WorldWideScience

Sample records for voltage ac-based method

  1. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  2. Voltage stability, bifurcation parameters and continuation methods

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, F L [Wisconsin Univ., Madison, WI (United States)

    1994-12-31

    This paper considers the importance of the choice of bifurcation parameter in the determination of the voltage stability limit and the maximum power load ability of a system. When the bifurcation parameter is power demand, the two limits are equivalent. However, when other types of load models and bifurcation parameters are considered, the two concepts differ. The continuation method is considered as a method for determination of voltage stability margins. Three variants of the continuation method are described: the continuation parameter is the bifurcation parameter the continuation parameter is initially the bifurcation parameter, but is free to change, and the continuation parameter is a new `arc length` parameter. Implementations of voltage stability software using continuation methods are described. (author) 23 refs., 9 figs.

  3. Voltage Balancing Method on Expert System for 51-Level MMC in High Voltage Direct Current Transmission

    Directory of Open Access Journals (Sweden)

    Yong Chen

    2016-01-01

    Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.

  4. Triple voltage dc-to-dc converter and method

    Science.gov (United States)

    Su, Gui-Jia

    2008-08-05

    A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.

  5. Analysis of Voltage Forming Methods for Multiphase Inverters

    Directory of Open Access Journals (Sweden)

    Tadas Lipinskis

    2013-05-01

    Full Text Available The article discusses advantages of the multiphase AC induction motor over three or less phase motors. It presents possible stator winding configurations for a multiphase induction motor. Various fault control strategies were reviewed for phases feeding the motor. The authors propose a method for quality evaluation of voltage forming algorithm in the inverter. Simulation of a six-phase voltage source inverter, voltage in which is formed using a simple SPWM control algorithm, was performed in Matlab Simulink. Simulation results were evaluated using the proposed method. Inverter’s power stage was powered by 400 V DC source. The spectrum of output currents was analysed and the magnitude of the main frequency component was at least 12 times greater than the next biggest-magnitude component. The value of rectified inverter voltage was 373 V.Article in Lithuanian

  6. New method for determining avalanche breakdown voltage of silicon photomultipliers

    International Nuclear Information System (INIS)

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  7. A method of accurate determination of voltage stability margin

    Energy Technology Data Exchange (ETDEWEB)

    Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology, Wroclaw (Poland); Klimek, A. [AREVA Transmission and Distribution, Stafford (United Kingdom)

    2008-07-01

    In the process of developing power system disturbance, voltage instability at the receiving substations often contributes to deteriorating system stability, which eventually may lead to severe blackouts. The voltage stability margin at receiving substations may be used to determine measures to prevent voltage collapse, primarily by operating or blocking the transformer tap changing device, or by load shedding. The best measure of the stability margin is the actual load to source impedance ratio and its critical value, which is unity. This paper presented an accurate method of calculating the load to source impedance ratio, derived from the Thevenin's equivalent circuit of the system, which led to calculation of the stability margin. The paper described the calculation of the load to source impedance ratio including the supporting equations. The calculation was based on the very definition of voltage stability, which says that system stability is maintained as long as the change of power, which follows the increase of admittance is positive. The testing of the stability margin assessment method was performed in a simulative way for a number of power network structures and simulation scenarios. Results of the simulations revealed that this method is accurate and stable for all possible events occurring downstream of the device location. 3 refs., 8 figs.

  8. Optically triggered high voltage switch network and method for switching a high voltage

    Science.gov (United States)

    El-Sharkawi, Mohamed A.; Andexler, George; Silberkleit, Lee I.

    1993-01-19

    An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).

  9. Optically triggered high voltage switch network and method for switching a high voltage

    Energy Technology Data Exchange (ETDEWEB)

    El-Sharkawi, Mohamed A. (Renton, WA); Andexler, George (Everett, WA); Silberkleit, Lee I. (Mountlake Terrace, WA)

    1993-01-19

    An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).

  10. An automatic method to analyze the Capacity-Voltage and Current-Voltage curves of a sensor

    CERN Document Server

    AUTHOR|(CDS)2261553

    2017-01-01

    An automatic method to perform Capacity versus voltage analysis for all kind of silicon sensor is provided. It successfully calculates the depletion voltage to unirradiated and irradiated sensors, and with measurements with outliers or reaching breakdown. It is built using C++ and using ROOT trees with an analogous skeleton as TRICS, where the data as well as the results of the ts are saved, to make further analysis.

  11. High Bandwidth Zero Voltage Injection Method for Sensorless Control of PMSM

    DEFF Research Database (Denmark)

    Ge, Xie; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet

    2014-01-01

    High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses to be inj......High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses...... in a fast current regulation performance. Injection of zero voltage also minimizes the inverter voltage error effects caused by the dead-time....

  12. Systems and methods for switched-inductor integrated voltage regulators

    Science.gov (United States)

    Shepard, Kenneth L.; Sturcken, Noah Andrew

    2017-12-12

    Power controller includes an output terminal having an output voltage, at least one clock generator to generate a plurality of clock signals and a plurality of hardware phases. Each hardware phase is coupled to the at least one clock generator and the output terminal and includes a comparator. Each hardware phase is configured to receive a corresponding one of the plurality of clock signals and a reference voltage, combine the corresponding clock signal and the reference voltage to produce a reference input, generate a feedback voltage based on the output voltage, compare the reference input and the feedback voltage using the comparator and provide a comparator output to the output terminal, whereby the comparator output determines a duty cycle of the power controller. An integrated circuit including the power controller is also provided.

  13. Circuit and method for controlling the threshold voltage of transistors.

    NARCIS (Netherlands)

    2008-01-01

    A control unit, for controlling a threshold voltage of a circuit unit having transistor devices, includes a reference circuit and a measuring unit. The measuring unit is configured to measure a threshold voltage of at least one sensing transistor of the circuit unit, and to measure a threshold

  14. Development of a fast voltage control method for electrostatic accelerators

    International Nuclear Information System (INIS)

    Lobanov, Nikolai R.; Linardakis, Peter; Tsifakis, Dimitrios

    2014-01-01

    The concept of a novel fast voltage control loop for tandem electrostatic accelerators is described. This control loop utilises high-frequency components of the ion beam current intercepted by the image slits to generate a correction voltage that is applied to the first few gaps of the low- and high-energy acceleration tubes adjoining the high voltage terminal. New techniques for the direct measurement of the transfer function of an ultra-high impedance structure, such as an electrostatic accelerator, have been developed. For the first time, the transfer function for the fast feedback loop has been measured directly. Slow voltage variations are stabilised with common corona control loop and the relationship between transfer functions for the slow and new fast control loops required for optimum operation is discussed. The main source of terminal voltage instabilities, which are due to variation of the charging current caused by mechanical oscillations of charging chains, has been analysed

  15. FPGA Based Compensation Method for Correcting Distortion in Voltage Inverters

    National Research Council Canada - National Science Library

    Williamson, Kenya D

    2007-01-01

    ...) voltage source inverters. Blanking time distortion is caused by the delay inserted to prevent the short circuit that would occur if the two transistors in the same inverter leg are both on at the same time...

  16. Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

    Science.gov (United States)

    Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

    2018-04-01

    This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

  17. Research on uncertainty evaluation measure and method of voltage sag severity

    Science.gov (United States)

    Liu, X. N.; Wei, J.; Ye, S. Y.; Chen, B.; Long, C.

    2018-01-01

    Voltage sag is an inevitable serious problem of power quality in power system. This paper focuses on a general summarization and reviews on the concepts, indices and evaluation methods about voltage sag severity. Considering the complexity and uncertainty of influencing factors, damage degree, the characteristics and requirements of voltage sag severity in the power source-network-load sides, the measure concepts and their existing conditions, evaluation indices and methods of voltage sag severity have been analyzed. Current evaluation techniques, such as stochastic theory, fuzzy logic, as well as their fusion, are reviewed in detail. An index system about voltage sag severity is provided for comprehensive study. The main aim of this paper is to propose thought and method of severity research based on advanced uncertainty theory and uncertainty measure. This study may be considered as a valuable guide for researchers who are interested in the domain of voltage sag severity.

  18. Remote Voltage Control Using the Holomorphic Embedding Load Flow Method

    DEFF Research Database (Denmark)

    Liu, Chengxi; Qin, Nan; Sun, Kai

    2018-01-01

    such that the approach can remotely control the voltage magnitudes of desired buses. The proposed approach is compared with a conventional Newton-Raphson approach by study cases on the IEEE New England 39-bus system. The results show that the proposed approach achieves a larger convergence region....

  19. Systems and methods for process and user driven dynamic voltage and frequency scaling

    Science.gov (United States)

    Mallik, Arindam [Evanston, IL; Lin, Bin [Hillsboro, OR; Memik, Gokhan [Evanston, IL; Dinda, Peter [Evanston, IL; Dick, Robert [Evanston, IL

    2011-03-22

    Certain embodiments of the present invention provide a method for power management including determining at least one of an operating frequency and an operating voltage for a processor and configuring the processor based on the determined at least one of the operating frequency and the operating voltage. The operating frequency is determined based at least in part on direct user input. The operating voltage is determined based at least in part on an individual profile for processor.

  20. Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

    Science.gov (United States)

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-12-27

    An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

  1. Minimum-Voltage Vector Injection Method for Sensorless Control of PMSM for Low-Speed Operations

    DEFF Research Database (Denmark)

    Xie, Ge; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet

    2016-01-01

    In this paper, a simple signal injection method is proposed for sensorless control of PMSM at low speed, which ideally requires one voltage vector only for position estimation. The proposed method is easy to implement resulting in low computation burden. No filters are needed for extracting...... may also be further developed to inject two opposite voltage vectors to reduce the effects of inverter voltage error on the position estimation accuracy. The effectiveness of the proposed method is demonstrated by comparing with other sensorless control method. Theoretical analysis and experimental...

  2. A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

    DEFF Research Database (Denmark)

    Liu, Chengxi; Qin, Nan; Bak, Claus Leth

    2015-01-01

    This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

  3. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    NARCIS (Netherlands)

    Wilders, R.; Jongsma, H. J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap

  4. A Method for Solving the Voltage and Torque Equations of the Split ...

    African Journals Online (AJOL)

    Akorede

    v′ Voltage applied across the d – axis rotor winding referred ... The embedded MATLAB function and other useful blocks from the ... III. EQUATIONS OF THE SPLIT PHASE INDUCTION MOTOR. The voltage, flux and electromagnetic torque equations are ..... of single phase induction motor using frequency control method ...

  5. Methods and Strategies for Overvoltage Prevention in Low Voltage Distribution Systems with PV

    DEFF Research Database (Denmark)

    Hashemi Toghroljerdi, Seyedmostafa; Østergaard, Jacob

    2016-01-01

    to handle a high share of PV power. This paper provides an in-depth review of methods and strategies proposed to prevent overvoltage in LV grids with PV, and discusses the effectiveness, advantages, and disadvantages of them in detail. Based on the mathematical framework presented in the paper......, the overvoltage caused by high PV penetration is described, solutions to facilitate higher PV penetration are classified, and their effectiveness, advantages, and disadvantages are illustrated. The investigated solutions include the grid reinforcement, electrical energy storage application, reactive power...... absorption by PV inverters, application of active medium voltage to low voltage (MV/LV) transformers, active power curtailment, and demand response (DR). Coordination between voltage control units by localized, distributed, and centralized voltage control methods is compared using the voltage sensitivity...

  6. Methods, systems and apparatus for controlling third harmonic voltage when operating a multi-space machine in an overmodulation region

    Science.gov (United States)

    Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel

    2014-06-03

    Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.

  7. Classification of methods for measuring current-voltage characteristics of semiconductor devices

    Directory of Open Access Journals (Sweden)

    Iermolenko Ia. O.

    2014-06-01

    Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.

  8. Noninvasive method for the calibration of the peak voltage (kVp) meters

    International Nuclear Information System (INIS)

    Macedo, E.M.; Navarro, M.V.T.; Pereira, L.; Garcia, I.F.M.; Navarro, V.C.C.

    2015-01-01

    Quality control in diagnostic radiology is one of the mechanisms that minimize radiation exposure, and the measurement of tube voltage is one of the main test in these procedures. So, the calibration of non-invasive tube voltage meters is essential to maintain the metrological reliability of quality control tests. Thus, this work describes the implementation of the calibration methodology of the quantity tube peak voltage by the substitution method, using non-invasive standard meter, at LABPROSAUD-IFBA. The results showed great performance and when compared with calibrations by invasive methods, showed maximum difference of 4%, contemplated in the uncertainty ranges of the calibrations. (author)

  9. A New High Frequency Injection Method Based on Duty Cycle Shifting without Maximum Voltage Magnitude Loss

    DEFF Research Database (Denmark)

    Wang, Dong; Lu, Kaiyuan; Rasmussen, Peter Omand

    2015-01-01

    The conventional high frequency signal injection method is to superimpose a high frequency voltage signal to the commanded stator voltage before space vector modulation. Therefore, the magnitude of the voltage used for machine torque production is limited. In this paper, a new high frequency...... amplitude. This may be utilized to develop new position estimation algorithm without involving the inductance in the medium to high speed range. As an application example, a developed inductance independent position estimation algorithm using the proposed high frequency injection method is applied to drive...... injection method, in which high frequency signal is generated by shifting the duty cycle between two neighboring switching periods, is proposed. This method allows injecting a high frequency signal at half of the switching frequency without the necessity to sacrifice the machine fundamental voltage...

  10. A Grid Voltage Measurement Method for Wind Power Systems during Grid Fault Conditions

    Directory of Open Access Journals (Sweden)

    Cheol-Hee Yoo

    2014-11-01

    Full Text Available Grid codes in many countries require low-voltage ride-through (LVRT capability to maintain power system stability and reliability during grid fault conditions. To meet the LVRT requirement, wind power systems must stay connected to the grid and also supply reactive currents to the grid to support the recovery from fault voltages. This paper presents a new fault detection method and inverter control scheme to improve the LVRT capability for full-scale permanent magnet synchronous generator (PMSG wind power systems. Fast fault detection can help the wind power systems maintain the DC-link voltage in a safe region. The proposed fault detection method is based on on-line adaptive parameter estimation. The performance of the proposed method is verified in comparison to the conventional voltage measurement method defined in the IEC 61400-21 standard.

  11. Method of controlling illumination device based on current-voltage model

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an illumination device comprising a number of LEDs, means for receiving an input signal, means for generating an activation signal for at least one of the LEDs based on the input signal. The illumination device comprises further means for obtaining the voltage...... and the colorimetric properties of said light emitted by LED. The present invention relates also to a method of controlling and a meted of calibrating such illumination device....... across and current through the LED and the means for generating the activation signal is adapted to generate the activating signal based on the voltage, the current and a current- voltage model related to LED. The current-voltage model defines a relationship between the current, the voltage...

  12. Non-contact current and voltage sensing method using a clamshell housing and a ferrite cylinder

    Science.gov (United States)

    Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael

    2016-04-26

    A method of measurement using a detachable current and voltage sensor provides an isolated and convenient technique for to measuring current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  13. A new method for analyzing and design of guard electrodes of high voltage insulators chain

    International Nuclear Information System (INIS)

    Vahidi, B.; Mohammad Zadeh, A.

    2002-01-01

    The main aim of this paper is analyzing design of guard electrodes of high voltage insulators chain. These electrodes are used for making the distribution of uniform potential across the insulators chain, reducing leakage current and preventing the degradation of insulators. If the design is not correct or in the case of insulators chain without guard electrodes, the potential distribution will not uniform. Thus the voltage drops on the insulators adjacent to conductors will be more than maximum voltage that can be tolerated by the insulators. Therefore these voltage drops can damage the insulators. In this paper A new method is introduced for analyzing and design of ga urad electrodes of high voltage insulators chain

  14. Electric field control methods for foil coils in high-voltage linear actuators

    NARCIS (Netherlands)

    Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.

    2015-01-01

    This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate

  15. Initial position estimation method for permanent magnet synchronous motor based on improved pulse voltage injection

    DEFF Research Database (Denmark)

    Wang, Z.; Lu, K.; Ye, Y.

    2011-01-01

    According to saliency of permanent magnet synchronous motor (PMSM), the information of rotor position is implied in performance of stator inductances due to the magnetic saturation effect. Researches focused on the initial rotor position estimation of PMSM by injecting modulated pulse voltage...... vectors. The relationship between the inductance variations and voltage vector positions was studied. The inductance variation effect on estimation accuracy was studied as well. An improved five-pulses injection method was proposed, to improve the estimation accuracy by choosing optimaized voltage vectors...

  16. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    OpenAIRE

    Wilders, R.; Jongsma, H.J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  17. A Grid Voltage Measurement Method for Wind Power Systems during Grid Fault Conditions

    OpenAIRE

    Yoo, Cheol-Hee; Chung, Il-Yop; Yoo, Hyun-Jae; Hong, Sung-Soo

    2014-01-01

    Grid codes in many countries require low-voltage ride-through (LVRT) capability to maintain power system stability and reliability during grid fault conditions. To meet the LVRT requirement, wind power systems must stay connected to the grid and also supply reactive currents to the grid to support the recovery from fault voltages. This paper presents a new fault detection method and inverter control scheme to improve the LVRT capability for full-scale permanent magnet synchronous generator (P...

  18. An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

    Science.gov (United States)

    Tanaka, Kazuyuki; Sakashita, Tadashi

    The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

  19. Control Method for DC-Link Voltage Ripple Cancellation in Voltage Source Inverter under Unbalanced Three-Phase Voltage Supply Conditions

    Czech Academy of Sciences Publication Activity Database

    Chomát, Miroslav; Schreier, Luděk

    2005-01-01

    Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005

  20. Methods of computing steady-state voltage stability margins of power systems

    Science.gov (United States)

    Chow, Joe Hong; Ghiocel, Scott Gordon

    2018-03-20

    In steady-state voltage stability analysis, as load increases toward a maximum, conventional Newton-Raphson power flow Jacobian matrix becomes increasingly ill-conditioned so power flow fails to converge before reaching maximum loading. A method to directly eliminate this singularity reformulates the power flow problem by introducing an AQ bus with specified bus angle and reactive power consumption of a load bus. For steady-state voltage stability analysis, the angle separation between the swing bus and AQ bus can be varied to control power transfer to the load, rather than specifying the load power itself. For an AQ bus, the power flow formulation is only made up of a reactive power equation, thus reducing the size of the Jacobian matrix by one. This reduced Jacobian matrix is nonsingular at the critical voltage point, eliminating a major difficulty in voltage stability analysis for power system operations.

  1. Online Voltage Stability Assessment for Load Areas Based on the Holomorphic Embedding Method

    DEFF Research Database (Denmark)

    Liu, Chengxi; Wang, Bin; Hu, Fengkai

    2018-01-01

    This paper proposes an online steady-state voltage stability assessment scheme to evaluate the proximity to voltage collapse at each bus of a load area. Using a non-iterative holomorphic embedding method (HEM) with a proposed physical germ solution, an accurate loading limit at each load bus can...... be calculated based on online state estimation on the entire load area and a measurement-based equivalent for the external system. The HEM employs a power series to calculate an accurate Power-Voltage (P-V) curve at each load bus and accordingly evaluates the voltage stability margin considering load variations...... and then demonstrated on a load area of the Northeast Power Coordinating Council (NPCC) 48-generator, 140-bus power system....

  2. Device and methods for writing and erasing analog information in small memory units via voltage pulses

    Science.gov (United States)

    El Gabaly Marquez, Farid; Talin, Albert Alec

    2018-04-17

    Devices and methods for non-volatile analog data storage are described herein. In an exemplary embodiment, an analog memory device comprises a potential-carrier source layer, a barrier layer deposited on the source layer, and at least two storage layers deposited on the barrier layer. The memory device can be prepared to write and read data via application of a biasing voltage between the source layer and the storage layers, wherein the biasing voltage causes potential-carriers to migrate into the storage layers. After initialization, data can be written to the memory device by application of a voltage pulse between two storage layers that causes potential-carriers to migrate from one storage layer to another. A difference in concentration of potential carriers caused by migration of potential-carriers between the storage layers results in a voltage that can be measured in order to read the written data.

  3. High voltage MOSFET devices and methods of making the devices

    Science.gov (United States)

    Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran

    2018-06-05

    A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.

  4. High voltage MOSFET devices and methods of making the devices

    Science.gov (United States)

    Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran

    2015-12-15

    A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.

  5. Establishment of an easy Ic measurement method of HTS superconducting tapes using clipped voltage taps

    International Nuclear Information System (INIS)

    Shin, Hyung Seop; Nisay, Arman; Dedicatoria, Marlon; Sim, Ki Deok

    2014-01-01

    The critical current, I c of HTS superconducting tapes can be measured by transport or contactless method. Practically, the transport method using the four-probe method is the most common. In this study, a simple test procedure by clipping the voltage lead taps have been introduced instead of soldering which reduces time and effort and thereby achieving a much faster measurement of I c . When using a pair of iron clips, I c value decreased as compared with the measured one by standard method using soldered voltage taps and varies with the width of the clipped specimen part. However, when using a pure Cu clip, both by clipping and by soldering voltage taps give a comparable result and I c measured are equal and close to the samples specification. As a result, material to be used as voltage clip should be considered and should not influence the potential voltage between the leads during I c measurement. Furthermore, the simulation result of magnetic flux during I c measurement test showed that the decrease of I c observed in the experiment is due to the magnetic flux density, By produced at the clipped part of the sample by the operating current with iron clips attached to the sample.

  6. High voltage semiconductor devices and methods of making the devices

    Energy Technology Data Exchange (ETDEWEB)

    Matocha, Kevin; Chatty, Kiran; Banerjee, Sujit

    2018-01-23

    A multi-cell MOSFET device including a MOSFET cell with an integrated Schottky diode is provided. The MOSFET includes n-type source regions formed in p-type well regions which are formed in an n-type drift layer. A p-type body contact region is formed on the periphery of the MOSFET. The source metallization of the device forms a Schottky contact with an n-type semiconductor region adjacent the p-type body contact region of the device. Vias can be formed through a dielectric material covering the source ohmic contacts and/or Schottky region of the device and the source metallization can be formed in the vias. The n-type semiconductor region forming the Schottky contact and/or the n-type source regions can be a single continuous region or a plurality of discontinuous regions alternating with discontinuous p-type body contact regions. The device can be a SiC device. Methods of making the device are also provided.

  7. A sensorless control method for capacitor voltage balance and circulating current suppression of modular multilevel converter

    DEFF Research Database (Denmark)

    Liu, Hui; Ma, Ke; Loh, Poh Chiang

    2015-01-01

    There are several problems in the Modular Multilevel Converter (MMC), such as the appearance of circulating current, capacitor voltage unbalance and the requirement for a high number of sensors. All these problems will decrease the reliability and raise the cost/uncertainty of using MMC solutions....... As a result, a sensorless control method is proposed in this paper, which targets to improve the performances of MMC in respect to the above mentioned disadvantages: To decrease the cost and simplify the physical implementation, a state observer is proposed and designed to estimate both the capacitor voltages...... and the circulating currents in order to replace the high numbers of sensors. Furthermore, a control method combining the circulating current suppression and the capacitor voltage balancing is conducted based on the proposed state observer. It is concluded that the proposed state observer and control method can...

  8. Permanent Magnet Flux Online Estimation Based on Zero-Voltage Vector Injection Method

    DEFF Research Database (Denmark)

    Xie, Ge; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet

    2015-01-01

    In this paper, a simple signal injection method is proposed for sensorless control of PMSM at low speed, which ideally requires one voltage vector only for position estimation. The proposed method is easy to implement resulting in low computation burden. No filters are needed for extracting...

  9. Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques

    Science.gov (United States)

    Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron

    2016-01-26

    A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.

  10. A combined compensation method for the output voltage of an insulated core transformer power supply

    Energy Technology Data Exchange (ETDEWEB)

    Yang, L.; Yang, J., E-mail: jyang@mail.hust.edu.cn; Liu, K. F.; Qin, B.; Chen, D. Z. [State Key Laboratory of Advanced Electromagnetic Engineering and Technology, Huazhong University of Science and Technology, Wuhan 430074 (China)

    2014-06-15

    An insulated core transformer (ICT) power supply is an ideal high-voltage generator for irradiation accelerators with energy lower than 3 MeV. However, there is a significant problem that the structure of the segmented cores leads to an increase in the leakage flux and voltage differences between rectifier disks. A high level of consistency in the output of the disks helps to achieve a compact structure by improving the utilization of both the rectifier components and the insulation distances, and consequently increase the output voltage of the power supply. The output voltages of the disks which are far away from the primary coils need to be improved to reduce their inhomogeneity. In this study, by investigating and comparing the existing compensation methods, a new combined compensation method is proposed, which increases the turns on the secondary coils and employs parallel capacitors to improve the consistency of the disks, while covering the entire operating range of the power supply. This method turns out to be both feasible and effective during the development of an ICT power supply. The non-uniformity of the output voltages of the disks is less than 3.5% from no-load to full-load, and the power supply reaches an output specification of 350 kV/60 mA.

  11. Verification of a Novel Method of Detecting Faults in Medium-Voltage Systems with Covered Conductors

    Directory of Open Access Journals (Sweden)

    Mišák Stanislav

    2017-06-01

    Full Text Available This paper describes the use of new methods of detecting faults in medium-voltage overhead lines built of covered conductors. The methods mainly address such faults as falling of a conductor, contacting a conductor with a tree branch, or falling a tree branch across three phases of a medium-voltage conductor. These faults cannot be detected by current digital relay protection systems. Therefore, a new system that can detect the above mentioned faults was developed. After having tested its operation, the system has already been implemented to protect mediumvoltage overhead lines built of covered conductors.

  12. A Method for the Realization of an Interruption Generator Based on Voltage Source Converters

    Directory of Open Access Journals (Sweden)

    Junhui Li

    2017-10-01

    Full Text Available In this paper we described the structure and working principle of an interruption generator based on voltage source converters (VSCs. The main circuit parameters of the VSCs are determined according to the target of power transfer capability, harmonic suppression, and dynamic response capability. A state feedback linearization method in nonlinear differential geometry theory was used for dq axis current decoupling, based on the mathematical model used in the dq coordinate system of VSCs. The direct current control strategy was adopted to achieve the independent regulation of active power and reactive power. The proportional integral (PI link was used to optimize the dynamic performance of the controller, and PI parameters were adjusted. Disturbance voltage waves were generated by the regular sampling method. PSCAD/EMTDC simulation results and physical prototype experiments showed that the device could generate various disturbance voltage waveforms steadily, and had good dynamic and steady-state performance.

  13. A Study of Economical Incentives for Voltage Profile Control Method in Future Distribution Network

    Science.gov (United States)

    Tsuji, Takao; Sato, Noriyuki; Hashiguchi, Takuhei; Goda, Tadahiro; Tange, Seiji; Nomura, Toshio

    In a future distribution network, it is difficult to maintain system voltage because a large number of distributed generators are introduced to the system. The authors have proposed “voltage profile control method” using power factor control of distributed generators in the previous work. However, the economical disbenefit is caused by the active power decrease when the power factor is controlled in order to increase the reactive power. Therefore, proper incentives must be given to the customers that corporate to the voltage profile control method. Thus, in this paper, we develop a new rules which can decide the economical incentives to the customers. The method is tested in one feeder distribution network model and its effectiveness is shown.

  14. Impacts of Voltage Control Methods on Distribution Circuit’s Photovoltaic (PV Integration Limits

    Directory of Open Access Journals (Sweden)

    Anamika Dubey

    2017-10-01

    Full Text Available The widespread integration of photovoltaic (PV units may result in a number of operational issues for the utility distribution system. The advances in smart-grid technologies with better communication and control capabilities may help to mitigate these challenges. The objective of this paper is to evaluate multiple voltage control methods and compare their effectiveness in mitigating the impacts of high levels of PV penetrations on distribution system voltages. A Monte Carlo based stochastic analysis framework is used to evaluate the impacts of PV integration, with and without voltage control. Both snapshot power flow and time-series analysis are conducted for the feeder with varying levels of PV penetrations. The methods are compared for their impacts on (1 the feeder’s PV hosting capacity; (2 the number of voltage violations and the magnitude of the largest bus voltage; (3 the net reactive power demand from the substation; and (4 the number of switching operations of feeder’s legacy voltage support devices i.e., capacitor banks and load tap changers (LTCs. The simulation results show that voltage control help in mitigating overvoltage concerns and increasing the feeder’s hosting capacity. Although, the legacy control solves the voltage concerns for primary feeders, a smart inverter control is required to mitigate both primary and secondary feeder voltage regulation issues. The smart inverter control, however, increases the feeder’s reactive power demand and the number of LTC and capacitor switching operations. For the 34.5-kV test circuit, it is observed that the reactive power demand increases from 0 to 6.8 MVAR on enabling Volt-VAR control for PV inverters. The total number of capacitor and LTC operations over a 1-year period also increases from 455 operations to 1991 operations with Volt-VAR control mode. It is also demonstrated that by simply changing the control mode of capacitor banks, a significant reduction in the unnecessary

  15. Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

    Science.gov (United States)

    Kikta, Thomas J.; Mitchell, Ronald D.

    1992-01-01

    A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.

  16. Study on model current predictive control method of PV grid- connected inverters systems with voltage sag

    Science.gov (United States)

    Jin, N.; Yang, F.; Shang, S. Y.; Tao, T.; Liu, J. S.

    2016-08-01

    According to the limitations of the LVRT technology of traditional photovoltaic inverter existed, this paper proposes a low voltage ride through (LVRT) control method based on model current predictive control (MCPC). This method can effectively improve the photovoltaic inverter output characteristics and response speed. The MCPC method of photovoltaic grid-connected inverter designed, the sum of the absolute value of the predictive current and the given current error is adopted as the cost function with the model predictive control method. According to the MCPC, the optimal space voltage vector is selected. Photovoltaic inverter has achieved automatically switches of priority active or reactive power control of two control modes according to the different operating states, which effectively improve the inverter capability of LVRT. The simulation and experimental results proves that the proposed method is correct and effective.

  17. Method and system for a gas tube switch-based voltage source high voltage direct current transmission system

    Science.gov (United States)

    She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William

    2016-12-13

    A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.

  18. Analysis of Paralleling Limited Capacity Voltage Sources by Projective Geometry Method

    Directory of Open Access Journals (Sweden)

    Alexandr Penin

    2014-01-01

    Full Text Available The droop current-sharing method for voltage sources of a limited capacity is considered. Influence of equalizing resistors and load resistor is investigated on uniform distribution of relative values of currents when the actual loading corresponds to the capacity of a concrete source. Novel concepts for quantitative representation of operating regimes of sources are entered with use of projective geometry method.

  19. Power System Decomposition for Practical Implementation of Bulk-Grid Voltage Control Methods

    Energy Technology Data Exchange (ETDEWEB)

    Vallem, Mallikarjuna R.; Vyakaranam, Bharat GNVSR; Holzer, Jesse T.; Elizondo, Marcelo A.; Samaan, Nader A.

    2017-10-19

    Power system algorithms such as AC optimal power flow and coordinated volt/var control of the bulk power system are computationally intensive and become difficult to solve in operational time frames. The computational time required to run these algorithms increases exponentially as the size of the power system increases. The solution time for multiple subsystems is less than that for solving the entire system simultaneously, and the local nature of the voltage problem lends itself to such decomposition. This paper describes an algorithm that can be used to perform power system decomposition from the point of view of the voltage control problem. Our approach takes advantage of the dominant localized effect of voltage control and is based on clustering buses according to the electrical distances between them. One of the contributions of the paper is to use multidimensional scaling to compute n-dimensional Euclidean coordinates for each bus based on electrical distance to perform algorithms like K-means clustering. A simple coordinated reactive power control of photovoltaic inverters for voltage regulation is used to demonstrate the effectiveness of the proposed decomposition algorithm and its components. The proposed decomposition method is demonstrated on the IEEE 118-bus system.

  20. Suitability of voltage stability study methods for real-time assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Vancraeyveld, Pieter

    2013-01-01

    This paper analyzes the suitability of existing methods for long-term voltage stability assessment for real-time operation. An overview of the relevant methods is followed with a comparison that takes into account the accuracy, computational efficiency and characteristics when used for security...... assessment. The results enable an evaluation of the run time of each method with respect to the number of inputs. Furthermore, the results assist in identifying which of the methods is most suitable for realtime operation in future power system with production based on fluctuating energy sources....

  1. Voltage Based Detection Method for High Impedance Fault in a Distribution System

    Science.gov (United States)

    Thomas, Mini Shaji; Bhaskar, Namrata; Prakash, Anupama

    2016-09-01

    High-impedance faults (HIFs) on distribution feeders cannot be detected by conventional protection schemes, as HIFs are characterized by their low fault current level and waveform distortion due to the nonlinearity of the ground return path. This paper proposes a method to identify the HIFs in distribution system and isolate the faulty section, to reduce downtime. This method is based on voltage measurements along the distribution feeder and utilizes the sequence components of the voltages. Three models of high impedance faults have been considered and source side and load side breaking of the conductor have been studied in this work to capture a wide range of scenarios. The effect of neutral grounding of the source side transformer is also accounted in this study. The results show that the algorithm detects the HIFs accurately and rapidly. Thus, the faulty section can be isolated and service can be restored to the rest of the consumers.

  2. A quasi-3-dimensional simulation method for a high-voltage level-shifting circuit structure

    International Nuclear Information System (INIS)

    Liu Jizhi; Chen Xingbi

    2009-01-01

    A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate. (semiconductor integrated circuits)

  3. A quasi-3-dimensional simulation method for a high-voltage level-shifting circuit structure

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jizhi; Chen Xingbi, E-mail: jzhliu@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

    2009-12-15

    A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate. (semiconductor integrated circuits)

  4. Universal trench design method for a high-voltage SOI trench LDMOS

    Institute of Scientific and Technical Information of China (English)

    Hu Xiarong; Zhang Bo; Luo Xiaorong; Li Zhaoji

    2012-01-01

    The design method for a high-voltage SOl trench LDMOS for various trench permittivities,widths and depths is introduced.A universal method for efficient design is presented for the first time,taking the trade-off between breakdown voltage (BV) and specific on-resistance (Rs,on) into account.The high-k (relative permittivity)dielectric is suitable to fill a shallow and wide trench while the low-k dielectric is suitable to fill a deep and narrow trench.An SOI LDMOS with a vacuum trench in the drift region is also discussed.Simulation results show that the high FOM BV2/Rs,on can be achieved with a trench filled with the low-k dielectric due to its shortened cell-pitch.

