
Sample records for vocational education sara

  1. Vocational Education and Vocational Skills

    DEFF Research Database (Denmark)

    Madsen, Erik Skov

    Abstract: This paper and presentation is based on case studies in China, Mexico and Denmark. The paper identifies challenges posed to production companies by a lack of vocational skills and vocational education. The study is focusing on different types of production systems i.e. on manual, complex......, a framework of skills related to process tasks is developed. The paper and the presentation conclude that much more focus is needed on the development of vocational education and vocational skills in Denmark, the U.K, and in the U.S. and in China for employees to be able to handle future automated...

  2. Vocational Education and Vocational Skills

    DEFF Research Database (Denmark)

    Madsen, Erik Skov

    Abstract: This paper and presentation is based on case studies in China, Mexico and Denmark. The paper identifies challenges posed to production companies by a lack of vocational skills and vocational education. The study is focusing on different types of production systems i.e. on manual, complex...... and automated production. The paper highlights how both China and Denmark have focused on theoretical rather than vocational education for more than a decade. Based on a combination of a literature review and field studies of cases, including studies of mass production and unmanned and automated production......, a framework of skills related to process tasks is developed. The paper and the presentation conclude that much more focus is needed on the development of vocational education and vocational skills in Denmark, the U.K, and in the U.S. and in China for employees to be able to handle future automated...

  3. Futurism in Vocational Education. (United States)

    Ediger, Marlow

    Vocational education is likely to change dramatically as society as a whole continues to change in the future. Research conducted by vocational education specialists will likely result in a new scope and sequence of vocational instruction. New theories of vocational education will be developed, as will new instructional methods based on these…

  4. Vocational Education and Training. (United States)

    van Leeuwen, Fred, Ed.


    This issue of the quarterly Education International focuses on vocational education and training (VET). The editorial, "Education and the Wealth of Nations" (Fred van Leeuwen), focuses on provision of quality education for all. "Education International's (EI's) First Joint Worldwide Action on Education Issues" (Elie Jouen) describes the Global…

  5. Vocational Education and Vocational Skills in Production

    DEFF Research Database (Denmark)

    Madsen, Erik Skov


    Through case studies in China, Mexico and Denmark, this paper identifies challenges posed to production companies by a lack of vocational skills and vocational education. The study includes manual, complex and automated production procedures. The paper highlights how both China and Denmark have...... focused on theoretical rather than vocational education for more than a decade. Based on a combination of a literature review and field studies of cases, including studies of mass production and unmanned and automated production, a framework of skills related to process tasks is developed. The paper...... concludes that much more focus on the development of vocational education and vocational skills is needed in Denmark, the U.K, the U.S. and in China for employees to be equipped to handle future automated and advanced production systems....


    African Journals Online (AJOL)


    This paper looked at one aspect of societal attitudes towards vocational education by conducting a survey ... services in Nigeria. Key Words: Parental Attitude, Vocational Education, Counselling, skill .... Some were 4 scale attitude questions ...

  7. Handbook on Marketing Vocational Education. (United States)

    Martin, William R.

    Compiled after interviews with vocational educators at urban and rural joint vocational schools, comprehensive high schools, and career centers considered to be successful at marketing vocational education locally in Ohio, this handbook contains information on successful marketing activities that other local educators can undertake. Section I…

  8. Dropout in vocational education

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms

    For the last ten years drop out of vocational education has increased strongly in Denmark. Only half of the students, who take up a vocational programme on upper secondary level, complete it. Like in other European countries the low completion rates has caused considerable alarm on the political...... level (Lamb and Markussen 2011). Continuing high dropout rates will make it very hard for the government to reach its target for educational completion, and the government has launched a series of measures to increase retention including the obligation for all colleges to make plans for retention...

  9. Developments in Vocational Education since 1976. (United States)

    Henze, Jurgen


    Assesses developments in Chinese vocational education since 1976 and between 1949 and 1976; defines terminology; profiles secondary vocational education alternatives, including secondary specialized schools, workers' training schools, agricultural/vocational high schools, vocational (technical) schools, apprenticeship training, and continuation…

  10. Promoting Vocational Education. A Public Relations Handbook for Vocational Educators. (United States)

    American Vocational Association, Arlington, VA.

    This handbook for vocational educators was developed as a tool to help them in their public relations efforts. Following a brief introduction, the content is presented in twelve sections. The first discusses the roles of various professionals and groups in vocational education. Section 2 covers planning a total public relations program and…

  11. Ensuring Quality Assurance in Vocational Education (United States)

    Idialu, Ethel E.


