1.43-11.8, p=0.007) with a sensitivity of 74.2%. The presence of seizures, faciobrachial movements, and hyponatraemia should raise suspicion of VGKC-disease; alkaline phosphatase may represent a novel biomarker, particularly in those with peripheral disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

Voltage-gated lipid ion channels

DEFF Research Database (Denmark)

Blicher, Andreas; Heimburg, Thomas Rainer

2013-01-01

Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

Mechanism of cesium sorption on potassium titanium hexacyanoferrate

International Nuclear Information System (INIS)

Sun Yongxia; Xu Shiping; Song Chongli

1998-01-01

The mechanism of cesium sorption on potassium titanium hexacyanoferrate is described. The dependence of the sorption speed on temperature, particle granule size, and the stirring speed is studied. The results show that the sorption process is controlled by liquid film diffusion and particle diffusion. An exchange reaction occurs mainly between K + in the exchanger and Cs + in the solution, i.e. potassium titanium hexacyanoferrate, and Cs + of simulated high-level liquid waste

Diadenosine pentaphosphate affects electrical activity in guinea pig atrium via activation of potassium acetylcholine-dependent inward rectifier.

Science.gov (United States)

Abramochkin, Denis V; Karimova, Viktoria M; Filatova, Tatiana S; Kamkin, Andre

2017-07-01

Diadenosine pentaphosphate (Ap5A) belongs to the family of diadenosine polyphosphates, endogenously produced compounds that affect vascular tone and cardiac performance when released from platelets. The previous findings indicate that Ap5A shortens action potentials (APs) in rat myocardium via activation of purine P2 receptors. The present study demonstrates alternative mechanism of Ap5A electrophysiological effects found in guinea pig myocardium. Ap5A (10 -4  M) shortens APs in guinea pig working atrial myocardium and slows down pacemaker activity in the sinoatrial node. P1 receptors antagonist DPCPX (10 -7  M) or selective GIRK channels blocker tertiapin (10 -6  M) completely abolished all Ap5A effects, while P2 blocker PPADS (10 -4  M) was ineffective. Patch-clamp experiments revealed potassium inward rectifier current activated by Ap5A in guinea pig atrial myocytes. The current was abolished by DPCPX or tertiapin and therefore was considered as potassium acetylcholine-dependent inward rectifier (I KACh ). Thus, unlike rat, in guinea pig atrium Ap5A produces activation of P1 receptors and subsequent opening of KACh channels leading to negative effects on cardiac electrical activity.

Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

International Nuclear Information System (INIS)

Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

2015-01-01

Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

International Nuclear Information System (INIS)

Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

2013-01-01

Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

Piezoelectric excitation of elastic waves in centrosymmetrical potassium tantalate crystal

International Nuclear Information System (INIS)

Smolenskij, G.A.; Lemanov, V.V.; Sotnikov, A.V.; Syrnikov, P.P.; Yushin, N.K.

1981-01-01

Experiment results on excitation of elastic oscillations in potassium tantalate crystals are considered. The experiment has been conducted by usual for supersonic measurements technique: an impulse of the variable electric field has been applied to one of plane-parallel sample end-faces, at the same end-face signals corresponding to elastic pulses propagating in the crystal have been detected. Basic radiopulses parameters: basic frequency 30 MHz, duration 1-2 μs, pulse recurrence frequency 500 Hz, power 10 W. The investigation carried out has shown that the application to the sample at T=80 K temperature of constant external electrical field parallel to direction of elastic wave propagation leads to hysteresis dependence of elastic waves amplitude on the external voltage value. With temperature increase the hysteresis loop is deformed. It has been found when investigating temperature dependence of elastic wave amplitude that in the absence of external constant electrical field in short-circuited by constant current samples the oxillation excitation effect disappears at T approximately equal to 200 K. An essential influence on the elastic wave amplitude value is exerted by illumination of the crystal surface by light with 360-630 nm wave length. At T 130 K bacaee of photovoltaic effect in illuminated samples [ru

Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

International Nuclear Information System (INIS)

Diserbo, M.; Barbier, M.; Quignard, J.F.

1998-01-01

Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

Pulse-voltage fast generator

International Nuclear Information System (INIS)

Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

1988-01-01

The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

Limbic encephalitis associated with anti-voltage-gated potassium channel complex antibodies as a cause of adult-onset mesial temporal lobe epilepsy.

Science.gov (United States)

Toyota, Tomoko; Akamatsu, Naoki; Tsuji, Sadatoshi; Nishizawa, Shigeru

2014-06-01

Recently, some reports have indicated that limbic encephalitis associated with anti-voltage-gated potassium channel complex antibodies (VGKC-Ab) is a cause of adult-onset mesial temporal lobe epilepsy (MTLE). We report a 53-year-old woman who had her first epileptic seizure at the age of 50 years old. Examination by 3-Tesla brain MRI revealed left hippocampal high signal intensity and swelling on fluid-attenuated inversion recovery (FLAIR) and T2-weighted imaging at 2 months after her first seizure. The patient received intravenous methylprednisolone and carbamazepine 300 mg/day. One month later, MRI revealed improvement of her left hippocampal abnormalities. Thereafter, she had no seizures, however, three years after her first seizure, EEG revealed a seizure pattern in the left temporal region. Brain MRI revealed left hippocampal high signal intensity and brain fluorodeoxyglucose positron emission tomography revealed hypermetabolism. Her serum VGKC-Ab levels were 118 pM(normal VGKC-Ab levels decreased to 4.4 pM. Remission of the epileptic seizures was also observed. This MTLE in the middle age was considered as limbic encephalitis associated with anti- VGKC-Ab. In cases of unexplained adult-onset MTLE, limbic encephalitis associated with anti-VGKC-Ab, which responds well to immunotherapy, should be considered in the differential diagnosis.

A Novel Reconfigurable Logic Unit Based on the DNA-Templated Potassium-Concentration-Dependent Supramolecular Assembly.

Science.gov (United States)

Yang, Chunrong; Zou, Dan; Chen, Jianchi; Zhang, Linyan; Miao, Jiarong; Huang, Dan; Du, Yuanyuan; Yang, Shu; Yang, Qianfan; Tang, Yalin

2018-03-15

Plenty of molecular circuits with specific functions have been developed; however, logic units with reconfigurability, which could simplify the circuits and speed up the information process, are rarely reported. In this work, we designed a novel reconfigurable logic unit based on a DNA-templated, potassium-concentration-dependent, supramolecular assembly, which could respond to the input stimuli of H + and K + . By inputting different concentrations of K + , the logic unit could implement three significant functions, including a half adder, a half subtractor, and a 2-to-4 decoder. Considering its reconfigurable ability and good performance, the novel prototypes developed here may serve as a promising proof of principle in molecular computers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regulation of voltage-gated potassium channels attenuates resistance of side-population cells to gefitinib in the human lung cancer cell line NCI-H460.

Science.gov (United States)

Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong

2017-02-21

Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.

Large-conductance calcium-dependent potassium channels prevent dendritic excitability in neocortical pyramidal neurons.

Science.gov (United States)

Benhassine, Narimane; Berger, Thomas

2009-03-01

Large-conductance calcium-dependent potassium channels (BK channels) are homogeneously distributed along the somatodendritic axis of layer 5 pyramidal neurons of the rat somatosensory cortex. The relevance of this conductance for dendritic calcium electrogenesis was studied in acute brain slices using somatodendritic patch clamp recordings and calcium imaging. BK channel activation reduces the occurrence of dendritic calcium spikes. This is reflected in an increased critical frequency of somatic spikes necessary to activate the distal initiation zone. Whilst BK channels repolarise the somatic spike, they dampen it only in the distal dendrite. Their activation reduces dendritic calcium influx via glutamate receptors. Furthermore, they prevent dendritic calcium electrogenesis and subsequent somatic burst discharges. However, the time window for coincident somatic action potential and dendritic input to elicit dendritic calcium events is not influenced by BK channels. Thus, BK channel activation in layer 5 pyramidal neurons affects cellular excitability primarily by establishing a high threshold at the distal action potential initiation zone.

Potassium fluorotitanate preparation

International Nuclear Information System (INIS)

Perillo, Patricia; Ares, Osvaldo; Botbol, Jose.

1989-01-01

In order to determine the best conditions for potassium fluotitanate preparation as intermediate step in the electrolytic production of metalic titanium, the effects of a number of experimental variables have been studied. This method is a process of sintering titanium dioxide with potassium fluosilicate and potassium chloride, followed by leaching with boiling water and further crystallization by cooling the solution. An overall yield of 90% has been attained under the following conditions: working temperature: 750 deg C; heating time for sintering: 3 hours; molar ratio: titanium dioxide: potassium fluosilicate: potassium chloride: 1 : 2 : 0.4; number of leachings: 6. (Author) [es

Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

OpenAIRE

Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

2009-01-01

Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

Lack of direct evidence for a functional role of voltage-operated calcium channels in juxtaglomerular cells

DEFF Research Database (Denmark)

Kurtz, A; Skott, O; Chegini, S

1990-01-01

in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...

Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

Science.gov (United States)

Petit, C.; Zander, D.

2007-10-01

It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

[Mechanism of potassium channel in hypoxia-ischemic brain edema: experiment with neonatal rat astrocyte].

Science.gov (United States)

Fu, Xue-mei; Xiang, Long; Liao, Da-qing; Feng, Zhi-chun; Mu, De-zhi

2008-11-04

To investigate the mechanism of potassium channel in brain edema caused by hypoxia-ischemia (HI). Astrocytes were obtained from 3-day-old SD rats, cultured, and randomly divided into 2 groups: normoxia group, cultured under normoxic condition, and hypoxic-ischemic group, cultured under hypoxic-ischemic condition. The cell volume was measured by radiologic method. Patch-clamp technique was used to observe the electric physiological properties of the voltage-gated potassium channels (Kv) in a whole cell configuration, and the change of voltage-gated potassium channel current (IKv) was recorded in cultured neonatal rat astrocyte during HI. Aquaporin 4 (AQP4) expression vector was constructed from pSUPER vector and transfected into the astrocytes (AQP4 RNAi) to construct AQP4 knockdown (AQP4-/-) cells. cellular volume was determined using [3H]-3-O-methyl-D-glucose uptake in both AQP4-/- and AQP4+/+ cells under the condition of HI. Real time PCR and Western blotting were used to detect the mRNA and protein expression of AQP4. The percentages of the AQP4+/+ and AQP4-/- astrocyte volumes in the condition of HI for 0.5, 1, 2, and 4 h were 104+/-7, 109+/-6, 126+/-12, and 152+/-9 times, and 97+/-7, 105+/-9, 109+/-7, and 132+/-6 times as those of their corresponding control groups (all Pastrocytes significantly increased during HI and the degrees of edema mediated by AQP4 knockdown at different time points were all significantly milder (all Pastrocytes via aquaporin-4 and then cell swelling.

Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

Science.gov (United States)

Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

2012-01-01

The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons.

Science.gov (United States)

Lazcano-Pérez, Fernando; Castro, Héctor; Arenas, Isabel; García, David E; González-Muñoz, Ricardo; Arreguín-Espinosa, Roberto

2016-05-05

The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7), voltage-gated calcium channel (CaV2.2), the A-type transient outward (IA) and delayed rectifier (IDR) currents of KV channels of the superior cervical ganglion (SCG) neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

Science.gov (United States)

Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

2013-01-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

Mechanism of voltage-gated channel formation in lipid membranes.

Science.gov (United States)

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

APETx4, a Novel Sea Anemone Toxin and a Modulator of the Cancer-Relevant Potassium Channel KV10.1

Directory of Open Access Journals (Sweden)

Lien Moreels

2017-09-01

Full Text Available The human ether-à-go-go channel (hEag1 or KV10.1 is a cancer-relevant voltage-gated potassium channel that is overexpressed in a majority of human tumors. Peptides that are able to selectively inhibit this channel can be lead compounds in the search for new anticancer drugs. Here, we report the activity-guided purification and electrophysiological characterization of a novel KV10.1 inhibitor from the sea anemone Anthopleura elegantissima. Purified sea anemone fractions were screened for inhibitory activity on KV10.1 by measuring whole-cell currents as expressed in Xenopus laevis oocytes using the two-microelectrode voltage clamp technique. Fractions that showed activity on Kv10.1 were further purified by RP-HPLC. The amino acid sequence of the peptide was determined by a combination of MALDI- LIFT-TOF/TOF MS/MS and CID-ESI-FT-ICR MS/MS and showed a high similarity with APETx1 and APETx3 and was therefore named APETx4. Subsequently, the peptide was electrophysiologically characterized on KV10.1. The selectivity of the toxin was investigated on an array of voltage-gated ion channels, including the cardiac human ether-à-go-go-related gene potassium channel (hERG or Kv11.1. The toxin inhibits KV10.1 with an IC50 value of 1.1 μM. In the presence of a similar toxin concentration, a shift of the activation curve towards more positive potentials was observed. Similar to the effect of the gating modifier toxin APETx1 on hERG, the inhibition of Kv10.1 by the isolated toxin is reduced at more positive voltages and the peptide seems to keep the channel in a closed state. Although the peptide also induces inhibitory effects on other KV and NaV channels, it exhibits no significant effect on hERG. Moreover, APETx4 induces a concentration-dependent cytotoxic and proapoptotic effect in various cancerous and noncancerous cell lines. This newly identified KV10.1 inhibitor can be used as a tool to further characterize the oncogenic channel KV10.1 or as a

Alteration of sodium, potassium-adenosine triphosphatase activity in rabbit ciliary processes by cyclic adenosine monophosphate-dependent protein kinase

International Nuclear Information System (INIS)

Delamere, N.A.; Socci, R.R.; King, K.L.

1990-01-01

The response of sodium, potassium-adenosine triphosphatase (Na,K-ATPase) to cyclic adenosine monophosphate (cAMP)-dependent protein kinase was examined in membranes obtained from rabbit iris-ciliary body. In the presence of the protein kinase together with 10(-5) M cAMP, Na,K-ATPase activity was reduced. No change in Na,K-ATPase activity was detected in response to the protein kinase without added cAMP. Likewise cAMP alone did not alter Na,K-ATPase activity. Reduction of Na,K-ATPase activity was also observed in the presence of the cAMP-dependent protein kinase catalytic subunit. The response of the enzyme to the kinase catalytic subunit was also examined in membranes obtained from rabbit ciliary processes. In the presence of 8 micrograms/ml of the catalytic subunit, ciliary process Na,K-ATPase activity was reduced by more than 50%. To examine whether other ATPases were suppressed by the protein kinase, calcium-stimulated ATPase activity was examined; its activity was stimulated by the catalytic subunit. To test whether the response of the ciliary process Na,K-ATPase is unique, experiments were also performed using membrane preparations from rabbit lens epithelium or rabbit kidney; the catalytic subunit significantly reduced the activity of Na,K-ATPase from the kidney but not the lens. These Na,K-ATPase studies suggest that in the iris-ciliary body, cAMP may alter sodium pump activity. In parallel 86Rb uptake studies, we observed that ouabain-inhibitable potassium uptake by intact pieces of iris-ciliary body was reduced by exogenous dibutryl cAMP or by forskolin

Potassium toxicity at low serum potassium levels with refeeding syndrome.