  5. High Operating Voltage Supercapacitor Using PPy/AC Composite Electrode Based on Simple Dipping Method

    Directory of Open Access Journals (Sweden)

    Kyoungho Kim

    2015-01-01

    Full Text Available As various wearable devices are emerging, self-generated power sources, such as piezoelectric generators, triboelectric generators, and thermoelectric generators, are of interest. To adapt self-generated power sources for application devices, a supercapacitor is necessary because of the short generation times (1–10 ms and low generated power (1–100 μW of self-generated power sources. However, to date, supercapacitors are too large to be adapted for wearable devices. There have been many efforts to reduce the size of supercapacitors by using polypyrrole (PPy for high energy supercapacitor electrodes. However, these supercapacitors have several disadvantages, such as a low operating voltage due to the use of an aqueous electrolyte, and complex manufacturing methods, such as the hydrogel and aerosol methods. In particular, the low operating voltage (~1.0 V is a significant issue because most electronic components operate above 3.0 V. In this study, we successfully demonstrated the high operating voltage (3.0 V of a supercapacitor using a PPy/activated carbon (AC composite electrode based on the chemical polymerization of the PPy by simple dipping. In addition, a twofold enhancement of its energy density was achieved compared with conventional supercapacitors using AC electrodes.

  6. Obtaining of bilateral high voltage epitaxial p—i—n Si structures by LPE method

    Directory of Open Access Journals (Sweden)

    Vakiv N. M.

    2013-12-01

    Full Text Available Silicon p—i—n-structures are usually obtained using conventional diffusion method or liquid phase epitaxy (LPE. In both cases, the formation of p- and n-layers occurs in two stages. This technological approach is quite complex. Moreover, when forming bilateral high-voltage epitaxial layers, their parameters significantly deteriorate as a result of prolonged heat treatment of active high-resistivity layer. Besides, when using diffusion method, it is impossible to provide good reproducibility of the process. In this paper a technique of growing bilateral high-voltage silicon p—i—n-structures by LPE in a single process is proposed. The authors have obtained the optimum compounds of silicon-undersaturated molten solutions for highly doped (5•1018 cm–3 contact layers: 0.4—0.8 at. % aluminum in gallium melt for growing p-Si-layers and 0.03—0.15 at. % ytterbium in tin melt for n-Si-layers. Parameters of such structures provide for manufacturing of high-voltage diodes on their basis. Such diodes can be used in navigational equipment, communication systems for household and special purposes, on-board power supply systems, radar systems, medical equipment, etc.

  7. Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band

    International Nuclear Information System (INIS)

    Fang Chao; Zhou Dongxiang; Gong Shuping

    2010-01-01

    A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.

  8. Electric field analysis of extra high voltage (EHV) underground cables using finite element method

    DEFF Research Database (Denmark)

    Kumar, Mantosh; Bhaskar, Mahajan Sagar; Padmanaban, Sanjeevikumar

    2017-01-01

    used for the insulator due electrical, thermal or environmental stress. Most of these problems are related to the electric field stress on the insulation of the underground cables. The objective of the electric field analysis by using different numerical techniques is to find electric field stress...... electric field stress and other parameters of EHV underground cables with given boundary conditions using 2-D electric field analysis software package (IES-ELECTRO module) which is based on the finite element method (FEM).......Transmission and Distribution of electric power through underground cables is a viable alternative to overhead lines, particularly in residential or highly populated areas. The electrical stresses are consequences of regular voltages and over voltages and the thermal stresses are related to heat...

  9. Ion transport by gating voltage to nanopores produced via metal-assisted chemical etching method

    Science.gov (United States)

    Van Toan, Nguyen; Inomata, Naoki; Toda, Masaya; Ono, Takahito

    2018-05-01

    In this work, we report a simple and low-cost way to create nanopores that can be employed for various applications in nanofluidics. Nano sized Ag particles in the range from 1 to 20 nm are formed on a silicon substrate with a de-wetting method. Then the silicon nanopores with an approximate 15 nm average diameter and 200 μm height are successfully produced by the metal-assisted chemical etching method. In addition, electrically driven ion transport in the nanopores is demonstrated for nanofluidic applications. Ion transport through the nanopores is observed and could be controlled by an application of a gating voltage to the nanopores.

  10. Enhanced Local Grid Voltage Support Method for High Penetration of Distributed Generators

    DEFF Research Database (Denmark)

    Demirok, Erhan; Sera, Dezso; Rodriguez, Pedro

    2011-01-01

    Grid voltage rise and thermal loading of network components are the most remarkable barriers to allow high number of distributed generator (DG) connections on the medium voltage (MV) and low voltage (LV) electricity networks. The other barriers such as grid power quality (harmonics, voltage...

  11. Improved Thévenin equivalent methods for real-time voltage stability assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    An improved Thévenin equivalent method for real-time voltage stability assessment that uses wide-area information from synchrophasors is proposed. The improvements are a better modeling of the limited synchronous generators, and a processing that anticipates the effect of field current limiters......, before the latter are activated. Several study cases using detailed dynamic simulations of the Nordic test system have been used to assess the performance of the proposed improvements. Their effectiveness is analyzed and, based on the results, their possible application in combination...

  12. Evaluation of enhancements to Thevenin equivalent based methods for real-time voltage stability assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2014-01-01

    The possibilities offered by the use of Phasor Measurement Units (PMU) in real - time monitoring provide interesting ways to ensure secure operation of power systems. This paper studies the specific case of voltage stability and the possible improvements to the Thevenin equivalent methods, which...... is applied generally with local measurements. This paper uses the PMU measurements to calculate the grid transformation coefficients to obtain wide - area information. This is achieved by studying the generator's electromo tive force estimated using values in the coefficient transformation matrix...

  13. Electric power quality analysis methods. Application to voltage dips and harmonic disturbances

    International Nuclear Information System (INIS)

    Vanya, Ignatova

    2006-10-01

    The power quality concerns all the actors in the energy domains, that they are network administrators, suppliers, producers, or consumers of electricity. The research work presented in this PhD thesis is situated in the field of the power quality monitoring. Its objective is to introduce new techniques for analysis of power quality problems. There are different methods designed for the analysis of the power quality disturbances. This method reaches very good performances in the voltage dips analysis, as it allows segmenting, classifying and characterising these power quality disturbances. The periodic systems method allows the theoretical study of the generation and the propagation of harmonic disturbances in the network. Finally, the statistical matrix method has the objective to represent statistically electrical signals without loss of important information. (author)

  14. Extension of the Accurate Voltage-Sag Fault Location Method in Electrical Power Distribution Systems

    Directory of Open Access Journals (Sweden)

    Youssef Menchafou

    2016-03-01

    Full Text Available Accurate Fault location in an Electric Power Distribution System (EPDS is important in maintaining system reliability. Several methods have been proposed in the past. However, the performances of these methods either show to be inefficient or are a function of the fault type (Fault Classification, because they require the use of an appropriate algorithm for each fault type. In contrast to traditional approaches, an accurate impedance-based Fault Location (FL method is presented in this paper. It is based on the voltage-sag calculation between two measurement points chosen carefully from the available strategic measurement points of the line, network topology and current measurements at substation. The effectiveness and the accuracy of the proposed technique are demonstrated for different fault types using a radial power flow system. The test results are achieved from the numerical simulation using the data of a distribution line recognized in the literature.

  15. Voltage-Balancing Method for Modular Multilevel Converters Switched at Grid Frequency

    DEFF Research Database (Denmark)

    Deng, Fujin; Chen, Zhe

    2015-01-01

    The modular multilevel converter (MMC) becomes attractive for high-voltage and high-power applications due to its high modularity, availability, and power quality. The voltage balance issue of capacitors is very important in the MMC, and the balancing of the capacitor voltage is increasingly...

  16. A DC-Link Voltage Self-Balance Method for a Diode-Clamped Modular Multilevel Converter With Minimum Number of Voltage Sensors

    DEFF Research Database (Denmark)

    Gao, Congzhe; Jiang, Xinjian; Li, Yongdong

    2013-01-01

    Voltage balance issue of dc-link capacitors is very important for applications of a cascade multilevel converter or a modular multilevel converter. In this paper, a novel diode-clamped modular multilevel converter (DCM2C) topology is proposed and a power feedback control method is developed...... used traditional method; therefore, the system performance improvement and cost reduction are expected. Based on the proposed DCM2C, a novel N +1-level cascade multilevel topology is proposed for a cascade active power filter (CS-APF). The simulation and experimental results from the CS-APF have...

  17. Influence of modulation method on using LC-traps with single-phase voltage source converters

    DEFF Research Database (Denmark)

    Wang, Xiongfei; Min, Huang; Bai, Haofeng

    2015-01-01

    The switching-frequency LC-trap filter has recently been employed with high-order passive filters for Voltage Source Inverters (VSIs). This paper investigates the influence of modulation method on using the LC-traps with single-phase VSIs. Two-level (bipolar) and three-level (unipolar) modulations...... that include phase distortion and alternative phase opposition distortion methods are analyzed. Harmonic filtering performances of four LC-trap-based filters with different locations of LC-traps are compared. It is shown that the use of parallel-LC-traps in series with filter inductors, either grid...... or converter side, has a worse harmonic filtering performance than using series-LC-trap in the shunt branch. Simulations and experimental results are presented for verifications....

  18. Degradation diagnosing method for low voltage electric wire and cable in nuclear facility

    International Nuclear Information System (INIS)

    Kamimura, Seiji; Seki, Ikuo; Yagyu, Hideki; Onishi, Takao; Kusama, Yasuo.

    1991-01-01

    A considerable skill is required for a visual inspection method which has been used most widely for determining the degradation of low voltage electric wires and cables used mostly in facilities such as nuclear power plants. It is extremely difficult to determine the degradation accurately and appropriately even for skilled inspectors because of individual difference. Then, a small amount of organic insulation materials is taken as a sample from insulators or sheath materials actually disposed. The pyrolytic temperature of the sample is measured by thermal gravimetric analysis to determine the extent of the degradation of the electric wire and cable based on the relationship between the degradation and the elongation. Since there is a close relationship between the temperature at which the measured weight of the sample is reduced by 5% and the degradation behavior of the mechanical property, analysis can be conducted effectively by an extremely small amount of the sample. Since the insulation degradation of relatively low voltage electric wires and cables can be determined in a non-destructive manner at high accuracy, the lifetime can be forecasted. (N.H.)

  19. A Method for Solving the Voltage and Torque Equations of the Split-Phase Induction Machines

    Directory of Open Access Journals (Sweden)

    G. A. Olarinoye

    2013-06-01

    Full Text Available Single phase induction machines have been the subject of many researches in recent times. The voltage and torque equations which describe the dynamic characteristics of these machines have been quoted in many papers, including the papers that present the simulation results of these model equations. The way and manner in which these equations are solved is not common in literature. This paper presents a detailed procedure of how these equations are to be solved with respect to the splitphase induction machine which is one of the different types of the single phase induction machines available in the market. In addition, these equations have been used to simulate the start-up response of the split phase induction motor on no-load. The free acceleration characteristics of the motor voltages, currents and electromagnetic torque have been plotted and discussed. The simulation results presented include the instantaneous torque-speed characteristics of the Split phase Induction machine. A block diagram of the method for the solution of the machine equations has also been presented.

  20. A Circulating-Current Suppression Method for Parallel-Connected Voltage-Source Inverters With Common DC and AC Buses

    DEFF Research Database (Denmark)

    Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2017-01-01

    This paper presents a theoretical study with experimental validation of a circulating-current suppression method for parallel operation of three-phase voltage source inverters (VSI), which may be suitable for modular parallel uninterruptible power supply systems or hybrid AC/DC microgrid applicat......This paper presents a theoretical study with experimental validation of a circulating-current suppression method for parallel operation of three-phase voltage source inverters (VSI), which may be suitable for modular parallel uninterruptible power supply systems or hybrid AC/DC microgrid......, and added into the conventional droop plus virtual impedance control. In the control architecture, the reference voltages of the inverters are generated by the primary control loop which consists of a droop control and a virtual impedance. The secondary control is used to compensate the voltage drop...

  1. An Improvement on the Junction Temperature Measurement of Light-Emitting Diodes by using the Peak Shift Method Compared with the Forward Voltage Method

    International Nuclear Information System (INIS)

    He Su-Ming; Wang Jin-Bin; Luo Xiang-Dong; Zhang Bo; Fu Lei; Cheng Li-Wen; Lu Wei

    2012-01-01

    The junction temperature of red, green and blue high power light emitting diodes (LEDs) is measured by using the emission peak shift method and the forward voltage method. Both the emission peak shift and the forward voltage decrease show a linear relationship relative to junction temperature. The linear coefficients of the red, green and blue LEDs for the peak shift method and the forward voltage method range from 0.03 to 0.15 nm/°C and from 1.33 to 3.59 mV/°C, respectively. Compared with the forward voltage method, the peak shift method is almost independent of bias current and sample difference. The variation of the slopes is less than 2% for the peak shift method and larger than 30% for the forward voltage method, when the LEDs are driven by different bias currents. It is indicated that the peak shift method gives better stability than the forward voltage method under different LED working conditions

  2. Local Reactive Power Control Methods for Overvoltage Prevention of Distributed Solar Inverters in Low-Voltage Grids

    DEFF Research Database (Denmark)

    Demirok, Erhan; Gonzalez, Pablo Casado; Frederiksen, Kenn H. B.

    2011-01-01

    on sensitivity analysis. The sensitivity analysis shows that the same amount of reactive power becomes more effective for grid voltage support if the solar inverter is located at the end of a feeder. Based on this fundamental knowledge, a location-dependent power factor set value can be assigned to each inverter......voltage (LV) grids by means of solar inverters with reactive power control capability. This paper underlines weak points of standard reactive power strategies which are already imposed by certain grid codes, and then, the study introduces a new reactive power control method that is based......, and the grid voltage support can be achieved with less total reactive power consumption. In order to prevent unnecessary reactive power absorption from the grid during admissible voltage range or to increase reactive power contribution from the inverters that are closest to the transformer during grid...

  3. Simple Moving Voltage Average Incremental Conductance MPPT Technique with Direct Control Method under Nonuniform Solar Irradiance Conditions

    Directory of Open Access Journals (Sweden)

    Amjad Ali

    2015-01-01

    Full Text Available A new simple moving voltage average (SMVA technique with fixed step direct control incremental conductance method is introduced to reduce solar photovoltaic voltage (VPV oscillation under nonuniform solar irradiation conditions. To evaluate and validate the performance of the proposed SMVA method in comparison with the conventional fixed step direct control incremental conductance method under extreme conditions, different scenarios were simulated. Simulation results show that in most cases SMVA gives better results with more stability as compared to traditional fixed step direct control INC with faster tracking system along with reduction in sustained oscillations and possesses fast steady state response and robustness. The steady state oscillations are almost eliminated because of extremely small dP/dV around maximum power (MP, which verify that the proposed method is suitable for standalone PV system under extreme weather conditions not only in terms of bus voltage stability but also in overall system efficiency.

  4. Research on a Hierarchical Dynamic Automatic Voltage Control System Based on the Discrete Event-Driven Method

    Directory of Open Access Journals (Sweden)

    Yong Min

    2013-06-01

    Full Text Available In this paper, concepts and methods of hybrid control systems are adopted to establish a hierarchical dynamic automatic voltage control (HD-AVC system, realizing the dynamic voltage stability of power grids. An HD-AVC system model consisting of three layers is built based on the hybrid control method and discrete event-driven mechanism. In the Top Layer, discrete events are designed to drive the corresponding control block so as to avoid solving complex multiple objective functions, the power system’s characteristic matrix is formed and the minimum amplitude eigenvalue (MAE is calculated through linearized differential-algebraic equations. MAE is applied to judge the system’s voltage stability and security and construct discrete events. The Middle Layer is responsible for management and operation, which is also driven by discrete events. Control values of the control buses are calculated based on the characteristics of power systems and the sensitivity method. Then control values generate control strategies through the interface block. In the Bottom Layer, various control devices receive and implement the control commands from the Middle Layer. In this way, a closed-loop power system voltage control is achieved. Computer simulations verify the validity and accuracy of the HD-AVC system, and verify that the proposed HD-AVC system is more effective than normal voltage control methods.

  5. Design of Position Estimation Strategy of Sensorless Interior PMSM at Standstill Using Minimum Voltage Vector Injection Method

    DEFF Research Database (Denmark)

    Wu, Xuan; Huang, Shoudao; Liu, Xiao

    2017-01-01

    This paper presents a new initial rotor position estimation method for an interior permanent magnet synchronous motor. The proposed method includes two steps: firstly, the minimum voltage vectors are injected to estimate the rotor position. Secondly, in order to identify the magnet polarity...

  6. A Comparative Study of Analog Voltage-mode Control Methods for Ultra-Fast Tracking Power Supplies

    DEFF Research Database (Denmark)

    Høyerby, Mikkel Christian Wendelboe; Andersen, Michael Andreas E.

    2007-01-01

    This paper presents a theoretical and experimental comparison of the standard PWM/PID voltage-mode control method for single-phase buck converters with two highperformance self-oscillating (a.k.a. sliding mode) control methods. The application considered is ultra-fast tracking power supplies...... (UFTPSs) for RF power amplifiers, where the switching converter needs to track a varying reference voltage precisely and quickly while maintaining low output impedance. The small-signal analyses performed on the different controllers show that the hysteretic-type controller can achieve the highest loop...

  7. High Frequency Voltage Injection Methods and Observer Design for Initial Position Detection of Permanent Magnet Synchronous Machines

    DEFF Research Database (Denmark)

    Jin, Xinhai; Ni, Ronggang; Chen, Wei

    2018-01-01

    The information of the initial rotor position is essential for smooth start up and robust control of Permanent Magnet Synchronous Machines (PMSMs). RoTating Voltage Injection (RTVI) methods in the stationary reference frame have been commonly adopted to detect the initial rotor position at stands......The information of the initial rotor position is essential for smooth start up and robust control of Permanent Magnet Synchronous Machines (PMSMs). RoTating Voltage Injection (RTVI) methods in the stationary reference frame have been commonly adopted to detect the initial rotor position...

  8. An improved control method of power electronic converters in low voltage micro-grid

    DEFF Research Database (Denmark)

    Xiaofeng, Sun; Qingqiu, Lv; Yanjun, Tian

    2011-01-01

    control of the voltage and frequency deviation added to power references could achieve secondary regulation of the voltage and frequency. In this paper, the authors take the steady and transient transition of grid connecting and disconnecting of the micro-grid as an example, and demonstrate......With the increasing acceptance, micro-grid, combined with distributed generation (DG), may be operated in two modes: grid-connected mode and island mode. In grid connected mode, energy management is the control objective. While in island mode, the control of Voltage and frequency will take...... the place. The conventional droop control can perform the energy management in grid-connected mode, but may not so effective when micro-grid transferring between grid-connected mode and island mode. The paper analysis the micro-grid in different modes (Conventional droop control, Voltage reference...

  9. A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

    DEFF Research Database (Denmark)

    Xu, Fengda; Guo, Qinglai; Sun, Hongbin

    2015-01-01

    For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

  10. Voltage clamp methods for the study of membrane currents and SR Ca2+ release in adult skeletal muscle fibres

    Science.gov (United States)

    Hernández-Ochoa, Erick O.; Schneider, Martin F.

    2012-01-01

    Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655

  11. A Circulating Current Suppression Method for Parallel Connected Voltage-Source-Inverters (VSI) with Common DC and AC Buses

    DEFF Research Database (Denmark)

    Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2016-01-01

    This paper describes a theoretical with experiment study on a control strategy for the parallel operation of threephase voltage source inverters (VSI), to be applied to uninterruptible power systems (UPS). A circulating current suppression strategy for parallel VSIs is proposed in this paper based...... on circulating current control loops used to modify the reference currents by compensating the error currents among parallel inverters. Both of the cross and zero-sequence circulating currents are considered. The proposed method is coordinated together with droop and virtual impedance control. In this paper......, droop control is used to generate the reference voltage of each inverter, and the virtual impedance is used to fix the output impedance of the inverters. In addition, a secondary control is used in order to recover the voltage deviation caused by the virtual impedance. And the auxiliary current control...

  12. A simple method to increase effective PMT gain by amplifier circuit powered from voltage divider

    International Nuclear Information System (INIS)

    Popov, V.; Majewski, S.; Wojtsekhowski, B.; Guerin, D

    2001-01-01

    A novel concept is introduced of additional effective signal amplification by employing a dedicated circuit to process anode or dynode signals prior to sending them through a standard 50 /spl Omega/ line/cable. The circuit is entirely powered by the current flowing through the base voltage divider. Additional gain factors of 2-10 were easily achieved with preserved operation speed and rate capability up to several MHz. This additional signal boost can be used in many applications where higher gain and/or lower PMT operational voltages are desirable. For example, in the case of a PMT employed in a low input light signal (such as a Cherenkov counter), this technique will permit operation at a lower voltage and, therefore, will result in better operational PMT stability and longer PMT lifetime. At present, two experimental set-ups at Jefferson Lab are using PMT bases using this concept

  13. Method to Minimize the Low-Frequency Neutral-Point Voltage Oscillations With Time-Offset Injection for Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    time of small- and medium-voltage vectors. However, if the power factor is lower, there is a limitation to eliminate neutral-point oscillations. In this case, the proposed method can be improved by changing the switching sequence properly. Additionally, a method for neutral-point voltage balancing......This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time offset to the three-phase turn-on times. The proper time offset is simply calculated considering the phase currents and dwell...

  14. On-line Monitoring Device for High-voltage Switch Cabinet Partial Discharge Based on Pulse Current Method

    Science.gov (United States)

    Y Tao, S.; Zhang, X. Z.; Cai, H. W.; Li, P.; Feng, Y.; Zhang, T. C.; Li, J.; Wang, W. S.; Zhang, X. K.

    2017-12-01

    The pulse current method for partial discharge detection is generally applied in type testing and other off-line tests of electrical equipment at delivery. After intensive analysis of the present situation and existing problems of partial discharge detection in switch cabinets, this paper designed the circuit principle and signal extraction method for partial discharge on-line detection based on a high-voltage presence indicating systems (VPIS), established a high voltage switch cabinet partial discharge on-line detection circuit based on the pulse current method, developed background software integrated with real-time monitoring, judging and analyzing functions, carried out a real discharge simulation test on a real-type partial discharge defect simulation platform of a 10KV switch cabinet, and verified the sensitivity and validity of the high-voltage switch cabinet partial discharge on-line monitoring device based on the pulse current method. The study presented in this paper is of great significance for switch cabinet maintenance and theoretical study on pulse current method on-line detection, and has provided a good implementation method for partial discharge on-line monitoring devices for 10KV distribution network equipment.

  15. Battery open-circuit voltage estimation by a method of statistical analysis

    NARCIS (Netherlands)

    Snihir, Iryna; Rey, William; Verbitskiy, Evgeny; Belfadhel-Ayeb, Afifa; Notten, Peter H.L.

    2006-01-01

    The basic task of a battery management system (BMS) is the optimal utilization of the stored energy and minimization of degradation effects. It is critical for a BMS that the state-of-charge (SoC) be accurately determined. Open-circuit voltage (OCV) is directly related to the state-of-charge of the

  16. A Method for Solving the Voltage and Torque Equations of the Split ...

    African Journals Online (AJOL)

    Single phase induction machines have been the subject of many researches in recent times. The voltage and torque equations which describe the dynamic characteristics of these machines have been quoted in many papers, including the papers that present the simulation results of these model equations. The way and ...

  17. Electrooptic Methods for Measurement of Small DC Currents at High Voltage Level

    DEFF Research Database (Denmark)

    Tønnesen, Ole; Beatty, Neville; Skilbreid, Asbjørn Ottar

    1989-01-01

    collectors are connected via resistors RA and RB to the protective side of the voltage to be measured and the emitters to the negative side. The currents flowing in to the bases of the transistors are independently controlled by the light levels following on the two photodiodes PDA, PDB....

  18. A New Method for a Piezoelectric Energy Harvesting System Using a Backtracking Search Algorithm-Based PI Voltage Controller

    Directory of Open Access Journals (Sweden)

    Mahidur R. Sarker

    2016-09-01

    Full Text Available This paper presents a new method for a vibration-based piezoelectric energy harvesting system using a backtracking search algorithm (BSA-based proportional-integral (PI voltage controller. This technique eliminates the exhaustive conventional trial-and-error procedure for obtaining optimized parameter values of proportional gain (Kp, and integral gain (Ki for PI voltage controllers. The generated estimate values of Kp and Ki are executed in the PI voltage controller that is developed through the BSA optimization technique. In this study, mean absolute error (MAE is used as an objective function to minimize output error for a piezoelectric energy harvesting system (PEHS. The model for the PEHS is designed and analyzed using the BSA optimization technique. The BSA-based PI voltage controller of the PEHS produces a significant improvement in minimizing the output error of the converter and a robust, regulated pulse-width modulation (PWM signal to convert a MOSFET switch, with the best response in terms of rise time and settling time under various load conditions.

  19. Single-point reactive power control method on voltage rise mitigation in residential networks with high PV penetration

    DEFF Research Database (Denmark)

    Hasheminamin, Maryam; Agelidis, Vassilios; Ahmadi, Abdollah

    2018-01-01

    Voltage rise (VR) due to reverse power flow is an important obstacle for high integration of Photovoltaic (PV) into residential networks. This paper introduces and elaborates a novel methodology of an index-based single-point-reactive power-control (SPRPC) methodology to mitigate voltage rise by ...... system with high r/x ratio. Efficacy, effectiveness and cost study of SPRPC is compared to droop control to evaluate its advantages.......Voltage rise (VR) due to reverse power flow is an important obstacle for high integration of Photovoltaic (PV) into residential networks. This paper introduces and elaborates a novel methodology of an index-based single-point-reactive power-control (SPRPC) methodology to mitigate voltage rise...... by absorbing adequate reactive power from one selected point. The proposed index utilizes short circuit analysis to select the best point to apply this Volt/Var control method. SPRPC is supported technically and financially by distribution network operator that makes it cost effective, simple and efficient...

  20. Circuit-field coupled finite element analysis method for an electromagnetic acoustic transducer under pulsed voltage excitation

    International Nuclear Information System (INIS)

    Hao Kuan-Sheng; Huang Song-Ling; Zhao Wei; Wang Shen

    2011-01-01

    This paper presents an analytical method for electromagnetic acoustic transducers (EMATs) under voltage excitation and considers the non-uniform distribution of the biased magnetic field. A complete model of EMATs including the non-uniform biased magnetic field, a pulsed eddy current field and the acoustic field is built up. The pulsed voltage excitation is transformed to the frequency domain by fast Fourier transformation (FFT). In terms of the time harmonic field equations of the EMAT system, the impedances of the coils under different frequencies are calculated according to the circuit-field coupling method and Poynting's theorem. Then the currents under different frequencies are calculated according to Ohm's law and the pulsed current excitation is obtained by inverse fast Fourier transformation (IFFT). Lastly, the sequentially coupled finite element method (FEM) is used to calculate the Lorentz force in the EMATs under the current excitation. An actual EMAT with a two-layer two-bundle printed circuit board (PCB) coil, a rectangular permanent magnet and an aluminium specimen is analysed. The coil impedances and the pulsed current are calculated and compared with the experimental results. Their agreement verified the validity of the proposed method. Furthermore, the influences of lift-off distances and the non-uniform static magnetic field on the Lorentz force under pulsed voltage excitation are studied. (interdisciplinary physics and related areas of science and technology)

  1. A voltage control method for an active capacitive DC-link module with series-connected circuit

    DEFF Research Database (Denmark)

    Wang, Haoran; Wang, Huai; Blaabjerg, Frede

    2017-01-01

    Many efforts have been made to improve the performance of power electronic systems with active capacitive DC-link module in terms of power density as well as reliability. One of the attractive solution is an active capacitive DC-link with the series-connected circuit because of handling small......-rated power. However, in the existing control method of this circuit, the DC-link current of the backward-stage or forward-stage need to be sensed for extracting the ripple components, which limits the flexibility of the active DC-link module. Thus, in this paper, a voltage control method of an active...... capacitive DC-link module is proposed. Current sensor at the DC-link will be cancel from the circuit. The controller of the series-connected circuit requires internal voltage signals of the DC-link module only, making it possible to be fully independent without any additional connection to the main circuit...

  2. SEMICONDUCTOR INTEGRATED CIRCUITS: A quasi-3-dimensional simulation method for a high-voltage level-shifting circuit structure

    Science.gov (United States)

    Jizhi, Liu; Xingbi, Chen

    2009-12-01

    A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate.

  3. A Ratiometric Method for Johnson Noise Thermometry Using a Quantized Voltage Noise Source

    Science.gov (United States)

    Nam, S. W.; Benz, S. P.; Martinis, J. M.; Dresselhaus, P.; Tew, W. L.; White, D. R.

    2003-09-01

    Johnson Noise Thermometry (JNT) involves the measurement of the statistical variance of a fluctuating voltage across a resistor in thermal equilibrium. Modern digital techniques make it now possible to perform many functions required for JNT in highly efficient and predictable ways. We describe the operational characteristics of a prototype JNT system which uses digital signal processing for filtering, real-time spectral cross-correlation for noise power measurement, and a digitally synthesized Quantized Voltage Noise Source (QVNS) as an AC voltage reference. The QVNS emulates noise with a constant spectral density that is stable, programmable, and calculable in terms of known parameters using digital synthesis techniques. Changes in analog gain are accounted for by alternating the inputs between the Johnson noise sensor and the QVNS. The Johnson noise power at a known temperature is first balanced with a synthesized noise power from the QVNS. The process is then repeated by balancing the noise power from the same resistor at an unknown temperature. When the two noise power ratios are combined, a thermodynamic temperature is derived using the ratio of the two QVNS spectral densities. We present preliminary results where the ratio between the gallium triple point and the water triple point is used to demonstrate the accuracy of the measurement system with a standard uncertainty of 0.04 %.

  4. Charged particle transport in gaseous nitrogen at intermediate E/N using the voltage transient method

    International Nuclear Information System (INIS)

    Purdie, P.H.; Fletcher, J.

    1992-01-01

    A pulsed swarm of charged particles crossing an inter-electrode gap under the influence of an applied electric field E will produce a pulsed current in the external circuit which, when integrated over time, will result in a transient voltage pulse, the shape and magnitude of which is characteristic of the number of type of charged particles. This voltage transient technique has been used to investigate a gas discharge in nitrogen gas at values of E/N (the ratio of applied electric field to gas number density), such that ionization is non-negligible. The voltage transients have been subjected to a theoretical analysis, which has previously been reported, which includes not only cathode and anode image terms but also both electron and ion diffusion terms. Electron transport parameters are reported for E/N ≤ 350 Td (1 Td = 10 -17 V cm 2 ). Data are also obtained for the drift velocities and diffusion coefficients of the ions operative within the nitrogen discharge. An estimate is obtained for the collisional decay rate of N 2 + . 21 refs., 7 figs

  5. Analysis of the photo voltage decay /PVD/ method for measuring minority carrier lifetimes in P-N junction solar cells

    Science.gov (United States)

    Von Roos, O.

    1981-01-01

    The photo voltage decay (PVD) method for the measurement of minority carrier lifetimes in P-N junction solar cells with cell thickness comparable to or even less than the minority carrier diffusion length is examined. The method involves the generation of free carriers in the quasi-neutral bulk material by flashes of light and the monitoring of the subsequent decay of the induced open-circuit voltages as the carriers recombine, which is dependent on minority carrier recombination lifetime. It is shown that the voltage versus time curve for an ordinary solar cell (N(+)-P junction) is proportional to the inverse minority carrier lifetime plus a factor expressing the ratio of diffusion length to cell thickness. In the case of an ideal back-surface-field cell (N(+)-P-P(+) junction) however, the slope is directly proportional to the inverse minority carrier lifetime. It is noted that since most BSF cells are not ideal, possessing a sizable back surface recombination velocity, the PVD measurements must be treated with caution and supplemented with other nonstationary methods.

  6. General and Simple Decision Method for DG Penetration Level in View of Voltage Regulation at Distribution Substation Transformers

    Directory of Open Access Journals (Sweden)

    Joon-Ho Choi

    2013-09-01

    Full Text Available A distribution system was designed and operated by considering unidirectional power flow from a utility source to end-use loads. The large penetrations of distributed generation (DG into the existing distribution system causes a variety of technical problems, such as frequent tap changing problems of the on-load tap changer (OLTC transformer, local voltage rise, protection coordination, exceeding short-circuit capacity, and harmonic distortion. In view of voltage regulation, the intermittent fluctuation of the DG output power results in frequent tap changing operations of the OLTC transformer. Thus, many utilities limit the penetration level of DG and are eager to find the reasonable penetration limits of DG in the distribution system. To overcome this technical problem, utilities have developed a new voltage regulation method in the distribution system with a large DG penetration level. In this paper, the impact of DG on the OLTC operations controlled by the line drop compensation (LDC method is analyzed. In addition, a generalized determination methodology for the DG penetration limits in a distribution substation transformer is proposed. The proposed DG penetration limits could be adopted for a simplified interconnection process in DG interconnection guidelines.

  7. Novel methods for earth fault management in medium voltage distribution networks

    Energy Technology Data Exchange (ETDEWEB)

    Nikander, A; Jaerventausta, P [Tampere Univ. of Technology (Finland)

    1998-08-01

    Customers have become less and less tolerable against even short interruptions of supply. Rapid autoreclosures are especially harmful for those commercial and private customers who have equipment which will be disturbed by these under half second interruptions. Mainly due to increasing use of distribution automation (eg. remote controlled switching devices, fault detectors, computational fault location) the average interruption period per customer has been reduced. Simultaneously the amount of equipment sensitive to short voltage break or dip has increased. Therefore reducing the number of the interruptions has become a more essential target

  8. A Method to Determine Supply Voltage of Permanent Magnet Motor at Optimal Design Stage

    Science.gov (United States)

    Matustomo, Shinya; Noguchi, So; Yamashita, Hideo; Tanimoto, Shigeya

    The permanent magnet motors (PM motors) are widely used in electrical machinery, such as air conditioner, refrigerator and so on. In recent years, from the point of view of energy saving, it is necessary to improve the efficiency of PM motor by optimization. However, in the efficiency optimization of PM motor, many design variables and many restrictions are required. In this paper, the efficiency optimization of PM motor with many design variables was performed by using the voltage driven finite element analysis with the rotating simulation of the motor and the genetic algorithm.