    Vocational education emphasises skill acquisition. Quality assurance in vocational education is a concept that is concerned with high performance involving activities with vocational education such as teaching, learning, infrastructures, students' behaviour and the entire academic process. Quality vocational education refers to input and output of…

  12. Vocational Education and Equality of Opportunity. (United States)

    Horowitz, Benjamin; Feinberg, Walter


    Examines the concepts of equality of opportunity and equality of educational opportunity and their relationship to vocational education. Traces the history of vocational education. Delineates the distinction between training and education as enumerated in Aristotelian philosophy. Discusses the role vocational education can play in the educative…

  13. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  14. Imperatives of Vocational Education and Sustainable Development ...

    African Journals Online (AJOL)


    vocational education play in contributing to sustainable development is the focal point ... and vocational education as a comprehensive term referring to those aspects of the ... technical institutions are highly skilled entrepreneurs. They rely on.

  15. The Advantage of Going For Vocational Education

    Institute of Scientific and Technical Information of China (English)



    With the entering of the 21st century,information technology has become the world's economic and social development trend,China is beginning to see vocational education as important to maintaining fast economic growth and social stability.Every one wants to have a lucrative career and bright future.That is the reason why most people these days take up vocational education.Vocational education is a type of educational attainment that teaches the student trade skills and aptitudes.Vocational school is a school that provides vocational education to individuals who desire to be trained in job-specific skills.

  16. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  17. Reforming Vocational Education and Training

    DEFF Research Database (Denmark)

    Friche, Nanna; Kondrup, Sissel

    The systems of vocational education and training are facing a number of challenges in many European countries. The share of young people who are neither employed, nor in education or training (NEET) is still higher for graduates from upper secondary VET than from upper secondary general programmes....... Students who enter vocational programmes are less likely to graduate than those who are enrolled in general programmes. Moreover, they are nearly five times less likely to enrol in further education than graduates from general secondary schools with similar proficiency in literacy (OECD 2015). These trends...... means that the challenges are twofold. First, the VET systems are required to offer double qualifications, which give access not only to skilled employment, but also to higher education (Deissinger 2013). Secondly, the VET systems are met by diverse demands to be social inclusive and exclusive...

  18. Chinese Vocational Education: Borrowing and Reforming (United States)

    Wang, Lei; Jiang, Dayuan


    In July 2010 in Beijing, Lei Wang interviewed Professor Dayuan Jiang, Research Fellow at the Ministry of Education's Central Institute for Vocational and Technical Education about how China has drawn from foreign vocational education models and China's own innovation process. Jiang pointed out that Germany's educational philosophy and talent…

  19. Special Education and Vocational Education Compatibility. (United States)

    Yoshinaga, Myrtle E.; Kallman, James R.


    The differences in the developmental philosophies of vocational education personnel and special education personnel, and the effects of these differences on students, are discussed. The need to examine specific job skills, to work with groups and modify group-developed materials, and to look at individual students prescriptively are discussed.…

  20. Identity Change during Vocational Teacher Education

    DEFF Research Database (Denmark)

    Duch, Henriette

    New vocational teachers cross a boundary when they move from one occupation to a job as teacher. A vocational teacher already has an education when he becomes a teacher. He also has several years of work experience. In Denmark, the educational background is related to the type of vocational schoo...... educations, reduce dropout rates and increase the supply of labor. The theoretical framework is identity theories....

  1. The Dutch vocational education and training system

    NARCIS (Netherlands)

    Verhagen, A.M.C.


    The Dutch educational system is highly stratified from secondary education onwards3, and this also applies to MBO. Each MBO course can be followed in two different learning pathways, called the vocationally educating learning pathway (beroepsopleidende leerweg: BOL) and the vocationally guiding lear

  2. Revitalizing Technical and Vocational Education Training for ...

    African Journals Online (AJOL)

    Revitalizing Technical and Vocational Education Training for Poverty ... with a population of 140 million people is battling with food insecurity, poverty and youth ... in education curricula, agricultural education and the rural poor was discussed.

  3. Vocational Education and Learning in Higher Education (United States)

    de Carvalho, Cynthia Paes


    This article discusses the relationship of students with learning and the university in the context of current challenges to vocational education and economic development. Inspired by the research of Pierre Bourdieu, this case study focuses on the relationship of students to learning and the university in Brazil. The survey gathered elements that…

  4. Nepal: Vocational Educator's Role in Elementary Education (United States)

    Stitt, Thomas R.


    The innovative vocational education program of the elementary grades in the developing country of Nepal focuses on "self-help" within the "practical arts" (agriculture, trade and industrial, and home science fields) and emphasizes application of subject matter to students' daily lives, integration of skills into the curriculum, and occupational…

  5. Vocational Education and Learning in Higher Education (United States)

    de Carvalho, Cynthia Paes


    This article discusses the relationship of students with learning and the university in the context of current challenges to vocational education and economic development. Inspired by the research of Pierre Bourdieu, this case study focuses on the relationship of students to learning and the university in Brazil. The survey gathered elements that…

  6. Data Available for Studying Vocational Education. (United States)

    Orr, David B.