Science.gov (United States)

Vemula, Praveen; Abela, Oliver G; Narisetty, Keerthy; Rhine, David; Abela, George S

2015-01-01

Refeeding syndrome is a life-threatening condition occurring in severely malnourished patients after initiating feeding. Severe hypophosphatemia with reduced adenosine triphosphate production has been implicated, but little data are available regarding electrolyte abnormalities. In this case, we report electrocardiographic changes consistent with hyperkalemia during potassium replacement after a serum level increase from 1.9 to 2.9 mEq/L. This was reversed by lowering serum potassium back to 2.0 mEq/L. In conclusion, the patient with prolonged malnutrition became adapted to low potassium levels and developed potassium toxicity with replacement. Copyright © 2015 Elsevier Inc. All rights reserved.

Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

DEFF Research Database (Denmark)

Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

2003-01-01

The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

Protective roles for potassium SK/KCa2 channels in microglia and neurons

Directory of Open Access Journals (Sweden)

Amalia M Dolga

2012-11-01

Full Text Available New concepts on potassium channel function in neuroinflammation suggest that they regulate mechanisms of microglial activation, including intracellular calcium homeostasis, morphological alterations, pro-inflammatory cytokine release, antigen presentation, and phagocytosis. Although little is known about voltage independent potassium channels in microglia, special attention emerges on small (SK/KCNN1-3/KCa2 and intermediate (IK/KCNN4/KCa3.1-conductance calcium-activated potassium channels as regulators of microglial activation in the field of research on neuroinflammation and neurodegeneration. In particular, recent findings suggested that SK/KCa2 channels, by regulating calcium homeostasis, may elicit a dual mechanism of action with protective properties in neurons and inhibition of inflammatory responses in microglia. Thus, modulating SK/KCa2 channels and calcium signaling may provide novel therapeutic strategies in neurological disorders, where neuronal cell death and inflammatory responses concomitantly contribute to disease progression. Here, we review the particular role of SK/KCa2 channels for [Ca2+]i regulation in microglia and neurons, and we discuss the potential impact for further experimental approaches addressing novel therapeutic strategies in neurological diseases, where neuronal cell death and neuroinflammatory processes are prominent.

Creutzfeldt-Jakob Disease-Like Periodic Sharp Wave Complexes in Voltage-Gated Potassium Channel-Complex Antibodies Encephalitis: A Case Report.

Science.gov (United States)

Savard, Martin; Irani, Sarosh R; Guillemette, Annie; Gosselin-Lefebvre, Stéphanie; Geschwind, Michael; Jansen, Gerard H; Gould, Peter V; Laforce, Robert

2016-02-01

Voltage-gated potassium channel-complex antibodies (VGKC-cAbs) encephalitis, a treatable autoantibody encephalopathy, has been previously reported to clinically mimic sporadic Creutzfeldt-Jakob disease. Among available clinical clues to distinguish them, periodic sharp wave complexes, a typical finding in sporadic Creutzfeldt-Jakob disease, have never been reported in association with VGKC-cAbs encephalitis. A 76-year-old man was transferred to a tertiary neurology center with a clinical history of 6-month weight loss, cognitive disturbance, and nonspecific generalized weakness. He had two seizures the month before transfer and then evolved to severe encephalopathy, requiring mechanical ventilation. Periodic sharp wave complexes every 1 to 2 seconds over slowed background were found on EEG, and MRI showed cerebellar and bifrontal cortical T2/FLAIR/DWI hypersignal without restricted diffusion on ADC mapping. Pancorporal positron emission tomography scan was negative. An immunotherapy trial did not improve the patient condition. Therefore, he died after life support withdrawal. Brain autopsy revealed mononuclear neocortex infiltrate without significant spongiosis, and the anti-VGKC test showed a seropositivity of 336 pmol/L (normal, 0-31), 3 month after the patient deceased. This is the first reported case of VGKC-cAbs encephalitis associated with periodic sharp wave complexes on EEG, which further confuse the differential diagnosis with sporadic Creutzfeldt-Jakob disease. However, the cortical DWI hypersignal without restriction seems to remain a way to discriminate these two entities appropriately, when present. These clues are of paramount importance because VGKC-cAbs encephalitis is a treatable disease.

Reaction of lithium, sodium and potassium polyphosphates with potassium permanganate at elevated temperatures

International Nuclear Information System (INIS)

Paderova, L.V.; Onuchina, T.V.; Kochergin, V.P.

1996-01-01

A study was made on destruction of molten polyphosphates of alkaline metals by potassium permanganate during change of KMnO 4 content, test time and temperature. Ortho-, di, tri- and tetraphosphate-anions, as well as manganese compounds with different oxidation degree were revealed in products of component interaction. Empirical equations of the dependence of the value of average molecular mass on change of melt temperature were derived. 11 refs.; 2 figs.; 2 tabs

Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons

Directory of Open Access Journals (Sweden)

Fernando Lazcano-Pérez

2016-05-01

Full Text Available The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7, voltage-gated calcium channel (CaV2.2, the A-type transient outward (IA and delayed rectifier (IDR currents of KV channels of the superior cervical ganglion (SCG neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

Voltage stability in low voltage microgrids in aspects of active and reactive power demand

Directory of Open Access Journals (Sweden)

Parol Mirosław

2016-03-01

Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

Handling of potassium

International Nuclear Information System (INIS)

Schwarz, N.; Komurka, M.

1983-03-01

As a result for the Fast Breeder Development extensive experience is available worldwide with respect to Sodium technology. Due to the extension of the research program to topping cycles with Potassium as the working medium, test facilities with Potassium have been designed and operated in the Institute of Reactor Safety. The different chemical properties of Sodium and Potassium give rise in new safety concepts and operating procedures. The handling problems of Potassium are described in the light of theoretical properties and own experiences. Selected literature on main safety and operating problems complete this report. (Author) [de

Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

International Nuclear Information System (INIS)

Pe, T.; McDonald, J.; Clem, J.R.

1995-01-01

The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

The inhibitory effects of potassium chloride versus potassium silicate application on 137Cs uptake by rice

International Nuclear Information System (INIS)

Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

2016-01-01

After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of 137 Cs by rice plants in two pot experiments. The 137 Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K + ) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K + concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K + for rice plants in the soil, which led to a greater uptake of 137 Cs after the potassium silicate application than after the application of potassium chloride. The 137 Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. - Highlights: • Potassium application reduced 137 Cs uptake by rice grown in pot experiments. • Readily available K fertilizer more effectively decreased brown rice 137 Cs concentration. • Potassium should be applied before heading to reduce brown rice 137 Cs concentration.

Electrical properties of the potassium polytitanate compacts

International Nuclear Information System (INIS)

Goffman, V.G.; Gorokhovsky, A.V.; Kompan, M.M.; Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V.; Fedorov, F.S.

2014-01-01

Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10 4 –10 5 . • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10 −2 to 10 −6 –10 −7 Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10 −2 Sm/m (high frequencies, ion conductivity) up to 10 −6 –10 −7 Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10 4 –10 5 . This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures

Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

2006-01-01

Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

Science.gov (United States)

Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

2016-03-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

International Nuclear Information System (INIS)

Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

2016-01-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

The inhibitory effects of potassium chloride versus potassium silicate application on (137)Cs uptake by rice.

Science.gov (United States)

Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

2016-03-01

After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of (137)Cs by rice plants in two pot experiments. The (137)Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K(+)) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K(+) concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K(+) for rice plants in the soil, which led to a greater uptake of (137)Cs after the potassium silicate application than after the application of potassium chloride. The (137)Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. Copyright © 2016 Elsevier Ltd. All rights reserved.

Electric organ discharge diversification in mormyrid weakly electric fish is associated with differential expression of voltage-gated ion channel genes.

Science.gov (United States)

Nagel, Rebecca; Kirschbaum, Frank; Tiedemann, Ralph

2017-03-01

In mormyrid weakly electric fish, the electric organ discharge (EOD) is used for species recognition, orientation and prey localization. Produced in the muscle-derived adult electric organ, the EOD exhibits a wide diversity across species in both waveform and duration. While certain defining EOD characteristics can be linked to anatomical features of the electric organ, many factors underlying EOD differentiation are yet unknown. Here, we report the differential expression of 13 Kv1 voltage-gated potassium channel genes, two inwardly rectifying potassium channel genes, two previously studied sodium channel genes and an ATPase pump in two sympatric species of the genus Campylomormyrus in both the adult electric organ and skeletal muscle. Campylomormyrus compressirostris displays a basal EOD, largely unchanged during development, while C. tshokwe has an elongated, putatively derived discharge. We report an upregulation in all Kv1 genes in the electric organ of Campylomormyrus tshokwe when compared to both skeletal muscle and C. compressirostris electric organ. This pattern of upregulation in a species with a derived EOD form suggests that voltage-gated potassium channels are potentially involved in the diversification of the EOD signal among mormyrid weakly electric fish.

Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

Directory of Open Access Journals (Sweden)

Galyna Maleeva

2017-05-01

Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

International Nuclear Information System (INIS)

Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

1993-01-01

The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

2017-01-01

Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

Oral potassium supplementation in surgical patients.

Science.gov (United States)

Hainsworth, Alison J; Gatenby, Piers A

2008-08-01

Hospital inpatients are frequently hypokalaemic. Low plasma potassium levels may cause life threatening complications, such as cardiac arrhythmias. Potassium supplementation may be administered parenterally or enterally. Oral potassium supplements have been associated with oesophageal ulceration, strictures and gastritis. An alternative to potassium salt tablets or solution is dietary modification with potassium rich food stuffs, which has been proven to be a safe and effective method for potassium supplementation. The potassium content of one medium banana is equivalent to a 12 mmol potassium salt tablet. Potassium supplementation by dietary modification has been shown to be equally efficacious to oral potassium salt supplementation and is preferred by the majority of patients. Subsequently, it is our practice to replace potassium using dietary modification, particularly in surgical patients having undergone oesophagogastrectomy or in those with peptic ulcer disease.

Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

Science.gov (United States)

Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

2006-03-01

We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

Mass-spectrometric study of thermodynamics of molybdate potassium evaporation

International Nuclear Information System (INIS)

Kazenas, E.K.; Tsvetkov, Yu.V.; Samojlova, I.O.; Astakhova, G.K.; Petrov, A.A.

2002-01-01

One investigated into evaporation of potassium molybdate within 1170-1310 K temperature range using platinum effusion chambers. Evaporation of potassium molybdate within 1170-1310 K temperature range may be described as follows: K 2 MoO 4(s,l) = K 2 MoO 4(g) . Based on method of least squares one calculated equation of K 2 MoO 4(g) vapor pressure (pressure in millimeters of mercury column) dependence on temperature for 1200-1320 K range. One evaluated value of K 2 MoO 4(g) molecule atomization energy [ru

Electrical properties of the potassium polytitanate compacts

Energy Technology Data Exchange (ETDEWEB)

Goffman, V.G.; Gorokhovsky, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Kompan, M.M. [Physico-Technical Institute of the Russian Academy of Science, St. Petersburg (Russian Federation); Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Fedorov, F.S., E-mail: fedorov_fs@daad-alumni.de [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation)

2014-12-05

Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10{sup 4}–10{sup 5}. • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10{sup −2} to 10{sup −6}–10{sup −7} Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10{sup −2} Sm/m (high frequencies, ion conductivity) up to 10{sup −6}–10{sup −7} Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10{sup 4}–10{sup 5}. This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures.

Outward Rectification of Voltage-Gated K+ Channels Evolved at Least Twice in Life History.

Directory of Open Access Journals (Sweden)

Janin Riedelsberger

Full Text Available Voltage-gated potassium (K+ channels are present in all living systems. Despite high structural similarities in the transmembrane domains (TMD, this K+ channel type segregates into at least two main functional categories-hyperpolarization-activated, inward-rectifying (Kin and depolarization-activated, outward-rectifying (Kout channels. Voltage-gated K+ channels sense the membrane voltage via a voltage-sensing domain that is connected to the conduction pathway of the channel. It has been shown that the voltage-sensing mechanism is the same in Kin and Kout channels, but its performance results in opposite pore conformations. It is not known how the different coupling of voltage-sensor and pore is implemented. Here, we studied sequence and structural data of voltage-gated K+ channels from animals and plants with emphasis on the property of opposite rectification. We identified structural hotspots that alone allow already the distinction between Kin and Kout channels. Among them is a loop between TMD S5 and the pore that is very short in animal Kout, longer in plant and animal Kin and the longest in plant Kout channels. In combination with further structural and phylogenetic analyses this finding suggests that outward-rectification evolved twice and independently in the animal and plant kingdom.

Effects of water soaking and/or sodium polystyrene sulfonate addition on potassium content of foods.

Science.gov (United States)

Picq, Christian; Asplanato, Marion; Bernillon, Noémie; Fabre, Claudie; Roubeix, Mathilde; Ricort, Jean-Marc

2014-09-01

In this study, we determined, by atomic absorption spectrophotometry, the potassium amount leached by soaking or boiling foods identified by children suffering from chronic renal failure as "pleasure food" and that they cannot eat because of their low-potassium diet, and evaluated whether addition of sodium polystyrene sulfonate resin (i.e. Kayexalate®) during soaking or boiling modulated potassium loss. A significant amount of potassium content was removed by soaking (16% for chocolate and potato, 26% for apple, 37% for tomato and 41% for banana) or boiling in a large amount of water (73% for potato). Although Kayexalate® efficiently dose-dependently removed potassium from drinks (by 48% to 73%), resin addition during soaking or boiling did not eliminate more potassium from solid foods. Our results therefore provide useful information for dietitians who elaborate menus for people on potassium-restricted diets and would give an interesting alternative to the systematic elimination of all potassium-rich foods from their diet.

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

Science.gov (United States)

Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

2017-05-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

Clinical relevance of positive voltage-gated potassium channel (VGKC)-complex antibodies: experience from a tertiary referral centre.