  9. Method to minimize the low-frequency neutral-point voltage oscillations with time-offset injection for neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, Kyo-Beum; Blaabjerg, Frede

    2013-01-01

    This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time-offset to the three phase turn-on times. The proper time-offset is simply calculated considering the phase currents and dwell...

  10. Development of a method of partial discharge detection in extra-high voltage cross-linked polyethylene insulated cable lines

    International Nuclear Information System (INIS)

    Katsuta, G.; Toya, A.; Muraoka, K.; Endoh, T.; Sekii, Y.; Ikeda, C.

    1992-01-01

    This paper reports that deterioration in the insulation performance of extra-high voltage XLPE cables is believed to be attributable to the deterioration caused by partial discharges. In the authors study, after using an XLPE cable to investigate the behavior of partial discharges under various adverse conditions, we succeeded in developing a highly sensitive new method of measuring partial discharge in XLPE cable lines. Partial discharges in a 275 kV XLPE cable live line has been measured using this newly developed method. As a result, a detection sensitivity of 1 pC has been achieved

  11. Methods for calculation of undelivered electricity in medium voltage network that is not integrated into the remote control system

    Directory of Open Access Journals (Sweden)

    Vrcelj Nada

    2013-01-01

    Full Text Available The method is based on data obtained from the so-called. hand-held measuring current at 10 kV voltage level and from reports of outages at reclosers that are installed in a part of network that is observed. At first, is calculates the electrical load of the main distribution power lines, and then simulates the corresponding power flow and calculates the undelivered electricity. The method was applied to parts of the network PD ED Belgrade that are not in the remote control system and is developed for the purpose of considering the effects of automation in the 10 kV PD ED Belgrade.

  12. Uncertainty in real-time voltage stability assessment methods based on Thevenin equivalent due to PMU’s accuracy

    DEFF Research Database (Denmark)

    Perez, Angel; Møller, Jakob Glarbo; Jóhannsson, Hjörtur

    2014-01-01

    This article studies the influence of PMU’s accuracy in voltage stability assessment, considering the specific case of Th ́ evenin equivalent based methods that include wide-area information in its calculations. The objective was achieved by producing a set of synthesized PMU measurements from...... a time domain simulation and using the Monte Carlo method to reflect the accuracy for the PMUs. This is given by the maximum value for the Total Vector Error defined in the IEEE standard C37.118. Those measurements allowed to estimate the distribution pa- rameters (mean and standard deviation...

  13. Study on Communication Methods for Electric Power High-voltage Equipment Monitoring System

    Directory of Open Access Journals (Sweden)

    Jia Yu Chen

    2018-02-01

    Full Text Available Real-time monitoring of high-voltage equipment in substations is beneficial for early detection of faults. The use of wireless sensor networks to build monitoring system is an effective way, but the data collection is a difficult task. The author introduces a real-time monitoring system based on ZIGBEE and mobile communication technology. The system includes multiple monitoring points and terminal platforms. Each monitoring point consists of a number of sensor nodes to form a ZIGBEE network, detecting relevant parameters, coordinator node data collected one by one, known as linear transmission, and finally to the monitoring platform through the mobile communication network. This paper presents a fusion algorithm for monitoring cell data acquisition to reduce the amount of data uploaded to the base station. In addition, multi-hop routing algorithm based on opportunistic routing is proposed to balance network energy and improve network transmission rate and efficiency.

  14. DC-pulsed voltage electrochemical method based on duty cycle self-control for producing TERS gold tips

    International Nuclear Information System (INIS)

    Vasilchenko, V E; Kharintsev, S S; Salakhov, M Kh

    2013-01-01

    This paper presents a modified dc-pulsed low voltage electrochemical method in which a duty cycle is self tuned while etching. A higher yield of gold tips suitable for performing tip-enhanced Raman scattering (TERS) measurements is demonstrated. The improvement is caused by the self-control of the etching rate along the full surface of the tip. A capability of the gold tips to enhance a Raman signal is exemplified by TERS spectroscopy of single walled carbon nanotubes bundle, sulfur and vanadium oxide

  15. An improved method for predicting the lightning performance of high and extra-high-voltage substation shielding

    Science.gov (United States)

    Vinh, T.

    1980-08-01

    There is a need for better and more effective lightning protection for transmission and switching substations. In the past, a number of empirical methods were utilized to design systems to protect substations and transmission lines from direct lightning strokes. The need exists for convenient analytical lightning models adequate for engineering usage. In this study, analytical lightning models were developed along with a method for improved analysis of the physical properties of lightning through their use. This method of analysis is based upon the most recent statistical field data. The result is an improved method for predicting the occurrence of sheilding failure and for designing more effective protection for high and extra high voltage substations from direct strokes.

  16. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  17. Design and simulation of maximum power point tracking (MPPT) system on solar module system using constant voltage (CV) method

    Science.gov (United States)

    Bhatara, Sevty Satria; Iskandar, Reza Fauzi; Kirom, M. Ramdlan

    2016-02-01

    Solar energy is one of renewable energy resource where needs a photovoltaic module to convert it into electrical energy. One of the problems on solar energy conversion is the process of battery charging. To improve efficiency of energy conversion, PV system needs another control method on battery charging called maximum power point tracking (MPPT). This paper report the study on charging optimation using constant voltage (CV) method. This method has a function of determining output voltage of the PV system on maximal condition, so PV system will always produce a maximal energy. A model represented a PV system with and without MPPT was developed using Simulink. PV system simulation showed a different outcome energy when different solar radiation and numbers of solar module were applied in the model. On the simulation of solar radiation 1000 W/m2, PV system with MPPT produces 252.66 Watt energy and PV system without MPPT produces 252.66 Watt energy. The larger the solar radiation, the greater the energy of PV modules was produced.

  18. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  19. A low-voltage flash memory cell utilizing the gate-injection program/erase method with a recessed channel structure

    International Nuclear Information System (INIS)

    Wu Dake; Huang Ru; Wang Pengfei; Tang Poren; Wang Yangyuan

    2008-01-01

    In this paper, a low-voltage recessed channel SONOS flash memory using the gate-injection program/erase method is proposed and investigated for NAND application. It is shown that the proposed flash memory can achieve 8 V lower programming voltage compared with planar flash memory, due to the effective capacitance coupling and the electric-field enhancement by combining the recessed channel structure and the gate-injection program/erase method. In addition, more than 30% larger threshold voltage window and improved short channel effects can be obtained in the proposed flash memory

  20. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  1. A Comparative Study of Voltage, Peak Current and Dual Current Mode Control Methods for Noninverting Buck-Boost Converter

    Directory of Open Access Journals (Sweden)

    M. Č. Bošković

    2016-06-01

    Full Text Available This paper presents a comparison of voltage mode control (VMC and two current mode control (CMC methods of noninverting buck-boost converter. The converter control-to-output transfer function, line-to-output transfer function and the output impedance are obtained for all methods by averaging converter equations over one switching period and applying small-signal linearization. The obtained results are required for the design procedure of feedback compensator to keep a system stable and robust. A comparative study of VMC, peak current mode control (PCMC and dual-current mode control (DCMC is performed. Performance evaluation of the closed-loop system with obtained compensator between these methods is performed via numerical simulations.

  2. Fine Output Voltage Control Method considering Time-Delay of Digital Inverter System for X-ray Computed Tomography

    Science.gov (United States)

    Shibata, Junji; Kaneko, Kazuhide; Ohishi, Kiyoshi; Ando, Itaru; Ogawa, Mina; Takano, Hiroshi

    This paper proposes a new output voltage control for an inverter system, which has time-delay and nonlinear load. In the next generation X-ray computed tomography of a medical device (X-ray CT) that uses the contactless power transfer method, the feedback signal often contains time-delay due to AD/DA conversion and error detection/correction time. When the PID controller of the inverter system is received the adverse effects of the time-delay, the controller often has an overshoot and a oscillated response. In order to overcome this problem, this paper proposes a compensation method based on the Smith predictor for an inverter system having a time-delay and the nonlinear loads which are the diode bridge rectifier and X-ray tube. The proposed compensation method consists of the hybrid Smith predictor system based on an equivalent analog circuit and DSP. The experimental results confirm the validity of the proposed system.

  3. A new method for compensation of the effect of charging transformer's leakage inductance on PFN voltage regulation in Klystron pulse modulators

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Akhil, E-mail: akhilpatel@rrcat.gov.in; Kale, Umesh; Shrivastava, Purushottam

    2017-04-21

    The Line type modulators have been widely used to generate high voltage rectangular pulses to power the klystron for high power RF generation. In Line type modulator, the Pulse Forming Network (PFN) which is a cascade combination of lumped capacitors and inductors is used to store the electrical energy. The charged PFN is then discharged into a klystron by firing a high voltage Thyratron switch. This discharge generates a high voltage rectangular pulse across the klystron electrodes. The amplitude and phase of Klystron's RF output is governed by the high voltage pulse amplitude. The undesired RF amplitude and phase stability issues arises at the klystron's output due to inter-pulse and during the pulse amplitude variations. To reduce inter-pulse voltage variations, the PFN is required to be charged at the same voltage after every discharge cycle. At present, the combination of widely used resonant charging and deQing method is used to regulate the pulse to pulse PFN voltage variations but the charging transformer's leakage inductance puts an upper bound on the regulation achievable by this method. Here we have developed few insights of the deQing process and devised a new compensation method to compensate this undesired effect of charging transformer's leakage inductance on the pulse to pulse PFN voltage stability. This compensation is accomplished by the controlled partial discharging of the split PFN capacitor using a low voltage MOSFET switch. Theoretically, very high values of pulse to pulse voltage stability may be achieved using this method. This method may be used in deQing based existing modulators or in new modulators, to increase the pulse to pulse voltage stability, without having a very tight bound on charging transformer's leakage inductance. Given a stable charging power supply, this method may be used to further enhance the inter-pulse voltage stability of modulators which employ the direct charging, after replacing the

  4. A Contribution To The Development And Analysis Of A Combined Current-Voltage Instrument Transformer By Using Modern CAD Methods

    International Nuclear Information System (INIS)

    Chundeva-Blajer, Marija M.

    2004-01-01

    The principle aim and task of the thesis is the analysis and development of 20 kV combined current-voltage instrument transformer (CCVIT) by using modern CAD techniques. CCVIT is a complex electromagnetic system comprising of four windings and two magnetic cores in one insulation housing for simultaneous transformation of high voltages and currents to measurable signal values by standard instruments. The analytical design methods can be applied on simple electromagnetic configurations, which is not the case with the CCVIT. There is mutual electromagnetic influence between the voltage measurement core (VMC) and the current measurement core (CMC). After the analytical CCVIT design had been done, exact determination of its metrological characteristics has been accomplished by using the numerical finite element method implemented in the FEM-3D program package. The FEM-3D calculation is made in 19 cross-sectional layers of the z-axis of the CCVIT three-dimensional domain. By FEM-3D application the three-dimensional CCVIT magnetic field distribution is derived. This is the basis for calculation of the initial metrological characteristics of the CCVIT (VMC is accuracy class 3 and CMC is accuracy class 1). By using the stochastic optimization technique based on genetic algorithm the CCVIT optimal design is achieved. The objective function is the minimum of the metrological parameters (VIM voltage error and CMC current error). There are I I independent input variables during the optimization process by which the optimal project is derived. The optimal project is adapted for realization of a prototype and the optimized project is derived. Full comparative analysis of the metrological and the electromagnetic characteristics of the three projects is accomplished. By application of the program package MATLAB/SIMULINK the CCVIT transient phenomena is analyzed for different regimes in the three design projects. In the Instrument Transformer Factory of EMO A. D.-Ohrid a CCVIT

  5. An Improved Droop Control Method for DC Microgrids Based on Low Bandwidth Communication with DC Bus Voltage Restoration and Enhanced Current Sharing Accuracy

    DEFF Research Database (Denmark)

    Lu, Xiaonan; Guerrero, Josep M.; Sun, Kai

    2014-01-01

    Droop control is the basic control method for load current sharing in dc microgrid applications. The conventional dc droop control method is realized by linearly reducing the dc output voltage as the output current increases. This method has two limitations. First, with the consideration of line...... resistance in a droop-controlled dc microgrid, since the output voltage of each converter cannot be exactly the same, the output current sharing accuracy is degraded. Second, the DC bus voltage deviation increases with the load due to the droop action. In this paper, in order to improve the performance......, and the LBC system is only used for changing the values of the dc voltage and current. Hence, a decentralized control scheme is accomplished. The simulation test based on Matlab/Simulink and the experimental validation based on a 2×2.2 kW prototype were implemented to demonstrate the proposed approach....

  6. A novel fault location scheme for power distribution system based on injection method and transient line voltage

    Science.gov (United States)

    Huang, Yuehua; Li, Xiaomin; Cheng, Jiangzhou; Nie, Deyu; Wang, Zhuoyuan

    2018-02-01

    This paper presents a novel fault location method by injecting travelling wave current. The new methodology is based on Time Difference Of Arrival(TDOA)measurement which is available measurements the injection point and the end node of main radial. In other words, TDOA is the maximum correlation time when the signal reflected wave crest of the injected and fault appear simultaneously. Then distance calculation is equal to the wave velocity multiplied by TDOA. Furthermore, in case of some transformers connected to the end of the feeder, it’s necessary to combine with the transient voltage comparison of amplitude. Finally, in order to verify the effectiveness of this method, several simulations have been undertaken by using MATLAB/SIMULINK software packages. The proposed fault location is useful to short the positioning time in the premise of ensuring the accuracy, besides the error is 5.1% and 13.7%.

  7. Optimal reactive power and voltage control in distribution networks with distributed generators by fuzzy adaptive hybrid particle swarm optimisation method

    DEFF Research Database (Denmark)

    Chen, Shuheng; Hu, Weihao; Su, Chi

    2015-01-01

    A new and efficient methodology for optimal reactive power and voltage control of distribution networks with distributed generators based on fuzzy adaptive hybrid PSO (FAHPSO) is proposed. The objective is to minimize comprehensive cost, consisting of power loss and operation cost of transformers...... that the proposed method can search a more promising control schedule of all transformers, all capacitors and all distributed generators with less time consumption, compared with other listed artificial intelligent methods....... algorithm is implemented in VC++ 6.0 program language and the corresponding numerical experiments are finished on the modified version of the IEEE 33-node distribution system with two newly installed distributed generators and eight newly installed capacitors banks. The numerical results prove...

  8. Negative Sequence Droop Method based Hierarchical Control for Low Voltage Ride-Through in Grid-Interactive Microgrids

    DEFF Research Database (Denmark)

    Zhao, Xin; Firoozabadi, Mehdi Savaghebi; Quintero, Juan Carlos Vasquez

    2015-01-01

    . In this paper, a voltage support strategy based on negative sequence droop control, which regulate the positive/negative sequence active and reactive power flow by means of sending proper voltage reference to the inner control loop, is proposed for the grid connected MGs to ride through voltage sags under...... complex line impedance conditions. In this case, the MGs should inject a certain amount of positive and negative sequence power to the grid so that the voltage quality at load side can be maintained at a satisfied level. A two layer hierarchical control strategy is proposed in this paper. The primary...... control loop consists of voltage and current inner loops, conventional droop control and virtual impedance loop while the secondary control loop is based on positive/negative sequence droop control which can achieve power injection under voltage sags. Experimental results with asymmetrical voltage sags...

  9. EDF's new environment-oriented method for planning the Extra High Voltage transmission network

    International Nuclear Information System (INIS)

    Trogneux, F.; Doquet, M.; Blondel, H.; Mallet, P.

    1996-01-01

    As EDF is experiencing increasing difficulties to develop its transmission network, the time may have come to reconsider the project selection method. In this paper, we point out that the currently used method essentially relies on a classical discounted balance criterion. We then present a new method taking into account the impact of a project on the environment by considering an environmental risk which may jeopardize the project's success. This method helps to evaluate the probability that each possible route of each project will be carried through. A simple probability computation then allows us to derive a global comparison of the eligible projects on the basis of an expected discounted balance criterion. Experiments now in progress will help to decide upon this method's efficiency in the context of an operational use. (author). 5 figs., 1 tab., 4 refs

  10. The Application of Auto-Disturbance Rejection Control Optimized by Least Squares Support Vector Machines Method and Time-Frequency Representation in Voltage Source Converter-High Voltage Direct Current System.

    Science.gov (United States)

    Liu, Ying-Pei; Liang, Hai-Ping; Gao, Zhong-Ke

    2015-01-01

    In order to improve the performance of voltage source converter-high voltage direct current (VSC-HVDC) system, we propose an improved auto-disturbance rejection control (ADRC) method based on least squares support vector machines (LSSVM) in the rectifier side. Firstly, we deduce the high frequency transient mathematical model of VSC-HVDC system. Then we investigate the ADRC and LSSVM principles. We ignore the tracking differentiator in the ADRC controller aiming to improve the system dynamic response speed. On this basis, we derive the mathematical model of ADRC controller optimized by LSSVM for direct current voltage loop. Finally we carry out simulations to verify the feasibility and effectiveness of our proposed control method. In addition, we employ the time-frequency representation methods, i.e., Wigner-Ville distribution (WVD) and adaptive optimal kernel (AOK) time-frequency representation, to demonstrate our proposed method performs better than the traditional method from the perspective of energy distribution in time and frequency plane.

  11. The Application of Auto-Disturbance Rejection Control Optimized by Least Squares Support Vector Machines Method and Time-Frequency Representation in Voltage Source Converter-High Voltage Direct Current System.

    Directory of Open Access Journals (Sweden)

    Ying-Pei Liu

    Full Text Available In order to improve the performance of voltage source converter-high voltage direct current (VSC-HVDC system, we propose an improved auto-disturbance rejection control (ADRC method based on least squares support vector machines (LSSVM in the rectifier side. Firstly, we deduce the high frequency transient mathematical model of VSC-HVDC system. Then we investigate the ADRC and LSSVM principles. We ignore the tracking differentiator in the ADRC controller aiming to improve the system dynamic response speed. On this basis, we derive the mathematical model of ADRC controller optimized by LSSVM for direct current voltage loop. Finally we carry out simulations to verify the feasibility and effectiveness of our proposed control method. In addition, we employ the time-frequency representation methods, i.e., Wigner-Ville distribution (WVD and adaptive optimal kernel (AOK time-frequency representation, to demonstrate our proposed method performs better than the traditional method from the perspective of energy distribution in time and frequency plane.

  12. Estimation of flashover voltage probability of overhead line insulators under industrial pollution, based on maximum likelihood method

    International Nuclear Information System (INIS)

    Arab, M.N.; Ayaz, M.

    2004-01-01

    The performance of transmission line insulator is greatly affected by dust, fumes from industrial areas and saline deposit near the coast. Such pollutants in the presence of moisture form a coating on the surface of the insulator, which in turn allows the passage of leakage current. This leakage builds up to a point where flashover develops. The flashover is often followed by permanent failure of insulation resulting in prolong outages. With the increase in system voltage owing to the greater demand of electrical energy over the past few decades, the importance of flashover due to pollution has received special attention. The objective of the present work was to study the performance of overhead line insulators in the presence of contaminants such as induced salts. A detailed review of the literature and the mechanisms of insulator flashover due to the pollution are presented. Experimental investigations on the behavior of overhead line insulators under industrial salt contamination are carried out. A special fog chamber was designed in which the contamination testing of insulators was carried out. Flashover behavior under various degrees of contamination of insulators with the most common industrial fume components such as Nitrate and Sulphate compounds was studied. Substituting the normal distribution parameter in the probability distribution function based on maximum likelihood develops a statistical method. The method gives a high accuracy in the estimation of the 50% flashover voltage, which is then used to evaluate the critical flashover index at various contamination levels. The critical flashover index is a valuable parameter in insulation design for numerous applications. (author)

  13. Implementation of Particle Swarm Optimization Method for Voltage Stability Analysis in 150 kV Sub System Grati – Paiton East Java

    Science.gov (United States)

    Kusumaningtyas, A. B.; Hidayat, M. N.; Ronilaya, F.

    2018-04-01

    Based on the data from State Electric Company on 15 January 2013, the undistributed power in the 150 kV sub system Grati-Paiton Region IV, that consist of 26 bus 150 kV and 2 bus generation 500 kV system, was recorded 3.286,00 MW. At the same time, the frequency of the system was down to 49 Hz. This lead to a deficit generation and unstable voltage condition in the system. Fast Voltage Stability Index (FVSI) method is used in this research to analyze the voltage stability of the buses. For buses with unstable voltage condition, reactive power will be injected through capacitor installation. The site where the capacitor will be installed is determined using the Fast Voltage Stability Index (FVSI) method while the size of the capacitor is determined using the Particle Swarm Optimization (PSO) method. The PSO method has been applied in some researches, such as to determine optimal placement and sizing in radial distribution network as well as in transmission network.. In this research, the PSO method is used to find the Qloss of an interconnection transmission system, which in turn, the value of the Qloss is used to determine the capacitance of the capacitor needed by the system.

  14. Methods and techniques for obtaining significant discharge measurements on high-voltage bushings

    Energy Technology Data Exchange (ETDEWEB)

    Jolley, H E.W.

    1965-05-01

    Forms of discharge tests are described and compared. The use of the Arman and Starr discharge bridge with cathode-ray-tube display is shown to be practicable for bushing testing up to 600 kV. Spurious discharge effects and the precautions necessary to eliminate them are discussed. Consideration is given to calibration methods and to the errors to be expected with various practical circuits. The problem of establishing safe discharge limits for bushings is considered on the basis of a large number of test results and on service experience.

  15. Separation method for rare-earths using high-voltage electrophoresis on paper strip

    International Nuclear Information System (INIS)

    Clarence, J.

    1966-01-01

    The equipment includes an electrophoresis set running at 3 000 V and 20 mA. Two cooling plates are used as heat exchanger, and a pneumatic pressure device to insure an uniform pressure on the paper strip laid flat. The mobilities and the separations of the rare earths in lactic, and, α hydroxy-isobutyric acid solutions are investigated on cellulose acetate strip. Better results are obtained with α hydroxy-isobutyric acid. The method is rapid and allows a fine fractionation of rare earth elements within less than an hour. A complete separation of a Ce - Pr - Nd - Pm - Eu mixture, and a Y - Tb mixture is obtained. (author) [fr

  16. Performance enhancement of the single-phase series active filter by employing the load voltage waveform reconstruction and line current sampling delay reduction methods

    DEFF Research Database (Denmark)

    Senturk, O.S.; Hava, A.M.

    2011-01-01

    This paper proposes the waveform reconstruction method (WRM), which is utilized in the single-phase series active filter's (SAF's) control algorithm, in order to extract the load harmonic voltage component of voltage harmonic type single-phase diode rectifier loads. Employing WRM and the line...... current sampling delay reduction method, a single-phase SAF compensated system provides higher harmonic isolation performance and higher stability margins compared to the system using conventional synchronous-reference-frame-based methods. The analytical, simulation, and experimental studies of a 2.5 k...

  17. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  18. Comparative Study of Fault Diagnostic Methods in Voltage Source Inverter Fed Three Phase Induction Motor Drive

    Science.gov (United States)

    Dhumale, R. B.; Lokhande, S. D.

    2017-05-01

    Three phase Pulse Width Modulation inverter plays vital role in industrial applications. The performance of inverter demeans as several types of faults take place in it. The widely used switching devices in power electronics are Insulated Gate Bipolar Transistors (IGBTs) and Metal Oxide Field Effect Transistors (MOSFET). The IGBTs faults are broadly classified as base or collector open circuit fault, misfiring fault and short circuit fault. To develop consistency and performance of inverter, knowledge of fault mode is extremely important. This paper presents the comparative study of IGBTs fault diagnosis. Experimental set up is implemented for data acquisition under various faulty and healthy conditions. Recent methods are executed using MATLAB-Simulink and compared using key parameters like average accuracy, fault detection time, implementation efforts, threshold dependency, and detection parameter, resistivity against noise and load dependency.

  19. Novel method for hit-position reconstruction using voltage signals in plastic scintillators and its application to Positron Emission Tomography

    Science.gov (United States)

    Raczyński, L.; Moskal, P.; Kowalski, P.; Wiślicki, W.; Bednarski, T.; Białas, P.; Czerwiński, E.; Kapłon, Ł.; Kochanowski, A.; Korcyl, G.; Kowal, J.; Kozik, T.; Krzemień, W.; Kubicz, E.; Molenda, M.; Moskal, I.; Niedźwiecki, Sz.; Pałka, M.; Pawlik-Niedźwiecka, M.; Rudy, Z.; Salabura, P.; Sharma, N. G.; Silarski, M.; Słomski, A.; Smyrski, J.; Strzelecki, A.; Wieczorek, A.; Zieliński, M.; Zoń, N.

    2014-11-01

    Currently inorganic scintillator detectors are used in all commercial Time of Flight Positron Emission Tomograph (TOF-PET) devices. The J-PET collaboration investigates a possibility of construction of a PET scanner from plastic scintillators which would allow for single bed imaging of the whole human body. This paper describes a novel method of hit-position reconstruction based on sampled signals and an example of an application of the method for a single module with a 30 cm long plastic strip, read out on both ends by Hamamatsu R4998 photomultipliers. The sampling scheme to generate a vector with samples of a PET event waveform with respect to four user-defined amplitudes is introduced. The experimental setup provides irradiation of a chosen position in the plastic scintillator strip with an annihilation gamma quanta of energy 511 keV. The statistical test for a multivariate normal (MVN) distribution of measured vectors at a given position is developed, and it is shown that signals sampled at four thresholds in a voltage domain are approximately normally distributed variables. With the presented method of a vector analysis made out of waveform samples acquired with four thresholds, we obtain a spatial resolution of about 1 cm and a timing resolution of about 80 ps (σ).

  20. Novel method for hit-position reconstruction using voltage signals in plastic scintillators and its application to Positron Emission Tomography

    International Nuclear Information System (INIS)

    Raczyński, L.; Moskal, P.; Kowalski, P.; Wiślicki, W.; Bednarski, T.; Białas, P.; Czerwiński, E.; Kapłon, Ł.; Kochanowski, A.; Korcyl, G.; Kowal, J.; Kozik, T.; Krzemień, W.; Kubicz, E.; Molenda, M.; Moskal, I.; Niedźwiecki, Sz.; Pałka, M.; Pawlik-Niedźwiecka, M.; Rudy, Z.

    2014-01-01

    Currently inorganic scintillator detectors are used in all commercial Time of Flight Positron Emission Tomograph (TOF-PET) devices. The J-PET collaboration investigates a possibility of construction of a PET scanner from plastic scintillators which would allow for single bed imaging of the whole human body. This paper describes a novel method of hit-position reconstruction based on sampled signals and an example of an application of the method for a single module with a 30 cm long plastic strip, read out on both ends by Hamamatsu R4998 photomultipliers. The sampling scheme to generate a vector with samples of a PET event waveform with respect to four user-defined amplitudes is introduced. The experimental setup provides irradiation of a chosen position in the plastic scintillator strip with an annihilation gamma quanta of energy 511 keV. The statistical test for a multivariate normal (MVN) distribution of measured vectors at a given position is developed, and it is shown that signals sampled at four thresholds in a voltage domain are approximately normally distributed variables. With the presented method of a vector analysis made out of waveform samples acquired with four thresholds, we obtain a spatial resolution of about 1 cm and a timing resolution of about 80 ps (σ)

  1. Novel method for hit-position reconstruction using voltage signals in plastic scintillators and its application to Positron Emission Tomography

    Energy Technology Data Exchange (ETDEWEB)

    Raczyński, L., E-mail: lech.raczynski@ncbj.gov.pl [Świerk Computing Centre, National Centre for Nuclear Research, 05-400 Otwock-Świerk (Poland); Moskal, P. [Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, 30-059 Cracow (Poland); Kowalski, P.; Wiślicki, W. [Świerk Computing Centre, National Centre for Nuclear Research, 05-400 Otwock-Świerk (Poland); Bednarski, T.; Białas, P.; Czerwiński, E. [Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, 30-059 Cracow (Poland); Kapłon, Ł. [Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, 30-059 Cracow (Poland); Institute of Metallurgy and Materials Science of Polish Academy of Sciences, Cracow (Poland); Kochanowski, A. [Faculty of Chemistry, Jagiellonian University, 30-060 Cracow (Poland); Korcyl, G.; Kowal, J.; Kozik, T.; Krzemień, W.; Kubicz, E. [Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, 30-059 Cracow (Poland); Molenda, M. [Faculty of Chemistry, Jagiellonian University, 30-060 Cracow (Poland); Moskal, I.; Niedźwiecki, Sz.; Pałka, M.; Pawlik-Niedźwiecka, M.; Rudy, Z. [Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, 30-059 Cracow (Poland); and others

    2014-11-11

    Currently inorganic scintillator detectors are used in all commercial Time of Flight Positron Emission Tomograph (TOF-PET) devices. The J-PET collaboration investigates a possibility of construction of a PET scanner from plastic scintillators which would allow for single bed imaging of the whole human body. This paper describes a novel method of hit-position reconstruction based on sampled signals and an example of an application of the method for a single module with a 30 cm long plastic strip, read out on both ends by Hamamatsu R4998 photomultipliers. The sampling scheme to generate a vector with samples of a PET event waveform with respect to four user-defined amplitudes is introduced. The experimental setup provides irradiation of a chosen position in the plastic scintillator strip with an annihilation gamma quanta of energy 511 keV. The statistical test for a multivariate normal (MVN) distribution of measured vectors at a given position is developed, and it is shown that signals sampled at four thresholds in a voltage domain are approximately normally distributed variables. With the presented method of a vector analysis made out of waveform samples acquired with four thresholds, we obtain a spatial resolution of about 1 cm and a timing resolution of about 80 ps (σ)

  2. Measurement of Internal Friction for Tungsten by the Curve Vibrating Method with Variation of Voltage and Temperature

    Directory of Open Access Journals (Sweden)

    Elin Yusibani

    2013-12-01

    Full Text Available Application of a curved vibrating wire method (CVM to measure gas viscosity has been widely used. A fine Tungsten wire with 50 mm of diameter is bent into a semi-circular shape and arranged symmetrically in a magnetic field of about 0.2 T. The frequency domain is used for calculating the viscosity as a response for forced oscillation of the wire. Internal friction is one of the parameter in the CVM which is has to be measured beforeahead. Internal friction coefficien for the wire material which is the inverse of the quality factor has to be measured in a vacuum condition. The term involving internal friction actually represents the effective resistance of motion due to all non-viscous damping phenomena including internal friction and magnetic damping. The testing of internal friction measurement shows that at different induced voltage and elevated temperature at a vacuum condition, it gives the value of internal friction for Tungsten is around 1 to 4 10-4.

  3. Simulation of the build-up phase of a high voltage low pressure gas discharge using Monte-Carlo-methods

    International Nuclear Information System (INIS)

    Niessen, W.

    1990-02-01

    In this report the simulation of a Pseudospark predischarge between anode and cathode using Monte-Carlo-Methods is described. In the early phase of the discharge electric and magnetic self-fields can be neglected. The model is based on a discharge between two infinitely extended capacitor plates. Eleven different collision reactions and two electrode surface effects are taken into account. A Fortran program was developed that computes the built-up of the discharge in time and space. A specially of the code is, that not only electrons and ions are taken into account, but also fast neutral atoms and molecules. Three pairs of diode-length and voltage were investigated at different pressures: 350 kV/5.0 cm, 30 kV/10.0 cm and 6.9 kV/0.7 cm. The working gas was hydrogen. The computations included: The Paschen-curve, the time evolution of the current densities of the electrons at the anode and the ions at the cathode, the space- and time-dependent particle densities, the time-dependent energy distributions of the different particle species, the relative number of the different collision reactions. (orig./HSI) [de

  4. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  5. Development of method for detecting signs deterioration in insulator of high-voltage motors. 2. Test Results of a new on-line partial discharge monitor for high-voltage motors in nuclear power stations

    International Nuclear Information System (INIS)

    Tochio, Atsushi; Kaneda, Yoshiharu; Urakawa, Nobuo

    2000-01-01

    For the purpose of early detection of deterioration of insulators in high-voltage motors which are widely utilized in nuclear power stations, a new on-line partial discharge (PD) monitor was developed and was tested for sixteen motors which were practically running in nuclear power stations. From the test results, it is seen that (1) good signal to noise ratio is obtained by adopting a two frequency correlation method, (2) a resistance temperature detector (RTD) in a motor has sufficient sensitivity to detect PD, (3) when RTD is not installed or is unable to use for this purpose, a radio frequency current transformer (RFCT) can be utilized, although its sensitivity is about 1/10 of that of the RTD monitor. Finally we found a good correlation between the results of this on-line method and the conventional off-line method in which the insulator resistance of a concerned motor was measured during its shut-down, and thereby we demonstrated that this method could be applicable to the on-line test of high-voltage motors in nuclear power stations. (author)

  6. Breakdown Voltage of CF3CHCl2 gas an Alternative to SF6 Gas using HV Test and Bonding Energy Methods

    Science.gov (United States)

    Juliandhy, Tedy; Haryono, T.; Suharyanto; Perdana, Indra

    2018-04-01

    For more than two decades of Sulphur Hexafluoride (SF6) gases is used as a gas insulation in high voltage equipment especially in substations. In addition to getting an advantage as an insulating gas. SF6 gas is recognized as one of the greenhouse effect gases that cause global warming. Under the Kyoto Protocol, SF6 gas is one of those gases whose use is restricted and gradually reduced to the presence of a replacement gas for SF6 gas. One of the alternative gas alternatives which have the potential of replacing SF6 gas as an insulating gas in Gas Insulated Switchgear (GIS) equipment in the substation is Dichlorotrifluoroethane (CF3CHCl2) gas. The purpose of this paper is to enable a comparison of breakdown voltage with high voltage test and method of calculating Bonding energy to Dichlorotrifluoroethane gas as substitute gas for SF6 gas. At 0.1 bar gas pressure obtained an average breakdown voltage of 18.68 kV / mm at 25oC chamber temperature and has the highest breakdown voltage at 50oC with a breakdown voltage of 19.56 kV / mm. The CF3CHCl2 gas has great potential as an insulating gas because it has more insulation ability high of SF6 gas, and is part of the gas recommended under the Kyoto Protocol. Gas CF3CHCl2 has the capacity to double the value of electronegativity greater than SF6 gas as a major requirement of gas isolation and has a value of Global Warming Potential (GWP) and Ozone Depleting lower than from SF6 gas.