    The Vocational Education Data System (VEDS) data base was created as a result of the Vocational Education Amendments of 1976. VEDS statistics were to be collected in the form of state-aggregate data (that is, state-level data is submitted by each state, based upon records and data collected by the state for this and other purposes); and VEDS data,…

  7. Leadership Skills among Technical and Vocational Educators (United States)

    Zakaria, Nurazyan Zahidah; Jizat, Nor Atikah Md.; Zakaria, Normah


    The purpose of leadership skills among technical and vocational educator are to prepare them towards effective organization. Effective leadership is widely accepted as being a key constituent in achieving organization improvement and to examine. This study aimed to gauge the leadership skills among technical and vocational educators effectiveness…

  8. Vocational Teachers between Educational Institutions and Workplaces (United States)

    Isopahkala-Bouret, Ulpukka


    The aim of this study is to analyze discursively how the relationship between educational institutions and workplaces materializes in the position of a vocational teacher. Several studies have pointed out that the role of vocational teachers is changing as a result of current educational reforms, which can be understood in terms of bringing…

  9. Hands-on creativity in Vocational Education

    DEFF Research Database (Denmark)

    Tanggaard, Lene

    This presentation poses the question: what conception of the phenomenon of creativity is best suited to the field of vocational education? VET (Vocational Education and Training) aims to prepare people for employment in craft and industry. In this field, there is an ever-growing requirement...... for creativity and innovation. In response, it is my concern that an understanding of creativity be developed with vocational education and training in mind. It is not enough to import models from other areas, where the distinction between ideas and production or creativity and execution is often relatively hazy...... and therefore not well suited for VET comprising production, handcraft and industry. In Europe, vocational education schemes are considered the solid base on which almost all kinds of industry and craft depend. If Europe is to retain its innovative capacity, then vocational education, especially the capacity...

  10. Anomie and Vocational-Technical Education (United States)

    Anthony, William P.; Miljus, Robert C.


    Graduates from a public, postsecondary vocational-technical school are compared with a control group to assess differences in level of anomie. While differences in some cases were minimal, vocational-technical graduates generally revealed more positive attitudes. It is suggested that since their education is more job-centered and they have…

  11. Anomie and Vocational-Technical Education (United States)

    Anthony, William P.; Miljus, Robert C.


    Graduates from a public, postsecondary vocational-technical school are compared with a control group to assess differences in level of anomie. While differences in some cases were minimal, vocational-technical graduates generally revealed more positive attitudes. It is suggested that since their education is more job-centered and they have…

  12. Vocational Education and Training in Kuwait: Vocational Education versus Values and Viewpoints (United States)

    Bilboe, Wendy


    Since the opening up of private universities and colleges in the Kuwait education system in the late 1990s, there has been an explosion of tertiary institutions (both domestic and international) established in the country, with many of them offering vocational education and training. The move towards vocational and educational training forms part…

  13. The Stages of Vocational/Academic Integration for Vocational Educators. Tip Sheet #5. (United States)

    Kisner, Mary J.

    This brief suggests that vocational educators may be unclear as to whether they have accomplished integration of vocational and academic education because of the multistage nature of the process. The three stages suggest a continuum of professional growth, as vocational and academic educators first become aware of limitations of the status quo,…

  14. English Higher Education and Its Vocational Zones (United States)

    Parry, Gareth


    Distinctions between academic, vocational and professional education inform but do not define the divisions of English higher education. Nevertheless, there are zones where courses, qualifications and institutions are specifically oriented to the world of work. These include most short-cycle higher education, large parts of undergraduate and…

  15. Vocational Education in Tourism: Conceptual Framework Problems

    Directory of Open Access Journals (Sweden)

    Galina Shchuka


    Full Text Available This article analyzes the basic concepts that define the essence of the system of vocational education and helps to analyze the problem of tourism staffing support. According to authors’ hypothesis, the personnel problem is related to the imperfection of the tourism conceptual framework. As of all enterprises of travel industry only travel agencies and accommodation facilities work with tourists, the author proves that personnel training for these businesses is the major objective of vocational training in tourism.

  16. Benchmarking Danish Vocational Education and Training Programmes

    DEFF Research Database (Denmark)

    Bogetoft, Peter; Wittrup, Jesper

    This study paper discusses methods whereby Danish vocational education and training colleges can be benchmarked, and presents results from a number of models. It is conceptually complicated to benchmark vocational colleges, as the various colleges in Denmark offer a wide range of course programmes...... attempt to summarise the various effects that the colleges have in two relevant figures, namely retention rates of students and employment rates among students who have completed training programmes....