Science.gov (United States)

Paterson, Ross W; Zandi, Michael S; Armstrong, Richard; Vincent, Angela; Schott, Jonathan M

2014-06-01

Voltage-gated potassium channel (VGKC)-complex antibodies can be associated with a range of immunotherapy-responsive clinical presentations including limbic encephalitis, Morvan's syndrome and acquired neuromyotonia. However, there are patients with positive levels in whom the significance is uncertain. To evaluate the clinical significance associated with positive (>100 pM) VGKC-complex antibodies. Over a 4-year period, 1053 samples were sent for testing of which 55 were positive. The clinical presentations, final diagnoses and responses to immunotherapies, when given, were assessed retrospectively and the likelihood of autoimmunity was categorised as definite, possible, unlikely or undetermined (modified from Zuliani et al 2012). Only 4 of the 32 patients with low-positive (100-400 pM) levels were considered definitely autoimmune, 3 with peripheral nerve hyperexcitability and 1 with a thymoma; 3 were given immunotherapies. Of the remaining 28 with low-positive levels, 13 (3 of whom had tumours) were considered possibly autoimmune, and 15 were unlikely or undetermined; 1 was given immunotherapy unsuccessfully. Of the 23 patients with high-positive (>400 pM) levels, 12 were given immunotherapies, 11 of whom showed a good response. 11 were considered definitely autoimmune, 10 with limbic encephalitis (antibody specificity: 5 LGI1, 1 contactin2, 2 negative, 2 untested) and 1 with a tumour. In the remaining 12, autoimmunity was considered possible (n=9; most had not received immunotherapies), or unlikely (n=3). As antibody testing becomes more widely available, and many samples are referred from patients with less clear-cut diagnoses, it is important to assess the utility of the results. VGKC-complex antibodies in the range of 100-400 pM (0.1-0.4 nM) were considered clinically relevant in rare conditions with peripheral nerve hyperexcitability and appeared to associate with tumours (12.5%). By contrast high-positive (>400 pM; >0.4 nM) levels were considered definitely

Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca²⁺ channels

DEFF Research Database (Denmark)

Garau, Gianpiero; Magotti, Paola; Heine, Martin

2015-01-01

Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

Science.gov (United States)

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

Science.gov (United States)

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

Directory of Open Access Journals (Sweden)

Sebastián eDubó

2016-03-01

Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

Science.gov (United States)

Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

2018-05-07

Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

Characterization of the Functional Domains of a Mammalian Voltage-Sensitive Phosphatase.

Science.gov (United States)

Rosasco, Mario G; Gordon, Sharona E; Bajjalieh, Sandra M

2015-12-15

Voltage-sensitive phosphatases (VSPs) are proteins that directly couple changes in membrane electrical potential to inositol lipid phosphatase activity. VSPs thus couple two signaling pathways that are critical for cellular functioning. Although a number of nonmammalian VSPs have been characterized biophysically, mammalian VSPs are less well understood at both the physiological and biophysical levels. In this study, we aimed to address this gap in knowledge by determining whether the VSP from mouse, Mm-VSP, is expressed in the brain and contains a functional voltage-sensing domain (VSD) and a phosphatase domain. We report that Mm-VSP is expressed in neurons and is developmentally regulated. To address whether the functions of the VSD and phosphatase domain are retained in Mm-VSP, we took advantage of the modular nature of these domains and expressed each independently as a chimeric protein in a heterologous expression system. We found that the Mm-VSP VSD, fused to a viral potassium channel, was able to drive voltage-dependent gating of the channel pore. The Mm-VSP phosphatase domain, fused to the VSD of a nonmammalian VSP, was also functional: activation resulted in PI(4,5)P2 depletion that was sufficient to inhibit the PI(4,5)P2-regulated KCNQ2/3 channels. While testing the functionality of the VSD and phosphatase domain, we observed slight differences between the activities of Mm-VSP-based chimeras and those of nonmammalian VSPs. Although the properties of VSP chimeras may not completely reflect the properties of native VSPs, the differences we observed in voltage-sensing and phosphatase activity provide a starting point for future experiments to investigate the function of Mm-VSP and other mammalian VSPs. In conclusion, our data reveal that both the VSD and the lipid phosphatase domain of Mm-VSP are functional, indicating that Mm-VSP likely plays an important role in mouse neurophysiology. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All

A novel mechanism for fine-tuning open-state stability in a voltage-gated potassium channel

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Niciforovic, Ana P; Galpin, Jason D

2013-01-01

stabilization is the consequence of the amelioration of an inherently repulsive open-state interaction between the partial negative charge on the face of Phe481 and a highly co-evolved acidic side chain, Glu395, and this interaction is potentially modulated through the Tyr485 hydroxyl. We propose...... fluorinated derivatives of aromatic residues previously implicated in the gating of Shaker potassium channels. Here we show that stepwise dispersion of the negative electrostatic surface potential of only one site, Phe481, stabilizes the channel open state. Furthermore, these data suggest that this apparent...

Sterically screened halogenocyclobutanones. I. Transformations of cyclopropyl-substituted 2,2-dichlorocyclobutanones under the influence of potassium hydroxide

International Nuclear Information System (INIS)

Donskaya, N.A.; Bessmertnykh, A.G.; Drobysh, V.A.; Shabarov, Yu.S.

1987-01-01

The reaction of 2,2-dichloro-3-cyclopropylcyclobutanones with potassium hydroxide was studied. The direction of the reaction depends on the concentration of the potassium hydroxide; with a 2% solution of potassium hydroxide 4,4-dichlorobutyric acids are formed with yields of up to 80%, and with a 15% solution of potassium hydroxide 5-hydroxydihydro-2-furanones are formed with yields of up to 80%. Proposals are made about the mechanism of formation of 5-hydroxydihydro-2-furanones

Penicillin V Potassium

Science.gov (United States)

Penicillin V potassium is used to treat certain infections caused by bacteria such as pneumonia and other ... heart valves and other symptoms) from coming back. Penicillin V potassium is in a class of medications ...

Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

Energy Technology Data Exchange (ETDEWEB)

Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

2015-01-15

In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

Evaluation of the potassium adsorption capacity of a potassium adsorption filter during rapid blood transfusion.

Science.gov (United States)

Matsuura, H; Akatsuka, Y; Muramatsu, C; Isogai, S; Sugiura, Y; Arakawa, S; Murayama, M; Kurahashi, M; Takasuga, H; Oshige, T; Yuba, T; Mizuta, S; Emi, N

2015-05-01

The concentration of extracellular potassium in red blood cell concentrates (RCCs) increases during storage, leading to risk of hyperkalemia. A potassium adsorption filter (PAF) can eliminate the potassium at normal blood transfusion. This study aimed to investigate the potassium adsorption capacity of a PAF during rapid blood transfusion. We tested several different potassium concentrations under a rapid transfusion condition using a pressure bag. The adsorption rates of the 70-mEq/l model were 76·8%. The PAF showed good potassium adsorption capacity, suggesting that this filter may provide a convenient method to prevent hyperkalemia during rapid blood transfusion. © 2015 International Society of Blood Transfusion.

Potassium maldistribution revisited

African Journals Online (AJOL)

Background:This study investigated maldistribution of concentrated 15% potassium chloride after injection into .... and latter experiments referred to for example as “Control 1” ..... be further investigated as a reliable, simple method of potassium.

Role of the pH in state-dependent blockade of hERG currents

Science.gov (United States)

Wang, Yibo; Guo, Jiqing; Perissinotti, Laura L.; Lees-Miller, James; Teng, Guoqi; Durdagi, Serdar; Duff, Henry J.; Noskov, Sergei Yu.

2016-10-01

Mutations that reduce inactivation of the voltage-gated Kv11.1 potassium channel (hERG) reduce binding for a number of blockers. State specific block of the inactivated state of hERG block may increase risks of drug-induced Torsade de pointes. In this study, molecular simulations of dofetilide binding to the previously developed and experimentally validated models of the hERG channel in open and open-inactivated states were combined with voltage-clamp experiments to unravel the mechanism(s) of state-dependent blockade. The computations of the free energy profiles associated with the drug block to its binding pocket in the intra-cavitary site display startling differences in the open and open-inactivated states of the channel. It was also found that drug ionization may play a crucial role in preferential targeting to the open-inactivated state of the pore domain. pH-dependent hERG blockade by dofetilie was studied with patch-clamp recordings. The results show that low pH increases the extent and speed of drug-induced block. Both experimental and computational findings indicate that binding to the open-inactivated state is of key importance to our understanding of the dofetilide’s mode of action.

Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

Science.gov (United States)

Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

2011-11-30

We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

21 CFR 184.1619 - Potassium carbonate.

Science.gov (United States)

2010-04-01

... solution of potassium hydroxide with excess carbon dioxide to produce potassium carbonate; (3) By treating a solution of potassium hydroxide with carbon dioxide to produce potassium bicarbonate, which is... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium carbonate. 184.1619 Section 184.1619 Food...

The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

OpenAIRE

ПАНЧЕНКО, В В

2015-01-01

The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels.

Science.gov (United States)

Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P

2012-09-01

Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

Science.gov (United States)

Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

2013-11-01

As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

Potassium supplements for oral diarrhoea regimens.

Science.gov (United States)

Clements, M L; Levine, M M; Black, R E; Hughes, T P; Rust, J; Tome, F C

1980-10-18

A study is proposed for supplementing potassium loss from diarrhea in rehydration therapies with fresh fruit and other naturally potassium-rich foods. Bananas contain .1 mol of potassium per gm. Freshly squeezed lemon or orange juices were tested for potassium and sodium content and found to have very low potassium concentration. Therefore, the banana was chosen for an upcoming study that will determine if infants and children suffering from diarrhea can ingest the amounts of the fruit necessary to elevate the potassium level sufficiently. Bananas as the potassium source are thought to be well-accepted in developing areas.

Potassium adsorption ratios as an indicator for the fate of agricultural potassium in groundwater

NARCIS (Netherlands)

Griffioen, J.

2001-01-01

Fertilization of agricultural land in groundwater infiltration areas often causes deterioration of groundwater quality. In addition to nitrogen and phosphorous, potassium deserves attention. The fate of potassium in the subsurface is controlled mainly by cation-exchange. Use of the Potassium

Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

International Nuclear Information System (INIS)

Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

2010-01-01

The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

Dynamic, nonlinear feedback regulation of slow pacemaking by A-type potassium current in ventral tegmental area neurons.

Science.gov (United States)

Khaliq, Zayd M; Bean, Bruce P

2008-10-22

We analyzed ionic currents that regulate pacemaking in dopaminergic neurons of the mouse ventral tegmental area by comparing voltage trajectories during spontaneous firing with ramp-evoked currents in voltage clamp. Most recordings were made in brain slice, with key experiments repeated using acutely dissociated neurons, which gave identical results. During spontaneous firing, net ionic current flowing between spikes was calculated from the time derivative of voltage multiplied by cell capacitance, signal-averaged over many firing cycles to enhance resolution. Net inward interspike current had a distinctive nonmonotonic shape, reaching a minimum (generally current that peaked near -55 mV. This current was undetectable with 5 mV/s ramps and increased steeply with depolarization rate over the range (10-50 mV/s) typical of natural pacemaking. Ramp-evoked subthreshold current was resistant to alpha-dendrotoxin, paxilline, apamin, and tetraethylammonium but sensitive to 4-aminopyridine and 0.5 mM Ba2+, consistent with A-type potassium current (I(A)). Same-cell comparison of currents elicited by various ramp speeds with natural spontaneous depolarization showed how the steep dependence of I(A) on depolarization rate results in small net inward currents during pacemaking. These results reveal a mechanism in which subthreshold I(A) is near zero at steady state, but is engaged at depolarization rates >10 mV/s to act as a powerful, supralinear feedback element. This feedback mechanism explains how net ionic current can be constrained to <1-2 pA but reliably inward, thus enabling slow, regular firing.

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

Science.gov (United States)

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-11-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

Potassium in milk and milk products

International Nuclear Information System (INIS)

Sombrito, E.Z.; Nuguid, Z.F.S.; Tangonan, M.C.

1989-01-01

The amount of potassium in imported processed milk was determined by gamma spectral analysis. The results show that the potassium content of diluted infant formula milk is closest to the reported mean concentration of potassium in human milk while other milk types have potassium values similar to the potassium content of cow milk. (Auth.). 2 figs., 5 refs

Asymmetric functional contributions of acidic and aromatic side chains in sodium channel voltage-sensor domains

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Elstone, Fisal D; Niciforovic, Ana P

2014-01-01

largely enigmatic. To this end, natural and unnatural side chain substitutions were made in the S2 hydrophobic core (HC), the extracellular negative charge cluster (ENC), and the intracellular negative charge cluster (INC) of the four VSDs of the skeletal muscle sodium channel isoform (NaV1......Voltage-gated sodium (NaV) channels mediate electrical excitability in animals. Despite strong sequence conservation among the voltage-sensor domains (VSDs) of closely related voltage-gated potassium (KV) and NaV channels, the functional contributions of individual side chains in Nav VSDs remain.......4). The results show that the highly conserved aromatic side chain constituting the S2 HC makes distinct functional contributions in each of the four NaV domains. No obvious cation-pi interaction exists with nearby S4 charges in any domain, and natural and unnatural mutations at these aromatic sites produce...

trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

Directory of Open Access Journals (Sweden)

Jader Santos Cruz

2012-10-01

Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

Effect of polacrilin potassium as disintegrant on bioavailability of diclofenac potassium in tablets : a technical note.

Science.gov (United States)

Bele, Mrudula H; Derle, Diliprao V

2012-09-01

Polacrilin potassium is an ion exchange resin used in oral pharmaceutical formulations as a tablet disintegrant. It is a weakly acidic cation exchange resin. Chemically, it is a partial potassium salt of a copolymer of methacrylic acid with divinyl benzene. It ionizes to an anionic polymer chain and potassium cations. It was hypothesized that polacrilin potassium may be able to improve the permeability of anionic drugs according to the Donnan membrane phenomenon. The effect of polacrilin potassium on the permeability of diclofenac potassium, used as a model anionic drug, was tested in vitro using diffusion cells and in vivo by monitoring serum levels in rats. The amount of drug permeated across a dialysis membrane in vitro was significantly more in the presence of polacrilin potassium. Significant improvement was found in the extent of drug absorption in vivo. It could be concluded that polacrilin potassium may be used as a high-functionality excipient for improving the bioavailability of anionic drugs having poor gastrointestinal permeability.

Voltage Unbalance Compensation with Smart Three-phase Loads

DEFF Research Database (Denmark)

Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

2016-01-01

unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

21 CFR 184.1625 - Potassium citrate.

Science.gov (United States)

2010-04-01

... acid with potassium hydroxide or potassium carbonate. It occurs as transparent crystals or a white... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium citrate. 184.1625 Section 184.1625 Food... Specific Substances Affirmed as GRAS § 184.1625 Potassium citrate. (a) Potassium citrate (C6H5K3O7·H2O, CAS...