  7. Detection Method for Soft Internal Short Circuit in Lithium-Ion Battery Pack by Extracting Open Circuit Voltage of Faulted Cell

    Directory of Open Access Journals (Sweden)

    Minhwan Seo

    2018-06-01

    Full Text Available Early detection of internal short circuit which is main cause of thermal runaway in a lithium-ion battery is necessary to ensure battery safety for users. As a promising fault index, internal short circuit resistance can directly represent degree of the fault because it describes self-discharge phenomenon caused by the internal short circuit clearly. However, when voltages of individual cells in a lithium-ion battery pack are not provided, the effect of internal short circuit in the battery pack is not readily observed in whole terminal voltage of the pack, leading to difficulty in estimating accurate internal short circuit resistance. In this paper, estimating the resistance with the whole terminal voltages and the load currents of the pack, a detection method for the soft internal short circuit in the pack is proposed. Open circuit voltage of a faulted cell in the pack is extracted to reflect the self-discharge phenomenon obviously; this process yields accurate estimates of the resistance. The proposed method is verified with various soft short conditions in both simulations and experiments. The error of estimated resistance does not exceed 31.2% in the experiment, thereby enabling the battery management system to detect the internal short circuit early.

  8. Voltage-Balancing Method for Modular Multilevel Converters Under Phase-Shifted Carrier-Based Pulsewidth Modulation

    DEFF Research Database (Denmark)

    Deng, Fujin; Chen, Zhe

    2015-01-01

    The modular multilevel converter (MMC) becomes attractive for medium- or high-power applications because of the advantages of high modularity, availability, and power quality. One of the technical challenges associated with an MMC is the balancing of the capacitors' voltages. In this paper...

  9. A Comprehensive Review of Low-Voltage-Ride-Through Methods for Fixed-Speed Wind Power Generators

    DEFF Research Database (Denmark)

    Moghadasi, Amirhasan; Sarwat, Arif; Guerrero, Josep M.

    2016-01-01

    This paper presents a comprehensive review of various techniques employed to enhance the low voltage ride through (LVRT) capability of the fixed-speed induction generators (FSIGs)-based wind turbines (WTs), which has a non-negligible 20% contribution of the existing wind energy in the world...

  10. Diagnostic method for measuring plasma-induced voltages on the PBX-M [Princeton Beta Experiment-Modified] stabilizing shell

    International Nuclear Information System (INIS)

    Kugel, H.W.; Okabayashi, M.; Schweitzer, S.

    1990-07-01

    The Princeton Beta Experiment-Modified (PBX-M) has a close-fitting conducting, passive plate, stabilizing shell which nearly surrounds highly indented, bean-shaped plasmas. The proximity of this electrically isolated shell to a large fraction of the plasma surface allows measurements similar to previous work on other tokamaks using floating probes and limiters. Measurements were performed to characterize the plasma-induced voltages on the PBX-M passive plate stabilizing shell during high-β plasmas. Voltage differences were measured between the respective passive plate toroidal and poloidal gaps, the respective passive plates and the vessel, and an outer poloidal graphite limiter and its passive plate. The calibration and qualification testing procedures are discussed. The initial measurements found that the largest voltages were observed at plasma start-up and at the plasma current disruption and exhibited characteristics depending on operating conditions. The highest voltages observed have been at disruption and were less than 2 kV. 9 refs., 5 figs

  11. High-voltage leak detection of a parenteral proteinaceous solution product packaged in form-fill-seal plastic laminate bags. Part 1. Method development and validation.

    Science.gov (United States)

    Damgaard, Rasmus; Rasmussen, Mats; Buus, Peter; Mulhall, Brian; Guazzo, Dana Morton

    2013-01-01

    In Part 1 of this three-part research series, a leak test performed using high-voltage leak detection (HVLD) technology, also referred to as an electrical conductivity and capacitance leak test, was developed and validated for container-closure integrity verification of a small-volume laminate plastic bag containing an aqueous solution for injection. The sterile parenteral product is the rapid-acting insulin analogue, insulin aspart (NovoRapid®/NovoLog®, by Novo Nordisk A/S, Bagsværd, Denmark). The aseptically filled and sealed package is designed to preserve product sterility through expiry. Method development and validation work incorporated positive control packages with a single hole laser-drilled through the laminate film of each bag. A unique HVLD method characterized by specific high-voltage and potentiometer set points was established for testing bags positioned in each of three possible orientations as they are conveyed through the instrument's test zone in each of two possible directions-resulting in a total of six different test method options. Validation study results successfully demonstrated the ability of all six methods to accurately and reliably detect those packages with laser-drilled holes from 2.5-11.2 μm in nominal diameter. Part 2 of this series will further explore HVLD test results as a function of package seal and product storage variables. The final Part 3 will report the impact of HVLD exposure on product physico-chemical stability. In this Part 1 of a three-part research series, a leak test method based on electrical conductivity and capacitance, called high voltage leak detection (HVLD), was used to find leaks in small plastic bags filled with an insulin pharmaceutical solution for human injection by Novo Nordisk A/S (Bagsværd, Denmark). To perform the test, the package is electrically grounded while being conveyed past an electrode linked to a high-voltage, low-amperage transformer. The instrument measures the current that passes

  12. Comparison of mega-voltage cone-beam computed tomography prostate localization with online ultrasound and fiducial markers methods.

    Science.gov (United States)

    Gayou, Olivier; Miften, Moyed

    2008-02-01

    The online image-guided localization data from 696 ultrasound (US), 598 mega-voltage cone-beam computed tomography (MV-CBCT), and 393 seed markers (SMs) couch alignments for patients undergoing intensity modulation radiotherapy of the prostate were analyzed. Daily US, MV-CBCT and SM images were acquired for 19, 17 and 12 patients, respectively, after each patient was immobilized in a vacuum cradle and setup to skin markers as the center of mass. The couch shifts applied in the lateral (left-right/LR), vertical (anterior-posterior/AP), and longitudinal (superior-inferior/SI) directions, along with the magnitude of the three-dimensional (3D) shift vector, were analyzed and compared for all three methods. The percentage of shifts larger than 5 mm in all directions was also compared. Clinical target volume-planning target volume (CTV-to-PTV) expansion margins were estimated based on the localization data with US, CB, and SM image guidance. Results show the US data have greater variability. Systematic and random shifts were -1.2 +/- 6.8 mm (LR), -2.8 +/- 5.1 mm (SI) and -1.0 +/- 5.9 mm (AP) for US, 1.0 +/- 3.9 mm (LR), -1.3 +/- 2.5 mm (SI) and -0.3 +/- 3.9 mm (AP) for CB, and -1.0 +/- 3.4 mm (LR), 0.0 +/- 3.4 mm (SI) and 0.5 +/- 4.1 mm (AP) for SM. The mean 3D shift distance was larger using US (8.8 +/- 6.2 mm) compared to CB and SM (5.3 +/- 3.4 mm and 5.2 +/- 3.7 mm, respectively). The percentage of US shifts larger than 5 mm were 34%, 31%, and 38% in the LR, SI, and AP directions, respectively, compared to 18%, 6%, and 16% for CB and 14%, 10%, and 20% for SM. MV-CBCT and SM localization data suggest a different distribution of prostate center-of-mass shifts with smaller variability, compared to US. The online MV-CBCT and SM image-guidance data show that for treatments that do not include daily prostate localization, one can use a CTV-to-PTV margin that is 4 mm smaller than the one suggested by US data, hence allowing more rectum and bladder sparing and potentially

  13. Computer aided method of low voltage power distribution networks protection system against lightning and electromagnetic pulse generated by high altitude nuclear burst

    International Nuclear Information System (INIS)

    Laroubine, J.

    1989-01-01

    The lightning creates an electromagnetic field which produces a slow duration and high energy pulse of current on low voltage power distribution networks. On the other hand an high altitude nuclear burst generates an electromagnetic pulse which causes fast and intense interferences. We describe here the specifications of a passive filter that can reject these interferences. We used a computer aided method of simulation to create a prototype. Experimental results confirm the validity of the model used for simulation [fr

  14. A novel method of methanol concentration control through feedback of the amplitudes of output voltage fluctuations for direct methanol fuel cells

    International Nuclear Information System (INIS)

    An, Myung-Gi; Mehmood, Asad; Hwang, Jinyeon; Ha, Heung Yong

    2016-01-01

    This study proposes a novel method for controlling the methanol concentration without using methanol sensors for DMFC (direct methanol fuel cell) systems that have a recycling methanol-feed loop. This method utilizes the amplitudes of output voltage fluctuations of DMFC as a feedback parameter to control the methanol concentration. The relationship between the methanol concentrations and the amplitudes of output voltage fluctuations is correlated under various operating conditions and, based on the experimental correlations, an algorithm to control the methanol concentration with no sensor is established. Feasibility tests of the algorithm have been conducted under various operating conditions including varying ambient temperature with a 200 W-class DMFC system. It is demonstrated that the sensor-less controller is able to control the methanol-feed concentration precisely and to run the DMFC systems more energy-efficiently as compared with other control systems. - Highlights: • A new sensor-less algorithm is proposed to control the methanol concentration without using a sensor. • The algorithm utilizes the voltage fluctuations of DMFC as a feedback parameter to control the methanol feed concentration. • A 200 W DMFC system is operated to evaluate the validity of the sensor-less algorithm. • The algorithm successfully controls the methanol feed concentration within a small error bound.

  15. Evaluation of the drain—source voltage effect on AlGaAs/InGaAs PHEMTs thermal resistance by the structure function method

    International Nuclear Information System (INIS)

    Ma Lin; Feng Shiwei; Zhang Yamin; Deng Bing; Yue Yuan

    2014-01-01

    The effect of drain—source voltage on AlGaAs/InGaAs PHEMTs thermal resistance is studied by experimental measuring and simulation. The result shows that AlGaAs/InGaAs PHEMTs thermal resistance presents a downward trend under the same power dissipation when the drain—source voltage (V DS ) is decreased. Moreover, the relatively low V DS and large drain—source current (I DS ) result in a lower thermal resistance. The chip-level and package-level thermal resistance have been extracted by the structure function method. The simulation result indicated that the high electric field occurs at the gate contact where the temperature rise occurs. A relatively low V DS leads to a relatively low electric field, which leads to the decline of the thermal resistance. (semiconductor devices)

  16. Current-voltage analysis of the record-efficiency CuGaSe2 solar cell: Application of the current separation method and the interface recombination model

    International Nuclear Information System (INIS)

    Saad, M.; Kasis, A.

    2011-01-01

    Current-voltage (j-V) characteristics of the record-efficiency CuGaSe 2 solar cell measured under several illumination levels are analyzed using a two-diode equation for a more accurate description of cell behavior. The contribution of each diode to the total cell j-V characteristic under illumination was estimated using the current separation method presented recently. This is performed in an effort to identify the distinctive features of this record-efficiency cell which have led to the up-to-date highest open circuit voltage of V o c = 946 mV and fill factor of FF = 66.5% for CuGaSe 2 solar cells. Furthermore, the interface recombination component of the cell current under illumination is quantitatively discussed applying the interface recombination model presented earlier. (author)

  17. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    DEFF Research Database (Denmark)

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  18. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  19. METHODICAL APPROACHES TO THE CHOICE OF THE NEW GENERATION OF HIGH-VOLTAGE POWER TRANSMISSION LINE 220 kV OPTIONS

    Directory of Open Access Journals (Sweden)

    POSTOLATI V.M.

    2010-08-01

    Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

  20. Method and system for a gas tube-based current source high voltage direct current transmission system

    Science.gov (United States)

    She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di

    2017-08-29

    A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.

  1. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  2. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  3. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  4. A current-excited triple-time-voltage oversampling method for bio-impedance model for cost-efficient circuit system.

    Science.gov (United States)

    Yan Hong; Yong Wang; Wang Ling Goh; Yuan Gao; Lei Yao

    2015-08-01

    This paper presents a mathematic method and a cost-efficient circuit to measure the value of each component of the bio-impedance model at electrode-electrolyte interface. The proposed current excited triple-time-voltage oversampling (TTVO) method deduces the component values by solving triple simultaneous electric equation (TSEE) at different time nodes during a current excitation, which are the voltage functions of time. The proposed triple simultaneous electric equations (TSEEs) allows random selections of the time nodes, hence numerous solutions can be obtained during a single current excitation. Following that, the oversampling approach is engaged by averaging all solutions of multiple TSEEs acquired after a single current excitation, which increases the practical measurement accuracy through the improvement of the signal-to-noise ratio (SNR). In addition, a print circuit board (PCB) that consists a switched current exciter and an analog-to-digital converter (ADC) is designed for signal acquisition. This presents a great cost reduction when compared against other instrument-based measurement data reported [1]. Through testing, the measured values of this work is proven to be in superb agreements on the true component values of the electrode-electrolyte interface model. This work is most suited and also useful for biological and biomedical applications, to perform tasks such as stimulations, recordings, impedance characterizations, etc.

  5. Biased low differential input impedance current receiver/converter device and method for low noise readout from voltage-controlled detectors

    Science.gov (United States)

    Degtiarenko, Pavel V [Williamsburg, VA; Popov, Vladimir E [Newport News, VA

    2011-03-22

    A first stage electronic system for receiving charge or current from voltage-controlled sensors or detectors that includes a low input impedance current receiver/converter device (for example, a transimpedance amplifier), which is directly coupled to the sensor output, a source of bias voltage, and the device's power supply (or supplies), which use the biased voltage point as a baseline.

  6. [Development of residual voltage testing equipment].

    Science.gov (United States)

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  7. Voltage Quality of Grid Connected Wind Turbines

    DEFF Research Database (Denmark)

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  8. Non-traditional method-based solution for elimination of lower order harmonics in voltage source inverter feeding an induction motor drive

    Directory of Open Access Journals (Sweden)

    Vargese Jegathesan

    2008-01-01

    Full Text Available This paper presents an efficient and reliable Genetic Algorithm-based solution for Specific Harmonic Elimination (SHE switching pattern. This method eliminates considerable amount of lower order line voltage harmonics in Pulse Width Modulation (PWM inverter. The determination of pulse pattern for the elimination of some lower order harmonics of a PWM inverter necessitates solving a system of nonlinear transcendental equations. Genetic Algorithm is used to solve nonlinear transcendental equations for PWM-SHE. In this proposed method, harmonics up to 17th are eliminated using Genetic Algorithm without using Dual transformer. Simulations using Matlab 7.0 and PSIM 6.1 are carried out so as to validate the solution.

  9. A Comparative Study on Pulse Sinusoidal High Frequency Voltage Injection and INFORM Methods for PMSM Position Sensorless Control

    DEFF Research Database (Denmark)

    Ni, Ronggang; Lu, Kaiyuan; Blaabjerg, Frede

    2016-01-01

    and Indirect Flux detection by On-line Reactance Measurement (INFORM) method in the α-β reference frame. Implementation methods are deliberated in detail and the position estimation error caused by magnetic field distorsion is also discussed. Experiments using a commercial PMSM are carried out...

  10. Numerical Simulation of Voltage Electric Field in Complex Geometries for Different Electrode Arrangements using Meshless Local MQ-DQ Method

    DEFF Research Database (Denmark)

    Jalaal, M.; Soleimani, Soheil; Domairry, G.

    2011-01-01

    In this paper the meshless Local Multi Quadrics-based Differential Quadrature (MQ-DQ) method is applied to obtain the electric field distribution for different applicable irregular geometries. This method is the combination of Differential Quadrature approximation of derivatives and function...

  11. Thermometry, acid-base-biamperometry and alternating voltage based biamperometry as new indication methods in volumetric analysis

    OpenAIRE

    Sobieszuk, Grzegorz

    2013-01-01

    Titration is one of the most important methods among the quantitative analysis in the pharmaceutical area. The difficult task within this field has always been the determination of equivalent points of the chemical reactions. The long history of the titration encompasses the use of colorful plats extracts, synthetic chemical compounds such as phenolphthalein and the use of instrumental and electrochemical based methods such as potentiometry. The latest research filed concerning titration conc...

  12. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  13. A semi-automated method for rapid detection of ripple events on interictal voltage discharges in the scalp electroencephalogram.

    Science.gov (United States)

    Chu, Catherine J; Chan, Arthur; Song, Dan; Staley, Kevin J; Stufflebeam, Steven M; Kramer, Mark A

    2017-02-01

    High frequency oscillations are emerging as a clinically important indicator of epileptic networks. However, manual detection of these high frequency oscillations is difficult, time consuming, and subjective, especially in the scalp EEG, thus hindering further clinical exploration and application. Semi-automated detection methods augment manual detection by reducing inspection to a subset of time intervals. We propose a new method to detect high frequency oscillations that co-occur with interictal epileptiform discharges. The new method proceeds in two steps. The first step identifies candidate time intervals during which high frequency activity is increased. The second step computes a set of seven features for each candidate interval. These features require that the candidate event contain a high frequency oscillation approximately sinusoidal in shape, with at least three cycles, that co-occurs with a large amplitude discharge. Candidate events that satisfy these features are stored for validation through visual analysis. We evaluate the detector performance in simulation and on ten examples of scalp EEG data, and show that the proposed method successfully detects spike-ripple events, with high positive predictive value, low false positive rate, and high intra-rater reliability. The proposed method is less sensitive than the existing method of visual inspection, but much faster and much more reliable. Accurate and rapid detection of high frequency activity increases the clinical viability of this rhythmic biomarker of epilepsy. The proposed spike-ripple detector rapidly identifies candidate spike-ripple events, thus making clinical analysis of prolonged, multielectrode scalp EEG recordings tractable. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Current control methods for grid-side three-phase PWM voltage-source inverter in distributed generation systems

    DEFF Research Database (Denmark)

    Lar, Ionut Andrei; Radulescu, Mircea; Ritchie, Ewen

    2012-01-01

    A comparison between two current control methods of grid side inverter, PI current control and Robust Forward control is made. PI control is implemented in d-q synchronous frame while Forward is implemented in abc stationary frames.The report contains both simulations and experimental test wich...

  15. SoC-Based Dynamic Power Sharing Method with AC-Bus Voltage Restoration for Microgrid Applications

    DEFF Research Database (Denmark)

    Lu, Xiaonan; Sun, Kai; Guerrero, Josep M.

    2012-01-01

    In a microgrid system, distributed energy storage units are commonly employed as the energy buffers. In this paper, a dynamic power sharing method based on the state-of-charge (SoC) of each energy storage unit is proposed. Droop control is employed as the basic control strategy for the distributed...

  16. Synthesis of novel high-voltage cathode material LiCoPO4 via rheological phase method

    International Nuclear Information System (INIS)

    Tan, Long; Luo, Zhimei; Liu, Haowen; Yu, Ying

    2010-01-01

    For the first time, rheological phase method, a simple and effective route, is applied to synthesize novel cathode material LiCoPO 4 . X-ray diffraction spectrometer (XRD), X-ray photoelectron spectrometer (XPS), transmission electron microscope (TEM) and electrochemical impedance spectroscopy (EIS) are taken to investigate this material, respectively. XRD figure shows that the rheological sample is better crystallized than the solid-state one. XPS result of the rheological sample exhibits that the valence of Co is 2+. TEM images show that better dispersed particles with smaller size can be formed by rheological method comparing to the solid-state route. Charge-discharge test is carried out in the range of 3.0-5.0 V at 0.2 mA cm -2 . The initial discharge capacity for rheological phase and solid-state powder is 71.5 and 30.9 mAh g -1 , respectively. The better electrochemical property should be ascribed to the better crystallized rheological phase production with better dispersed and smaller particles, which can greatly facilitate the diffusion of Li + .

  17. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  18. High-Performance Harmonic Isolation and Load Voltage Regulation of the Three-Phase Series Active Filter Utilizing the Waveform Reconstruction Method

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Hava, Ahmet M.

    2009-01-01

    . The SAF-compensated system utilizing WRM provides highperformance load harmonic voltage isolation and load voltage regulation at steady-state and during transients compared to the system utilizing the synchronous reference-frame-based signal decomposition. In addition, reducing the line current sampling...

  19. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  20. Calculation of voltage drop during motors startup: power flow calculation by using the direct method; Calculo da queda de tensao na partida de motores: metodo direto do fluxo de potencia

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Monaco [PETROBRAS, Rio de Janeiro, RJ (Brazil)

    1998-07-01

    In this paper, is presented a new theoretical approach developed in order to determine by direct method, non iterative, the load flow among the N bus bar of a generic power system. This method has been used to, from a single line simplified system of a typical industrial substation, used in the petroleum and by products storage and transportation facilities, calculate the voltage drops at bus bars and motors terminals from starting of the electric motors, after defining active and reactive power expressions flowing among bus bars, as a function of their voltages, impedance of connecting cables and of the loads connected to them. (author)

  1. Toward magnetic resonance-guided electroanatomical voltage mapping for catheter ablation of scar-related ventricular tachycardia: a comparison of registration methods.

    Science.gov (United States)

    Tao, Qian; Milles, Julien; VAN Huls VAN Taxis, Carine; Lamb, Hildo J; Reiber, Johan H C; Zeppenfeld, Katja; VAN DER Geest, Rob J

    2012-01-01

    Integration of preprocedural delayed enhanced magnetic resonance imaging (DE-MRI) with electroanatomical voltage mapping (EAVM) may provide additional high-resolution substrate information for catheter ablation of scar-related ventricular tachycardias (VT). Accurate and fast image integration of DE-MRI with EAVM is desirable for MR-guided ablation. Twenty-six VT patients with large transmural scar underwent catheter ablation and preprocedural DE-MRI. With different registration models and EAVM input, 3 image integration methods were evaluated and compared to the commercial registration module CartoMerge. The performance was evaluated both in terms of distance measure that describes surface matching, and correlation measure that describes actual scar correspondence. Compared to CartoMerge, the method that uses the translation-and-rotation model and high-density EAVM input resulted in a registration error of 4.32±0.69 mm as compared to 4.84 ± 1.07 (P <0.05); the method that uses the translation model and high-density EAVM input resulted in a registration error of 4.60 ± 0.65 mm (P = NS); and the method that uses the translation model and a single anatomical landmark input resulted in a registration error of 6.58 ± 1.63 mm (P < 0.05). No significant difference in scar correlation was observed between all 3 methods and CartoMerge (P = NS). During VT ablation procedures, accurate integration of EAVM and DE-MRI can be achieved using a translation registration model and a single anatomical landmark. This model allows for image integration in minimal mapping time and is likely to reduce fluoroscopy time and increase procedure efficacy. © 2011 Wiley Periodicals, Inc.

  2. Electric power quality analysis methods. Application to voltage dips and harmonic disturbances; Methodes d'analyse de la qualite de l'energie electrique. Application aux creux de tension et a la pollution harmonique

    Energy Technology Data Exchange (ETDEWEB)

    Vanya, Ignatova

    2006-10-15

    The power quality concerns all the actors in the energy domains, that they are network administrators, suppliers, producers, or consumers of electricity. The research work presented in this PhD thesis is situated in the field of the power quality monitoring. Its objective is to introduce new techniques for analysis of power quality problems. There are different methods designed for the analysis of the power quality disturbances. This method reaches very good performances in the voltage dips analysis, as it allows segmenting, classifying and characterising these power quality disturbances. The periodic systems method allows the theoretical study of the generation and the propagation of harmonic disturbances in the network. Finally, the statistical matrix method has the objective to represent statistically electrical signals without loss of important information. (author)

  3. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  4. Non-destructive vacuum decay method for pre-filled syringe closure integrity testing compared with dye ingress testing and high-voltage leak detection.

    Science.gov (United States)

    Simonetti, Andrea; Amari, Filippo

    2015-01-01

    In reaction to the limitations of the traditional sterility test methods, in 2008, the U.S. Food and Drug Administration issued the guidance "Container and Closure System Integrity Testing in Lieu of Sterility Testing as a Component of the Stability Protocol for Sterile Products" encouraging sterile drug manufacturers to use properly validated physical methods, apart from conventional microbial challenge testing, to confirm container closure integrity as part of the stability protocol. The case study presented in this article investigated the capability of four container closure integrity testing methods to detect simulated defects of different sizes and types on glass syringes, prefilled both with drug product intended for parenteral administration and sterile water. The drug product was a flu vaccine (Agrippal, Novartis Vaccines, Siena, Italy). Vacuum decay, pharmacopoeial dye ingress test, Novartis specific dye ingress test, and high-voltage leak detection were, in succession, the methods involved in the comparative studies. The case study execution was preceded by the preparation of two independent sets of reference prefilled syringes, classified, respectively, as examples of conforming to closure integrity requirements (negative controls) and as defective (positive controls). Positive controls were, in turn, split in six groups, three of with holes laser-drilled through the prefilled syringe glass barrel, while the other three with capillary tubes embedded in the prefilled syringe plunger. These reference populations were then investigated by means of validated equipment used for container closure integrity testing of prefilled syringe commercial production; data were collected and analyzed to determine the detection rate and the percentage of false results. Results showed that the vacuum decay method had the highest performance in terms of detection sensitivity and also ensured the best reliability and repeatability of measurements. An innovative technical

  5. Comparison of Different Methods for Optimal Control of UPFC for Load Flow Control and Voltage Flicker Elimination and Current Harmonics Elimination

    Czech Academy of Sciences Publication Activity Database

    Al Asooly, H.; Tlustý, J.; Valouch, Viktor

    2003-01-01

    Roč. 48, č. 1 (2003), s. 65-75 ISSN 0001-7043 Institutional research plan: CEZ:AV0Z2057903 Keywords : voltage source inverter * unified power flow controller (UPFC) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  6. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  7. Coordinated Voltage Control of Active Distribution Network

    Directory of Open Access Journals (Sweden)

    Xie Jiang

    2016-01-01

    Full Text Available This paper presents a centralized coordinated voltage control method for active distribution network to solve off-limit problem of voltage after incorporation of distributed generation (DG. The proposed method consists of two parts, it coordinated primal-dual interior point method-based voltage regulation schemes of DG reactive powers and capacitors with centralized on-load tap changer (OLTC controlling method which utilizes system’s maximum and minimum voltages, to improve the qualified rate of voltage and reduce the operation numbers of OLTC. The proposed coordination has considered the cost of capacitors. The method is tested using a radial edited IEEE-33 nodes distribution network which is modelled using MATLAB.

  8. Enhancement of open-circuit voltage on organic photovoltaic devices by Al-doped TiO{sub 2} modifying layer produced by sol–gel method

    Energy Technology Data Exchange (ETDEWEB)

    Valaski, R.; Arantes, C.; Senna, C.A.; Carôzo, Victor; Achete, C.A. [Materials Metrology Division, Instituto Nacional de Metrologia, Qualidade e Tecnologia, Xerém, Duque de Caxias 25250-020, RJ (Brazil); Cremona, M., E-mail: cremona@fis.puc-rio.br [Materials Metrology Division, Instituto Nacional de Metrologia, Qualidade e Tecnologia, Xerém, Duque de Caxias 25250-020, RJ (Brazil); Physics Department, Pontifícia Universidade Católica do Rio de Janeiro, Rio de Janeiro 22453-970, RJ (Brazil)

    2014-12-01

    Sol–gel method has shown several advantages for oxide synthesis, such as lower cost production, coating large areas, lower processing temperatures and ease insertion of doping materials. Therefore, it is attractive for production of intermediate and electrode modifying layers in organic optoelectronic devices. Herein, spin-coated aluminum-doped titanium dioxide (AlTiO{sub 2}) thin films were produced by sol–gel method onto glass and fluorine-doped tin oxide (FTO) substrates, using different Al-dopant concentrations and post-done annealing temperatures. Electrical measurements were performed in order to investigate the improvement of the TiO{sub 2} resistivity. Additionally, structural, compositional, morphological, optical and electrical properties of the optimal AlTiO{sub 2} modifying layers onto FTO substrates were probed by different techniques, and compared with those obtained from the undoped thin films produced under similar conditions. Organic photovoltaic devices (OPVs) with the structure FTO/AlTiO{sub 2}(30 nm)/C{sub 60}(50 nm)/CuPc(50 nm)/Al with an Al concentration of 0.03 M in AlTiO{sub 2} layer were produced. The insertion of AlTiO{sub 2} thin films improved the short-circuit current density (J{sub sc}) as well as the open circuit voltage (V{sub oc}) in comparison with non-modified electrode FTO based devices. This behavior is discussed in terms of induced interface phenomena as dipole formation induced by Al. - Highlights: • Easy and cheap solution-process for AlTiO{sub 2} modification of FTO electrode for OPVs • Electrical, structural and optical characterization of TiO{sub 2} layers with Al-dopant • Improvement of Voc and Jsc of inverted OPVs with AlTiO{sub 2} modified electrode.

  9. Enhancement of open-circuit voltage on organic photovoltaic devices by Al-doped TiO2 modifying layer produced by sol–gel method

    International Nuclear Information System (INIS)

    Valaski, R.; Arantes, C.; Senna, C.A.; Carôzo, Victor; Achete, C.A.; Cremona, M.

    2014-01-01

    Sol–gel method has shown several advantages for oxide synthesis, such as lower cost production, coating large areas, lower processing temperatures and ease insertion of doping materials. Therefore, it is attractive for production of intermediate and electrode modifying layers in organic optoelectronic devices. Herein, spin-coated aluminum-doped titanium dioxide (AlTiO 2 ) thin films were produced by sol–gel method onto glass and fluorine-doped tin oxide (FTO) substrates, using different Al-dopant concentrations and post-done annealing temperatures. Electrical measurements were performed in order to investigate the improvement of the TiO 2 resistivity. Additionally, structural, compositional, morphological, optical and electrical properties of the optimal AlTiO 2 modifying layers onto FTO substrates were probed by different techniques, and compared with those obtained from the undoped thin films produced under similar conditions. Organic photovoltaic devices (OPVs) with the structure FTO/AlTiO 2 (30 nm)/C 60 (50 nm)/CuPc(50 nm)/Al with an Al concentration of 0.03 M in AlTiO 2 layer were produced. The insertion of AlTiO 2 thin films improved the short-circuit current density (J sc ) as well as the open circuit voltage (V oc ) in comparison with non-modified electrode FTO based devices. This behavior is discussed in terms of induced interface phenomena as dipole formation induced by Al. - Highlights: • Easy and cheap solution-process for AlTiO 2 modification of FTO electrode for OPVs • Electrical, structural and optical characterization of TiO 2 layers with Al-dopant • Improvement of Voc and Jsc of inverted OPVs with AlTiO 2 modified electrode

  10. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    Science.gov (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  11. Voltage harmonic elimination with RLC based interface smoothing filter

    International Nuclear Information System (INIS)

    Chandrasekaran, K; Ramachandaramurthy, V K

    2015-01-01

    A method is proposed for designing a Dynamic Voltage Restorer (DVR) with RLC interface smoothing filter. The RLC filter connected between the IGBT based Voltage Source Inverter (VSI) is attempted to eliminate voltage harmonics in the busbar voltage and switching harmonics from VSI by producing a PWM controlled harmonic voltage. In this method, the DVR or series active filter produces PWM voltage that cancels the existing harmonic voltage due to any harmonic voltage source. The proposed method is valid for any distorted busbar voltage. The operating VSI handles no active power but only harmonic power. The DVR is able to suppress the lower order switching harmonics generated by the IGBT based VSI. Good dynamic and transient results obtained. The Total Harmonic Distortion (THD) is minimized to zero at the sensitive load end. Digital simulations are carried out using PSCAD/EMTDC to validate the performance of RLC filter. Simulated results are presented. (paper)

  12. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  13. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  14. Separation method for rare-earths using high-voltage electrophoresis on paper strip; Methode de separation des terres rares par electrophorese a haute tension sur papier - support

    Energy Technology Data Exchange (ETDEWEB)

    Clarence, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1966-07-01

    The equipment includes an electrophoresis set running at 3 000 V and 20 mA. Two cooling plates are used as heat exchanger, and a pneumatic pressure device to insure an uniform pressure on the paper strip laid flat. The mobilities and the separations of the rare earths in lactic, and, {alpha} hydroxy-isobutyric acid solutions are investigated on cellulose acetate strip. Better results are obtained with {alpha} hydroxy-isobutyric acid. The method is rapid and allows a fine fractionation of rare earth elements within less than an hour. A complete separation of a Ce - Pr - Nd - Pm - Eu mixture, and a Y - Tb mixture is obtained. (author) [French] L'equipement comporte un appareil d'electrophorese fonctionnant sous 3000 V a 20 mA. Deux plaques refrigerantes absorbent la chaleur dissipee, et un coussin pneumatique assure une pression uniforme sur le papier support. Les mobilites et les separations des terres rares sont etudiees en milieux lactiques et {alpha} hydroxyisobutyriques sur papier d'acetate de cellulose. De meilleurs resultats sont obtenus avec l'acide {alpha} hydroxyisobutyrique. La methode est tres rapide et permet de separer un melange de terres rares radioactives en moins d'une heure. Des separations fines d'un melange Ce, Pr, Nd, Pm, Eu, et d'un melange Y, Tb sont egalement obtenues. (auteur)

  15. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  16. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  17. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  18. A novel method for in-situ monitoring of local voltage, temperature and humidity distributions in fuel cells using flexible multi-functional micro sensors.

    Science.gov (United States)

    Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping

    2011-01-01

    In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it.

  19. A Novel Method for In-Situ Monitoring of Local Voltage, Temperature and Humidity Distributions in Fuel Cells Using Flexible Multi-Functional Micro Sensors

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chang

    2011-01-01

    Full Text Available In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS. These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it.