Effects of Voltage on Microstructure and Corrosion Resistance of Micro-arc Oxidation Ceramic Coatings Formed on KBM10 Magnesium Alloy

Science.gov (United States)

Lu, J. P.; Cao, G. P.; Quan, G. F.; Wang, C.; Zhuang, J. J.; Song, R. G.

2018-01-01

Micro-arc oxidation (MAO) coatings on KBM10 magnesium alloy were prepared in an electrolyte system with sodium silicate, potassium hydroxide, sodium tungstate, and citric acid. The effects of voltage on the microstructure and corrosion resistance of MAO coatings were studied using stereoscopic microscopy, scanning electron microscopy, x-ray diffraction, scratch tests, potentiodynamic polarization, and electrochemical impedance spectroscopy. The results showed that the roughness of the MAO coatings, diameter, and number of pores increase with the increase in voltage. The coating formed at the voltage of 350 V exhibited the best adhesive strength when evaluated by the automatic scratch tester. The coatings were mainly composed of MgO, MgWO4, and Mg2SiO4, and the content of Mg2SiO4 increased with the increase in voltage. The corrosion resistance of MAO coatings could be improved by changing the applied voltage, and the best corrosion resistance of MAO coating was observed at the voltage of 350 V.

Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

Science.gov (United States)

Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

2018-05-01

Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

Thermoluminescence Response of Copper-Doped Potassium Borate Glass Subjected to 6 Megavolt X-Ray Irradiation

Science.gov (United States)

Hossain, I.; Shekaili, N. K.; Wagiran, H.

2015-03-01

This study addresses the characteristics of Cu-doped and undoped potassium borate glass for use as ionizing radiation dosimeters by investigating and comparing the thermoluminescence responses, linearity, sensitivity and dose response s of the two types of glasses. A number of samples based on xK 2 CO 3 + (100 - x)H 3 BO 3 , where 10 ≤ x ≤ 30 mol.%, have been prepared using a melt quenching technique. The amorphous phases were identified using X-ray diffraction (XRD). The undoped potassium borate samples 20K 2 CO 3 + 80H 3 BO 3 (mol.%) and Cu-doped (0.5 mol.%) samples were placed in a solid phantom apparatus and irradiated with in X-ray tube under 6 MV accelerating voltage with doses ranging from 0.5 to 4.0 Gy. This beam was produced by the Primus MLC 3339 linear accelerator (LINAC) available at Hospital Sultan Ismail, Johor Bahru, Malaysia. The results clearly show the superiority of Cu-doped glass in terms of response and sensitivity to producing luminescence over undoped potassium borate glass. The sensitivity of Cu-doped glass is 6.75 times greater than that of undoped glass.

A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

Directory of Open Access Journals (Sweden)

M. R. Aghamohammadi

2011-06-01

Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

Potassium humate inhibits complement activation and the production of inflammatory cytokines in vitro

Energy Technology Data Exchange (ETDEWEB)

van Rensburg, C.E.J.; Naude, P.J. [University of Pretoria, Pretoria (South Africa)

2009-08-15

The effects of brown coal derived potassium humate on lymphocyte proliferation, cytokine production and complement activation were investigated in vitro. Potassium humate increased lymphocyte proliferation of phytohaemaglutinin A (PHA) and pokeweed mitogen (PWM) stimulated mononuclear lymphocytes (MNL) in vitro from concentrations of 20 to 80 {mu} g/ml, in a dose dependant manner. On the other hand potassium humate, at 40 {mu} g/ml, significantly inhibited the release of TNF-alpha, IL-1 beta, IL-6 and IL-10 by PHA stimulated MNL. Regarding complement activation it was found that potassium humate inhibits the activation of both the alternative and classical pathways without affecting the stability of the red blood cell membranes. These results indicate that the anti-inflammatory potential of potassium humate could be partially due to the inhibition of pro-inflammatory cytokines responsible for the initiation of these reactions as well as inhibition of complement activation. The increased lymphocyte proliferation observed, might be due to increased IL-2 production as previously been documented.

Potassium and Your CKD Diet

Science.gov (United States)

... vegetable in your diet, leach them before using. Leaching is a process by which some potassium can be pulled out ... out of my favorite high-potassium vegetables? The process of leaching will help pull potassium out of some high- ...

Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

International Nuclear Information System (INIS)

Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

1986-01-01

Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

PIP2 mediates functional coupling and pharmacology of neuronal KCNQ channels

DEFF Research Database (Denmark)

Kim, Robin Y; Pless, Stephan A; Kurata, Harley T

2017-01-01

Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation. To elucid......Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation....... These findings reveal an important role for PIP2 in coupling retigabine binding to altered VSD function. We identify a polybasic motif in the proximal C terminus of retigabine-sensitive KCNQ channels that contributes to VSD-pore coupling via PIP2, and thereby influences the unique gating effects of retigabine....

Obtaining of potassium dicyan-argentate

International Nuclear Information System (INIS)

Sattarova, M.A.; Solojenkin, P.M.

1997-01-01

This work is devoted to obtaining of potassium dicyan-argentate. By means of exchange reaction between silver nitrate and potassium cyanide the potassium dicyan-argentate was synthesized. The analysis of obtained samples was carried out by means of titration and potentiometry.

Extrarenal potassium adaptation: role of skeletal muscle

International Nuclear Information System (INIS)

Blachley, J.D.; Crider, B.P.; Johnson, J.H.

1986-01-01

Following the ingestion of a high-potassium-content diet for only a few days, the plasma potassium of rats rises only modestly in response to a previously lethal dose of potassium salts. This acquired tolerance, termed potassium adaptation, is principally the result of increased capacity to excrete potassium into the urine. However, a substantial portion of the acute potassium dose is not immediately excreted and is apparently translocated into cells. Previous studies have failed to show an increase in the content of potassium of a variety of tissues from such animals. Using 86 Rb as a potassium analogue, we have shown that the skeletal muscle of potassium-adapted rats takes up significantly greater amounts of potassium in vivo in response to an acute challenge than does that of control animals. Furthermore, the same animals exhibit greater efflux of 86 Rb following the termination of the acute infusion. We have also shown that the Na+-K+-ATPase activity and ouabain-binding capacity of skeletal muscle microsomes are increased by the process of potassium adaptation. We conclude that skeletal muscle is an important participant in potassium adaptation and acts to temporarily buffer acute increases in the extracellular concentration of potassium

Common variants in the hERG (KCNH2) voltage-gated potassium channel are associated with altered fasting and glucose-stimulated plasma incretin and glucagon responses

DEFF Research Database (Denmark)

Engelbrechtsen, Line; Mahendran, Yuvaraj; Jonsson, Anna

2018-01-01

BACKGROUND: Patients with long QT syndrome due to rare loss-of-function mutations in the human ether-á-go-go-related gene (hERG) have prolonged QT interval, risk of arrhythmias, increased secretion of insulin and incretins and impaired glucagon response to hypoglycemia. This is caused by a dysfun......BACKGROUND: Patients with long QT syndrome due to rare loss-of-function mutations in the human ether-á-go-go-related gene (hERG) have prolonged QT interval, risk of arrhythmias, increased secretion of insulin and incretins and impaired glucagon response to hypoglycemia. This is caused...... by a dysfunctional Kv11.1 voltage-gated potassium channel. Based on these findings in patients with rare variants in hERG, we hypothesized that common variants in hERG may also lead to alterations in glucose homeostasis. Subsequently, we aimed to evaluate the effect of two common gain-of-function variants in hERG...... in hERG on QT-interval and circulation levels of incretins, insulin and glucagon. The Danish population-based Inter99 cohort (n = 5895) was used to assess the effect of common variants on QT-interval. The Danish ADDITION-PRO cohort was used (n = 1329) to study genetic associations with levels of GLP-1...

Sound velocity in potassium hydroxide aqueous solution

International Nuclear Information System (INIS)

Tsapuryan, Kh.D.; Aleksandrov, A.A.; Kochetkov, A.I.

1992-01-01

Measurements of ultrasonic velocities in potassium hydroxide aqueous solutions are carried out within the frames of studies on improvement of water chemistry in NPP cooling systems. Method of echo pulses superposition with acoustic path length of 41.447 mm is used for measurements. The measurements are performed at 2.6 MHz frequency. Complex temperature dependence of ultrasonic velocity is determined. Ultrasonic velocity dependence on pressure is close to linear one. The formula for calculation of thermodynamic properties of the studied solutions on the basis of experimental data obtained is proposed

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

Science.gov (United States)

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

21 CFR 184.1631 - Potassium hydroxide.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium hydroxide. 184.1631 Section 184.1631 Food... Specific Substances Affirmed as GRAS § 184.1631 Potassium hydroxide. (a) Potassium hydroxide (KOH, CAS Reg... pellets, flakes, sticks, lumps, and powders. Potassium hydroxide is obtained commercially from the...

Porosity Dependence of Piezoelectric Properties for Porous Potassium Niobate System Ceramics

Energy Technology Data Exchange (ETDEWEB)

Wada, S; Mase, Y; Shimizu, S; Maeda, K; Fujii, I; Nakashima, K; Pulpan, P; Miyajima, N, E-mail: swada@yamanashi.ac.jp [Interdisciplinary Graduate School of Medical and Engineering, University of Yamanashi, 4-4-37 Takeda, Kofu, Yamanashi 400-8510 (Japan)

2011-10-29

Porous potassium niobate (KNbO{sub 3}, KN) system ceramics were prepared by a conventional sintering method using carbon black (CB) nanoparticles. First, KN nanoparticles with a size of 100 nm was mixed with CB nanoparticles and binder using ball milling with ethanol. The mixture was dried, and pressed into pellets using uniaxial pressing. After binder burnout, these ceramics was sintered in air. Their piezoelectric properties were measured and discussed a relationship between porosity and piezoelectric properties. As the results, with increasing porosity, piezoelectric g33 constant increased significantly, which suggested that porous ceramics were effective for stress sensor application.

Porosity Dependence of Piezoelectric Properties for Porous Potassium Niobate System Ceramics

International Nuclear Information System (INIS)

Wada, S; Mase, Y; Shimizu, S; Maeda, K; Fujii, I; Nakashima, K; Pulpan, P; Miyajima, N

2011-01-01

Porous potassium niobate (KNbO 3 , KN) system ceramics were prepared by a conventional sintering method using carbon black (CB) nanoparticles. First, KN nanoparticles with a size of 100 nm was mixed with CB nanoparticles and binder using ball milling with ethanol. The mixture was dried, and pressed into pellets using uniaxial pressing. After binder burnout, these ceramics was sintered in air. Their piezoelectric properties were measured and discussed a relationship between porosity and piezoelectric properties. As the results, with increasing porosity, piezoelectric g33 constant increased significantly, which suggested that porous ceramics were effective for stress sensor application.

21 CFR 184.1622 - Potassium chloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium chloride. 184.1622 Section 184.1622 Food... Specific Substances Affirmed as GRAS § 184.1622 Potassium chloride. (a) Potassium chloride (KCl, CAS Reg... levels not to exceed current good manufacturing practice. Potassium chloride may be used in infant...

Impact of potassium bromate and potassium iodate in a pound cake system.

Science.gov (United States)

Wilderjans, Edith; Lagrain, Bert; Brijs, Kristof; Delcour, Jan A

2010-05-26

This study investigates the impact of the oxidants potassium bromate and potassium iodate (8, 16, 32, 64, and 128 micromol/g dry matter of egg white protein) on pound cake making. The impact of the oxidants on egg white characteristics was studied in a model system. Differential scanning calorimetry showed that the oxidants caused egg white to denature later. During heating in a rapid visco analyzer, the oxidants caused the free sulfhydryl (SH) group levels to decrease more intensively and over a smaller temperature range. The oxidants made the proteins more resistant to decreases in protein extractability in sodium dodecyl sulfate containing buffer during cake recipe mixing and less resistant to such decreases during cake baking. We assume that, during baking, the degree to which SH/disulfide exchange and SH oxidation can occur depends on the properties of the protein at the onset of the process. In our view, the prevention of extractability loss during mixing increased the availability of SH groups and caused more such loss during baking. During cooling, all cakes baked with added oxidants showed less collapse. On the basis of the presented data, we put forward that only those protein reactions that occur during baking contribute to the formation of a network that supports final cake structure and prevents collapse.

Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

DEFF Research Database (Denmark)

Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

1999-01-01

bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

2016-03-07

We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

Lactococcin G is a potassium ion-conducting, two-component bacteriocin.

Science.gov (United States)

Moll, G; Ubbink-Kok, T; Hildeng-Hauge, H; Nissen-Meyer, J; Nes, I F; Konings, W N; Driessen, A J

1996-02-01

Lactococcin G is a novel lactococcal bacteriocin whose activity depends on the complementary action of two peptides, termed alpha and beta. Peptide synthesis of the alpha and beta peptides yielded biologically active lactococcin G, which was used in mode-of-action studies on sensitive cells of Lactococcus lactis. Approximately equivalent amounts of both peptides were required for optimal bactericidal effect. No effect was observed with either the alpha or beta peptide in the absence of the complementary peptide. The combination of alpha and beta peptides (lactococcin G) dissipates the membrane potential (delta omega), and as a consequence cells release alpha-aminoisobutyrate, a non-metabolizable alanine analog that is accumulated through a proton motive-force dependent mechanism. In addition, the cellular ATP level is dramatically reduced, which results in a drastic decrease of the ATP-driven glutamate uptake. Lactococcin G does not form a proton-conducting pore, as it has no effect on the transmembrane pH gradient. Dissipation of the membrane potential by uncouplers causes a slow release of potassium (rubidium) ions. However, rapid release of potassium was observed in the presence of lactococcin G. These data suggest that the bactericidal effect of lactococcin G is due to the formation of potassium-selective channels by the alpha and beta peptides in the target bacterial membrane.

21 CFR 184.1643 - Potassium sulfate.

Science.gov (United States)

2010-04-01

... hydroxide or potassium carbonate. (b) The ingredient meets the specifications of the “Food Chemicals Codex... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium sulfate. 184.1643 Section 184.1643 Food... Specific Substances Affirmed as GRAS § 184.1643 Potassium sulfate. (a) Potassium sulfate (K2SO4, CAS Reg...

A novel 13 residue acyclic peptide from the marine snail, Conus monile, targets potassium channels.