  20. A Novel Method for In-Situ Monitoring of Local Voltage, Temperature and Humidity Distributions in Fuel Cells Using Flexible Multi-Functional Micro Sensors

    Science.gov (United States)

    Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping

    2011-01-01

    In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it. PMID:22319361

  1. Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

    Directory of Open Access Journals (Sweden)

    Dung Vo Tien

    2018-01-01

    Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

  2. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  3. Four-quadrant speed control circuit of DC servo motor using integrated voltage control method; Den`atsu sekibunchi seigyo wo mochoiita chokuryu dendoki no shishogen sokudo seigyo

    Energy Technology Data Exchange (ETDEWEB)

    Okui, H. [Osaka polytechnic College, Osaka (Japan); Irie, H. [Osaka Electro-Communication Univ., Osaka (Japan)

    1996-08-20

    The Two-Quadrant chopper is constructed by using smoothing reactor in common of the step-down chopper and step-up chopper of the DC chopper. Furthermore, since the circuit connected in bridge type by using these two groups has both of positive and negative voltage from DC source and can supplies the current from positive and negative directions for load, it is called in general as the Four-Quadrant chopper. As the Four-Quadrant chopper may supply and regenerate power, it works as power amplifier with high efficiency. In this paper, the speed control circuit of DC servo motor using Four-Quadrant integrated voltage control circuit is described. The speed control circuit is composed of simple circuits of one adder integrator and four hysteresis comparators. The Four-Quadrant speed control circuit has a DC motor speed feedback loop and a voltage feedback loop which connects with AC, it plays the Four-Quadrant speed control without current inspection. The speed control characteristics with no steady state error over four quadrants may be obtained, changing of the quadrant is smooth and transition response is rapid. 9 refs., 11 figs.

  4. Voltage linear transformation circuit design

    Science.gov (United States)

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  5. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  6. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  7. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  8. Prediction of breakdown voltages in novel gases for high voltage insulation

    International Nuclear Information System (INIS)

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  9. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  10. High voltage designing of 300.000 Volt

    International Nuclear Information System (INIS)

    Hutapea, Sumihar.

    1978-01-01

    Some methods of designing a.c and d.c high voltage supplies are discussed. A high voltage supply for the Gama Research Centre accelerator is designed using transistor pulse generators. High voltage transformers being made using radio transistor ferrits as a core are also discussed. (author)

  11. On Secondary Control Approaches for Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Peyghami, Saeed; Mokhtari, Hossein; Davari, Pooya

    2017-01-01

    Centralized or decentralized secondary controller is commonly employed to regulate the voltage drop raised by the primary controller. However, in the case of high capacity MGs and long feeders with much voltage drop on the line resistances, the conventional methods may not guarantee the voltage r...

  12. On Secondary Control Approaches for Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Peyghami Akhuleh, Saeed; Mokhtari, Hossein; Davari, Pooya

    2017-01-01

    Centralized or decentralized secondary controller is commonly employed to regulate the voltage drop raised by the primary controller. However, in the case of high capacity MGs and long feeders with much voltage drop on the line resistances, the conventional methods may not guarantee the voltage...

  13. Performance Improvement of DFIG Wind Turbine Using Series Grid-Side Converter under Unbalanced Grid Voltage and Voltage Sag Conditions

    DEFF Research Database (Denmark)

    Shokri, Yunes; Ebrahimzadeh, Esmaeil; Lesani, Hamid

    2014-01-01

    under unbalanced grid voltage and small voltage sag conditions without needing additional DC link capacitor or energy storage unlike other methods. The control system includes negative and positive sequence controllers which make the stator voltage balanced and keep it constant at the nominal value...

  14. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  15. Common planning of operations of and extensions to a nuclear park and a high-voltage network of a service area with the aid of a modified optimization method of dynamic programming

    International Nuclear Information System (INIS)

    Bieselt, R.

    1974-01-01

    While making extensive use of the possibilities dynamic programming as an optimization method has to offer, a planning method for the common operation and the extension of a nuclear park and a high-voltage network for a service area of a large size is worked out in a system-analytical manner in this thesis. With the aid of the computer programmes developed, those decisions concerning construction and operation of power plant and network are looked for which result within appr. 10 years of planning in a minimum of overall generating and transmission costs. (orig./LN) [de

  16. New methods for the voltage drop desensitization of frequency converters for asynchronous machines; De nouvelles methodes de desensibilisation aux creux de tension des convertisseurs de frequence pour machines asynchrones

    Energy Technology Data Exchange (ETDEWEB)

    David, A.

    1995-12-31

    In order to reduce the vulnerability of electronic speed variators to load transients and outages, and more especially to short ones (inferior to one second), which represent 95 pc of voltage drop and failures, Electricite de France (EDF) has developed (and patented) several insensitivity techniques: voltage drop compensation, free-wheel machine speed identification, automatic adjustment and synchronization of converter and machine during the drop. These techniques have been validated through experiments

  17. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  18. Synthesis of Li{sub 2}MnO{sub 3}-stabilized LiCoO{sub 2} cathode material by spray-drying method and its high-voltage performance

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhiguo; Wang, Zhixing, E-mail: zxwang.csu@hotmail.com; Guo, Huajun; Peng, Wenjie; Li, Xinhai

    2015-03-25

    Highlights: • Li{sub 2}MnO{sub 3} is introduced to stabilize the structure of LiCoO{sub 2} at high voltages. • xLi{sub 2}MnO{sub 3}·(1−x)LiCoO{sub 2} with fine particles prepared by a simple spray-drying method. • The modified sample exhibits enhanced high-voltage electrochemical performance. • Possible kinetic behaviors of the electrode surface are discussed. - Abstract: xLi{sub 2}MnO{sub 3}⋅(1 − x)LiCoO{sub 2} (x = 0, 0.02, 0.05, 0.1) as a cathode material for lithium ion batteries has been prepared by a spray-drying assisted solid-state method. The effects of Li{sub 2}MnO{sub 3} content on crystal structure, morphology, and high-voltage electrochemical performance of LiCoO{sub 2} have been characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDS) and galvanostatic charge–discharge test. XRD results reveal that all samples have a well-ordered layered structure. SEM and EDS analyses confirm that homogeneous powders with a primary particle size of about 2 μm are observed and the elementals distribute uniformly in the particles. Electrochemical tests demonstrate that the modified samples exhibit obviously enhanced cycling stability in the voltage ranges of 3.0–4.5 V and 3.0–4.6 V, although they deliver somewhat lower discharge capacity. Specifically, 0.02Li{sub 2}MnO{sub 3}⋅0.98LiCoO{sub 2} delivers the initial discharge capacity of 189.0, 216.8 mA h g{sup −1} at 0.1 C in the voltage range of 3.0–4.5 V and 3.0–4.6 V, respectively, and excellent cycling behaviors at 1 C are achieved.

  19. Experimental evaluation of voltage unbalance compensation in an islanded microgrid

    DEFF Research Database (Denmark)

    Savaghebi, Mehdi; Guerrero, Josep M.; Jalilian, Alireza

    2011-01-01

    In this paper, a method for voltage unbalance compensation in an islanded microgrid based on the proper control of distributed generators (DGs) interface converter is proposed. In this method, active and reactive power control loops are considered to control the power sharing among the DGs. Also......, a virtual impedance loop and voltage and current proportional-resonant controllers are included. Experimental results show the effectiveness of the proposed method for compensating voltage unbalance to an acceptable level....

  20. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  1. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  2. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  3. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  4. A method for load management in low voltage grids. Application from e-mobility to heat storage; Verfahren zum Lastmanagement in Niederspannungsnetzen. Anwendung von E-Mobility bis Waermespeicher

    Energy Technology Data Exchange (ETDEWEB)

    Hess, Tobias; Schegner, Peter [TU Dresden (Germany). IEEH; Hable, Matthias [ENSO NETZ GmbH, Dresden (Germany)

    2012-07-01

    With the expected charging characteristic of e-mobility a considerable load peak during the night is expected. The paper describes the application of a modified maximal rectangle algorithm to determine the optimal starting times for charging to realise a flat load curve. The load characteristic of e-mobility is similar to heat storage. This allows to use the currently widely spread heat storage devices as example for developing and testing methods for optimized load management in low voltage networks. It is shown that the developed optimization algorithm finds solutions close to the global optimum even in large networks ({approx} 25000 devices) with low requirements of calculation time (< 1 min). (orig.)

  5. Grid Voltage Modulated Control of Grid-Connected Voltage Source Inverters under Unbalanced Grid Conditions

    DEFF Research Database (Denmark)

    Li, Mingshen; Gui, Yonghao; Quintero, Juan Carlos Vasquez

    2017-01-01

    In this paper, an improved grid voltage modulated control (GVM) with power compensation is proposed for grid-connected voltage inverters when the grid voltage is unbalanced. The objective of the proposed control is to remove the power ripple and to improve current quality. Three power compensation...... objectives are selected to eliminate the negative sequence components of currents. The modified GVM method is designed to obtain two separate second-order systems for not only the fast convergence rate of the instantaneous active and reactive powers but also the robust performance. In addition, this method...

  6. Fast and accurate methods for the performance testing of highly-efficient c-Si photovoltaic modules using a 10 ms single-pulse solar simulator and customized voltage profiles

    International Nuclear Information System (INIS)

    Virtuani, A; Rigamonti, G; Friesen, G; Chianese, D; Beljean, P

    2012-01-01

    Performance testing of highly efficient, highly capacitive c-Si modules with pulsed solar simulators requires particular care. These devices in fact usually require a steady-state solar simulator or pulse durations longer than 100–200 ms in order to avoid measurement artifacts. The aim of this work was to validate an alternative method for the testing of highly capacitive c-Si modules using a 10 ms single pulse solar simulator. Our approach attempts to reconstruct a quasi-steady-state I–V (current–voltage) curve of a highly capacitive device during one single 10 ms flash by applying customized voltage profiles–-in place of a conventional V ramp—to the terminals of the device under test. The most promising results were obtained by using V profiles which we name ‘dragon-back’ (DB) profiles. When compared to the reference I–V measurement (obtained by using a multi-flash approach with approximately 20 flashes), the DB V profile method provides excellent results with differences in the estimation of P max (as well as of I sc , V oc and FF) below ±0.5%. For the testing of highly capacitive devices the method is accurate, fast (two flashes—possibly one—required), cost-effective and has proven its validity with several technologies making it particularly interesting for in-line testing. (paper)

  7. Determination of the cathode fall voltage in fluorescent lamps by measurement of the operating voltage

    International Nuclear Information System (INIS)

    Hilscher, A.

    2002-01-01

    A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)

  8. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  9. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  10. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  11. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  12. Modeling and simulation of dynamic voltage restorer in power system

    International Nuclear Information System (INIS)

    Abdel Aziz, M.A.A.M.

    2012-01-01

    There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.

  13. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  14. New Substrate-Guided Method of Predicting Slow Conducting Isthmuses of Ventricular Tachycardia: Preliminary Analysis to the Combined Use of Voltage Limit Adjustment and Fast-Fourier Transform Analysis.

    Science.gov (United States)

    Kuroki, Kenji; Nogami, Akihiko; Igarashi, Miyako; Masuda, Keita; Kowase, Shinya; Kurosaki, Kenji; Komatsu, Yuki; Naruse, Yoshihisa; Machino, Takeshi; Yamasaki, Hiro; Xu, Dongzhu; Murakoshi, Nobuyuki; Sekiguchi, Yukio; Aonuma, Kazutaka

    2018-04-01

    Several conducting channels of ventricular tachycardia (VT) can be identified using voltage limit adjustment (VLA) of substrate mapping. However, the sensitivity or specificity to predict a VT isthmus is not high by using VLA alone. This study aimed to evaluate the efficacy of the combined use of VLA and fast-Fourier transform analysis to predict VT isthmuses. VLA and fast-Fourier transform analyses of local ventricular bipolar electrograms during sinus rhythm were performed in 9 postinfarction patients who underwent catheter ablation for a total of 13 monomorphic VTs. Relatively higher voltage areas on an electroanatomical map were defined as high voltage channels (HVCs), and relatively higher fast-Fourier transform areas were defined as high-frequency channels (HFCs). HVCs were classified into full or partial HVCs (the entire or >30% of HVC can be detectable, respectively). Twelve full HVCs were identified in 7 of 9 patients. HFCs were located on 7 of 12 full HVCs. Five VT isthmuses (71%) were included in the 7 full HVC+/HFC+ sites, whereas no VT isthmus was found in the 5 full HVC+/HFC- sites. HFCs were identical to 9 of 16 partial HVCs. Eight VT isthmuses (89%) were included in the 9 partial HVC+/HFC+ sites, whereas no VT isthmus was found in the 7 partial HVC+/HFC- sites. All HVC+/HFC+ sites predicted VT isthmus with a sensitivity of 100% and a specificity of 80%. Combined use of VLA and fast-Fourier transform analysis may be a useful method to detect VT isthmuses. © 2018 American Heart Association, Inc.

  15. A New Secondary Control Approach for Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Peyghami, Saeed; Mokhtari, Hossein; Davari, Pooya

    2016-01-01

    feeders with much voltage drop on the line resistances, the conventional methods may not guarantee the voltage regulation on the load busses. Therefore, in addition to compensate the voltage drop of the primary controller, it is necessary to regulate the voltage of critical loads. In this paper, a new...

  16. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  17. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  18. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  19. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Science.gov (United States)

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  20. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  1. Voltage scheduling for low power/energy

    Science.gov (United States)

    Manzak, Ali

    2001-07-01

    Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

  2. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  3. Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching

    Science.gov (United States)

    Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest

    2017-09-01

    A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k  =  2) at 1 MHz and 0.5 part in 106 (k  =  2) at 100 kHz is within reach.

  4. Square-Wave Voltage Injection Algorithm for PMSM Position Sensorless Control With High Robustness to Voltage Errors

    DEFF Research Database (Denmark)

    Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede

    2017-01-01

    relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...

  5. DC-Voltage Fluctuation Elimination Through a DC-Capacitor Current Control for DFIG Converters Under Unbalanced Grid Voltage Conditions

    DEFF Research Database (Denmark)

    Liu, Changjin; Xu, Dehong; Zhu, Nan

    2013-01-01

    Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...

  6. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  7. High resolution studies of the origins of polyatomic ions in inductively coupled plasma-mass spectrometry, Part I. Identification methods and effects of neutral gas density assumptions, extraction voltage, and cone material

    International Nuclear Information System (INIS)

    Ferguson, Jill Wisnewski; Houk, R.S.

    2006-01-01

    Common polyatomic ions (ArO + , NO + , H 2 O + , H 3 O + , Ar 2 + , ArN + , OH + , ArH + , O 2 + ) in inductively coupled plasma-mass spectrometry (ICP-MS) are identified using high mass resolution and studied using kinetic gas temperatures (T gas ) determined from a dissociation reaction approach. Methods for making accurate mass measurements, confirming ion identifications, and correcting for mass bias are discussed. The effects of sampler and skimmer cone composition and extraction voltage on polyatomic ion formation are also explored. Neutral species densities at several locations in the extraction interface are estimated and the corresponding effects of the T gas value are calculated. The results provide information about the origins of background ions and indicate possible locations for their formation or removal

  8. Critical voltage effects in electron channeling patterns

    International Nuclear Information System (INIS)

    Farrow, R.C.

    1984-01-01

    Electron channeling patterns were used to study critical voltage effects in the metals molybdenum and tungsten. The purpose was to characterize both theoretically and experimentally how a critical voltage will affect the channeling pattern line shapes. The study focused on the second order critical voltage that results from the degeneracy between the Bloch wave states of the (110) and (220) reflections. Theoretical (110) series electron channeling pattern line profiles were calculated using the dynamical theory of Hirsch and Humphreys (1970). A 10 beam dynamical electron diffraction calculation was performed (using complex Fourier lattice potentials) to generate Bloch wave coefficients, excitation amplitudes, and absorption coefficients needed for determining backscattering coefficients and subsequent backscattered electron intensities. The theoretical model is applicable to electron diffraction at all energies since no high energy approximation or perturbation method was used

  9. Semisupervised Community Detection by Voltage Drops

    Directory of Open Access Journals (Sweden)

    Min Ji

    2016-01-01

    Full Text Available Many applications show that semisupervised community detection is one of the important topics and has attracted considerable attention in the study of complex network. In this paper, based on notion of voltage drops and discrete potential theory, a simple and fast semisupervised community detection algorithm is proposed. The label propagation through discrete potential transmission is accomplished by using voltage drops. The complexity of the proposal is OV+E for the sparse network with V vertices and E edges. The obtained voltage value of a vertex can be reflected clearly in the relationship between the vertex and community. The experimental results on four real networks and three benchmarks indicate that the proposed algorithm is effective and flexible. Furthermore, this algorithm is easily applied to graph-based machine learning methods.

  10. Evaluation of indices for voltage stability monitoring using PMU measurements

    Directory of Open Access Journals (Sweden)

    Sindy Lorena Ramirez Perdomo

    2014-09-01

    Full Text Available Large disturbances such as voltage collapse and its consequences represent a large challenge to the operational safety of power systems. Therefore, it is important to have indicators of the presence of voltage stability problems in real time. Using phasor measure-ments of voltage and current that are presented in Phasor Measurement Units (PMU, indices for voltage stability monitoring can be calculated in real time. This paper presents some indices for voltage stability monitoring using PMU measurements. Evaluation of such indices on a simplified system was carried out, and the indices were classified according to their method of calculation. Finally, one of these indices was used with the New England 39-bus system under different operating scenarios, including load increments, line output and generator output, to check the indices’ behavior for voltage stability monitoring based on synchronized local measurements.

  11. Automatic Voltage Control (AVC) System under Uncertainty from Wind Power

    DEFF Research Database (Denmark)

    Qin, Nan; Abildgaard, Hans; Flynn, Damian

    2016-01-01

    An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...

  12. Resonance of magnetization excited by voltage in magnetoelectric heterostructures

    Science.gov (United States)

    Yu, Guoliang; Zhang, Huaiwu; Li, Yuanxun; Li, Jie; Zhang, Dainan; Sun, Nian

    2018-04-01

    Manipulation of magnetization dynamics is critical for spin-based devices. Voltage driven magnetization resonance is promising for realizing low-power information processing systems. Here, we show through Finite Element Method (FEM) simulations that magnetization resonance in nanoscale magnetic elements can be generated by a radio frequency (rf) voltage via the converse magnetoelectric (ME) effect. The magnetization dynamics induced by voltage in a ME heterostructures is simulated by taking into account the magnetoelastic and piezoelectric coupling mechanisms among magnetization, strain and voltage. The frequency of the excited magnetization resonance is equal to the driving rf voltage frequency. The proposed voltage driven magnetization resonance excitation mechanism opens a way toward energy-efficient spin based device applications.

  13. Probabilistic methods in grid planning ''low voltage''; Probabilistische Methoden in der Netzplanung ''Niederspannung''

    Energy Technology Data Exchange (ETDEWEB)

    Schmidtner, Theo [LEW Verteilnetz GmbH, Augsburg (Germany)

    2012-07-01

    With the penetration of the grids with renewable energy sources, approaches for planning based on standardized customer behavior run to their limits. In addition to the energy supply based on profiles at the network nodes, additional power requirements must be considered (photovoltaic power, micro-CHP, controlled hot water preparation, E-Mobility memory, etc.). The consequence of this is, that the grid requirements are to determine for each grid node individually. These tasks could be accompolished by probabilistic methods. This methodology is emerging over discrete process by the following results. Unlike discrete methods, not only the possible operation points of a subnetwork are determined, but also the probability of occurrence will be calculated. (orig.)

  14. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  15. Local Dynamic Reactive Power for Correction of System Voltage Problems

    Energy Technology Data Exchange (ETDEWEB)

    Kueck, John D [ORNL; Rizy, D Tom [ORNL; Li, Fangxing [ORNL; Xu, Yan [ORNL; Li, Huijuan [University of Tennessee, Knoxville (UTK); Adhikari, Sarina [ORNL; Irminger, Philip [ORNL

    2008-12-01

    Distribution systems are experiencing outages due to a phenomenon known as local voltage collapse. Local voltage collapse is occurring in part because modern air conditioner compressor motors are much more susceptible to stalling during a voltage dip than older motors. These motors can stall in less than 3 cycles (.05s) when a fault, such as on the sub-transmission system, causes voltage to sag to 70 to 60%. The reasons for this susceptibility are discussed in the report. During the local voltage collapse, voltages are depressed for a period of perhaps one or two minutes. There is a concern that these local events are interacting together over larger areas and may present a challenge to system reliability. An effective method of preventing local voltage collapse is the use of voltage regulation from Distributed Energy Resources (DER) that can supply or absorb reactive power. DER, when properly controlled, can provide a rapid correction to voltage dips and prevent motor stall. This report discusses the phenomenon and causes of local voltage collapse as well as the control methodology we have developed to counter voltage sag. The problem is growing because of the use of low inertia, high efficiency air conditioner (A/C) compressor motors and because the use of electric A/C is growing in use and becoming a larger percentage of system load. A method for local dynamic voltage regulation is discussed which uses reactive power injection or absorption from local DER. This method is independent, rapid, and will not interfere with conventional utility system voltage control. The results of simulations of this method are provided. The method has also been tested at the ORNL s Distributed Energy Communications and Control (DECC) Laboratory using our research inverter and synchronous condenser. These systems at the DECC Lab are interconnected to an actual distribution system, the ORNL distribution system, which is fed from TVA s 161kV sub-transmission backbone. The test results

  16. Effect of Anode Floating Voltage and its Applications in Characterizing Silicon Drift Detectors

    International Nuclear Information System (INIS)

    Guang-Guo, Wu; Hong-Ri, Li; Kun, Liang; Ru, Yang; De-Jun, Han; Xue-Lei, Cao; Huan-Yu, Wang; Jun-Ming, An; Xiong-Wei, Hu

    2009-01-01

    Anode Boating voltage is predicted and investigated for silicon drift detectors (SDDs) with an active area of 5 mm 2 fabricated by a double-side parallel technology. It is demonstrated that the anode Boating voltage increases with the increasing inner ring voltage, and is almost unchanged with the external ring voltage. The anode Boating voltage will not be affected by the back electrode biased voltage until it reaches the full-depleted voltage (−50 V) of the SDD. Theoretical analysis and experimental results show that the anode Boating voltage is equal to the sum of the inner ring voltage and the built-in potential between the p + inner ring and the n + anode. A fast checking method before detector encapsulation is proposed by employing the anode Boating voltage along with checking the leakage current, potential distribution and drift properties

  17. Modulation Methods for Neutral-Point-Clamped Wind Power Converter Achieving Loss and Thermal Redistribution Under Low-Voltage Ride-Through

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2014-01-01

    The three-level neutral-point (NP)-clamped (3L-NPC) converter is a promising multilevel topology in the application of megawatt wind power generation systems. However, the growing requirements by grid codes may impose high stress and even give reliability problem to this converter topology......, with the proposed modulation methods, the thermal distribution in the 3L-NPC wind power inverter undergoing LVRT becomes more equal, and the junction temperature of the most stressed devices can be also relieved. Also, the control ability of the dc-bus NP potential, which is one of the crucial considerations...

  18. Loss and thermal redistributed modulation methods for three-level neutral-point-clamped wind power inverter undergoing Low Voltage Ride Through

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2012-01-01

    The three-level neutral-point-clamped (3L-NPC) converter is a promising multilevel topology in the application of mega-watts wind power generation system. However, the growing requirements by grid codes may impose high stress and even give reliability problem to this converter topology. This paper...... modulation methods, the thermal distribution in the 3L-NPC wind power inverter undergoing LVRT becomes more equal, and the junction temperature of the most stressed devices can be also relieved. Also the control ability of DC-bus neutral point potential, which is one of the crucial considerations for the 3L...

  19. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  20. Energy Storage Characteristic Analysis of Voltage Sags Compensation for UPQC Based on MMC for Medium Voltage Distribution System

    Directory of Open Access Journals (Sweden)

    Yongchun Yang

    2018-04-01

    Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.

  1. A Quantification of the Energy Savings by Conservation Voltage Reduction

    NARCIS (Netherlands)

    Ellens, W.; Berry, A.; West, S.

    2013-01-01

    The introduction of `Smart grid' technologies in the electricity supply industry has attracted new attention to Conservation Voltage Reduction (CVR). CVR is a method that aims to save energy by reducing the voltage level of the electrical distribution network. However, not all devices consume less

  2. Dual voltage source inverter topology extending machine operating range

    NARCIS (Netherlands)

    Gerrits, T.; Wijnands, C.G.E.; Paulides, J.J.H.; Duarte, J.L.

    2012-01-01

    Field weakening operation of an electrical machine is a conventional method to extend the angular velocity range of a system above the peak output voltage of the inverter. A downside, however, is that an increased reactive current is required that creates losses but no output torque. A dual voltage

  3. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  4. Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

    2016-03-07

    We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

  5. First detection of multiple knockdown resistance (kdr)-like mutations in voltage-gated sodium channel using three new genotyping methods in Anopheles sinensis from Guangxi Province, China.

    Science.gov (United States)

    Tan, Wei L; Li, Chun X; Wang, Zhong M; Liu, Mei D; Dong, Yan D; Feng, Xiang Y; Wu, Zhi M; Guo, Xiao X; Xing, Dan; Zhang, Ying M; Wang, Zhong C; Zhao, Tong Y

    2012-09-01

    To investigate knockdown resistance (kdr)-like mutations associated with pyrethroid resistance in Anopheles sinensis (Wiedemann, 1828), from Guangxi province, southwest China, a segment of a sodium channel gene was sequenced and genotyped using three new genotyping assays. Direct sequencing revealed the presence of TTG-to-TCG and TG-to-TTT mutations at allele position L1014, which led to L1014S and L1014F substitutions in a few individual and two novel substitutions of N1013S and L1014W in two DNA templates. A low frequency of the kdr allele mostly in the heterozygous state of L1014S and L1014F was observed in this mosquito population. In this study, the genotyping of An. sinensis using three polymerase chain reaction-based methods generated consistent results, which agreed with the results of DNA sequencing. In total, 52 mosquitoes were genotyped using a direct sequencing assay. The number of mosquitoes and their genotypes were as follows: L/L = 24, L/S = 19, L/F = 8, and F/W = 1. The allelic frequency of L1014, 1014S, and 1014F were 72, 18, and 9%, respectively.

  6. Voltage control on a train system

    Science.gov (United States)

    Gordon, Susanna P.; Evans, John A.

    2004-01-20

    The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.

  7. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  8. Synchronised Voltage Space Vector Modulation for Three-level Inverters with Common-mode Voltage Elimination

    DEFF Research Database (Denmark)

    Oleschuk, Valentin; Blaabjerg, Frede

    2002-01-01

    A novel method of direct synchronous pulse-width modulation (PWM) is disseminated to three-level voltage source inverters with control algorithms with elimination of the common-mode voltages in three-phase drive systems with PWM. It provides smooth pulses-ratio changing and a quarter-wave symmetry...... of the voltage waveforms during the whole control range including overmodulation. Continuous, discontinuous and "direct-direct" schemes of synchronous PWM with both algebraic and trigonometric control functions have been analysed and compared. Simulations give the behaviour of the proposed methods and show some...... advantages of synchronous PWM in comparison with asynchronous at low ratios between the switching frequency and fundamental frequency....

  9. Static Voltage Stability Analysis by Using SVM and Neural Network

    Directory of Open Access Journals (Sweden)

    Mehdi Hajian

    2013-01-01

    Full Text Available Voltage stability is an important problem in power system networks. In this paper, in terms of static voltage stability, and application of Neural Networks (NN and Supported Vector Machine (SVM for estimating of voltage stability margin (VSM and predicting of voltage collapse has been investigated. This paper considers voltage stability in power system in two parts. The first part calculates static voltage stability margin by Radial Basis Function Neural Network (RBFNN. The advantage of the used method is high accuracy in online detecting the VSM. Whereas the second one, voltage collapse analysis of power system is performed by Probabilistic Neural Network (PNN and SVM. The obtained results in this paper indicate, that time and number of training samples of SVM, are less than NN. In this paper, a new model of training samples for detection system, using the normal distribution load curve at each load feeder, has been used. Voltage stability analysis is estimated by well-know L and VSM indexes. To demonstrate the validity of the proposed methods, IEEE 14 bus grid and the actual network of Yazd Province are used.

  10. Determination of the diagnostic x-ray tube practical peak voltage (PPV) from average or average peak voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Hourdakis, C J, E-mail: khour@gaec.gr [Ionizing Radiation Calibration Laboratory-Greek Atomic Energy Commission, PO Box 60092, 15310 Agia Paraskevi, Athens, Attiki (Greece)

    2011-04-07

    The practical peak voltage (PPV) has been adopted as the reference measuring quantity for the x-ray tube voltage. However, the majority of commercial kV-meter models measure the average peak, U-bar{sub P}, the average, U-bar, the effective, U{sub eff} or the maximum peak, U{sub P} tube voltage. This work proposed a method for determination of the PPV from measurements with a kV-meter that measures the average U-bar or the average peak, U-bar{sub p} voltage. The kV-meter reading can be converted to the PPV by applying appropriate calibration coefficients and conversion factors. The average peak k{sub PPV,kVp} and the average k{sub PPV,Uav} conversion factors were calculated from virtual voltage waveforms for conventional diagnostic radiology (50-150 kV) and mammography (22-35 kV) tube voltages and for voltage ripples from 0% to 100%. Regression equation and coefficients provide the appropriate conversion factors at any given tube voltage and ripple. The influence of voltage waveform irregularities, like 'spikes' and pulse amplitude variations, on the conversion factors was investigated and discussed. The proposed method and the conversion factors were tested using six commercial kV-meters at several x-ray units. The deviations between the reference and the calculated - according to the proposed method - PPV values were less than 2%. Practical aspects on the voltage ripple measurement were addressed and discussed. The proposed method provides a rigorous base to determine the PPV with kV-meters from U-bar{sub p} and U-bar measurement. Users can benefit, since all kV-meters, irrespective of their measuring quantity, can be used to determine the PPV, complying with the IEC standard requirements.

  11. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  12. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  13. High-voltage leak detection of a parenteral proteinaceous solution product packaged in form-fill-seal plastic laminate bags. Part 2. Method performance as a function of heat seal defects, product-package refrigeration, and package plastic laminate lot.

    Science.gov (United States)

    Rasmussen, Mats; Damgaard, Rasmus; Buus, Peter; Mulhall, Brian; Guazzo, Dana Morton

    2013-01-01

    Part 1 of this three-part research series detailed the development and validation of a high-voltage leak detection test (HVLD, also known as an electrical conductivity and capacitance test) for verifying the container-closure integrity of a small-volume laminate plastic bag containing an aqueous solution formulation of the rapid-acting insulin analogue, insulin aspart (NovoRapid®/NovoLog®) by Novo Nordisk A/S, Bagsværd, Denmark. Leak detection capability was verified using positive controls each with a single laser-drilled hole in the bag film face. In this Part 2, HVLD leak detection capability was further explored in four separate studies. Study 1 investigated the ability of HVLD to detect weaknesses and/or gaps in the bag heat seal. Study 2 checked the HVLD detection of bag holes in packages stored 4 days at ambient conditions followed by 17 days at refrigeration. Study 3 examined HVLD test results for packages tested when cold. Study 4 compared HVLD test results as a function of bag plastic film lots. The final Part 3 of this series will report the impact of HVLD exposure on product visual appearance and chemical stability. In Part 1 of this three-part series, a leak test method based on electrical conductivity and capacitance, also called high-voltage leak detection (HVLD), was used to find leaks in small plastic bags filled with a solution for injection of the rapid-acting insulin analogue, insulin aspart (NovoRapid®/NovoLog®) by Novo Nordisk A/S, Bagsværd, Denmark. In this Part 2, HVLD leak detection capability was further explored in four separate studies. Study 1 investigated the ability of HVLD to detect bag heat seal leaks. Study 2 checked HVLD's ability to detect bag holes after a total of 21 days at ambient plus refrigerated temperatures. Study 3 looked to see if HVLD results changed for packages tested when still cold. Study 4 compared HVLD results for multiple bag plastic film lots. The final Part 3 of this series will report any evidence of

  14. Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

    Directory of Open Access Journals (Sweden)

    Padalko D.A.

    2017-12-01

    Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

  15. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  16. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Science.gov (United States)

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  17. Artificial intelligence techniques for voltage control

    Energy Technology Data Exchange (ETDEWEB)

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  18. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  19. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  20. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  1. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  2. SOGI-based capacitor voltage feedback active damping in LCL-filtered grid converters

    DEFF Research Database (Denmark)

    Xin, Zhen; Wang, Xiongfei; Loh, Poh Chiang

    2015-01-01

    The capacitor voltage feedback active damping control is an attractive way to suppress LCL-filter resonance especially for the systems where the capacitor voltage is used for grid synchronization, since no extra sensors are added. The derivative is the core of the capacitor voltage feedback active...... derivative is more suited for capacitor voltage feedback active damping control. Experimental results validate the effectiveness of the proposed method....

  3. Early Prediction of Transient Voltage Sags caused by Rotor Swings

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Van Cutsem, Thierry

    2014-01-01

    The paper investigates various methods to predict voltage sags at load buses caused by large generator rotor swings and following a transient disturbance. Three different prediction methods are proposed, which all use real-time measurements from PMUs. One of the methods uses a slightly extended v...... version of the E-SIME method. The other two methods use Measurements and process them by recursive least square estimation. It is shown that the prediction method employing E-SIME allows the earliest detection of a critical voltage sag with satisfactory accuracy....