Science.gov (United States)

Sudarslal, Sadasivannair; Singaravadivelan, Govindaswamy; Ramasamy, Palanisamy; Ananda, Kuppanna; Sarma, Siddhartha P; Sikdar, Sujit K; Krishnan, K S; Balaram, Padmanabhan

2004-05-07

A novel 13-residue peptide Mo1659 has been isolated from the venom of a vermivorous cone snail, Conus monile. HPLC fractions of the venom extract yielded an intense UV absorbing fraction with a mass of 1659Da. De novo sequencing using both matrix assisted laser desorption and ionization and electrospray MS/MS methods together with analysis of proteolytic fragments successfully yielded the amino acid sequence, FHGGSWYRFPWGY-NH(2). This was further confirmed by comparison with the chemically synthesized peptide and by conventional Edman sequencing. Mo1659 has an unusual sequence with a preponderance of aromatic residues and the absence of apolar, aliphatic residues like Ala, Val, Leu, and Ile. Mo1659 has no disulfide bridges distinguishing it from the conotoxins and bears no sequence similarity with any of the acyclic peptides isolated thus far from the venom of cone snails. Electrophysiological studies on the effect of Mo1659 on measured currents in dorsal root ganglion neurons suggest that the peptide targets non-inactivating voltage-dependent potassium channels.

Origin of the transition voltage in gold–vacuum–gold atomic junctions

International Nuclear Information System (INIS)

Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

2013-01-01

The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

Homogeneous catalysis of deuterium transfer by potassium hydroxide and potassium methoxide D2-H2O and D2-CH3OH exchange

International Nuclear Information System (INIS)

Strathdee, G.G.; Garner, D.M.; Given, R.M.

1977-01-01

The kinetics and mechanism of exchange of deuterium between D 2 and water and between D 2 and methanol, catalyzed respectively by concentrated potassium hydroxide and potassium methoxide, has been studied between 348 and 398 K. In the D 2 -KOH-H 2 O case, the transfer of deuterium was found to be controlled by the rate of activation of the D 2 molecule by OH - . Rapid exchange of D + with the aqueous solution followed. From the D 2 -KOCH 3 -CH 3 OH studies, it was concluded that deuterium exchange depended upon the rates of both D 2 activation by methoxide and interaction of the solvent with the transition, or encounter, complex. The dependence of second-order rate constants on solvent activity for both systems was determined by normalization of the exchange reaction rates to unit reagent activity. Analysis of the kinetic isotope effects for each system suggested that their increase with base concentration or temperature was due to solvation effects. (author)

Delayed rectifier potassium channels are involved in SO2 derivative-induced hippocampal neuronal injury.

Science.gov (United States)

Li, Guangke; Sang, Nan

2009-01-01

Recent studies implicate the possible neurotoxicity of SO(2), however, its mechanisms remain unclear. In the present study, we investigated SO(2) derivative-induced effect on delayed rectifier potassium channels (I(K)) and cellular death/apoptosis in primary cultured hippocampal neurons. The results demonstrate that SO(2) derivatives (NaHSO(3) and Na(2)SO(3), 3:1M/M) effectively augmented I(K) and promoted the activation of delayed rectifier potassium channels. Also, SO(2) derivatives increased neuronal death percentage and contributed to the formation of DNA ladder in concentration-dependent manners. Interestingly, the neuronal death and DNA ladder formation, caused by SO(2) derivatives, could be attenuated by the delayed rectifier potassium channel blocker (tetraethylammonium, TEA), but not by the transient outward potassium channel blocker (4-aminopyridine, 4-AP). It implies that stimulating delayed rectifier potassium channels were involved in SO(2) derivative-caused hippocampal neuronal insults, and blocking these channels might be one of the possibly clinical treatment for SO(2)-caused neuronal dysfunction.

Gabapentin Modulates HCN4 Channel Voltage-Dependence

Directory of Open Access Journals (Sweden)

Han-Shen Tae

2017-08-01

Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

Current–voltage characteristics of manganite–titanite perovskite junctions

Directory of Open Access Journals (Sweden)

Benedikt Ifland

2015-07-01

Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

Interacting influence of potassium and polychlorinated biphenyl on cortisol and aldosterone biosynthesis

International Nuclear Information System (INIS)

Li, L.-A.; Lin, Tsu-Chun Emma

2007-01-01

Giving human adrenocortical H295R cells 14 mM KCl for 24 h significantly induced not only aldosterone biosynthesis but also cortisol biosynthesis. Pre-treating the cells with polychlorinated biphenyl 126 (PCB126) further increased potassium-induced aldosterone and cortisol productions in a dose-dependent manner, but all examined concentrations of PCB126 had little effect on the yields of precursor steroids progesterone and 17-OH-progesterone. Subsequent examinations revealed that CYP11B1 and CYP11B2 genes, responsible for the respective final steps of the cortisol and aldosterone biosynthetic pathways, exhibited increased responsiveness to PCB126 under high potassium. While 10 -5 M PCB126 was needed to induce a significant increase in the basal mRNA abundance of either gene, PCB126 could enhance potassium-induced mRNA expression of CYP11B1 at 10 -7 M and CYP11B2 at 10 -9 M. Actually, potassium and PCB126 synergistically upregulated mRNA expression of both genes. Potassium raised the transcriptional rates of CYP11B1 and CYP11B2 probably through a conserved Ad5 cis-element, whereas PCB126 appeared to regulate these two genes at the post-transcriptional level. Positive potassium-PCB126 synergism was also detected in CYP11B2 enzyme activity estimated by aldosterone/progesterone ratio. In contrast, potassium and PCB126 increased CYP11B1 enzyme activity or cortisol/17-OH-progesterone ratio additively. Moreover, potassium improved the time effect of PCB126 on gene expression and enzyme activity of CYP11B2, but not the PCB126 time response of CYP11B1. These data demonstrated that potassium differentially enhanced the potency of PCB126 to induce CYP11B1- and CYP11B2-mediated steroidogenesis

Macroeconomic Assessment of Voltage Sags

Directory of Open Access Journals (Sweden)

Sinan Küfeoğlu

2016-12-01

Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

Active Sites of Spinoxin, a Potassium Channel Scorpion Toxin, Elucidated by Systematic Alanine Scanning.

Science.gov (United States)

Peigneur, Steve; Yamaguchi, Yoko; Kawano, Chihiro; Nose, Takeru; Nirthanan, Selvanayagam; Gopalakrishnakone, Ponnampalam; Tytgat, Jan; Sato, Kazuki

2016-05-31

Peptide toxins from scorpion venoms constitute the largest group of toxins that target the voltage-gated potassium channel (Kv). Spinoxin (SPX) isolated from the venom of scorpion Heterometrus spinifer is a 34-residue peptide neurotoxin cross-linked by four disulfide bridges. SPX is a potent inhibitor of Kv1.3 potassium channels (IC50 = 63 nM), which are considered to be valid molecular targets in the diagnostics and therapy of various autoimmune disorders and cancers. Here we synthesized 25 analogues of SPX and analyzed the role of each amino acid in SPX using alanine scanning to study its structure-function relationships. All synthetic analogues showed similar disulfide bond pairings and secondary structures as native SPX. Alanine replacements at Lys(23), Asn(26), and Lys(30) resulted in loss of activity against Kv1.3 potassium channels, whereas replacements at Arg(7), Met(14), Lys(27), and Tyr(32) also largely reduced inhibitory activity. These results suggest that the side chains of these amino acids in SPX play an important role in its interaction with Kv1.3 channels. In particular, Lys(23) appears to be a key residue that underpins Kv1.3 channel inhibition. Of these seven amino acid residues, four are basic amino acids, suggesting that the positive electrostatic potential on the surface of SPX is likely required for high affinity interaction with Kv1.3 channels. This study provides insight into the structure-function relationships of SPX with implications for the rational design of new lead compounds targeting potassium channels with high potency.

Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

Directory of Open Access Journals (Sweden)

J. Koton

2011-04-01

Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

Membrane Potential-dependent Uptake of 18F-triphenylphosphonium - A New Voltage Sensor as an Imaging Agent for Detecting Burn-induced Apoptosis

Science.gov (United States)

Zhao, Gaofeng; Yu, Yong-Ming; Shoup, Timothy M.; Elmaleh, David R.; Bonab, Ali A.; Tompkins, Ronald G.; Fischman, Alan J.

2014-01-01

Background Mitochondrial dysfunction has been closely related to many pathological processes, such as cellular apoptosis. Alterations in organelle membrane potential are associated with mitochondrial dysfunction. A fluorine -18 labeled phosphonium compound: 18F-triphenylphosphonium (18F-TPP) was prepared to determine its potential use as a mitochondria-targeting radiopharmaceutical to evaluate cellular apoptosis. Methods Studies were conducted in both ex vivo cell lines and in vivo using a burned animal model. Uptake of 18F-TPP was assessed in PC-3 cells by gamma counting under the following conditions: graded levels of extra-cellular potassium concentrations, incubation with carbonyl cyanide m-chlorophenylhydrazone (CCCP) and staurosporine. Apoptosis was studied in a burn animal model using TUNEL staining and simultaneous assessment of 18F-TPP uptake by biodistribution. Results We found that stepwise membrane depolarization by potassium (K) resulted in a linear decrease in 18F-TPP uptake, with a slope of 0.62+/−0.08 and a correlation coefficient of 0.936+/−0.11. Gradually increased concentrations of CCCP lead to decreased uptakes of 18F-TPP. Staurosporine significantly decreased the uptake of 18F-TPP in PC-3 cells from 14.2+/−3.8% to 5.6+/−1.3% (P<0.001). Burn induced significant apoptosis (sham: 4.4 +/−1.8% vs. burn: 24.6+/− 6.7 %; p<0.005) and a reduced uptake of tracer in the spleens of burn injured animals as compared to sham burn controls (burn: 1.13+/−0.24% vs. sham: 3.28+/−0.67%; p<0.005). Biodistribution studies demonstrated that burn induced significant reduction in 18F-TPP uptake in spleen, heart, lung, and liver, which were associated with significantly increased apoptosis. Conclusions 18F-TPP is a promising new voltage sensor for detecting mitochondrial dysfunction and apoptosis in various tissues. PMID:24582214

Hydrogen peroxide-induced reduction of delayed rectifier potassium current in hippocampal neurons involves oxidation of sulfhydryl groups.

Science.gov (United States)

Hasan, Sonia M K; Redzic, Zoran B; Alshuaib, Waleed B

2013-07-03

This study examined the effect of H2O2 on the delayed rectifier potassium current (IKDR) in isolated hippocampal neurons. Whole-cell voltage-clamp experiments were performed on freshly dissociated hippocampal CA1 neurons of SD rats before and after treatment with H2O2. To reveal the mechanism behind H2O2-induced changes in IKDR, cells were treated with different oxidizing and reducing agents. External application of membrane permeable H2O2 reduced the amplitude and voltage-dependence of IKDR in a concentration dependent manner. Desferoxamine (DFO), an iron-chelator that prevents hydroxyl radical (OH) generation, prevented H2O2-induced reduction in IKDR. Application of the sulfhydryl-oxidizing agent 5,5 dithio-bis-nitrobenzoic acid (DTNB) mimicked the effect of H2O2. Sulfhydryl-reducing agents dithiothreitol (DTT) and glutathione (GSH) alone did not affect IKDR; however, DTT and GSH reversed and prevented the H2O2-induced inhibition of IKDR, respectively. Membrane impermeable agents GSH and DTNB showed effects only when added intracellularly identifying intracellular sulfhydryl groups as potential targets for hydroxyl-mediated oxidation. However, the inhibitory effects of DTNB and H2O2 at the positive test potentials were completely and partially abolished by DTT, respectively, suggesting an additional mechanism of action for H2O2, that is not shared by DTNB. In summary, this study provides evidence for the redox modulation of IKDR, identifies hydroxyl radical as an intermediate oxidant responsible for the H2O2-induced decrease in current amplitude and identifies intracellular sulfhydryl groups as an oxidative target. Copyright © 2013 Elsevier B.V. All rights reserved.

The heart and potassium: a banana republic.

Science.gov (United States)

Khan, Ehsan; Spiers, Christine; Khan, Maria

2013-03-01

The importance of potassium in maintaining stable cardiac function is a clinically understood phenomenon. Physiologically the importance of potassium in cardiac function is described by the large number of different kinds of potassium ions channels found in the heart compared to channels and membrane transport mechanisms for other ions such as sodium and calcium. Potassium is important in physiological homeostatic control of cardiac function, but is also of relevance to the diseased state, as potassium-related effects may stabilize or destabilize cardiac function. This article aims to provide a detailed understanding of potassium-mediated cardiac function. This will help the clinical practitioner evaluate how modulation of potassium ion channels by disease and pharmacological manipulation affect the cardiac patient, thus aiding in decision making when faced with clinical problems related to potassium.

Lunar atmosphere. How surface composition and meteoroid impacts mediate sodium and potassium in the lunar exosphere.

Science.gov (United States)

Colaprete, A; Sarantos, M; Wooden, D H; Stubbs, T J; Cook, A M; Shirley, M

2016-01-15

Despite being trace constituents of the lunar exosphere, sodium and potassium are the most readily observed species due to their bright line emission. Measurements of these species by the Ultraviolet and Visible Spectrometer (UVS) on the Lunar Atmosphere and Dust Environment Explorer (LADEE) have revealed unambiguous temporal and spatial variations indicative of a strong role for meteoroid bombardment and surface composition in determining the composition and local time dependence of the Moon's exosphere. Observations show distinct lunar day (monthly) cycles for both species as well as an annual cycle for sodium. The first continuous measurements for potassium show a more repeatable variation across lunations and an enhancement over KREEP (Potassium Rare Earth Elements and Phosphorus) surface regions, revealing a strong dependence on surface composition. Copyright © 2016, American Association for the Advancement of Science.

T-dependent B-cell activation is signalled by an early increase in potassium influx

DEFF Research Database (Denmark)

Owens, T; Kaplan, J G

1982-01-01

both by incorporation of 3H-thymidine after 48 h of culture and by uptake of potassium (measured as 86Rb) after 15 h. Analysis of metaphase chromosomes stained with Hoechst dye 33258 from co-cultured T-enriched and nude lymphocytes (from female and male donors, respectively) mixed in the proportion 1...

Potassium effect on cesium 137 behaviour in natural waters of contaminated regions (Belarus)

International Nuclear Information System (INIS)

Kudel'skij, A.V.; Pashkevich, V.I.; Ovsyannikova, S.V.; Petrovich, A.A.; Smit, D.T.

1998-01-01

Very close relationships between cesium 137 activity of water objects (soil solutions, bog and lake water) and their stable potassium contents have been revealed in the contaminated area in south-eastern Belarus. It was revealed the increase of cesium 137 activity in soil solutions and bog ecosystems proportionally with the increase of potassium content. The exponential dependence of cesium 137 activity of fish production was similar to reverse. The coefficient of cesium 137 accumulation in plants was estimated to be reverse connected with the potassium content in soils. So an universal character of these relations and their specificity are of interest when elaborating countermeasures for reducing population dose loads due to cesium 137 water migration

Increased serum potassium affects renal outcomes

DEFF Research Database (Denmark)

Miao, Y; Dobre, D; Heerspink, H J Lambers

2011-01-01

To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy.......To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy....

Can Diuretics Decrease Your Potassium Level?

Science.gov (United States)

... of low potassium? Can diuretics decrease your potassium level? Answers from Sheldon G. Sheps, M.D. Yes, ... your urine. This can lead to low potassium levels in your blood (hypokalemia). Signs and symptoms of ...

Origin of the transition voltage in gold–vacuum–gold atomic junctions

KAUST Repository

Wu, Kunlin

2012-12-13

The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

International Nuclear Information System (INIS)

Hebboul, S.E.; Garland, J.C.

1993-01-01

We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

[Effects of allitridum on rapidly delayed rectifier potassium current in HEK293 cell line].

Science.gov (United States)

Zhang, Jiancheng; Lin, Kun; Wei, Zhixiong; Chen, Qian; Liu, Li; Zhao, Xiaojing; Zhao, Ying; Xu, Bin; Chen, Xi; Li, Yang

2015-08-01

To study the effect of allitridum on rapidly delayed rectifier potassium current (IKr) in HEK293 cell line. HEK293 cells were transiently transfected with HERG channel cDNA plasmid pcDNA3.1 via Lipofectamine. Allitridum was added to the extracellular solution by partial perfusion after giga seal at the final concentration of 30 µmol/L. Whole-cell patch clamp technique was used to record the HERG currents and gating kinetics before and after allitridum exposure at room temperature. The amplitude and density of IHERG were both suppressed by allitridum in a voltage-dependent manner. In the presence of allitridum, the peak current of IHERG was reduced from 73.5∓4.3 pA/pF to 42.1∓3.6 pA/pF at the test potential of +50 mV (P<0.01). Allitridum also concentration-dependently decreased the density of the IHERG. The IC50 of allitridum was 34.74 µmol/L with a Hill coefficient of 1.01. Allitridum at 30 µmol/L caused a significant positive shift of the steady-state activation curve of IHERG and a markedly negative shift of the steady-state inactivation of IHERG, and significantly shortened the slow time constants of IHERG deactivation. Allitridum can potently block IHERG in HEK293 cells, which might be the electrophysiological basis for its anti-arrhythmic action.

C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

Science.gov (United States)

Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

2013-09-01

Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

Escitalopram block of hERG potassium channels.

Science.gov (United States)

Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June

2014-01-01

Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.

Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

2007-01-01

Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

Studies of alpha-helicity and intersegmental interactions in voltage-gated Na+ channels: S2D4.

Directory of Open Access Journals (Sweden)

Zhongming Ma

2009-11-01

Full Text Available Much data, including crystallographic, support structural models of sodium and potassium channels consisting of S1-S4 transmembrane segments (the "voltage-sensing domain" clustered around a central pore-forming region (S5-S6 segments and the intervening loop. Voltage gated sodium channels have four non-identical domains which differentiates them from the homotetrameric potassium channels that form the basis for current structural models. Since potassium and sodium channels also exhibit many different functional characteristics and the fourth domain (D4 of sodium channels differs in function from other domains (D1-D3, we have explored its structure in order to determine whether segments in D4 of sodium channels differ significantly from that determined for potassium channels. We have probed the secondary and tertiary structure and the role of the individual amino acid residues of the S2D4 of Na(v1.4 by employing cysteine-scanning mutagenesis (with tryptophan and glutamine substituted for native cysteine. A Fourier transform power spectrum of perturbations in free energy of steady-state inactivation gating (using midpoint potentials and slopes of Boltzmann equation fits of channel availability, h(infinity-V plots indicates a substantial amount of alpha-helical structure in S2D4 (peak at 106 degrees, alpha-Periodicity Index (alpha-PI of 3.10, This conclusion is supported by alpha-PI values of 3.28 and 2.84 for the perturbations in rate constants of entry into (beta and exit from (alpha fast inactivation at 0 mV for mutant channels relative to WT channels assuming a simple two-state model for transition from the open to inactivated state. The results of cysteine substitution at the two most sensitive sites of the S2D4 alpha-helix (N1382 and E1392C support the existence of electrostatic network interactions between S2 and other transmembrane segments within Na(v1.4D4 similar to but not identical to those proposed for K+ channels.

Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

Science.gov (United States)

Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

2017-09-20

Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

Directory of Open Access Journals (Sweden)

Paula L Diaz-Sylvester

Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

Simulation of forward dark current voltage characteristics of tandem solar cells

International Nuclear Information System (INIS)

Rubinelli, F.A.

2012-01-01

The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

Energy Technology Data Exchange (ETDEWEB)

Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

2007-04-30

The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

Preparation of potassium-reduced tantalum powders

International Nuclear Information System (INIS)

Kolosov, V.N.; Miroshnichenko, M.N.; Orlov, V.M.; Prokhorova, T.Yu.

2005-01-01

Characteristics of tantalum powders prepared by reduction of molten potassium heptafluorotantalate with liquid potassium are studied in a temperature range of 750 - 850 deg C using potassium chloride as a flux at a ratio of K 2 TaF 7 : KCl = 1, 2, and 3. The use of potassium as a reducing agent facilitates washing of tantalum powders for impurity salt removal, reduces sodium content and leakage currents in the anodes. As compared to sodium process, the potassium reduction results in a high yield of sponge material, a decrease in the specific surface area and yield of tantalum powder suitable for manufacture of capacitor anodes [ru

Intermediate state trapping of a voltage sensor

DEFF Research Database (Denmark)

Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

2012-01-01

Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

Enterocin P Causes Potassium Ion Efflux from Enterococcus faecium T136 Cells

Science.gov (United States)

Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.; Moll, Gert N.; Driessen, Arnold J. M.

2001-01-01

Enterocin P is a bacteriocin produced by Enterococcus faecium P13. We studied the mechanism of its bactericidal action using enterocin-P-sensitive E. faecium T136 cells. The bacteriocin is incapable of dissipating the transmembrane pH gradient. On the other hand, depending on the buffer used, enterocin P dissipates the transmembrane potential. Enterocin P efficiently elicits efflux of potassium ions, but not of intracellularly accumulated anions like phosphate and glutamate. Taken together, these data demonstrate that enterocin P forms specific, potassium ion-conducting pores in the cytoplasmic membrane of target cells. PMID:11181377

Nonlinear electrokinetics at large voltages

Energy Technology Data Exchange (ETDEWEB)

Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

2009-07-15

The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

Potassium Intake, Bioavailability, Hypertension, and Glucose Control

Directory of Open Access Journals (Sweden)

Michael S. Stone

2016-07-01

Full Text Available Potassium is an essential nutrient. It is the most abundant cation in intracellular fluid where it plays a key role in maintaining cell function. The gradient of potassium across the cell membrane determines cellular membrane potential, which is maintained in large part by the ubiquitous ion channel the sodium-potassium (Na+-K+ ATPase pump. Approximately 90% of potassium consumed (60–100 mEq is lost in the urine, with the other 10% excreted in the stool, and a very small amount lost in sweat. Little is known about the bioavailability of potassium, especially from dietary sources. Less is understood on how bioavailability may affect health outcomes. Hypertension (HTN is the leading cause of cardiovascular disease (CVD and a major financial burden ($50.6 billion to the US public health system, and has a significant impact on all-cause morbidity and mortality worldwide. The relationship between increased potassium supplementation and a decrease in HTN is relatively well understood, but the effect of increased potassium intake from dietary sources on blood pressure overall is less clear. In addition, treatment options for hypertensive individuals (e.g., thiazide diuretics may further compound chronic disease risk via impairments in potassium utilization and glucose control. Understanding potassium bioavailability from various sources may help to reveal how specific compounds and tissues influence potassium movement, and further the understanding of its role in health.

Wind Power Plant Voltage Stability Evaluation: Preprint

Energy Technology Data Exchange (ETDEWEB)

Muljadi, E.; Zhang, Y. C.

2014-09-01

Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

New phenomenon of potassium permanganate treatment effect in polymer irradiated with heavy ions

International Nuclear Information System (INIS)

Zhou Mi; Liu Yibao; Wei Qianglin; Fu Yuanyong; Ju Wei; Chen Dongfeng; Wu Zhendong; Liang Haiying

2014-01-01

Background: Nuclear track membranes offer distinct advantages over conventional membranes due to their precisely determined structure. Their pore size, shape and density can be controlled intentionally so that a membrane with the required characteristics can be produced. The track etching technology plays an important role in the production of nuclear track membranes. Purpose: The effect of potassium permanganate solution pretreatment on the etching rate for polyethylene terephthalate film (PET) is studied in this work. Methods: The conductivity method is used in this research. Under different conditions, the PET films were pretreated for 1 h, 2 h, 3 h, 4 h, 5 h and 6 h by potassium permanganate solution. 5%, 15%, 25%, 35% of 2-mol·L -1 sulfuric acid solutions were added in 0.1 mol·L -1 potassium permanganate solution. Results: Track etching rate reached a peak at 2 h, Afterwards, with the pretreatment time increasing, the track etching rate declined, and the longer of the pretreatment time, the smaller of the bulk etching rate. Half cone angle either. Adding to sulfuric solution, the experimental results show that the effect on track etching rate is small, with the amount of sulfuric acid increasing, bulk etching rate becomes larger, the same change with half cone angle. In addition, the DC voltage used in the conductivity method also has impact on the track etching rate. Conclusion: The experiment has provided a method to improve the etching rate. (authors)

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

21 CFR 582.1631 - Potassium hydroxide.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium hydroxide. 582.1631 Section 582.1631 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1631 Potassium hydroxide. (a) Product. Potassium hydroxide. (b) Conditions of use. This...

Alkylation of 2,6-di-tert-butylphenol with methyl acrylate catalyzed by potassium-2,6-di-tert-butylphenoxide

OpenAIRE

Zaikov, Gennady; Volod’kin, Alexander

2010-01-01

The kinetics of catalytic alkylation of 2,6-ditert- butylphenol (ArOH) with methyl acrylate (MA) in the presence of potassium 2,6-di-tert-butylphenoxide (ArOK) depends on the method for the preparation of ArOK. The reaction ofArOH withKOHat temperatures > 453 Kaffords monomeric ArOK, which properties differ from those in the case of potassium 2,6-di-tert-butylphenoxide synthesized by the earliermethods.The regularities ofArOH alkylation depend ontheArOKconcentration, theArOH...

21 CFR 582.5622 - Potassium chloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium chloride. 582.5622 Section 582.5622 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5622 Potassium chloride. (a) Product. Potassium chloride. (b) Conditions of use. This...

High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

Science.gov (United States)

Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

2012-01-01

BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

Directory of Open Access Journals (Sweden)

Padalko D.A.

2017-12-01

Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

Science.gov (United States)

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

Potassium distribution in sugar cane

International Nuclear Information System (INIS)

Medina, N.H.

2014-01-01

In this work the distribution of potassium in sugarcane has been studied during its growth in two different conditions. In the first one the sugarcane soil was prepared with natural fertilizers, using sugarcane bagasse and, in another plantation the soil was prepared with commercial fertilizer NPK with a proportion of 10-10-10. For the measurement of potassium concentration in each part of the plant, gamma ray spectrometry techniques have been used to measure gamma-rays emitted from the radioisotope 40 K present in the sugarcane samples. The concentration of potassium in roots, stems and leaves were measured periodically. The results for sugarcane cultivated in soil with natural fertilizer show a higher concentration of potassium at the beginning of plant development and over time there is an oscillatory behavior in this concentration in each part of the plant, reaching a lower concentration in the adult plant. The results for the plant grown in soil with NPK fertilizer, indicate that the potassium concentration is higher in the stem at the beginning of cultivation and remained practically constant over time in various parts of the plant, with higher values in the leaves and stem than at the root. On the other hand, the results obtained using fertilizer NPK shows a lower potassium concentration, since the fertilizer provoked a much higher growth rate. (author)

A common pathway for charge transport through voltage-sensing domains.

Science.gov (United States)

Chanda, Baron; Bezanilla, Francisco

2008-02-07

Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

Thermal voltage noise in layered superconductors

International Nuclear Information System (INIS)

Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

1995-01-01

Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

Science.gov (United States)

Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

2010-10-01

The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

21 CFR 172.160 - Potassium nitrate.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium nitrate. 172.160 Section 172.160 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Preservatives § 172.160 Potassium nitrate. The food additive potassium nitrate may be safely used as a curing...

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

Science.gov (United States)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

Proapoptotic Role of Potassium Ions in Liver Cells

Directory of Open Access Journals (Sweden)

Zhenglin Xia

2016-01-01

Full Text Available Potassium channels are transmembrane proteins that selectively promote the infiltration of potassium ions. The significance of these channels for tumor biology has become obvious. However, the effects of potassium ions on the tumor or normal cells have seldom been studied. To address this problem, we studied the biological effects of L02 and HepG2 cells with ectogenous potassium ions. Cell proliferation, cell cycle, and apoptosis rate were analyzed. Our results indicated that potassium ions inhibited proliferation of L02 and HepG2 cells and promoted their apoptosis. Potassium ions induced apoptosis through regulating Bcl-2 family members and depolarized the mitochondrial membrane, especially for HepG2 cell. These biological effects were associated with channel protein HERG. By facilitating expression of channel protein HERG, potassium ions may prevent it from being shunted to procancerous pathways by inducing apoptosis. These results demonstrated that potassium ions may be a key regulator of liver cell function. Thus, our findings suggest that potassium ions could inhibit tumorigenesis through inducing apoptosis of hepatoma cells by upregulating potassium ions transport channel proteins HERG and VDAC1.

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

Directory of Open Access Journals (Sweden)

S. Demirezen

Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

Patients with Long QT Syndrome Due to Impaired hERG-encoded Kv11.1 Potassium Channel Have Exaggerated Endocrine Pancreatic and Incretin Function Associated with Reactive Hypoglycemia

DEFF Research Database (Denmark)

Hyltén-Cavallius, Louise; Iepsen, Eva W; Wewer Albrechtsen, Nicolai J

2017-01-01

Background -Loss-of-function mutations in hERG (encoding the Kv11.1 voltage-gated potassium channel) cause long QT syndrome (LQT2) due to prolonged cardiac repolarization. However, Kv11.1 is also present in pancreatic α and β cells and intestinal L and K cells, secreting glucagon, insulin, and th...

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

Science.gov (United States)

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

International Nuclear Information System (INIS)

Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

2014-01-01

Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

Functional interactions at the interface between voltage-sensing and pore domains in the Shaker K(v) channel.