  4. Regression Analysis of the Effect of Bias Voltage on Nano- and Macrotribological Properties of Diamond-Like Carbon Films Deposited by a Filtered Cathodic Vacuum Arc Ion-Plating Method

    Directory of Open Access Journals (Sweden)

    Shojiro Miyake

    2014-01-01

    Full Text Available Diamond-like carbon (DLC films are deposited by bend filtered cathodic vacuum arc (FCVA technique with DC and pulsed bias voltage. The effects of varying bias voltage on nanoindentation and nanowear properties were evaluated by atomic force microscopy. DLC films deposited with DC bias voltage of −50 V exhibited the greatest hardness at approximately 50 GPa, a low modulus of dissipation, low elastic modulus to nanoindentation hardness ratio, and high nanowear resistance. Nanoindentation hardness was positively correlated with the Raman peak ratio Id/Ig, whereas wear depth was negatively correlated with this ratio. These nanotribological properties highly depend on the films’ nanostructures. The tribological properties of the FCVA-DLC films were also investigated using a ball-on-disk test. The average friction coefficient of DLC films deposited with DC bias voltage was lower than that of DLC films deposited with pulse bias voltage. The friction coefficient calculated from the ball-on-disk test was correlated with the nanoindentation hardness in dry conditions. However, under boundary lubrication conditions, the friction coefficient and specific wear rate had little correlation with nanoindentation hardness, and wear behavior seemed to be influenced by other factors such as adhesion strength between the film and substrate.

  5. Voltage current characteristics of type III superconductors

    International Nuclear Information System (INIS)

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  6. Voltage current characteristics of type III superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  7. Electronic voltage and current transformers testing device.

    Science.gov (United States)

    Pan, Feng; Chen, Ruimin; Xiao, Yong; Sun, Weiming

    2012-01-01

    A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs) with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz). The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.

  8. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  9. Direct harmonic voltage control strategy for shunt active power filter

    DEFF Research Database (Denmark)

    Munir, Hafiz Mudassir; Zou, JianXiao; Xie, Chuan

    2017-01-01

    generation system (DPGS) where the nonlinear loads are highly dispersed. Local harmonic voltage detection based Resistive-APF (R-APF) seems more suitable to be applied in the DPGS, however, R-APF suffers from poor compensation performance and difficulty of parameter tuning. In this paper, a direct harmonic...... voltage control strategy for the S-APF is proposed with local point of common coupling (PCC) voltage detection only. The control strategy design procedure is given in detail. Simulation is conducted in Matlab/Simulink to compare the performance between the R-APF and the proposed method. The results...

  10. Harmonic elimination technique for a single-phase multilevel converter with unequal DC link voltage levels

    DEFF Research Database (Denmark)

    Ghasemi, N.; Zare, F.; Boora, A.A.

    2012-01-01

    Multilevel converters, because of the benefits they attract in generating high quality output voltage, are used in several applications. Various modulation and control techniques are introduced by several researchers to control the output voltage of the multilevel converters like space vector...... modulation and harmonic elimination (HE) methods. Multilevel converters may have a DC link with equal or unequal DC voltages. In this study a new HE technique based on the HE method is proposed for multilevel converters with unequal DC link voltage. The DC link voltage levels are considered as additional...

  11. Exciplex-triplet energy transfer: A new method to achieve extremely efficient organic light-emitting diode with external quantum efficiency over 30% and drive voltage below 3 V

    Science.gov (United States)

    Seo, Satoshi; Shitagaki, Satoko; Ohsawa, Nobuharu; Inoue, Hideko; Suzuki, Kunihiko; Nowatari, Hiromi; Yamazaki, Shunpei

    2014-04-01

    A novel approach to enhance the power efficiency of an organic light-emitting diode (OLED) by employing energy transfer from an exciplex to a phosphorescent emitter is reported. It was found that excitation energy of an exciplex formed between an electron-transporting material with a π-deficient quinoxaline moiety and a hole-transporting material with aromatic amine structure can be effectively transferred to a phosphorescent iridium complex in an emission layer of a phosphorescent OLED. Moreover, such an exciplex formation increases quantum efficiency and reduces drive voltage. A highly efficient, low-voltage, and long-life OLED based on this energy transfer is also demonstrated. This OLED device exhibited extremely high external quantum efficiency of 31% even without any attempt to enhance light outcoupling and also achieved a low drive voltage of 2.8 V and a long lifetime of approximately 1,000,000 h at a luminance of 1,000 cd/m2.

  12. High voltage dc cables

    Energy Technology Data Exchange (ETDEWEB)

    Bjustrom, B

    1965-12-01

    How stress distribution in dc cables varies with temperature and stress level, influence of polarity reversals and space charges, and different types of overvoltage to which dc cable may be subjected are discussed. Design problems, especially as related to corrosion protection and to mechanical stress caused by wire armoring during manufacturing and laying, accessories and work done on test methods, and the possibility of designing 400 to 600 kV dc cables for transmitting 2000 to 4000 MW are described.

  13. Secondary Droop for Frequency and Voltage Restoration in Microgrids

    DEFF Research Database (Denmark)

    Nutkani, Inam Ullah; Peng, Wang; Blaabjerg, Frede

    2015-01-01

    Droop based autonomous control offers several advantages such as communication independence, plug-n-play capability and enhanced reliability of the system. Despite these advantages, frequency and voltage of droop controlled microgrid varies with the load change which is one of the major drawback...... of the droop control. Presently, the frequency and voltage restoration in microgrid is achieved through secondary control using low bandwidth communication links. This paper presents secondary-droop based frequency and voltage restoration method which is fully autonomous and independent of communication links....... With the proposed method, the microgrid frequency and voltage can be restored back to nominal value without affecting the power sharing performance of the generation sources. The proposed scheme performance has been validated in simulation for several cases of active and reactive power load conditions....

  14. Voltage Control Support and Coordination between Renewable Generation Plants in MV Distribution Systems

    DEFF Research Database (Denmark)

    Petersen, Lennart; Iov, Florin; Hansen, Anca Daniela

    2016-01-01

    This paper focusses on voltage control support and coordination between renewable generation plants in medium voltage distribution systems. An exemplary benchmark grid in Denmark, including a number of flexible ReGen plants providing voltage control functionality, is used as a base case. First......, voltage sensitivity analysis is performed to quantify node voltage variations due to injections of reactive power for given operational points of the network. The results are then used to develop an adaptive voltage droop control method, where various droop settings are allocated to each ReGen plant...... according to the sensitivity indices of corresponding node voltages and the location of respective ReGen plants in the distribution system. Case studies are performed in time-domain to analyze the impact of voltage fluctuations due to active power variations of ReGen plants in order to verify...

  15. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  16. Surge currents and voltages at the low voltage power mains during lightning strike to a GSM tower

    Energy Technology Data Exchange (ETDEWEB)

    Markowska, Renata [Bialystok Technical University (Poland)], E-mail: remark@pb.edu.pl

    2007-07-01

    The paper presents the results of numerical calculations of lightning surge currents and voltages in the low voltage power mains system connected to a free standing GSM base station. Direct lightning strike to GSM tower was studied. The analysis concerned the current that flows to the transformer station through AC power mains, the potential difference between the grounding systems of the GSM and the transformer stations and the voltage differences between phase and PE conductors of the power mains underground cable at both the GSM and the transformer sides. The calculations were performed using a numerical program based on the electromagnetic field theory and the method of moments. (author)

  17. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  18. Frequency to Voltage Converter Analog Front-End Prototype

    Science.gov (United States)

    Mata, Carlos; Raines, Matthew

    2012-01-01

    The frequency to voltage converter analog front end evaluation prototype (F2V AFE) is an evaluation board designed for comparison of different methods of accurately extracting the frequency of a sinusoidal input signal. A configurable input stage is routed to one or several of five separate, configurable filtering circuits, and then to a configurable output stage. Amplifier selection and gain, filter corner frequencies, and comparator hysteresis and voltage reference are all easily configurable through the use of jumpers and potentiometers.

  19. Control Strategy for Microgrid Inverter under Unbalanced Grid Voltage Conditions

    DEFF Research Database (Denmark)

    Guo, Xiaoqiang; Liu, Wenzhao; Zhang, X.

    2014-01-01

    This paper presents the theoretical analysis of the inherent reason of current harmonic and power oscillation phenomena in case of operating the microgrid inverter under unbalanced grid voltage conditions. In order to flexibly control the current harmonic and power oscillation, a new stationary...... inverter. Finally, the performance evaluation tests are carried out under unbalanced grid voltage conditions. Results verify the effectiveness of the propose method....

  20. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  1. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  2. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  3. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  4. Voltage Estimation in Active Distribution Grids Using Neural Networks

    DEFF Research Database (Denmark)

    Pertl, Michael; Heussen, Kai; Gehrke, Oliver

    2016-01-01

    the observability of distribution systems has to be improved. To increase the situational awareness of the power system operator data driven methods can be employed. These methods benefit from newly available data sources such as smart meters. This paper presents a voltage estimation method based on neural networks...

  5. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  6. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  7. High voltage power network construction

    CERN Document Server

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  8. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  9. Prediction of windings temperature rise in induction motors supplied with distorted voltage

    Energy Technology Data Exchange (ETDEWEB)

    Gnacinski, P. [Gdynia Maritime University, Department of Ship Electrical Power Engineering, Morska Street 83, 81-225 Gdynia (Poland)

    2008-04-15

    One of the features of ship power systems is a different level and intensity of disturbances appearing during routine operation - the rms voltage value and frequency deviation, voltage unbalance and waveform voltage distortion. As a result, marine induction machines are exposed to overheating due to the lowered voltage quality. This paper is devoted to windings temperature rise prediction in marine induction cage machines supplied with distorted voltage, which means real voltage conditions. The proposed method of prediction does not require detailed knowledge of the thermal properties of a machine. Although the method was developed for marine induction motors, it is applicable for industry machines supplied with distorted voltage. It can also be generalized and used for estimation of the steady state windings temperature rise of any electrical machinery in various work conditions. (author)

  10. Prediction of windings temperature rise in induction motors supplied with distorted voltage

    International Nuclear Information System (INIS)

    Gnacinski, P.

    2008-01-01

    One of the features of ship power systems is a different level and intensity of disturbances appearing during routine operation - the rms voltage value and frequency deviation, voltage unbalance and waveform voltage distortion. As a result, marine induction machines are exposed to overheating due to the lowered voltage quality. This paper is devoted to windings temperature rise prediction in marine induction cage machines supplied with distorted voltage, which means real voltage conditions. The proposed method of prediction does not require detailed knowledge of the thermal properties of a machine. Although the method was developed for marine induction motors, it is applicable for industry machines supplied with distorted voltage. It can also be generalized and used for estimation of the steady state windings temperature rise of any electrical machinery in various work conditions

  11. Evaluation of Voltage Control Approaches for Future Smart Distribution Networks

    Directory of Open Access Journals (Sweden)

    Pengfei Wang

    2017-08-01

    Full Text Available This paper evaluates meta-heuristic and deterministic approaches for distribution network voltage control. As part of this evaluation, a novel meta-heuristic algorithm, Cuckoo Search, is applied for distribution network voltage control and compared with a deterministic voltage control algorithm, the oriented discrete coordinate decent method (ODCDM. ODCDM has been adopted in a state-of-the-art industrial product and applied in real distribution networks. These two algorithms have been evaluated under a set of test cases, which were generated to represent the voltage control problems in current and future distribution networks. Sampled test results have been presented, and findings have been discussed regarding the adoption of different optimization algorithms for current and future distribution networks.

  12. Responsive demand to mitigate slow recovery voltage sags

    DEFF Research Database (Denmark)

    Garcia-Valle, Rodrigo; da Silva, Luiz Carlos Pereira; Xu, Zhao

    2012-01-01

    , and reactive power reserve for peak load management through price responsive methods and also as energy providers through embedded generation technologies. This article introduces a new technology, called demand as voltagecontrolled reserve, which can help mitigation of momentary voltage sags. The technology...... faults. This article presents detailed models, discussion, and simulation tests to demonstrate the technical viability and effectiveness of the demand as voltage-controlled reserve technology for mitigating voltage sags....... can be provided by thermostatically controlled loads as well as other types of load. This technology has proven to be effective in distribution systems with a large composition of induction motors, when voltage sags present slow recovery characteristics because of the deceleration of the motors during...

  13. Voltage control in smart grid using T2FLS

    DEFF Research Database (Denmark)

    Khodayar, Yaser; Sabahi, Kamel; Hajizadeh, Amin

    2017-01-01

    coordinated to keep the voltage within the standard range. Therefore, in this paper, a multi-agent controller based on type-2 fuzzy logic system (T2FLS) is utilized to coordinate the DG, ULTC, and load to regulate the voltage of the smart grid in the presence of noise and uncertainty. The proposed fuzzy...... system identifies the different parts of the smart grid as an agent (i.e. ULTC, DG, and load) and regulates the voltage by managing them. A 16-bus power system has been utilized to demonstrate the effectiveness of the proposed method. It has been shown that the proposed T2FLS controller outperforms...... the type-1 fuzzy controller and regulates the voltage in an appropriate way even in the presence of the different levels of measurement noise and uncertainty....

  14. Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter

    Science.gov (United States)

    Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun

    2018-03-01

    The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.

  15. Buck supplies output voltage ripple reduction using fuzzy control

    Directory of Open Access Journals (Sweden)

    Nicu BIZON

    2007-12-01

    Full Text Available Using the PWM control for switching power supplies the peaks EMI noise appear at the switching frequency and its harmonics. Using randomize or chaotic PWM control techniques in these systems the power spectrum is spread out in all frequencies band spectral emissions, but with a bigger ripple in the output voltage. The proposed nonlinear feedback control method, which induces chaos, is based by fuzzy rules that minimize the output voltage ripple. The feasibility and effectiveness of this relative simple method is shown by simulation. A comparison with the previous control method is included, too.

  16. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  17. A Study on Energy Saving of Single Phase Induction Motor By Voltage Control

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Jong Moon [Pusan College of Information Technolgy, Pusan (Korea); Kim, Joon Hong [Dong Myong College, Pusan (Korea)

    2001-06-01

    This paper describes a simple effective method for energy saving of AC motors having a widely variable load. The proposed method is based on an optimal efficiency control which is operated by voltage-current pattern such as to maintain the maximum efficiency on the efficiency-output characteristics of the motor, TRIAC voltage control characteristics. The parameters of simplified voltage-current pattern can be determined approximately and reliably from the rated voltage and current of the motor. Experiments are focused on a single phase capacitor motor, the optimal energy saving are proved by proposed method. (author). 8 refs., 15 figs.

  18. Analyzing randomly occurring voltage breakdowns

    International Nuclear Information System (INIS)

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  19. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  20. A new approach to voltage sag detection based on wavelet transform

    Energy Technology Data Exchange (ETDEWEB)

    Gencer, Oezguer; Oeztuerk, Semra; Erfidan, Tarik [Kocaeli University, Faculty of Engineering, Department of Electrical Engineering, Veziroglu Kampuesue, Eski Goelcuek Yolu, Kocaeli (Turkey)

    2010-02-15

    In this work, a new voltage sag detection method based on wavelet transform is developed. Voltage sag detection algorithms, so far have proved their efficiency and computational ability. Using several windowing techniques take long computational times for disturbance detection. Also researchers have been working on separating voltage sags from other voltage disturbances for the last decade. Due to increasing power quality standards new high performance disturbance detection algorithms are necessary to obtain high power quality standards. For this purpose, the wavelet technique is used for detecting voltage sag duration and magnitude. The developed voltage sag detection algorithm is implemented with high speed microcontroller. Test results show that, the new approach provides very accurate and satisfactory voltage sag detection. (author)

  1. Using a Voltage Domain Programmable Technique for Low-Power Management Cell-Based Design

    Directory of Open Access Journals (Sweden)

    Ching-Hwa Cheng

    2011-09-01

    Full Text Available The Multi-voltage technique is an effective way to reduce power consumption. In the proposed cell-based voltage domain programmable (VDP technique, the high and low voltages applied to logic gates are programmable. The flexible voltage domain reassignment allows the chip performance and power consumption to be dynamically adjusted. In the proposed technique, the power switches possess the feature of flexible programming after chip manufacturing. This VDP method does not use an external voltage regulator to regulate the supply voltage level from outside of the chip but can be easily integrated within the design. This novel technique is proven by use of a video decoder test chip, which shows 55% and 61% power reductions compared to conventional single-Vdd and low-voltage designs, respectively. This power-aware performance adjusting mechanism shows great power reduction with a good power-performance management mechanism.

  2. A Transformerless Medium Voltage Multiphase Motor Drive System

    Directory of Open Access Journals (Sweden)

    Dan Wang

    2016-04-01

    Full Text Available A multiphase motor has several major advantages, such as high reliability, fault tolerance, and high power density. It is a critical issue to develop a reliable and efficient multiphase motor drive system. In this paper, a transformerless voltage source converter-based drive system for a medium-voltage (MV multiphase motor is proposed. This drive converter employs cascaded H-bridge rectifiers loaded by H-bridge inverters as the interface between the grid and multiphase motor. The cascaded H-bridge rectifier technique makes the drive system able to be directly connected to the MV grid without the phase-shifting transformer because it can offset the voltage level gap between the MV grid and the semiconductor devices, provide near-sinusoidal AC terminal voltages without filters, and draw sinusoidal line current from the grid. Based on a digital signal processor (DSP, a complete improved Phase Disposition Pulse Width Modulation (PD-PWM method is developed to ensure the individual DC-link capacitor voltage balancing for enhancing the controllability and limiting the voltage and power stress on the H-bridge cells. A downscaled prototype is designed and developed based on a nine-phase motor. The experimental results verify the excellent performances of the proposed drive system and control strategy in steady-state and variant-frequency startup operations.

  3. High-voltage CMOS detectors

    International Nuclear Information System (INIS)

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  4. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  5. High-voltage CMOS detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  6. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  7. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  8. On-Line Voltage Stability Assessment based on PMU Measurements

    DEFF Research Database (Denmark)

    Garcia-Valle, Rodrigo; P. Da Silva, Luiz C.; Nielsen, Arne Hejde

    2009-01-01

    This paper presents a method for on-line monitoring of risk voltage collapse based on synchronised phasor measurement. As there is no room for intensive computation and analysis in real-time, the method is based on the combination of off-line computation and on-line monitoring, which are correlat...

  9. Application of high voltage electric field (HVEF) drying technology in potato chips

    International Nuclear Information System (INIS)

    Bai, Yaxiang; Shi, Hua; Yang, Yaxin

    2013-01-01

    In order to improve the drying efficiency and qualities of vegetable by high voltage electric field (HVEF), potato chips as a representative of vegetable was dried using a high voltage electric drying systems at 20°C. The shrinkage rate, water absorption and rehydration ratio of dried potato chips were measured. The results indicated that the drying rate of potato chips was significantly improved in the high voltage electric drying systems. The shrinkage rate of potato chips dried by high voltage electric field was 1.1% lower than that by oven drying method. And the rehydration rate of high voltage electric field was 24.6% higher than that by oven drying method. High voltage electric field drying is very advantageous and can be used as a substitute for traditional drying method.

  10. Symmetric voltage-controlled variable resistance

    Science.gov (United States)

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  11. Ultra Low-Voltage Energy Harvesting

    Science.gov (United States)

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  12. Manufacturing technology for practical Josephson voltage normals

    International Nuclear Information System (INIS)

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  13. 49 CFR 234.221 - Lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  14. Bootstrapped Low-Voltage Analog Switches

    DEFF Research Database (Denmark)

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  15. Voltage generators of high voltage high power accelerators

    International Nuclear Information System (INIS)

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  16. Congestion management considering voltage security of power systems

    International Nuclear Information System (INIS)

    Esmaili, Masoud; Shayanfar, Heidar Ali; Amjady, Nima

    2009-01-01

    Congestion in a power network is turned up due to system operating limits. To relieve congestion in a deregulated power market, the system operator pays to market participants, GENCOs and DISCOs, to alter their active powers considering their bids. After performing congestion management, the network may be operated with a low security level because of hitting some flows their upper limit and some voltages their lower limit. In this paper, a novel congestion management method based on the voltage stability margin sensitivities is introduced. Using the proposed method, the system operator so alleviates the congestion that the network can more retain its security. The proposed method not only makes the system more secure after congestion management than other methods already presented for this purpose but also its cost of providing security is lower than the earlier methods. Test results of the proposed method along with the earlier ones on the New-England test system elaborate the efficiency of the proposed method from the viewpoint of providing a better voltage stability margin and voltage profile as well as a lower security cost. (author)

  17. A grid-voltage-sensorless resistive active power filter with series LC-filter

    DEFF Research Database (Denmark)

    Bai, Haofeng; Wang, Xiongfei; Blaabjerg, Frede

    2017-01-01

    Voltage-sensorless control has been investigated for Voltage Source Inverters (VSIs) for many years due to the reduced system cost and potentially improved system reliability. The VSI based Resistive Active Power Filters (R-APFs) are now widely used to prevent the harmonic resonance in power...... distribution network, for which the voltage sensors are needed in order to obtain the current reference. In this paper a grid-voltage-sensorless control strategy is proposed for the R-APF with series LC-filter. Unlike the traditional resistance emulation method, this proposed control method re...

  18. A Grid-Voltage-Sensorless Resistive Active Power Filter with Series LC-Filter

    DEFF Research Database (Denmark)

    Bai, Haofeng; Wang, Xiongfei; Blaabjerg, Frede

    2018-01-01

    Voltage-sensorless control has been investigated for Voltage Source Inverters (VSIs) for many years due to the reduced system cost and potentially improved system reliability. The VSI based Resistive Active Power Filters (R-APFs) are now widely used to prevent the harmonic resonance in power...... distribution network, for which the voltage sensors are needed in order to obtain the current reference. In this paper a grid-voltage-sensorless control strategy is proposed for the R-APF with series LC-filter. Unlike the traditional resistance emulation method, this proposed control method re...

  19. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    DEFF Research Database (Denmark)

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  20. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    Science.gov (United States)

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  1. Computation of Steady State Nodal Voltages for Fast Security Assessment in Power Systems

    DEFF Research Database (Denmark)

    Møller, Jakob Glarbo; Jóhannsson, Hjörtur; Østergaard, Jacob

    2014-01-01

    Development of a method for real-time assess-ment of post-contingency nodal voltages is introduced. Linear network theory is applied in an algorithm that utilizes Thevenin equivalent representation of power systems as seen from every voltage-controlled node in a network. The method is evaluated b...

  2. Analytical solution of the PNP equations at AC applied voltage

    International Nuclear Information System (INIS)

    Golovnev, Anatoly; Trimper, Steffen

    2012-01-01

    A symmetric binary polymer electrolyte subjected to an AC voltage is considered. The analytical solution of the Poisson–Nernst–Planck equations (PNP) is found and analyzed for small applied voltages. Three distinct time regimes offering different behavior can be discriminated. The experimentally realized stationary behavior is discussed in detail. An expression for the external current is derived. Based on the theoretical result a simple method is suggested of measuring the ion mobility and their concentration separately. -- Highlights: ► Analytical solution of Poisson–Nernst–Planck equations. ► Binary polymer electrolyte subjected to an external AC voltage. ► Three well separated time scales exhibiting different behavior. ► The experimentally realized stationary behavior is discussed in detail. ► A method is proposed measuring the mobility and the concentration separately.

  3. Allocation of Load-Loss Cost Caused by Voltage Sag

    Science.gov (United States)

    Gao, X.

    2017-10-01

    This paper focuses on the allocation of load-loss cost caused by voltage sag in the environment of electricity market. To compensate the loss of loads due to voltage sags, the load-loss cost is allocated to both sources and power consumers. On the basis of Load Drop Cost (LDC), a quantitative evaluation index of load-loss cost caused by voltage sag is identified. The load-loss cost to be allocated to power consumers themselves is calculated according to load classification. Based on the theory of power component the quantitative relation between sources and loads is established, thereby a quantitative calculation method for load-loss cost allocated to each source is deduced and the quantitative compensation from individual source to load is proposed. A simple five-bus system illustrates the main features of the proposed method.

  4. Piezo Voltage Controlled Planar Hall Effect Devices.

    Science.gov (United States)

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  5. Precise derating of three phase induction motors with unbalanced voltages

    International Nuclear Information System (INIS)

    Faiz, Jawad; Ebrahimpour, H.

    2007-01-01

    Performance analysis of three phase induction motors under supply voltage unbalance conditions is normally conducted using the well-known symmetrical components analysis. In this analysis, the voltage unbalance level at the terminals of the machine is assessed by means of the NEMA or IEC definitions. Both definitions lead to a relatively large error in predicting the performance of a machine. A method has recently been proposed in which, in addition to the voltage unbalance factor (VUF), the phase angle has been taken into account in the analysis. This means that the voltage unbalance factor is regarded as a complex value. This paper shows that although the use of the complex VUF reduces the computational error considerably, it is still high. This is proven by evaluating the derating factor of a three phase induction motor. A method is introduced to determine the derating factor precisely using the complex unbalance factor for an induction motor operating under any unbalanced supply condition. A practical case for derating of a typical three phase squirrel cage induction motor supplied by an unbalanced voltage is studied in the paper

  6. Characterization of a low-voltage electron beam

    International Nuclear Information System (INIS)

    Berejka, A.J.

    2004-01-01

    Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams

  7. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  8. The Significance of Breakdown Voltages for Quality Assurance of Low-Voltage BME Ceramic Capacitors

    Science.gov (United States)

    Teverovsky, Alexander A.

    2014-01-01

    Application of thin dielectric, base metal electrode (BME) ceramic capacitors for high-reliability applications requires development of testing procedures that can assure high quality and reliability of the parts. In this work, distributions of breakdown voltages (VBR) in variety of low-voltage BME multilayer ceramic capacitors (MLCCs) have been measured and analyzed. It has been shown that analysis of the distributions can indicate the proportion of defective parts in the lot and significance of the defects. Variations of the distributions after solder dip testing allow for an assessment of the robustness of capacitors to soldering-related stresses. The drawbacks of the existing screening and qualification methods to reveal defects in high-value, low-voltage MLCCs and the importance of VBR measurements are discussed. Analysis has shown that due to a larger concentration of oxygen vacancies, defect-related degradation of the insulation resistance (IR) and failures are more likely in BME compared to the precious metal electrode (PME) capacitors.

  9. A Comparison Study of Sinusoidal PWM and Space Vector PWM Techniques for Voltage Source Inverter

    Directory of Open Access Journals (Sweden)

    Ömer Türksoy

    2017-06-01

    Full Text Available In this paper, the methods used to control voltage source inverters which have been intensively investigated in recent years are compared. Although the most efficient result is obtained with the least number of switching elements in the inverter topologies, the method used in the switching is at least as effective as the topology. Besides, the selected switching method to control the inverter will play an effective role in suppressing harmonic components while producing the ideal output voltage. There are many derivatives of pulse width modulation techniques that are commonly used to control voltage source inverters. Some of widespread methods are sinusoidal pulse width modulation and space vector pulse width modulation techniques. These modulation techniques used for generating variable frequency and amplitude output voltage in voltage source inverters, have been simulated by using MATLAB/SIMULINK. And, the total harmonic distortions of the output voltages are compared. As a result of simulation studies, sinusoidal pulse width modulation has been found to have more total harmonic distortion in output voltages of voltage source inverters in the simulation. Space vector pulse width modulation has been shown to produce a more efficient output voltage with less total harmonic distortion.

  10. Modular low-voltage electron beams

    International Nuclear Information System (INIS)

    Berejka, A.J.; Avnery, Tovi; Carlson, Carl

    2004-01-01

    Modular, low-voltage systems have simplified electron beam (EB) technology for industrial uses and for research and development. Modular EB units are produced in quantity as sealed systems that are evacuated at the factory eliminating the need for vacuum pumps at the point of use. A simple plug-out--plug-in method of replacement eliminates downtime for servicing. Use of ultra-thin beam windows (<10 μm of titanium foil), solid-state 19 in. (48 cm) rack-mounted power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, combine for ease of use and electrical transfer efficiency at voltages that can be varied between 80 and 150 kV and with high beam currents (up to 40 mA across the 25 cm window). These electron systems are available in three widths, the standard 25 cm and new 5 and 40 cm beams. Traditional uses in the graphic arts and coatings areas as well as uses in surface sterilization have found these compact, lightweight (approximately 15 kg) modular beams of interest. Units have been configured around complex shapes to enable three-dimensional surface curing (as for coatings on aluminum tubing) to be achieved at high production rates. Details of the beam construction and some industrial uses are discussed

  11. Modular low-voltage electron emitters

    International Nuclear Information System (INIS)

    Berejka, Anthony J.

    2005-01-01

    Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates

  12. Modular low-voltage electron emitters

    Science.gov (United States)

    Berejka, Anthony J.

    2005-12-01

    Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates.

  13. Modular low-voltage electron beams

    Science.gov (United States)

    Berejka, Anthony J.; Avnery, Tovi; Carlson, Carl

    2004-09-01

    Modular, low-voltage systems have simplified electron beam (EB) technology for industrial uses and for research and development. Modular EB units are produced in quantity as sealed systems that are evacuated at the factory eliminating the need for vacuum pumps at the point of use. A simple plug-out—plug-in method of replacement eliminates downtime for servicing. Use of ultra-thin beam windows (innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, combine for ease of use and electrical transfer efficiency at voltages that can be varied between 80 and 150 kV and with high beam currents (up to 40 mA across the 25 cm window). These electron systems are available in three widths, the standard 25 cm and new 5 and 40 cm beams. Traditional uses in the graphic arts and coatings areas as well as uses in surface sterilization have found these compact, lightweight (approximately 15 kg) modular beams of interest. Units have been configured around complex shapes to enable three-dimensional surface curing (as for coatings on aluminum tubing) to be achieved at high production rates. Details of the beam construction and some industrial uses are discussed.

  14. Voltage current characteristics of type III superconductors

    Science.gov (United States)

    Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

  15. PC-based control of a high-voltage injector

    International Nuclear Information System (INIS)

    Constantin, F.

    1998-01-01

    The stability of high voltage injectors is one of the major problems in any accelerator system. Most of the troubles encountered in the normal operation of an accelerator are connected with the ion source and associated high voltage platforms, regardless of the source or high voltage generator type. The quality of the ion beam injected in the accelerator strongly depends on the power supplies used in the injector and on the ability to control the non-electrical parameters (gas-flow, temperature, etc.). A wide used method in controlling is based on optical links between high-voltage platform and computer, the adjustments being more or less automated. Although the method mentioned above can be still useful in injector control, a different approach is presented in this work, i.e., the computer itself is placed inside the high-voltage terminal. Only one optical link is still necessary to connect this computer with an user-friendly host at ground potential. Requirements: - varying and monitoring the filament current; - gas flow control in the ion source; - reading the vacuum values; - current and voltage control for the anodic, magnet, extraction, suppression and lens' sources. Even in the high voltage terminal there are compartments with different voltages regardless the floating ground. In our injector the extraction voltage is applied on the top of the ion source including the filament and the anodic voltage. The extraction voltage is of maximum 30 kV. In this situation a second optical link is required to transfer the control for the anodic and magnet source power supply assuming the dedicated computer on the floating ground. One PC is placed inside the high voltage terminal and one PC outside the injector. The optical link (more precisely two optical wires) connects the serial ports. The inside computer is equipped with two multipurpose ADC/DAC and digital I/O card. They permit to read or output DC levels ranging between 0 to 10 volts or TTL signals. The filament

  16. GECM-Based Voltage Stability Assessment Using Wide-Area Synchrophasors

    OpenAIRE

    Heng-Yi Su; Tzu-Yi Liu

    2017-01-01

    Voltage instability is a crucial issue in the secure operation of power grids. Several methods for voltage stability assessment were presented. Some of them are highly computationally intensive, while others are reported not to work properly under all circumstances. This paper proposes a new methodology based on the generator equivalent circuit model (GECM) and the phasor measurement unit (PMU) technology for online voltage stability monitoring of a power grid. First, the proposed methodology...

  17. A SCHEDULING SCHEME WITH DYNAMIC FREQUENCY CLOCKING AND MULTIPLE VOLTAGES FOR LOW POWER DESIGNS

    Institute of Scientific and Technical Information of China (English)

    Wen Dongxin; Wang Ling; Yang Xiaozong

    2007-01-01

    In this letter, a scheduling scheme based on Dynamic Frequency Clocking (DFC) and multiple voltages is proposed for low power designs under the timing and the resource constraints.Unlike the conventional methods at high level synthesis where only voltages of nodes were considered,the scheme based on a gain function considers both voltage and frequency simultaneously to reduce energy consumption. Experiments with a number of DSP benchmarks show that the proposed scheme achieves an effective energy reduction.

  18. Calculations following voltage breakdown in a single-ended Van de Graaff with an accelerator tube

    International Nuclear Information System (INIS)

    Staniforth, J.A.

    1979-01-01

    Calculation of voltages and voltage gradients in the terminal, along the insulating column and the accelerating tube are described for various breakdown positions. The method uses a number of inverted-L network sections to represent the machine assuming that the tube is coupled to the column. Various forms of coupling are examined. The calculations use an iterative computer program which calculates the voltages and currents in the networks at successive small time intervals. (author)

  19. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  20. Observability of Low Voltage grids

    DEFF Research Database (Denmark)

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  1. SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION

    Directory of Open Access Journals (Sweden)

    A. G. Stryzhniou

    2014-01-01

    Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of  harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.

  2. Identification of voltage stability condition of a power system using measurements of bus variables

    Directory of Open Access Journals (Sweden)

    Durlav Hazarika

    2014-12-01

    Full Text Available Several online methods were proposed for investigating the voltage stability condition of an interconnected power system using the measurements of voltage and current phasors at a bus. For this purpose, phasor measurement units (PMUs are used. A PMU is a device which measures the electrical waves on an electrical network, using a common time source (reference bus for synchronisation. This study proposes a method for online monitoring of voltage stability condition of a power system using measurements of bus variables namely – (i real power, (ii reactive power and (iii bus voltage magnitude at a bus. The measurements of real power, reactive power and bus voltage magnitude could be extracted/captured from a smart energy meter. The financial involvement for implementation of the proposed method would significantly lower compared with the PMU-based method.

  3. Voltage margin control for offshore multi-use platform integration

    DEFF Research Database (Denmark)

    Mier, V.; Casielles, P.G.; Koto, J.

    This paper discusses a multiterminal direct current (MTDC) connection proposed for integration of offshore multi-use platforms into continental grids. Voltage source converters (VSC) were selected for their suitability for multiterminal dc systems and for their flexibility in control. A five...... terminal VSC-MTDC which includes offshore generation, storage, loads and ac connection, was modeled and simulated in DigSILENT Power Factory software. Voltage margin method has been used for reliable operation of the MTDC system without the need of fast communication. Simulation results show......, sell or store energy attending to the price in the electricity market....