Science.gov (United States)

Soler-Llavina, Gilberto J; Chang, Tsg-Hui; Swartz, Kenton J

2006-11-22

Voltage-activated potassium (K(v)) channels contain a central pore domain that is partially surrounded by four voltage-sensing domains. Recent X-ray structures suggest that the two domains lack extensive protein-protein contacts within presumed transmembrane regions, but whether this is the case for functional channels embedded in lipid membranes remains to be tested. We investigated domain interactions in the Shaker K(v) channel by systematically mutating the pore domain and assessing tolerance by examining channel maturation, S4 gating charge movement, and channel opening. When mapped onto the X-ray structure of the K(v)1.2 channel the large number of permissive mutations support the notion of relatively independent domains, consistent with crystallographic studies. Inspection of the maps also identifies portions of the interface where residues are sensitive to mutation, an external cluster where mutations hinder voltage sensor activation, and an internal cluster where domain interactions between S4 and S5 helices from adjacent subunits appear crucial for the concerted opening transition.

Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies - a national cohort study.

Science.gov (United States)

Celicanin, M; Blaabjerg, M; Maersk-Moller, C; Beniczky, S; Marner, L; Thomsen, C; Bach, F W; Kondziella, D; Andersen, H; Somnier, F; Illes, Z; Pinborg, L H

2017-08-01

The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2 antibodies in the serum/cerebrospinal fluid between 2009 and 2013 with follow-up interviews in 2015 and 2016. We evaluated antibody status, symptoms leading to testing, course of disease, suspected diagnosis and time of admission as well as diagnosis and treatment. All magnetic resonance imaging, electroencephalography and 18 F-fluorodeoxyglucose positron emission tomography scans were re-evaluated by experts in the field. A total of 28/192 patients tested positive for VGKC-complex antibodies by radioimmunoassay and indirect immunofluorescence; 17 had antibodies to LGI1 and 6/7 of the available cerebrospinal fluids from these patients were seropositive. These 17 patients all had a clinical phenotype appropriate to LGI1 antibodies. The remaining 11 were LGI1 negative (n = 4) or not tested (n = 7). Of these, two had a phenotype consistent with limbic encephalitis. The remaining phenotypes were Guillain-Barré syndrome, Creutzfeldt-Jakob disease, neuromyotonia and anti-N-methyl-D-aspartate receptor encephalitis. Magnetic resonance imaging abnormalities were demonstrated in 69% of the LGI1-positive patients. Two patients with normal magnetic resonance imaging demonstrated temporal lobe hypermetabolism using 18 F-fluorodeoxyglucose positron emission tomography. Abnormal electroencephalography recordings were found in 86% of the patients. Upon follow-up (median 3.2 years), the median modified Rankin Scale score of anti-LGI1-positive patients was 2 and only two patients reported seizures in the past year. Patients diagnosed with anti-LGI1 autoimmune encephalitis increased significantly from 2009 to 2014, probably due to increased awareness. In contrast to seropositive anti-VGKC-complex patients, all anti-LGI1

Free-energy relationships in ion channels activated by voltage and ligand

Science.gov (United States)

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Regulation of renal Na+-K-ATPase in the rat: role of increased potassium transport

International Nuclear Information System (INIS)

Mujais, S.K.; Chekal, M.A.; Hayslett, J.P.; Katz, A.I.

1986-01-01

The purpose of this study was to characterize the alterations in collecting tubule Na + -K + -ATPase activity produced by sustained increments in dietary potassium in the rat and to evaluate the role of aldosterone in their generation. In adrenal-intact animals, feeding a high-potassium diet or administration of a high physiological dose of aldosterone, which simulates the delivery rate of this hormone during potassium loading, caused marked increments in Na + -K + -ATPase activity in the cortical collecting tubule (CCT) but had no effect on the enzyme in the inner stripe of the medullary collecting tubule (MCT). A significant increase in enzyme activity was also observed after smaller dietary potassium increments and after 4 days of dietary potassium load. In adrenalectomized rats provided with physiological replacement doses of corticosterone and aldosterone, Na + -K + -ATPase activity in both CCT and MCT was similar to that of adrenal-intact controls but remained unchanged after 7 days on the potassium-enriched (10-fold) diet. In contrast, adrenalectomized animals receiving the high physiological dose of aldosterone displayed an increase in Na + -K + -ATPase activity of CCT comparable with that of adrenal-intact animals, whereas the enzyme activity in the MCT was unaffected. In conclusion, 1) following chronic potassium loading Na + -K + -ATPase activity increases significantly in the CCT with no change in its activity in the inner stripe of the MCT; 2) this increase in enzyme activity occurs in a time-dependent fashion and in proportion to the potassium load; and 3) the stimulation of Na + -K + -ATPase activity in adrenal-replaced rats is facilitated by augmented levels of aldosterone, such as those actually observed in adrenal-intact rats subjected to chronic potassium loading

Regulation of renal Na -K-ATPase in the rat: role of increased potassium transport

Energy Technology Data Exchange (ETDEWEB)

Mujais, S.K.; Chekal, M.A.; Hayslett, J.P.; Katz, A.I.

1986-08-01

The purpose of this study was to characterize the alterations in collecting tubule Na -K -ATPase activity produced by sustained increments in dietary potassium in the rat and to evaluate the role of aldosterone in their generation. In adrenal-intact animals, feeding a high-potassium diet or administration of a high physiological dose of aldosterone, which simulates the delivery rate of this hormone during potassium loading, caused marked increments in Na -K -ATPase activity in the cortical collecting tubule (CCT) but had no effect on the enzyme in the inner stripe of the medullary collecting tubule (MCT). A significant increase in enzyme activity was also observed after smaller dietary potassium increments and after 4 days of dietary potassium load. In adrenalectomized rats provided with physiological replacement doses of corticosterone and aldosterone, Na -K -ATPase activity in both CCT and MCT was similar to that of adrenal-intact controls but remained unchanged after 7 days on the potassium-enriched (10-fold) diet. In contrast, adrenalectomized animals receiving the high physiological dose of aldosterone displayed an increase in Na -K -ATPase activity of CCT comparable with that of adrenal-intact animals, whereas the enzyme activity in the MCT was unaffected. In conclusion, 1) following chronic potassium loading Na -K -ATPase activity increases significantly in the CCT with no change in its activity in the inner stripe of the MCT; 2) this increase in enzyme activity occurs in a time-dependent fashion and in proportion to the potassium load; and 3) the stimulation of Na -K -ATPase activity in adrenal-replaced rats is facilitated by augmented levels of aldosterone, such as those actually observed in adrenal-intact rats subjected to chronic potassium loading.

Kidney in potassium depletion. II. K+ handling by the isolated perfused rat kidney

International Nuclear Information System (INIS)

Hayashi, M.; Katz, A.I.

1987-01-01

In a companion paper the authors reported a large increment in Na + -K + -ATPase activity and [ 3 H]ouabain binding the inner stripe of outer medullary collecting tubules from K-depleted rats. To test the hypothesis that the increased number of Na + -K + pumps in these animals may be involved in potassium reabsorption they examined the effect of ouabain on K excretion by isolated, perfused kidneys from rats fed a K-free diet for 3 wk. Kidneys from K-depleted rats retain potassium avidly, both the fractional (FE/sub K/) and absolute K excretion being approximately fivefold lower than in control kidneys. Ouabain (5 mM) increased FE/sub K/ in kidneys from each K-depleted rat; similar results were obtained when kidneys were perfused with low and high potassium concentrations. In contrast, ouabain produced a variable effect in control kidneys, that depended on the perfusate potassium concentration. In K-depleted rats amiloride did not significantly alter K excretion and did not block the ouabain-induced kaliuresis, suggesting that the latter is not due to enhanced secretion secondary to increased distal fluid delivery. These results provide evidence for ouabain-sensitive potassium reabsorption in kidneys of chronically K-depleted rats, and suggest an explanation for the increased Na + -K + -ATPase observed in such animals

Level of radioactive strontium-90, potassium-40 in bone tissues of sheep

International Nuclear Information System (INIS)

Bandi, D.; Andrei, S.; Ehnkhtuya, Ts.

1992-01-01

We have studied the level of strontium-90 and potassium-40 in bone tissues of sheep. Level of the radioactive elements in its bone tissues decreases depending on its ripeness, but a strong decrease was observable in its old ages

Autoimmune encephalitis with anti-leucine-rich glioma-inactivated 1 or anti-contactin-associated protein-like 2 antibodies (formerly called voltage-gated potassium channel-complex antibodies).

Science.gov (United States)

Bastiaansen, Anna E M; van Sonderen, Agnes; Titulaer, Maarten J

2017-06-01

Twenty years since the discovery of voltage-gated potassium channel (VGKC)-related autoimmunity; it is currently known that the antibodies are not directed at the VGKC itself but to two closely associated proteins, anti-leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (Caspr2). Antibodies to LGI1 and Caspr2 give well-described clinical phenotypes. Anti-LGI1 encephalitis patients mostly have limbic symptoms, and anti-Caspr2 patients have variable syndromes with both central and peripheral symptoms. A large group of patients with heterogeneous symptoms are VGKC positive but do not have antibodies against LGI1 or Caspr2. The clinical relevance of VGKC positivity in these 'double-negative' patients is questionable. This review focusses on these three essentially different subgroups. The clinical phenotypes of anti-LGI1 encephalitis and anti-Caspr2 encephalitis have been described in more detail including data on treatment and long-term follow-up. A specific human leukocyte antigen (HLA) association was found in nontumor anti-LGI1 encephalitis, but not clearly in those with tumors. There has been increasing interest in the VGKC patients without LGI1/Caspr2 antibodies questioning its relevance in clinical practice. Anti-LGI1 encephalitis and anti-Caspr2 encephalitis are separate clinical entities. Early recognition and treatment is necessary and rewarding. The term VGKC-complex antibodies, lumping patients with anti-LGI1, anti-Caspr2 antibodies or lacking both, should be considered obsolete.

Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

NARCIS (Netherlands)

Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

1993-01-01

A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

Enthalpies of potassium iodide dissolution in dimethyl acetamide mixtures with water

International Nuclear Information System (INIS)

Privalova, N.M.; Gritsenko, S.I.; Vorob'ev, A.F.

1986-01-01

Enthalpies of potassium iodide dissolution in mixed dimethyl acetamide - water solvent at 298.15 K in the whole range of dimethyl acetamide compositions are measured by the calorimetric method. From the plots of KI dissolution enthalpy dependence and dependence of experimental ΔH p∞ 0 value deviations from calculational ones on solvent composition, as well as from the results of calculation of solvate shell composition of potassium iodide ions in the mixed solvent, it is obvious that in the region of 0-15 mol% concentrations of dimethyl acetamide insufficient enrichment of solvate ion shells by dimethyl acetamide (DMAA) occurs, in the region of 15-40 mol% DMAA compositions enrichment of solvate shells of ions by water occurs, in the region of 40-100 mol% DMAA enrichment of solvate ion shells by the organic component in comparison with mixture compostion occurs. Maximum enrichment of solvate ion shells by mixture components in three above mentioned regions of the mixed solvent occurs at 10, 30 and 80 mol% DMAA concentrations

Multi-objective optimization of distributed generation with voltage ...

African Journals Online (AJOL)

DR OKE

1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

Population coherent control of Rydberg potassium atom via adiabatic passage

International Nuclear Information System (INIS)

Jiang Li-Juan; Zhang Xian-Zhou; Jia Guang-Rui; Zhang Yong-Hui; Xia Li-Hua

2013-01-01

The time-dependent multilevel approach (TDMA) and B-spline expansion technique are used to study the coherent population transfer between the quantum states of a potassium atom by a single frequency-chirped microwave pulse. The Rydberg potassium atom energy levels of n = 6–15, l = 0–5 states in zero field are calculated and the results are in good agreement with other theoretical values. The time evolutions of the population transfer of the six states from n = 70 to n = 75 in different microwave fields are obtained. The results show that the coherent control of the population transfer from the lower states to the higher ones can be accomplished by optimizing the microwave pulse parameters. (atomic and molecular physics)

Recording membrane potential changes through photoacoustic voltage sensitive dye

DEFF Research Database (Denmark)

Zhang, Haichong K.; Kang, Jeeun; Yan, Ping

2017-01-01

Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...

Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

International Nuclear Information System (INIS)

Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

2002-01-01

The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

Potassium-doped n-type bilayer graphene

Science.gov (United States)

Yamada, Takatoshi; Okigawa, Yuki; Hasegawa, Masataka

2018-01-01

Potassium-doped n-type bilayer graphene was obtained. Chemical vapor deposited bilayer and single layer graphene on copper (Cu) foils were used. After etching of Cu foils, graphene was dipped in potassium hydroxide aqueous solutions to dope potassium. Graphene on silicon oxide was characterized by X-ray photoelectron spectroscopy (XPS), energy dispersive X-ray spectroscopy (EDX), and Raman spectroscopy. Both XPS and EDX spectra indicated potassium incorporation into the bilayer graphene via intercalation between the graphene sheets. The downward shift of the 2D peak position of bilayer graphene after the potassium hydroxide (KOH) treatment was confirmed in Raman spectra, indicating that the KOH-treated bilayer graphene was doped with electrons. Electrical properties were measured using Hall bar structures. The Dirac points of bilayer graphene were shifted from positive to negative by the KOH treatment, indicating that the KOH-treated bilayer graphene was n-type conduction. For single layer graphene after the KOH treatment, although electron doping was confirmed from Raman spectra, the peak of potassium in the X-ray photoelectron spectroscopy (XPS) spectrum was not detected. The Dirac points of single layer graphene with and without the KOH treatment showed positive.

Potassium chloride production by microcline chlorination

Energy Technology Data Exchange (ETDEWEB)

Orosco, Pablo, E-mail: porosco@unsl.edu.ar [Instituto de Investigaciones en Tecnología Química (INTEQUI), Chacabuco y Pedernera, San Luis (Argentina); Facultad de Química, Bioquímica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, San Luis (Argentina); Ruiz, María del Carmen [Instituto de Investigaciones en Tecnología Química (INTEQUI), Chacabuco y Pedernera, San Luis (Argentina)

2015-08-10

Highlights: • Use of chlorination for the KCl production. • The reagents used were microcline, hydromagnesite and chlorine. • Isothermal and non-isothermal assays were performed in Cl{sub 2}–N{sub 2} mixture. • The chlorination generated KCl at 700 °C. • The chlorination products promote KCl formation. - Abstract: The potassium chloride is one of the most important fertilizers used in agriculture. The current demand of this salt makes interesting the study of potassium chloride production from unconventional potassium resources. In this work the potassium chloride production by chlorination of microcline was investigated. The starting reagents were microcline, hydromagnesite and chlorine. Non-isothermal and isothermal chlorination assays were carried out in a thermogravimetric device adapted to work in corrosive atmospheres. The temperature effect on potassium extraction and the phase transformations produced during chlorination of microcline were studied. The reagents and reaction products were analyzed by X-ray fluorescence (XRF) and X-ray diffraction (XRD). The experimental results indicated that by chlorination of microcline an important extraction of potassium in the temperature range from 800 to 900 °C was produced. Moreover, at 800 °C the forsterite, enstatite and magnesium aluminate spinel phases were generated.

New method for determining avalanche breakdown voltage of silicon photomultipliers

International Nuclear Information System (INIS)

Chirikov-Zorin, I.

2017-01-01

The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

Expression of the voltage-gated potassium channel KCNQ1 in mammalian taste bud cells and the effect of its null-mutation on taste preferences.

Science.gov (United States)

Wang, Hong; Iguchi, Naoko; Rong, Qi; Zhou, Minliang; Ogunkorode, Martina; Inoue, Masashi; Pribitkin, Edmund A; Bachmanov, Alexander A; Margolskee, Robert F; Pfeifer, Karl; Huang, Liquan

2009-01-20

Vertebrate taste buds undergo continual cell turnover. To understand how the gustatory progenitor cells in the stratified lingual epithelium migrate and differentiate into different types of mature taste cells, we sought to identify genes that were selectively expressed in taste cells at different maturation stages. Here we report the expression of the voltage-gated potassium channel KCNQ1 in mammalian taste buds of mouse, rat, and human. Immunohistochemistry and nuclear staining showed that nearly all rodent and human taste cells express this channel. Double immunostaining with antibodies against type II and III taste cell markers validated the presence of KCNQ1 in these two types of cells. Co-localization studies with cytokeratin 14 indicated that KCNQ1 is also expressed in type IV basal precursor cells. Null mutation of the kcnq1 gene in mouse, however, did not alter the gross structure of taste buds or the expression of taste signaling molecules. Behavioral assays showed that the mutant mice display reduced preference to some umami substances, but not to any other taste compounds tested. Gustatory nerve recordings, however, were unable to detect any significant change in the integrated nerve responses of the mutant mice to umami stimuli. These results suggest that although it is expressed in nearly all taste bud cells, the function of KCNQ1 is not required for gross taste bud development or peripheral taste transduction pathways, and the reduced preference of kcnq1-null mice in the behavioral assays may be attributable to the deficiency in the central nervous system or other organs.

A simple calibration of a whole-body counter for the measurement of total body potassium in humans

International Nuclear Information System (INIS)

Abdel-Wahab, M.S.; El-Fiki, S.A.; El-Enany, N.; Youssef, S.K.; Aly, A.M.; Abbas, M.T.

1992-01-01

A simple calibration procedure for the Inshas whole body counter for evaluating total body potassium has been adopted. More than 120 Egyptian employees in the Nuclear Research Center (N.R.C.) were studied for their total body potassium (TBK). The potassium values were found to have an average of 2.85±0.57 g K kg -1 body weight for males and 2.62±0.52 g K kg -1 for females, which are higher than the recommended value given for reference man by ICRP. The TBK varied directly with body build index and is slightly sex dependent (Author)

Race, Serum Potassium, and Associations With ESRD and Mortality.

Science.gov (United States)

Chen, Yan; Sang, Yingying; Ballew, Shoshana H; Tin, Adrienne; Chang, Alex R; Matsushita, Kunihiro; Coresh, Josef; Kalantar-Zadeh, Kamyar; Molnar, Miklos Z; Grams, Morgan E

2017-08-01

Recent studies suggest that potassium levels may differ by race. The basis for these differences and whether associations between potassium levels and adverse outcomes differ by race are unknown. Observational study. Associations between race and potassium level and the interaction of race and potassium level with outcomes were investigated in the Racial and Cardiovascular Risk Anomalies in Chronic Kidney Disease (RCAV) Study, a cohort of US veterans (N=2,662,462). Associations between African ancestry and potassium level were investigated in African Americans in the Atherosclerosis Risk in Communities (ARIC) Study (N=3,450). Race (African American vs non-African American and percent African ancestry) for cross-sectional analysis; serum potassium level for longitudinal analysis. Potassium level for cross-sectional analysis; mortality and end-stage renal disease for longitudinal analysis. The RCAV cohort was 18% African American (N=470,985). Potassium levels on average were 0.162mmol/L lower in African Americans compared with non-African Americans, with differences persisting after adjustment for demographics, comorbid conditions, and potassium-altering medication use. In the ARIC Study, higher African ancestry was related to lower potassium levels (-0.027mmol/L per each 10% African ancestry). In both race groups, higher and lower potassium levels were associated with mortality. Compared to potassium level of 4.2mmol/L, mortality risk associated with lower potassium levels was lower in African Americans versus non-African Americans, whereas mortality risk associated with higher levels was slightly greater. Risk relationships between potassium and end-stage renal disease were weaker, with no difference by race. No data for potassium intake. African Americans had slightly lower serum potassium levels than non-African Americans. Consistent associations between potassium levels and percent African ancestry may suggest a genetic component to these differences. Higher and

Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

DEFF Research Database (Denmark)

Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

2012-01-01

The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

Docetaxel modulates the delayed rectifier potassium current (IK) and ATP-sensitive potassium current (IKATP) in human breast cancer cells.

Science.gov (United States)

Sun, Tao; Song, Zhi-Guo; Jiang, Da-Qing; Nie, Hong-Guang; Han, Dong-Yun

2015-04-01

Ion channel expression and activity may be affected during tumor development and cancer growth. Activation of potassium (K(+)) channels in human breast cancer cells is reported to be involved in cell cycle progression. In this study, we investigated the effects of docetaxel on the delayed rectifier potassium current (I K) and the ATP-sensitive potassium current (I KATP) in two human breast cancer cell lines, MCF-7 and MDA-MB-435S, using the whole-cell patch-clamp technique. Our results show that docetaxel inhibited the I K and I KATP in both cell lines in a dose-dependent manner. Compared with the control at a potential of +60 mV, treatment with docetaxel at doses of 0.1, 1, 5, and 10 µM significantly decreased the I K in MCF-7 cells by 16.1 ± 3.5, 30.2 ± 5.2, 42.5 ± 4.3, and 46.4 ± 9% (n = 5, P < 0.05), respectively and also decreased the I KATP at +50 mV. Similar results were observed in MDA-MB-435S cells. The G-V curves showed no significant changes after treatment of either MCF-7 or MDA-MB-435S cells with 10 μM docetaxel. The datas indicate that the possible mechanisms of I K and I KATP inhibition by docetaxel may be responsible for its effect on the proliferation of human breast cancer cells.

Technical and economic considerations of extra high voltage power transmission

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1966-09-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

The twisted ion-permeation pathway of a resting voltage-sensing domain.

Science.gov (United States)

Tombola, Francesco; Pathak, Medha M; Gorostiza, Pau; Isacoff, Ehud Y

2007-02-01

Proteins containing voltage-sensing domains (VSDs) translate changes in membrane potential into changes in ion permeability or enzymatic activity. In channels, voltage change triggers a switch in conformation of the VSD, which drives gating in a separate pore domain, or, in channels lacking a pore domain, directly gates an ion pathway within the VSD. Neither mechanism is well understood. In the Shaker potassium channel, mutation of the first arginine residue of the S4 helix to a smaller uncharged residue makes the VSD permeable to ions ('omega current') in the resting conformation ('S4 down'). Here we perform a structure-guided perturbation analysis of the omega conductance to map its VSD permeation pathway. We find that there are four omega pores per channel, which is consistent with one conduction path per VSD. Permeating ions from the extracellular medium enter the VSD at its peripheral junction with the pore domain, and then plunge into the core of the VSD in a curved conduction pathway. Our results provide a model of the resting conformation of the VSD.

NCBI nr-aa BLAST: CBRC-GACU-17-0011 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-17-0011 ref|NP_005540.1| potassium voltage-gated channel, shaker-related ...4990.1| Potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapiens] emb|CAH74103.1| ...potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapien...s] gb|EAW56454.1| potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapiens] NP_005540.1 0.0 62% ...

NCBI nr-aa BLAST: CBRC-FRUB-02-0329 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-FRUB-02-0329 ref|NP_005540.1| potassium voltage-gated channel, shaker-related ...4990.1| Potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapiens] emb|CAH74103.1| ...potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapien...s] gb|EAW56454.1| potassium voltage-gated channel, shaker-related subfamily, member 10 [Homo sapiens] NP_005540.1 0.0 66% ...

Crystallization and preliminary X-ray crystallographic characterization of a cyclic nucleotide-binding homology domain from the mouse EAG potassium channel

International Nuclear Information System (INIS)

Marques-Carvalho, Maria João; Morais-Cabral, João Henrique

2012-01-01

The crystallization conditions and preliminary crystal characterization of the cytoplasmic cyclic nucleotide-binding homology domain from the mouse EAG potassium channel are reported. The members of the family of voltage-gated KCNH potassium channels play important roles in cardiac and neuronal repolarization, tumour proliferation and hormone secretion. These channels have a C-terminal cytoplasmic domain which is homologous to cyclic nucleotide-binding domains (CNB-homology domains), but it has been demonstrated that channel function is not affected by cyclic nucleotides and that the domain does not bind nucleotides in vitro. Here, the crystallization and preliminary crystallographic analysis of a CNB-homology domain from a member of the KCNH family, the mouse EAG channel, is reported. X-ray diffraction data were collected to 2.2 Å resolution and the crystal belonged to the hexagonal space group P3 1 21

Leaching of potassium in a lysimeter experiment

International Nuclear Information System (INIS)

Gerzabek, M.H.

1996-11-01

Leaching of potassium was studied in the lysimeter plant in Seibersdorf/Austria (Pannonian climate). Averaged over three years, gravitational water amounted to 15.7% of the sum of precipitation (mean 485 mm) and irrigation (mean 138 mm). Differences between the four soils with respect to drainage were explained by the specific percentage of the soil skeleton. The average yearly potassium leaching ranged from 3.64 kg K/ha·yr (Dystric-Cambisol) to 22.7 kg K/ha·yr (drained Gleysol). Correlation between gravitational water volume and potassium leaching were only significant for one out of four soil types. No correlation was observed between extractable potassium in the soil profiles and potassium leaching. (author)

Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

Science.gov (United States)

Abramochkin, Denis V; Vornanen, Matti

2014-09-01

KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

Depolarization-stimulated 42K+ efflux in rat aorta is calcium- and cellular volume-dependent

International Nuclear Information System (INIS)

Magliola, L.; Jones, A.W.

1987-01-01

The purpose of this study was to investigate the factors controlling membrane permeability to potassium of smooth muscle cells from rat aorta stimulated by depolarization. The increase 42 K+ efflux (change in the rate constant) induced by depolarization (application of high concentrations of potassium chloride) was inhibited significantly by the calcium antagonists diltiazem and nisoldipine. Parallel inhibitory effects on contraction were observed. Diltiazem also inhibited potassium-stimulated 36 Cl- efflux. The addition of 25-150 mM KCl to normal physiologic solution stimulated 42 K+ efflux in a concentration-dependent manner. Diltiazem suppressed potassium-stimulated 42 K+ efflux approximately 90% at 25 mM KCl and approximately 40% at 150 mM KCl. The ability of nisoldipine to inhibit 42 K+ efflux also diminished as the potassium chloride concentration was elevated. The component of efflux that was resistant to calcium antagonists probably resulted from a decrease in the electrochemical gradient for potassium. Cellular water did not change during potassium addition. Substitution of 80 and 150 mM KCl for sodium chloride produced cellular swelling and enhanced potassium-stimulated 42 K+ efflux compared with potassium chloride addition. The addition of sucrose to prevent cellular swelling reduced efflux response to potassium substitution toward that of potassium addition. A hypoosmolar physiologic solution produced an increase in the 42 K+ efflux and a contracture that were both prevented by the addition of sucrose. We concluded that the depolarization-mediated 42 K+ efflux has three components: one is calcium dependent; a second is dependent on cellular volume; and a third is resistant to inhibition by calcium antagonists

Potassium adsorption behaviour of three Malaysian rice soils

International Nuclear Information System (INIS)

Choudhury, A.T.M.A.; Khanif, Y.M.

2003-01-01

Potassium (K) deficiency exists in different rice growing areas of Malaysia. A study on K adsorption was carried out in three Malaysian rice soils (Guar, Hutan and Kangar series) using six levels of K (0.00,28.77, 33.57, 38.37, 43.16 and 47.96 mmol kg/sup -1/). The data on K adsorption were fitted into Langmuir, Freundlich, and Temkin adsorption equations. Adsorption data were also correlated with pH, cation exchange capacity and organic matter content of the soils. Potassium adsorption increased linearly with increasing level of added K in all the three soils. The rate of increase was the highest in Guar series followed by Kangar and Hutan series, respectively. Potassium adsorption in two soils (Hutan and Kangar) fitted into Langmuir equation while he adsorption data in Guar series did not fit into this equation. Adsorption data in none of the soils fitted well in Freundlich and Temkin adsorption equations. Correlation between K adsorption and pH was significant (r = 0.881,), whereas, correlation of K adsorption with either organic matter content or cation exchange capacity was non-significant. The results of this study indicated that K adsorption is mainly dependent on soil pH. In soils with higher adsorption capacity, more K fertilizer may be needed to get immediate crop response. (author)

Dietary reference values for potassium

DEFF Research Database (Denmark)

Sjödin, Anders Mikael

2016-01-01

Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for potassium. The Panel decides to set DRVs on the basis of the relationships between potassium intake and blood pressure and stroke...

Ammonium nitrate-potassium nitrate system

Energy Technology Data Exchange (ETDEWEB)

Cady, H.H.

1981-01-01

A portion of the binary phase diagram for the system ammonium nitrate-potassium nitrate has been determined from -55/sup 0/C to 185/sup 0/C. Results are presented for the ammonium-nitrate-rich end of the system up to 30 wt% potassium nitrate.

MOTOR ACCELERATION TIME OPTIMIZATION BY THE CHANGE OF THE SUPPLY VOLTAGE VALUE

Directory of Open Access Journals (Sweden)

G. K. Aslanov

2016-01-01

Full Text Available Abstract. It is proved that the deviation of the voltage from the nominal values, often leads to overheating of the motor windings, which reduces the insulation life to a great extent.The task of determining the change in the acceleration time of the motor depending on the switching time of its supply voltage is set. The modeling of DC motor 2ПН132М operation in the short- run changes in starting voltage from 380 V to 220 V - which is its nominal value-is carried out. By sweep method is determined the optimum time for switching the supply voltage of the motor. Mathematical dependencies and simulation results are presented. 

E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

Science.gov (United States)

Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

2018-04-17

E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

Science.gov (United States)

Teverovsky, Alexander

2016-01-01

Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.