  4. Symmetric low-voltage powering system for relativistic electronic devices

    International Nuclear Information System (INIS)

    Agafonov, A.V.; Lebedev, A.N.; Krastelev, E.G.

    2005-01-01

    A special driver for double-sided powering of relativistic magnetrons and several methods of localized electron flow forming in the interaction region of relativistic magnetrons are proposed and discussed. Two experimental installations are presented and discussed. One of them is designed for laboratory research and demonstration experiments at a rather low voltage. The other one is a prototype of a full-scale installation for an experimental research at relativistic levels of voltages on the microwave generation in the new integrated system consisting of a relativistic magnetron and symmetrical induction driver

  5. High-voltage short-fall pulse generator

    International Nuclear Information System (INIS)

    Dolbilov, G.V.; Fateev, A.A.; Petrov, V.A.

    1986-01-01

    Powerful high-voltage pulses with short fall times and relatively low afterpulse amplitude are required for the deflection systems of accelerators. A generator is described that provides, into a 75-ohm load, a voltage pulse of up to 100 kV with a fall time of less than 1 nsec and a relative afterpulse amplitude of less than or equal to 15%. The generator employs a short-circuited ferrite-filled line in which shock waves are formed. A magnetic section is used to increase power. The switch is a TGI1-2500/50 thyratron. The main causes of afterpulses and methods for reducing their amplitude are examined

  6. Voltage Control of Antiferromagnetic Phases at Near-Terahertz Frequencies

    Science.gov (United States)

    Barra, Anthony; Domann, John; Kim, Ki Wook; Carman, Greg

    2018-03-01

    A method to control antiferromagnetism using voltage-induced strain is proposed and theoretically examined. Voltage-induced magnetoelastic anisotropy is shown to provide sufficient torque to switch an antiferromagnetic domain 90° either from out of plane to in plane or between in-plane axes. Numerical results indicate that strain-mediated antiferromagnetic switching can occur in an 80-nm nanopatterned disk at frequencies approaching 1 THz but that the switching speed heavily depends on the system's mechanical design. Furthermore, the energy cost to induce magnetic switching is only 450 aJ, indicating that magnetoelastic control of antiferromagnetism is substantially more energy efficient than other approaches.

  7. Estimation of Medium Voltage Cable Parameters for PD Detection

    DEFF Research Database (Denmark)

    Villefrance, Rasmus; Holbøll, Joachim T.; Henriksen, Mogens

    1998-01-01

    Medium voltage cable characteristics have been determined with respect to the parameters having influence on the evaluation of results from PD-measurements on paper/oil and XLPE-cables. In particular, parameters essential for discharge quantification and location were measured. In order to relate...... and phase constants. A method to estimate this propagation constant, based on high frequency measurements, will be presented and will be applied to different cable types under different conditions. The influence of temperature and test voltage was investigated. The relevance of the results for cable...

  8. Utility Interfaced Pulse-Width Modulation of Solar Fed Voltage ...

    African Journals Online (AJOL)

    Utility Interfaced Pulse-Width Modulation of Solar Fed Voltage Source Inverter Using Fixed-Band Hysteresis Current Controller Method. ... with the conversion of solar energy into electrical energy; boosting the dc power; inversion of the dc to ac and then synchronization of the inverter output with the utility, and consequently, ...

  9. Local Identification of Voltage Instability from Load Tap Changer Response

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Papangelis, Lampros; Vournas, Costas D.

    2017-01-01

    . The new method is not bound to assessing system response over a predefined LTC tapping period. This allows handling LTCs with variable delays, as well as events taking place during the tapping sequence impacting the distribution voltages. For that purpose, eLIVES applies recursive least square fitting...

  10. One-carrier free space charge motion under applied voltage

    International Nuclear Information System (INIS)

    Camargo, P.C.; Ferreira, G.F.L.

    1976-01-01

    The system of partial differential equations describing the one-carrier free space-charge motion under a given applied voltage is transformed into a system of two ordinary differential equations. The method is applied to find the external current injection [pt

  11. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  12. Synchrophasor-Based Online Coherency Identification in Voltage Stability Assessment

    Directory of Open Access Journals (Sweden)

    ADEWOLE, A. C.

    2015-11-01

    Full Text Available This paper presents and investigates a new measurement-based approach in the identification of coherent groups in load buses and synchronous generators for voltage stability assessment application in large interconnected power systems. A hybrid Calinski-Harabasz criterion and k-means clustering algorithm is developed for the determination of the cluster groups in the system. The proposed method is successfully validated by using the New England 39-bus test system. Also, the performance of the voltage stability assessment algorithm using wide area synchrophasor measurements from the key synchronous generator in each respective cluster was tested online for the prediction of the system's margin to voltage collapse using a testbed comprising of a Programmable Logic Controller (PLC in a hardware-in-the-loop configuration with the Real-Time Digital Simulator (RTDS and Phasor Measurement Units (PMUs.

  13. Water Electrolysis at Different Current - Voltage Regimes

    International Nuclear Information System (INIS)

    Kleperis, J.; Blums, J.; Vanags, M.

    2007-01-01

    Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)

  14. A Voltage Doubler Circuit to Extend the Soft-switching Range of Dual Active Bridge Converters

    DEFF Research Database (Denmark)

    Qin, Zian; Shen, Yanfeng; Wang, Huai

    2017-01-01

    A voltage doubler circuit is realized to extend the soft-switching range of Dual Active Bridge (DAB) converters. No extra hardware is added to the DAB to form this circuit, since it is composed of the dc blocking capacitor and the low side full bridge converter, which already exist in DAB....... With the voltage doubler, the DAB converter can achieve soft switching and high efficiency when the low side dc voltage is close to 2 pu (1 pu is the high side dc voltage divided by the transformer turn ratio), which can be realized only when the low side dc voltage is close to 1 pu by using the conventional phase...... shift modulation in DAB. Thus the soft switching range is extended. The soft switching boundary conditions are derived. A map to show the soft switching or hard switching in the full load and voltage range is obtained. The feasibility and effectiveness of the proposed method is finally verified...

  15. Improvement of Voltage Stability in Electrical Network by Using a STATCOM

    Directory of Open Access Journals (Sweden)

    Kamel MERINI

    2014-02-01

    Full Text Available This paper aims to clarify power flow without and with static synchronous compensator (STATCOM and searching the best location of STATCOM to improve voltage in the Algerian network. In daily operation where there are all kinds of disturbances such as voltage fluctuations, voltage sags, swells, voltage unbalances and harmonics. STATCOM is modeled as a controllable voltage source. To validate the effectiveness of the Newton-Raphson method algorithm was implemented to solve power flow equations in presence of STATCOM. Case studies are carried out on 59-bus Algerian network test to demonstrate the performance of proposed models. Simulation results show the effectiveness and capability of STATCOM in improving voltage regulation in transmission systems; moreover the power solution using the Newton-Raphson algorithm developed. The STATCOM and the detailed simulation are performed using Matlab program.

  16. Charging and absorption characteristics of small particulates under alternative and electrostatic voltages in an electrostatic precipitator

    International Nuclear Information System (INIS)

    Jiang Xue-Dong; Xu He; Wang Xin

    2014-01-01

    The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)

  17. Power Quality Problems Mitigation using Dynamic Voltage Restorer in Egypt Thermal Research Reactor (ETRR-2)

    International Nuclear Information System (INIS)

    Kandil, T.; Ayad, N.M.; Abdel Haleam, A.; Mahmoud, M.

    2013-01-01

    Egypt thermal research reactor (ETRR-2) was subjected to several Power Quality Problems such as voltage sags/swells, harmonics distortion, and short interruption. ETRR-2 encompasses a wide range of loads which are very sensitive to voltage variations and this leads to several unplanned shutdowns of the reactor due to trigger of the Reactor Protection System (RPS). The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances. It is considered as one of the most efficient and effective solution. Its appeal includes smaller size and fast dynamic response to the disturbance. This paper describes a proposal of a DVR to improve power quality in ETRR-2 electrical distribution systems . The control of the compensation voltage is based on d-q-o algorithm. Simulation is carried out by Matlab/Simulink to verify the performance of the proposed method

  18. Coordinated voltage control in offshore HVDC connected cluster of wind power plants

    DEFF Research Database (Denmark)

    Sakamuri, Jayachandra Naidu; Rather, Zakir Hussain; Rimez, Johan

    This paper presents a coordinated voltage control scheme (CVCS) for a cluster of offshore wind power plants connected to a voltage-source converter-based high-voltage direct current system. The primary control point of the proposed voltage control scheme is the introduced Pilot bus, which is having...... by dispatching reactive power references to each wind turbine (WT) in the wind power plant cluster based on their available reactive power margin and network sensitivity-based participation factors, which are derived from the dV/dQ sensitivity of a WT bus w.r.t. the Pilot bus. This method leads...

  19. Unbalanced voltage control of virtual synchronous generator in isolated micro-grid

    Science.gov (United States)

    Cao, Y. Z.; Wang, H. N.; Chen, B.

    2017-06-01

    Virtual synchronous generator (VSG) control is recommended to stabilize the voltage and frequency in isolated micro-grid. However, common VSG control is challenged by widely used unbalance loads, and the linked unbalance voltage problem worsens the power quality of the micro-grid. In this paper, the mathematical model of VSG was presented. Based on the analysis of positive- and negative-sequence equivalent circuit of VSG, an approach was proposed to eliminate the negative-sequence voltage of VSG with unbalance loads. Delay cancellation method and PI controller were utilized to identify and suppress the negative-sequence voltages. Simulation results verify the feasibility of proposed control strategy.

  20. Voltage and frequency control of wind-powered islanded microgrids based on induction generator and STATCOM

    DEFF Research Database (Denmark)

    Bouzid, Allal; Sicard, Pierre; Guerrero, Josep M.

    2015-01-01

    This paper presents a comprehensive modeling of a three-phase cage induction machine used as a self-excited squirrel-cage induction generator (SEIG), and discusses the regulation of the voltage and frequency of a self-excited SEIG based on the action of the static synchronous Compensator (STATCOM......). The STATCOM with the proposed controller consists of a three-phase voltage-sourced inverter and a DC voltage. The compensator can provide the active and reactive powers and regulate AC system bus voltage and the frequency, but also may enhance the load stability. Moreover, a feed forward control method...

  1. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  2. Theoretical analysis of magnetic sensor output voltage

    International Nuclear Information System (INIS)

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  3. Voltage-Controlled Floating Resistor Using DDCC

    Directory of Open Access Journals (Sweden)

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  4. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  5. A comparison of medium voltage static transfer switches and medium voltage mechanical transfer switches

    Energy Technology Data Exchange (ETDEWEB)

    Risko, W. P.

    2002-07-01

    Medium voltage static transfer switches (MVSTS) and medium voltage mechanical transfer switches (MVATS) perform a common function, namely selecting between two independent power sources to provide uninterrupted power to the loads. Although the functions are the same the method of performing that function is different and this method impacts the sources and connected load. This article describes the two methods of transfer -- mechanical and static -- their advantages and disadvantages, and their preferred applications. The MVSTS can be incorporated into many applications; it can work in conjunction with backup sources such as generators; and can replace generators as a low cost solution. The reliability of the MVSTS is very high; it also outperforms the MVATS with regard to transfer speed, and can react to anomalies in the same sub-cycle time frame. Because the design of the MVSTS is modular, it can be engineered and designed to fit into existing and future systems and applications, and can be used with different switchgear variations and protection arrangements. For example, load isolation and protection breakers can be added to the switchgear to provide flexibility and isolation.

  6. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    OpenAIRE

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  7. High voltage investigations for ITER coils

    International Nuclear Information System (INIS)

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  8. Maximum permissible voltage of YBCO coated conductors

    Energy Technology Data Exchange (ETDEWEB)

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  9. Microprocessor-controlled, programmable ramp voltage generator

    International Nuclear Information System (INIS)

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  10. Low-Voltage Switched-Capacitor Circuits

    DEFF Research Database (Denmark)

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  11. Low Voltage Ride-Through Capability of a Single-Stage Single-Phase Photovoltaic System Connected to the Low-Voltage Grid

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede

    2013-01-01

    The progressively growing of single-phase photovoltaic (PV) systems makes the Distribution System Operators (DSO) to update or revise the existing grid codes in order to guarantee the availability, quality and reliability of the electrical system. It is expected that the future PV systems connected...... to the low-voltage grid will be more active with functionalities of low voltage ride-through (LVRT) and the grid support capability, which is not the case today. In this paper, the operation principle is demonstrated for a single-phase grid-connected PV system in low voltage ride through operation in order...... to map future challenges. The system is verified by simulations and experiments. Test results show that the proposed power control method is effective and the single-phase PV inverters connected to low-voltage networks are ready to provide grid support and ride-through voltage fault capability...

  12. Suppression of Spiral Waves by Voltage Clamp Techniques in a Conductance-Based Cardiac Tissue Model

    International Nuclear Information System (INIS)

    Lian-Chun, Yu; Guo-Yong, Zhang; Yong, Chen; Jun, Ma

    2008-01-01

    A new control method is proposed to control the spatio-temporal dynamics in excitable media, which is described by the Morris–Lecar cells model. It is confirmed that successful suppression of spiral waves can be obtained by spatially clamping the membrane voltage of the excitable cells. The low voltage clamping induces breakup of spiral waves and the fragments are soon absorbed by low voltage obstacles, whereas the high voltage clamping generates travel waves that annihilate spiral waves through collision with them. However, each method has its shortcomings. Furthermore, a two-step method that combines both low and high voltage clamp techniques is then presented as a possible way of out this predicament. (cross-disciplinary physics and related areas of science and technology)

  13. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  14. Determination of the internal parameters of tc from the current-voltage characteristics

    International Nuclear Information System (INIS)

    Kaibyshev, V.Z.

    1986-01-01

    This paper proposes a method for determining the effective work function of a collector, the electron temperature, and the voltage drop in the interelectrode gap from the experimental vurrent-voltage characteristics (IVC). Analysis of the boundary conditions at the collector shows that as the emission from the collector increases the height of the potential jump retarding plasma electrons decrease

  15. 76 FR 70117 - Notice of Intent To Grant an Exclusive License; Voltage Networking, LLC

    Science.gov (United States)

    2011-11-10

    ...; Voltage Networking, LLC AGENCY: National Security Agency, Department of Defense (DoD). ACTION: Notice. SUMMARY: The National Security Agency hereby gives notice of its intent to grant Voltage Networking, LLC a... described in the following: Patent No. 6,835,581 entitled ``Method of coating optical device facets with...

  16. Power System Stability Using Decentralized Under Frequency and Voltage Load Shedding

    DEFF Research Database (Denmark)

    Hoseinzadeh, Bakhtyar; Silva, Filipe Faria Da; Bak, Claus Leth

    2014-01-01

    information to shed the loads with higher voltage decay first. Therefore, this approach deals with coordination of voltage and frequency information instead of independent methods. Numerical simulations which are carried out in DigSilent PowerFactory software confirm the efficiency of proposed methodology...

  17. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  18. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  19. Capacitance-Voltage Characterization of La2O3 Metal-Oxide-Semiconductor Structures on In0.53Ga0.47As Substrate with Different Surface Treatment Methods

    Science.gov (United States)

    Zade, Dariush; Kanda, Takashi; Yamashita, Koji; Kakushima, Kuniyuki; Nohira, Hiroshi; Ahmet, Parhat; Tsutsui, Kazuo; Nishiyama, Akira; Sugii, Nobuyuki; Natori, Kenji; Hattori, Takeo; Iwai, Hiroshi

    2011-10-01

    We studied InGaAs surface treatment using hexamethyldisilazane (HMDS) vapor or (NH4)2S solution after initial oxide removal by hydrofluoric acid. The effect of each treatment on interface properties of La2O3/In0.53Ga0.47As metal-oxide-semiconductor (MOS) capacitor was evaluated. We found that HMDS surface treatment of InGaAs, followed by La2O3 deposition and forming gas annealing reduces the MOS capacitor's interface state density more effectively than (NH4)2S treatment. The comparison of the capacitance-voltage data shows that the HMDS-treated sample reaches a maximum accumulation capacitance of 2.3 µF/cm2 at 1 MHz with roughly 40% less frequency dispersion near accumulation, than the sample treated with (NH4)2S solution. These results suggest that process optimization of HMDS application could lead to further improvement of InGaAs MOS interface, thereby making it a potential routine step for InGaAs surface passivation.

  20. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Science.gov (United States)

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  1. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  2. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  3. Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

    DEFF Research Database (Denmark)

    Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

    2014-01-01

    This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

  4. On-site voltage measurement with capacitive sensors on high voltage systems

    NARCIS (Netherlands)

    Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

    2011-01-01

    In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

  5. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    Science.gov (United States)

    2011-11-22

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

  6. Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

    Science.gov (United States)

    Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

    2017-10-23

    The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

  7. Voltage gradient mapping and electrophysiologically guided cryoablation in children with AVNRT.

    Science.gov (United States)

    Drago, Fabrizio; Battipaglia, Irma; Russo, Mario Salvatore; Remoli, Romolo; Pazzano, Vincenzo; Grifoni, Gino; Allegretti, Greta; Silvetti, Massimo Stefano

    2018-04-01

    Recently, voltage gradient mapping of Koch's triangle to find low-voltage connections, or 'voltage bridges', corresponding to the anatomic position of the slow pathway, has been introduced as a method to ablate atrioventricular nodal reentry tachycardia (AVNRT) in children. Thus, we aimed to assess the effectiveness of voltage mapping of Koch's triangle, combined with the search for the slow potential signal in 'low-voltage bridges', to guide cryoablation of AVNRT in children. From June 2015 to May 2016, 35 consecutive paediatric patients (mean age 12.1 ± 4.5 years) underwent 3D-guided cryoablation of AVNRT at our Institution. Fifteen children were enrolled as control group (mean age 14 ± 4 years). A voltage gradient mapping of Koch's triangle was obtained in all patients, showing low-voltage connections in all children with AVNRT but not in controls. Prior to performing cryoablation, we looked for the typical 'hump and spike' electrogram, generally considered to be representative of slow pathway potential within a low-voltage bridge. In all patients the 'hump and spike' electrogram was found inside bridges of low voltage. Focal or high-density linear lesions, extended or not, were delivered guided by low-voltage bridge visualization. Acute success rate was 100%, and no recurrence was reported at a mean follow-up of 8 ± 3 months. Voltage gradient mapping of Koch's triangle, combined with the search for the slow potential signal in low-voltage bridges, is effective in guiding cryoablation of AVNRT in paediatric patients, with a complete acute success rate and no AVNRT recurrences at mid-term follow-up.

  8. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Science.gov (United States)

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  9. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Directory of Open Access Journals (Sweden)

    Zhibin Hao

    Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  10. A pragmatic approach to voltage stability analysis of large power systems

    Energy Technology Data Exchange (ETDEWEB)

    Sarmiento, H.G.; Pampin, G. [Inst. de Investigaciones Electricas, Morelos (Mexico); Diaz de Leon, J.A. [American Superconductor, Middleton, WI (United States)

    2008-07-01

    A methodology for performing voltage stability analyses for large power systems was presented. Modal and time-domain analyses were used for selection and siting solutions for potential voltage instability and collapse. Steady state systems were used to compute the smallest eigenvalues and associated eigenvalues of a reduced Jacobean matrix. The eigenvalues were used to provide a relative measure of proximity to voltage instability. The analysis was applied to provide an indication of a network's proximity to voltage collapse. Negative eigenvalues were representative of voltage instability conditions, while small positive values indicated proximity to voltage instability. The analysis technique was used to identify buses, lines, and generators prone to voltage instabilities for a 10-node network. A comparative analysis of results obtained from modal and time domain analyses were used to identify areas vulnerable to voltage instability conditions. Pre-fault, fault, and post-fault conditions were analyzed statically and dynamically. Results of the study showed that the combined method can be used to identify and place reactive power compensation solutions for voltage collapses in electric networks. 20 refs., 5 tabs., 7 figs.

  11. Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL

    International Nuclear Information System (INIS)

    Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang

    2007-01-01

    The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)

  12. Modeling and Simulation of Low Voltage Arcs

    NARCIS (Netherlands)

    Ghezzi, L.; Balestrero, A.

    2010-01-01

    Modeling and Simulation of Low Voltage Arcs is an attempt to improve the physical understanding, mathematical modeling and numerical simulation of the electric arcs that are found during current interruptions in low voltage circuit breakers. An empirical description is gained by refined electrical

  13. Reduced Voltage Scaling in Clock Distribution Networks

    Directory of Open Access Journals (Sweden)

    Khader Mohammad

    2009-01-01

    Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.

  14. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  15. Time isolation high-voltage impulse generator

    International Nuclear Information System (INIS)

    Chodorow, A.M.

    1975-01-01

    Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation

  16. High-voltage engineering and testing

    CERN Document Server

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  17. Improving transition voltage spectroscopy of molecular junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...

  18. Reducing Ripple In A Switching Voltage Regulator

    Science.gov (United States)

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  19. Multipurpose Compensation Scheme for Voltage Sag/Swell and Selective Harmonics Elimination in Distribution Systems

    Directory of Open Access Journals (Sweden)

    Mustafa Inci

    2018-01-01

    Full Text Available Voltage harmonics, sag, and swell are the most harmful disturbances in distribution systems. This paper introduces a novel effective controller method for simultaneous compensation of both voltage sag/swell and voltage harmonics by using multifunctional dynamic voltage restorer. In proposed controller method called FFT with integrated ISRF, ISRF detects the magnitudes of voltage sag/swell quickly and precisely, and FFT extracts the selective components of voltage harmonics very effectively. The proposed method integrates the superior properties of ISRF and FFT methods. FFT integrated ISRF is applied for the first time to provide the compensation of both sag/swell and selective harmonics together. The proposed system has ability to compensate symmetrical/asymmetrical sag/swell and symmetrical/asymmetrical selective harmonics which are 5th, 7th, 11th and 13th. The controlled system is modelled in PSCAD/EMDTC and compared with conventional methods. The performance results verify that the proposed method compensates voltage disturbances effectively in the system.

  20. Wide-range voltage modulation

    International Nuclear Information System (INIS)

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  1. The high voltage divider - a tool for comparison of measurement equipment in diagnostic radiology

    International Nuclear Information System (INIS)

    Slavchev, A.; Litchev, A.; Constantinov, B.

    2004-01-01

    The high voltage divider (HVD) is designed for control and analysis of the characteristics of the X-ray generator. The low voltage analogous signals produced by the divider are proportional to the high voltage (kVp) applied to the x-ray tube by a ratio 1:1000 or 1:10000 and can be measured with external test devices like storage oscilloscope (or digital multimeter). The exposure duration and the wave form may be visualized, too. Apart of this invasive way the high voltage also may be measured non-invasively by means of appropriate devices as well as indirectly through calculations. Since the invasive method of measurement with the high voltage divider is distinguished by a high accuracy, it may be utilized as an effective tool for calibration of different devices and for comparison of the measurement methods. (authors)

  2. Practical considerations in voltage stability assessment

    Energy Technology Data Exchange (ETDEWEB)

    Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)

    1994-12-31

    This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.

  3. Voltage-assisted polymer wafer bonding

    International Nuclear Information System (INIS)

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  4. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  5. Non-contact current and voltage sensor

    Science.gov (United States)

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  6. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  7. The Study of Residual Voltage of Induction Motor and the Influence of Various Parameters on the Residual Voltage

    Science.gov (United States)

    Zhang, Shuping; Zhao, Chen; Tan, Weipu

    2017-05-01

    The majority important load of industrial area is mainly composed of induction motor, it is more common that induction motor becomes sluggishness and even tripping due to the lose of power supply or other malfunction in the practical work. In this paper, space vector method is used to establish a reduced order model of induction motor, and then study the changes of motor electromagnetic after losing electricity. Based on motion equations of the rotor and magnetic flux conservation principle, it uses mathematical methods to deduce the expression of rotor current, rotor flux, the stator flux and the residual voltage of stator side. In addition, relying on thermal power plants, it uses the actual data of power plants, takes DIgsilent software to simulate the residual voltage of motor after losing electricity. analyses the influence on the residual voltage with the changes of the moment of inertia, load ratio, initial size of slip and the load characteristic of induction motor. By analysis of these, it has a more detailed understanding about the changes of residual voltage in practical application, in additional, it is more beneficial to put into standby power supply safely and effectively, moreover, reduce the influence of the input process to the whole system.

  8. Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

    Directory of Open Access Journals (Sweden)

    Perić Dragoslav M.

    2015-01-01

    Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

  9. Disintegration of rocks based on magnetically isolated high voltage discharge

    Science.gov (United States)

    He, Mengbing; Jiang, Jinbo; Huang, Guoliang; Liu, Jun; Li, Chengzu

    2013-02-01

    Recently, a method utilizing pulsed power technology for disintegration of rocks arouses great interest of many researchers. In this paper, an improved method based on magnetic switch and the results shown that the uniform dielectrics like plastic can be broken down in water is presented, and the feasible mechanism explaining the breakdown of solid is proposed and proved experimentally. A high voltage pulse of 120 kV, rise time 0.2 μs was used to ignite the discharging channel in solids. When the plasma channel is formed in the solid, the resistance of the channel is quiet small; even if a relatively low voltage is applied on the channel on this occasion, it will produce high current to heat the plasma channel rapidly, and eventually disintegrate the solids. The feasibility of promising industrial application in the drilling and demolition of natural and artificial solid materials by the method we presented is verified by the experiment result in the paper.

  10. An analog RF gap voltage regulation system for the Advanced Photon Source storage ring

    International Nuclear Information System (INIS)

    Horan, D.

    1999-01-01

    An analog rf gap voltage regulation system has been designed and built at Argonne National Laboratory to maintain constant total storage ring rf gap voltage, independent of beam loading and cavity tuning effects. The design uses feedback control of the klystron mod-anode voltage to vary the amount of rf power fed to the storage ring cavities. The system consists of two independent feedback loops, each regulating the combined rf gap voltages of eight storage ring cavities by varying the output power of either one or two rf stations, depending on the mode of operation. It provides full operator control and permissive logic to permit feedback control of the rf system output power only if proper conditions are met. The feedback system uses envelope-detected cavity field probe outputs as the feedback signal. Two different methods of combining the individual field probe signals were used to generate a relative DC level representing one-half of the total storage ring rf voltage, an envelope-detected vector sum of the field probe rf signals, and the DC sum of individual field probe envelope detector outputs. The merits of both methods are discussed. The klystron high-voltage power supply (HVPS) units are fitted with an analog interface for external control of the mod-anode voltage level, using a four-quadrant analog multiplier to modulate the HVPS mod-anode voltage regulator set-point in response to feedback system commands

  11. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  12. Analysis of the error of the developed method of determination the active conductivity reducing the insulation level between one phase of the network and ground, and insulation parameters in a non-symmetric network with isolated neutral with voltage above 1000 V

    Science.gov (United States)

    Utegulov, B. B.

    2018-02-01

    In the work the study of the developed method was carried out for reliability by analyzing the error in indirect determination of the insulation parameters in an asymmetric network with an isolated neutral voltage above 1000 V. The conducted studies of the random relative mean square errors show that the accuracy of indirect measurements in the developed method can be effectively regulated not only by selecting a capacitive additional conductivity, which are connected between phases of the electrical network and the ground, but also by the selection of measuring instruments according to the accuracy class. When choosing meters with accuracy class of 0.5 with the correct selection of capacitive additional conductivity that are connected between the phases of the electrical network and the ground, the errors in measuring the insulation parameters will not exceed 10%.

  13. High-voltage pulse generator synchronous with LINAC

    International Nuclear Information System (INIS)

    Muto, M.; Hiratsuka, Yoshio; Niimura, Nobuo

    1974-01-01

    High-voltage pulse generator (H.V. Flip-Flop) No.2, an improved type of No.1, is described, which is used in the structural analysis of transient phenomena in materials through the neutron TOF with a Linac. The method of producing positive and negative high-voltage pulses synchronous with the Linac is identical with that in No.1. However, No.2 has outstanding features as follows: (1) The rise time of output pulses is reduced to 0.3 msec, due to the improvement of switching circuit and the winding of a step-up transformer; (2) The widths of positive and negative pulses are variable up to maximum 8 and 16 frames, respectively (One frame = 10 msec); (3) The distribution of TOF signals from a BF 3 counter to a time analyzer is possible even in the negative voltage duration. The panel is provided with the switches for choosing pulse width and the frame for analysis, as well as the dials for setting positive/negative pulse voltage values and the respective indicating meters. (Mori, K)

  14. Novel Voltage limiting concept for avalance breakdown protection

    NARCIS (Netherlands)

    Ruijs, L.C.H.; Bezooijen, van A.; Mahmoudi, R.; Roermund, van A.H.M.

    2006-01-01

    Destructive over-voltage breakdown of cellular phone power transistors is prevented by using a new voltage-limiting concept. The output voltage is detected by an avalanche-based detector, and limited by decreasing the output power when needed. The voltage detector contains a low voltage bipolar NPN

  15. Fuel Cell/Electrochemical Cell Voltage Monitor

    Science.gov (United States)

    Vasquez, Arturo

    2012-01-01

    A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

  16. PMU-Aided Voltage Security Assessment for a Wind Power Plant: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, H.; Zhang, Y. C.; Zhang, J. J.; Muljadi, E.

    2015-04-08

    Because wind power penetration levels in electric power systems are continuously increasing, voltage stability is a critical issue for maintaining power system security and operation. The traditional methods to analyze voltage stability can be classified into two categories: dynamic and steady-state. Dynamic analysis relies on time-domain simulations of faults at different locations; however, this method needs to exhaust faults at all locations to find the security region for voltage at a single bus. With the widely located phasor measurement units (PMUs), the Thevenin equivalent matrix can be calculated by the voltage and current information collected by the PMUs. This paper proposes a method based on a Thevenin equivalent matrix to identify system locations that will have the greatest impact on the voltage at the wind power plant’s point of interconnection. The number of dynamic voltage stability analysis runs is greatly reduced by using the proposed method. The numerical results demonstrate the feasibility, effectiveness, and robustness of the proposed approach for voltage security assessment for a wind power plant.

  17. High voltage electricity installations a planning perspective

    CERN Document Server

    Jay, Stephen Andrew

    2006-01-01

    The presence of high voltage power lines has provoked widespread concern for many years. High Voltage Electricity Installations presents an in-depth study of policy surrounding the planning of high voltage installations, discussing the manner in which they are percieved by the public, and the associated environmental issues. An analysis of these concerns, along with the geographical, environmental and political influences that shape their expression, is presented. Investigates local planning policy in an area of the energy sector that is of highly topical environmental and public concern Cover

  18. Investigation of voltage swell mitigation using STATCOM

    International Nuclear Information System (INIS)

    Razak, N A Abdul; Jaafar, S; Hussain, I S

    2013-01-01

    STATCOM is one of the best applications of a self commutated FACTS device to control power quality problems in the distribution system. This project proposed a STATCOM model with voltage control mechanism. DQ transformation was implemented in the controller system to achieve better estimation. Then, the model was used to investigate and analyse voltage swell problem in distribution system. The simulation results show that voltage swell could contaminate distribution network with unwanted harmonic frequencies. Negative sequence frequencies give harmful effects to the network. System connected with proposed STATCOM model illustrates that it could mitigate this problems efficiently.

  19. Analysis of NSTX TF Joint Voltage Measurements

    International Nuclear Information System (INIS)

    Woolley R

    2005-01-01

    This report presents findings of analyses of recorded current and voltage data associated with 72 electrical joints operating at high current and high mechanical stress. The analysis goal was to characterize the mechanical behavior of each joint and thus evaluate its mechanical supports. The joints are part of the toroidal field (TF) magnet system of the National Spherical Torus Experiment (NSTX) pulsed plasma device operating at the Princeton Plasma Physics Laboratory (PPPL). Since there is not sufficient space near the joints for much traditional mechanical instrumentation, small voltage probes were installed on each joint and their voltage monitoring waveforms have been recorded on sampling digitizers during each NSTX ''shot''

  20. An Integrated Chip High-Voltage Power Receiver for Wireless Biomedical Implants

    Directory of Open Access Journals (Sweden)

    Vijith Vijayakumaran Nair

    2015-06-01

    Full Text Available In near-field wireless-powered biomedical implants, the receiver voltage largely overrides the compliance of low-voltage power receiver systems. To limit the induced voltage, generally, low-voltage topologies utilize limiter circuits, voltage clippers or shunt regulators, which are power-inefficient methods. In order to overcome the voltage limitation and improve power efficiency, we propose an integrated chip high-voltage power receiver based on the step down approach. The topology accommodates voltages as high as 30 V and comprises a high-voltage semi-active rectifier, a voltage reference generator and a series regulator. Further, a battery management circuit that enables safe and reliable implant battery charging based on analog control is proposed and realized. The power receiver is fabricated in 0.35-μm high-voltage Bipolar-CMOS-DMOStechnology based on the LOCOS0.35-μm CMOS process. Measurement results indicate 83.5% power conversion efficiency for a rectifier at 2.1 mA load current. The low drop-out regulator based on the current buffer compensation and buffer impedance attenuation scheme operates with low quiescent current, reduces the power consumption and provides good stability. The topology also provides good power supply rejection, which is adequate for the design application. Measurement results indicate regulator output of 4 ± 0.03 V for input from 5 to 30 V and 10 ± 0.05 V output for input from 11 to 30 V with load current 0.01–100 mA. The charger circuit manages the charging of the Li-ion battery through all if the typical stages of the Li-ion battery charging profile.

  1. LIMIT SOLUTIONS OF EQUATIONS OF A DC HIGH-VOLTAGE CASCADE GENERATOR

    Directory of Open Access Journals (Sweden)

    V. O. Brzhezitsky

    2015-04-01

    Full Text Available In the paper the issue of calculating the high voltage cascade mode oscillator with a nonlinear load using the analytical method under different conditions of selection values of its components is presented. The peculiarity of the method of the study is that during multivariate calculations output parameters load generator remain unchanged. For high-voltage cascade direct current power found conditions under which can be significantly reduced high capacity capacitors cascade generator. The calculations show that acceptable for practical applications of high-voltage characteristics of cascade generators can be achieved with substantial reduction of the volume of their constituents, and thus substantial decline in their value.

  2. DC-link Voltage Coordinative-Proportional Control in Cascaded Converter Systems

    DEFF Research Database (Denmark)

    Tian, Yanjun; Loh, Poh Chiang; Deng, Fujin

    2015-01-01

    PI controllers are frequently implemented in cascaded converter system to control the DC-link voltage, because they can achieve zero steady state error. However the PI controller adds a pole at the origin point and a zero on the left half plane, and it increases the control system type number......, and then the system is more difficult to control. This paper proposed a DC-link control method for the two stages cascaded converter, and it uses proportional controller for the DC-link voltage control. This control method can achieve zero steady state error on the DC-link voltage; reduce the control system type...

  3. Available transfer capability calculation considering voltage stability margin

    International Nuclear Information System (INIS)

    Pan, Xiong; Xu, Guoyu

    2005-01-01

    To make the electricity trades carry out successfully, the calculation of available transfer capability (ATC) must coordinate the relationship between the security and economic benefits. In this paper, a model for ATC calculations accorded with trade-off mechanism in electricity market was set up. The impact of branch outage contingency on the static voltage stability margin was analyzed, and contingency ranking was performed through sensitivity indices of branch flows with respect to the loading margin. Optimal power flow based on primal-dual interior point method was applied to obtain ATC when the N-1 security constraints were included. The calculation results of IEEE 30-bus and IEEE 118-bus systems show that the proposed model and method are valid. (author) (N-1 security constraints; Electricity market; Available transfer capability; Optimal power flow; Voltage stability)

  4. Voltage unbalance mitigation in LV networks using three-phase PV systems

    DEFF Research Database (Denmark)

    Garcia Bajo, Cristina; Hashemi Toghroljerdi, Seyedmostafa; Bækhøj Kjær, Søren

    2015-01-01

    In this paper a new method is proposed to mitigate voltage unbalance caused by single-phase solar inverters in low voltage (LV) networks. The method is based on uneven reactive power absorption and injection by three-phase solar inverters. Independent control of each phase is performed to achieve...... this uneven injection. The average values of phase voltages at the connection points of the photovoltaic (PV) inverters are used as the references for the balancing algorithm. Voltage unbalance mitigation is achieved by use of this method in different scenarios with variable three-phase and single......-phase inverters penetration in a realistic LV grid. In addition, the overvoltage is reduced by using this method....

  5. Optimal Operation and Dispatch of Voltage Regulation Devices Considering High Penetrations of Distributed Photovoltaic Generation

    Energy Technology Data Exchange (ETDEWEB)

    Mather, Barry A [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hodge, Brian S [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Cho, Gyu-Jung [Sungkyunkwan University; Oh, Yun-Sik [Sungkyunkwan University; Kim, Min-Sung [Sungkyunkwan University; Kim, Ji-Soo [Sungkyunkwan University; Kim, Chul-Hwan [Sungkyunkwan University

    2017-06-29

    Voltage regulation devices have been traditionally installed and utilized to support distribution voltages. Installations of distributed energy resources (DERs) in distribution systems are rapidly increasing, and many of these generation resources have variable and uncertain power output. These generators can significantly change the voltage profile for a feeder; therefore, in the distribution system planning stage of the optimal operation and dispatch of voltage regulation devices, possible high penetrations of DERs should be considered. In this paper, we model the IEEE 34-bus test feeder, including all essential equipment. An optimization method is adopted to determine the optimal siting and operation of the voltage regulation devices in the presence of distributed solar power generation. Finally, we verify the optimal configuration of the entire system through the optimization and simulation results.

  6. Active Power Filter DC Bus Voltage Piecewise Reaching Law Variable Structure Control

    Directory of Open Access Journals (Sweden)

    Baolian Liu

    2014-01-01

    Full Text Available The DC bus voltage stability control is one key technology to ensure that Active Power Filter (APF operates stably. The external disturbances such as power grid and load fluctuation and the system parameters changing may affect the stability of APF DC bus voltage and the normal operation of APF. The mathematical model of DC bus voltage is established according to power balance principle and a DC bus voltage piecewise reaching law variable structure control algorithm is proposed to solve the above problem, and the design method is given. The simulation and experiment results proved that the proposed variable structure control algorithm can eliminate the chattering problem existing in traditional variable structure control effectively, is insensitive to system disturbance, and has good robustness and fast dynamic response speed and stable DC bus voltage with small fluctuation. The above advantages ensure the compensation effect of APF.

  7. An AMOLED AC-Biased Pixel Design Compensating the Threshold Voltage and I-R Drop

    Directory of Open Access Journals (Sweden)

    Ching-Lin Fan

    2011-01-01

    Full Text Available We propose a novel pixel design and an AC bias driving method for active-matrix organic light-emitting diode (AM-OLED displays using low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs. The proposed threshold voltage and I-R drop compensation circuit, which comprised three transistors and one capacitor, have been verified to supply uniform output current by simulation work using the Automatic Integrated Circuit Modeling Simulation Program with Integrated Circuit Emphasis (AIM-SPICE simulator. The simulated results demonstrate excellent properties such as low error rate of OLED anode voltage variation (<0.7% and low voltage drop of VDD power line. The proposed pixel circuit effectively enables threshold-voltage-deviation correction of driving TFT and compensates for the voltage drop of VDD power line using AC bias on OLED cathode.

  8. Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

    International Nuclear Information System (INIS)

    Baruah, Ratul Kumar; Mahapatra, Santanu

    2009-01-01

    Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

  9. Common voltage eliminating of SVM diode clamping three-level inverter connected to grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    A novel method of common voltage eliminating is put forward for SVM diode clamping three-level inverter connected to grid by calculation of common voltage of its various switching states. PLECS is used to model this three-level inverter connected to grid and good results are obtained. First...... analysis of common mode voltage for switching states of diode clamping 3-level inverter is given in detail. Second the common mode voltage eliminating control strategy of SVM is described for diode clamping three-level inverter. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping...... three-level inverter is presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS is a very powerful tool to real power circuits modeling. They have also verified that proposed common mode voltage eliminating control strategy of SVM is feasible...

  10. Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

    Science.gov (United States)

    Agarwal, Ruchi; Singh, Sanjeev

    2017-12-01

    The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

  11. Absolute Determination of High DC Voltages by Means of Frequency Measurement

    Science.gov (United States)

    Peier, Dirk; Schulz, Bernd

    1983-01-01

    A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

  12. Voltage Sag Mitigation and Load Reactive Power Compensation by UPQC

    OpenAIRE

    Ajitha, P; Jananisri, D

    2014-01-01

    This paper presents Unified Power Quality Conditioner(UPQC) that consist of series inverter and shunt inverter in back to back configuration which simultaneously compensate the power quality(PQ) problems of both voltage sag and load reactive power compensation . In this paper ,Neural network is tool which is considered for solving power quality problems. The simulation results from MATLAB/SIMULINK are discussed to validate the proposed method.

  13. Lightning-induced overvoltages in low-voltage systems

    Energy Technology Data Exchange (ETDEWEB)

    Hoeidalen, Hans Kristian

    1997-12-31

    Lightning-induced overvoltages (LIOs) are a main source of failures in low-voltage overhead line systems. This thesis deals mainly with calculations of LIOs aiming to enable the design of a proper voltage protection. Models for calculation of LIOs are adapted from the literature or developed based on measurements. The models used are believed to be fairly accurate for the first few microseconds, which is usually sufficient for predicting the maximum induced voltage in the system. The lightning channel is modelled by the Modified Transmission Line (MTL) model with the Transmission Line (TL) model as a special case. The coupling between the electrical fields from a lightning channel and an overhead line is modelled by Agrawal`s model. The attenuation of electrical fields over a lossy ground is modelled by Norton`s- or the Surface Impedance methods. The validity of all the applied models is analysed. In addition, measurements have been performed in order to develop models of distribution transformers and low-voltage power installation (LVPI) networks. Simple models of typical transformers and LVPIs are developed for calculations when specific data are unavailable. The practical range of values and its influence on the LIOs in a system is investigated. The main frequency range of interest related to LIOs is 10 kHz - 1 MHz in which all the models are accurate. The adapted or developed models are used to calculate LIOs in low-voltage systems. The influence of various key parameters in the system is investigated. Most important are the return stroke amplitude and rise time, the overhead line height and location, the termination of overhead line segments, neutral grounding, and the ground conductivity. 135 refs., 136 figs., 12 tabs.

  14. Design and Control of a Dynamic Voltage Restorer

    DEFF Research Database (Denmark)

    Nielsen, John Godsk

    voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...

  15. Non-iterative Voltage Stability

    Energy Technology Data Exchange (ETDEWEB)

    Makarov, Yuri V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Vyakaranam, Bharat [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hou, Zhangshuan [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wu, Di [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Meng, Da [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wang, Shaobu [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Elbert, Stephen T. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Miller, Laurie E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Huang, Zhenyu [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2014-09-30

    This report demonstrates promising capabilities and performance characteristics of the proposed method using several power systems models. The new method will help to develop a new generation of highly efficient tools suitable for real-time parallel implementation. The ultimate benefit obtained will be early detection of system instability and prevention of system blackouts in real time.

  16. Fiber-optic voltage measuring system

    Science.gov (United States)

    Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

    1993-09-01

    A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

  17. Constant potential high-voltage generator

    International Nuclear Information System (INIS)

    Resnick, T.A.; Dupuis, W.A.; Palermo, T.

    1980-01-01

    An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)

  18. Nested high voltage generator/particle accelerator

    International Nuclear Information System (INIS)

    Adler, R.J.

    1992-01-01

    This patent describes a modular high voltage particle accelerator having an emission axis and an emission end, the accelerator. It comprises: a plurality of high voltage generators in nested adjacency to form a nested stack, each the generator comprising a cup-like housing having a base and a tubular sleeve extending from the base, a primary transformer winding encircling the nested stack; a secondary transformer winding between each adjacent pair of housings, magnetically linked to the primary transformer winding through the gaps; a power supply respective to each of the secondary windings converting alternating voltage from its respective secondary winding to d.c. voltage, the housings at the emission end forming a hollow throat for particle acceleration, a vacuum seal at the emission end of the throat which enables the throat to be evacuated; a particle source in the thrond power means to energize the primary transformer winding

  19. Low voltage arc formation in railguns

    Science.gov (United States)

    Hawke, R.S.

    1985-08-05

    A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.

  20. Realization of Nth-Order Voltage Transfer Function using Current Conveyors CCII

    Directory of Open Access Journals (Sweden)

    K. Vrba

    1997-06-01

    Full Text Available A universal method for the realization of arbitrary voltage transfer function in canonic form is presented. A voltage-controlled current-source using a plus-type second-generation current conveyor is here applied as the basic building element. Filters designed according to this method have a high input impedance and low sensitivity to variations of circuit parameters. All passive elements are grounded.

  1. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  2. Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

    Science.gov (United States)

    Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

    2012-03-01

    Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

  3. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    KAUST Repository

    Wu, Kunlin

    2012-12-13

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

  4. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    International Nuclear Information System (INIS)

    Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

    2013-01-01

    The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

  5. Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

    Science.gov (United States)

    Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

    2017-10-01

    Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. High voltage disconnect switch position monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Crampton, S W

    1983-08-01

    Unreliable position indication on high-voltage (HV) disconnect switches can result in equipment damage worth many times the cost of a disconnect switch. The benefits and limitations of a number of possible methods of reliably monitoring HV disconnect switches are assessed. Several methods of powering active devices at HV are noted. It is concluded that the most reliable way of monitoring switch position at reasonable cost would use a passive hermetically-sealed blade-position sensor located at HV, with a fibre-optic link between HV and ground. Separate sensors would be used for open and closed position indication. For maximum reliability the fibre-optic link would continue into the relay building. A passive magnetically actuated fibre-optic sensor has been built which demonstrates the feasibility of the concept. The sensor monitors blade position relative to the jaws in three dimensions with high resolution. A design for an improved passive magneto-optic sensor has significantly lower optical losses, allowing a single fibre-optic loop and 3 sensors to monitor closure of all phases of a disconnect switch. A similar loop would monitor switch opening. The improved sensor has a solid copper housing to provide greater immunity to fault currents, and to protect it from the environment and from physical damage. Two methods of providing a protected path for fibre-optics passing from HV to ground are proposed, one using a hollow porcelain switch-support insulator and the other using an additional small-diameter polymer insulator with optical fibres imbedded in its fibreglass core. A number of improvements are recommended which can be made to existing switches to increase their reliability. 16 refs., 13 figs., 1 tab.

  7. Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

    Directory of Open Access Journals (Sweden)

    N Hatefi Kargan

    2013-09-01

    Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

  8. Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

    Directory of Open Access Journals (Sweden)

    Seyyed Yousef Mousazadeh Mousavi

    2017-10-01

    Full Text Available In recent years, the harmonics and unbalance problems endanger the voltage and current quality of power systems, due to increasing usage of nonlinear and unbalanced loads. Use of Distributed Generation (DG-interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method is proposed to compensate voltage and current unbalance and harmonics using the distributed generation (DG-interfacing inverters. This method is applicable to both grid-connected and islanded Microgrids (MGs. In the proposed method, not only the proper control of active and reactive powers can be achieved, but also there is flexibility in compensating the voltage or current quality problems at DG terminals or Points of Common Coupling (PCCs. This control strategy consists of active and reactive power controllers and a voltage/current quality-improvement block. The controller is designed in a stationary (αβ frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. Depending on the compensation modes, the harmonics and unbalance compensation of DG output current, MG-injected current to the grid, as well as PCC and DG voltages, can be achieved in grid-connected operation of MG while in the islanded operation, and the PCC and DG voltages compensation can be obtained through the proposed control scheme.

  9. Baking of tandem accelerator tube by low voltage arc discharge

    International Nuclear Information System (INIS)

    Nakajima, Yutaka

    1982-01-01

    In designing the accelerating tube for a static tandem accelerator in Kyushu University, the basic policy was as described below: individual unit composing the accelerating tube should fully withstand the electric field of 2 MV/m, and electric discharge must not be propagated from one unit to the adjacent unit when these are assembled to the accelerating tube. The accelerating tube units are each 25 cm in length, and both high and low energy sides are composed of 20 units, respectively. Although about 10 -9 Torr vacuum was obtained at the both ends of the accelerating tube by baking the tube at 300 to 350 deg C with electric heaters wound outside the tube in the conventional method, vast outgas was generated, which decreased vacuum by two or three figures if breakdown occurred through the intermediary of outgas. As a method of positively outgassing and cleaning the electrodes inside the accelerating tube, it was attempted to directly bake all the electrodes in the accelerating tube by causing strong arc discharge flowing H 2 gas in the tube. As a result of considering the conditions for this method, the low voltage arc discharge was employed using oxide cathodes. Thus, after implementing 10A arc discharge for several hours, the voltage was able to be raised to 10 MV almost immediately after the vacuum recovery, and further, after another conditioning for several hours, it was successful to raise voltage up to 11 MV. (Wakatsuki, Y.)

  10. PZT/PLZT - elastomer composites with improved piezoelectric voltage coefficient

    Science.gov (United States)

    Harikrishnan, K.; Bavbande, D. V.; Mohan, Dhirendra; Manoharan, B.; Prasad, M. R. S.; Kalyanakrishnan, G.

    2018-02-01

    Lead Zirconate Titanate (PZT) and Lanthanum-modified Lead Zirconate Titanate (PLZT) ceramic sensor materials are widely used because of their excellent piezoelectric coefficients. These materials are brittle, high density and have low achievable piezoelectric voltage coefficients. The density of the sintered ceramics shall be reduced by burnable polymeric sponge method. The achievable porosity level in this case is nearly 60 - 90%. However, the porous ceramic structure with 3-3 connectivity produced by this method is very fragile in nature. The strength of the porous structure is improved with Sylgard®-184 (silicone elastomer) by vacuum impregnation method maintaining the dynamic vacuum level in the range of -650 mm Hg. The elastomer Sylgard®-184 is having low density, low dielectric constant and high compliance (as a resultant stiffness of the composites is increased). To obtain a net dipole moment, the impregnated ceramic composites were subjected to poling treatment with varying conditions of D.C. field and temperature. The properties of the poled PZT/PLZT - elastomer composites were characterized with LCR meter for measuring the dielectric constant values (k), d33 meter used for measuring piezo-electric charge coefficient values (d33) and piezo-electric voltage coefficient (g33) values which were derived from d33 values. The voltage coefficient (g33) values of these composites are increased by 10 fold as compared to the conventional solid ceramics demonstrates that it is possible to fabricate a conformable detector.

  11. Voltage, Temperature, Frequency Margin Test Report

    DEFF Research Database (Denmark)

    Denver, Troelz

    1999-01-01

    The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation......The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation...

  12. Detecting Faults In High-Voltage Transformers

    Science.gov (United States)

    Blow, Raymond K.

    1988-01-01

    Simple fixture quickly shows whether high-voltage transformer has excessive voids in dielectric materials and whether high-voltage lead wires too close to transformer case. Fixture is "go/no-go" indicator; corona appears if transformer contains such faults. Nests in wire mesh supported by cap of clear epoxy. If transformer has defects, blue glow of corona appears in mesh and is seen through cap.

  13. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  14. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  15. Photonic characterization of capacitance-voltage characteristics in MOS capacitors and current-voltage characteristics in MOSFETs

    International Nuclear Information System (INIS)

    Kim, H. C.; Kim, H. T.; Cho, S. D.; Song, S. J.; Kim, Y. C.; Kim, S. K.; Chi, S. S.; Kim, D. J.; Kim, D. M.

    2002-01-01

    Based on the photonic high-frequency capacitance-voltage (HF-CV) response of MOS capacitors, a new characterization method is reported for the analysis of interface states in MOS systems. An optical source with a photonic energy less than the silicon band-gap energy (hv g ) is employed for the photonic HF-CV characterization of interface states distributed in the photoresponsive energy band (E C - hv t C ). If a uniform distribution of trap levels is assumed, the density of interface states (D it ) in the photoresponsive energy band of MOS capacitors, characterized by the new photonic HF-CV method, was observed to be D it = 1 ∼ 5 x 10 11 eV -1 cm -2 . Photonic current-voltage characteristics (I D - V GS , V DS ) of MOSFETs, which are under control of the photoconductive and the photovoltaic effects, are also investigated under optical illumination

  16. Modular high voltage power supply for chemical analysis

    Science.gov (United States)

    Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

    2008-07-15

    A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

  17. Energy Efficiency of Induction Motors Running Off Frequency Converters with Pulse-Width Voltage Modulation{sup 1}

    Energy Technology Data Exchange (ETDEWEB)

    Shvetsov, N. K., E-mail: elmash@em.ispu.ru [V. I. Lenin Ivanovo State Power University (Russian Federation)

    2016-11-15

    The results of calculations of the increase in losses in an induction motor with frequency control and different forms of the supply voltage are presented. The calculations were performed by an analytic method based on harmonic analysis of the supply voltage as well as numerical calculation of the electromagnetic processes by the finite-element method.

  18. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  19. Experimental validation of prototype high voltage bushing

    Science.gov (United States)

    Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.

    2017-08-01

    Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.

  20. Beam induced rf cavity transient voltage

    International Nuclear Information System (INIS)

    Kramer, S.L.; Wang, J.M.

    1998-10-01

    The authors calculate the transient voltage induced in a radio frequency cavity by the injection of a relativistic bunched beam into a circular accelerator. A simplified model of the beam induced voltage, using a single tone current signal, is generated and compared with the voltage induced by a more realistic model of a point-like bunched beam. The high Q limit of the bunched beam model is shown to be related simply to the simplified model. Both models are shown to induce voltages at the resonant frequency ω r of the cavity and at an integer multiple of the bunch revolution frequency (i.e. the accelerating frequency for powered cavity operation) hω ο . The presence of two nearby frequencies in the cavity leads to a modulation of the carrier wave exp(hω ο t). A special emphasis is placed in this paper on studying the modulation function. These models prove useful for computing the transient voltage induced in superconducting rf cavities, which was the motivation behind this research. The modulation of the transient cavity voltage discussed in this paper is the physical basis of the recently observed and explained new kinds of longitudinal rigid dipole mode which differs from the conventional Robinson mode

  1. Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

    Directory of Open Access Journals (Sweden)

    Chaichana Amornchai

    2017-01-01

    Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

  2. Thyristor voltage converter in induction electric drives with microprocessor control

    Energy Technology Data Exchange (ETDEWEB)

    Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)

    1997-12-31

    The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.

  3. Autonomous Voltage Unbalance Compensation in an Islanded Droop-Controlled Microgrid

    DEFF Research Database (Denmark)

    Savaghebi, Mehdi; Jalilian, Alireza; Vasquez, Juan Carlos

    2013-01-01

    Recently, there is an increasing interest in using distributed generators (DGs) not only to inject power into the grid, but also to enhance the power quality. In this paper, a stationary-frame control method for voltage unbalance compensation in an islanded microgrid is proposed. This method...... is based on the proper control of DGs interface converters. The DGs are controlled to compensate voltage unbalance autonomously while share the compensation effort and also active and reactive power, properly. The control system of the DGs mainly consists of active and reactive power droop controllers......, virtual impedance loop, voltage and current controllers and unbalance compensator. The design approach of the control system is discussed in detail and simulation and experimental results are presented. The results demonstrate the effectiveness of the proposed method in compensation of voltage unbalance....

  4. Sensorless Control Technology for PMSG base on the Dead-time Compensation voltage

    Directory of Open Access Journals (Sweden)

    Yang Li-yong

    2015-01-01

    Full Text Available In order to improve the speed sensorless-control system of PMSG in low speed performance, this paper introduces a novel Dead-time compensation control method .Mathematical model is established according to the Dead-zone of the influence of the voltage source type inverter output voltage. At the same time, the given value of current regulator output voltage has been fixed based on the established model. Then the stator voltage after compensationed is applied to the flux estimation, which improves the performance of flux estimation. Finally, the position and speed of the rotor is estimated based on Back-Electromotive Force, which has Simple algorithm and good robustness. In order to verify the correctness of theoretical analysis, the experiment was done according to the new control method. The results proved the correctness and feasibility of this control method.

  5. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  6. A Generalised Fault Protection Structure Proposed for Uni-grounded Low-Voltage AC Microgrids

    Science.gov (United States)

    Bui, Duong Minh; Chen, Shi-Lin; Lien, Keng-Yu; Jiang, Jheng-Lun

    2016-04-01

    This paper presents three main configurations of uni-grounded low-voltage AC microgrids. Transient situations of a uni-grounded low-voltage (LV) AC microgrid (MG) are simulated through various fault tests and operation transition tests between grid-connected and islanded modes. Based on transient simulation results, available fault protection methods are proposed for main and back-up protection of a uni-grounded AC microgrid. In addition, concept of a generalised fault protection structure of uni-grounded LVAC MGs is mentioned in the paper. As a result, main contributions of the paper are: (i) definition of different uni-grounded LVAC MG configurations; (ii) analysing transient responses of a uni-grounded LVAC microgrid through line-to-line faults, line-to-ground faults, three-phase faults and a microgrid operation transition test, (iii) proposing available fault protection methods for uni-grounded microgrids, such as: non-directional or directional overcurrent protection, under/over voltage protection, differential current protection, voltage-restrained overcurrent protection, and other fault protection principles not based on phase currents and voltages (e.g. total harmonic distortion detection of currents and voltages, using sequence components of current and voltage, 3I0 or 3V0 components), and (iv) developing a generalised fault protection structure with six individual protection zones to be suitable for different uni-grounded AC MG configurations.

  7. High-voltage therapy of carcinoma of the prostate

    International Nuclear Information System (INIS)

    Schnorr, D.; Kelly, L.U.; Guddat, H.M.; Schubert, J.; Gorski, J.; Schorcht, J.; Mau, S.; Wehnert, J.; Medizinische Akademie, Dresden

    1983-01-01

    High-voltage therapy is becoming increasingly important as a form of individual differential therapy of carcinoma of the prostate. Around 40% of all patients with a diagnosis of carcinoma of the prostate can be treated with high-voltage therapy. The precondition is the absence of bone and soft tissue metastases and of juxtaregional lymph node metastases. Individual carcinoma therapy is based on pre therapeutic tumor classification according to the TNM system. The 5-year survival rates are presented from a retrospective study carried out using primary radiation monotherapy and a combined hormone and radiation therapy; these figures were calculated by the life-table method. The study revealed no significant differences between the two forms of therapy as regards 5-year survival rates. The 5-year survival rates of all patients of the classifications T 0 -T 3 N/sub x/-N 2 M 0 irradiated (n: 198) (72% +- 11% for hormone plus radiation therapy and 74% +- 11% for radiation monotherapy) did not differ greatly from those of a normal male population of the same age (77%). High-voltage therapy of carcinoma of the prostate can thus be classified as a curative method of treatment. (author)

  8. Alternating voltage-induced electrochemical synthesis of colloidal Au nanoicosahedra

    Energy Technology Data Exchange (ETDEWEB)

    McCann, Kevin; Cloud, Jacqueline E.; Yang, Yongan, E-mail: yonyang@mines.edu [Colorado School of Mines, Department of Chemistry and Geochemistry (United States)

    2013-11-15

    A simple method of alternating voltage-induced electrochemical synthesis has been developed to synthesize highly dispersed colloidal Au nanoicosahedra of 14 ± 3 nm in size. This simple and effective method uses a common transformer to apply a zero-offset alternating voltage to a pair of identical Au electrodes that are immersed in an electrolyte solution containing ligands. The obtained Au nanoicosahedra in this work are among the smallest Au icosahedra synthesized in aqueous solutions. A series of experimental conditions have been studied, such as voltage, the electrolyte identity and concentration, stabilizer identity and concentration, and reaction temperature. The mechanistic study indicates that Au nanoicosahedra are produced on electrode surfaces through an intermediate state of AuO{sub x}. The kinetic rate constant of these Au icosahedra in catalyzing the reduction of 4-nitrophenol with sodium borohydride is found much larger than the literature values of similar Au nanocrystals. In addition, the synthesis of Au–Pd-alloyed NCs has also been attempted.Graphical Abstract.

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. A high-voltage triggered pseudospark discharge experiment

    International Nuclear Information System (INIS)

    Ramaswamy, K.; Destler, W.W.; Rodgers, J.

    1996-01-01

    The design and execution of a pulsed high-voltage (350 endash 400 keV) triggered pseudospark discharge experiment is reported. Experimental studies were carried out to obtain an optimal design for stable and reliable pseudospark operation in a high-voltage regime (approx-gt 350 kV). Experiments were performed to determine the most suitable fill gas for electron-beam formation. The pseudospark discharge is initiated by a trigger mechanism involving a flashover between the trigger electrode and hollow cathode housing. Experimental results characterizing the electron-beam energy using the range-energy method are reported. Source size imaging was carried out using an x-ray pinhole camera and a novel technique using Mylar as a witness plate. It was experimentally determined that strong pinching occurred later in time and was associated with the lower-energy electrons. copyright 1996 American Institute of Physics

  11. Accuracy of Voltage Signal Measurement During Radiofrequency Delivery Through the SMARTTOUCH Catheter.

    Science.gov (United States)

    Safavi-Naeini, Payam; Zafar-Awan, Dreema; Zhu, Hongjian; Zablah, Gerardo; Ganapathy, Anand V; Rasekh, Abdi; Saeed, Mohammad; Razavi, Joanna Esther Molina; Razavi, Mehdi

    2017-01-01

    Current methods for measuring voltage during radiofrequency (RF) ablation (RFA) necessitate turning off the ablation catheter. If voltage could be accurately read without signal attenuation during RFA, turning off the catheter would be unnecessary, allowing continuous ablation. We evaluated the accuracy of the Thermocool SMARTTOUCH catheter for measuring voltage while RF traverses the catheter. We studied 26 patients undergoing RFA for arrhythmias. A 7.5F SMARTTOUCH catheter was used for sensing voltage and performing RFA. Data were collected from the Carto-3 3-dimensional mapping system. Voltages were measured during ablation (RF-ON) and immediately before or after ablation (RF-OFF). In evaluating the accuracy of RF-ON measurements, we utilized the RF-OFF measure as the gold standard. We measured 465 voltage signals. The median values were 0.2900 and 0.3100 for RF-ON and RF-OFF, respectively. Wilcoxon signed rank testing showed no significant difference in these values (P = 0.608). The intraclass correlation coefficient (ICC) was 0.96, indicating that voltage measurements were similarly accurate during RF-OFF versus RF-ON. Five patients had baseline atrial fibrillation (AF), for whom 82 ablation points were measured; 383 additional ablation points were measured for the remaining patients. The voltages measured during RF-ON versus RF-OFF were similar in the presence of AF (P = 0.800) versus non-AF rhythm (P = 0.456) (ICC, 0.96 for both). Voltage signal measurement was similarly accurate during RF-ON versus RF-OFF independent of baseline rhythm. Physicians should consider not turning off the SMARTTOUCH ablation catheter when measuring voltage during RFA. © 2016 Wiley Periodicals, Inc.

  12. Investigation of phase-wise voltage regulator control logics for compensating voltage deviations in an experimental low voltage network

    DEFF Research Database (Denmark)

    Hu, Junjie; Zecchino, Antonio; Marinelli, Mattia

    2016-01-01

    This paper investigates the control logics of an on-load tap-changer (OLTC) transformer by means of an experimental system validation. The experimental low-voltage unbalanced system consists of a decoupled single-phase OLTC transformer, a 75-metre 16 mm2 cable, a controllable single-phase resistive...... load and an electric vehicle, which has the vehicle-to-grid function. Three control logics of the OLTC transformer are described in the study. The three control logics are classified based on their control objectives and control inputs, which include network currents and voltages, and can be measured...... either locally or remotely. To evaluate and compare the control performances of the three control logics, all the tests use the same loading profiles. The experimental results indicate that the modified line compensation control can regulate voltage in a safe band in the case of various load...

  13. Analysis of Mechanical Stresses Due to Voltage Dips in Fixed-Speed Wind Turbines

    DEFF Research Database (Denmark)

    Veluri, Badrinath; Santos-Martin, David; Jensen, Henrik Myhre

    2011-01-01

    stresses transients that may have a detrimental effect on the fatigue life of drivetrain system due to voltage dips. A rainflow cycle counting method for the stress history during the voltage dip event, analyses mean and amplitudes of the counted cycles, their occurrence moment and time of duration.......Voltage dips due to electrical grid faults generate transients of the generator electromagnetic torque which result in significant high stresses and noticeable vibrations for the wind turbine mechanical system. These events may also have a detrimental effect on the fatigue life of important...

  14. Unbalanced voltage faults: the impact on structural loads of doubly fed asynchronous generator wind turbines

    DEFF Research Database (Denmark)

    Barahona Garzón, Braulio; Cutululis, Nicolaos Antonio; Hansen, Anca Daniela

    2014-01-01

    This paper investigates the impact that unbalanced voltage faults have on wind turbine structural loads. In such cases, electromagnetic torque oscillations occur at two times the supply voltage frequency. The objectives of this work are to quantify wind turbine structural loads induced...... by unbalanced voltage faults relative to those during normal operation; and to evaluate the potential for reducing structural loads with the control of the generator. The method applied is integrated dynamic analysis. Namely, dynamic analysis with models that consider the most important aeroelastic, electrical...

  15. Coordinated Voltage Control of a Wind Farm based on Model Predictive Control

    DEFF Research Database (Denmark)

    Zhao, Haoran; Wu, Qiuwei; Guo, Qinglai

    2016-01-01

    This paper presents an autonomous wind farm voltage controller based on Model Predictive Control (MPC). The reactive power compensation and voltage regulation devices of the wind farm include Static Var Compensators (SVCs), Static Var Generators (SVGs), Wind Turbine Generators (WTGs) and On...... are calculated based on an analytical method to improve the computation efficiency and overcome the convergence problem. Two control modes are designed for both voltage violated and normal operation conditions. A wind farm with 20 wind turbines was used to conduct case studies to verify the proposed coordinated...

  16. Evaluation of HVDC interconnection models for considering its impact in real-time voltage stability assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Lund, P.

    2015-01-01

    An approach to evaluate the HVDC interconnectionsmodels to be used in real-time voltage stability assessment is proposed.The existing models for the HVDC interconnections, thatare based on voltage source converter, were studied selecting theones that are suitable for its application in Thevenin...... equivalent ´methods for voltage stability assessment. The proposed methodis to evaluate the validity of the models by using synthetizedPMU measurements from simulations and from PMUs connectedto the danish system. Wide-area measurements are used toestimate the HVDC model parameters which are needed...

  17. Insulation co-ordination in high-voltage electric power systems

    CERN Document Server

    Diesendorf, W

    2015-01-01

    Insulation Co-ordination in High-Voltage Electric Power Systems deals with the methods of insulation needed in different circumstances. The book covers topics such as overvoltages and lightning surges; disruptive discharge and withstand voltages; self-restoring and non-self-restoring insulation; lightning overvoltages on transmission lines; and the attenuation and distortion of lightning surges. Also covered in the book are topics such as the switching surge designs of transmission lines, as well as the insulation coordination of high-voltage stations. The text is recommended for electrical en

  18. Digital Realization of Capacitor-Voltage Feedback Active Damping for LCL-Filtered Grid Converters

    DEFF Research Database (Denmark)

    Xin, Zhen; Wang, Xiongfei; Loh, Poh Chiang

    2015-01-01

    The capacitor voltage of an LCL-filter can also be used for active damping, if it is fed back for synchronization. By this way, an extra current sensor can be avoided. Compared with the existing active damping techniques designed with capacitor current feedback, the capacitor voltage feedback....... To overcome their drawbacks, a new derivative method is then proposed, based on the non-ideal generalized integrator. The performance of the proposed derivative has been found to match the ideal “s” function closely. Active damping based on capacitor voltage feedback can therefore be realized accurately...

  19. Identification of TCT, a novel knockdown resistance allele mutation and analysis of resistance detection methods in the voltage-gated Na⁺ channel of Culex pipiens pallens from Shandong Province, China.

    Science.gov (United States)

    Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing

    2013-02-01

    The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.

  20. Transmission of power at high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Lane, F J

    1963-01-01

    High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.