  17. Design of Trigonometry Apps for Vocational Education

    DEFF Research Database (Denmark)

    Pedersen, Jens Bjarke; Andersen, Steffen; Majgaard, Gunver


    How can smartphones apps enrich the learning of mathematicsin vocational education? This article examines how mathematics teaching can be enriched by apps using smartphone sensors such as gyroscope, compass, camera, and touch screen in a aming context. An iterative and participatory design proces...... talk about our experience in implementing our design process and subsequently summarize the pros and cons of the application and the smartphone platform and how the app developed contributes to vocational mathematics teaching....

  18. Design of Trigonometry Apps for Vocational Education

    DEFF Research Database (Denmark)

    Pedersen, Jens Bjarke; Andersen, Steffen; Majgaard, Gunver


    How can smartphones apps enrich the learning of mathematicsin vocational education? This article examines how mathematics teaching can be enriched by apps using smartphone sensors such as gyroscope, compass, camera, and touch screen in a aming context. An iterative and participatory design process...... talk about our experience in implementing our design process and subsequently summarize the pros and cons of the application and the smartphone platform and how the app developed contributes to vocational mathematics teaching....

  19. Dual model of vocational education: Austrian example

    Directory of Open Access Journals (Sweden)

    Tomić Milica


    Full Text Available Dual education, as a form of secondary vocational education means that education and practical training are held on two locations - in school and in a company (organization, factory and that these two institutions jointly participate in the realization of vocational education. The paper presents an account of the functioning of dual education in Austria. In that framework special attention was paid to law regulations in this field, the modes of dual education, progression through the system and the perspectives of the young in the labour market. Among the key features of dual education which are, at the same time, considered the factors of its successfulness, the following stand out: active role of social partners in the conceptualization and realization of vocational education; intensive practical training of high quality; systemic interrelatedness of vocational schools and firms where practical training is provided, the compliance of the offer of educational profiles and the needs of labour market; the system of stimulation for the firms that provide professional training for students, clear legislation and the system of professional qualifications. Yet, the challenges of dual educations are not neglected in the paper.

  20. Bilingual Vocational Education for Youths with Limited English Proficiency. (United States)

    Bateman, Mary Jo


    Describes the Bilingual Vocational Education Program for Refugee Youth in Richmond, Virginia. Presents data that support the concept of mainstreaming refugee youth with limited English proficiency into public vocational education programs using the assistance of bilingual aides. (Author)

  1. Teachers’ perceptions of the coaching role in secondary vocational education

    NARCIS (Netherlands)

    Ketelaar, Evelien; Den Brok, Perry; Beijaard, Douwe; Boshuizen, Els


    Ketelaar, E., Den Brok, P., Beijaard, D., & Boshuizen, H. P. A. (2012). Teachers’ perceptions of the coaching role in secondary vocational education. Journal of Vocational Education & Training, 64(3), 295-315. doi:10.1080/13636820.2012.691534

  2. Student and Parent Images of Vocational Education Offerings: Declining Enrollment in Vocational Education. (United States)

    Rossetti, Rosemarie

    To investigate factors that influence a student not to enroll in a high school vocational curriculum, a study sought to determine the following: (1) what relationships exist between the high school students' sex, race, socioeconomic status, and curriculum choice and the students' image of vocational education; and (2) what image of vocational…

  3. Institutionalization of Higher Vocational Education in China: A Neoinstitutionalist Perspective (United States)

    Xiong, Jie


    From the perspective of neoinstitutionalism, higher vocational education has become an emerging institution in Chinese society. Its development over three decades entails a trend of institutionalization of higher vocational education. In such a process, higher vocational education is gaining legitimacy and experiencing isomorphic changes. Various…

  4. Financing Technical and Vocational Education: Modalities and Experiences. (United States)

    German Foundation for International Development (DSE), Bonn (Germany).

    The two papers in this document explain various options and modalities for UNEVOC (International Project on Technical and Vocational Education) Member States' financing of their individual systems of technical and vocational education and disseminating experiences in this area. "Financing Vocational Education and Training in Developing…

  5. Achieving Sex Equity via Vocational Education. (United States)

    Goetsch, David L.; Gulledge, Earl N.


    Reviews the women's rights movement and discusses the evolution of society's attitudes toward women. Discusses the goals and methods of Okaloosa-Walton Junior College Sex Equity Plan, a vocational education program for achieving sex equity. Highlights five major components: education, student recruitment, self-paced, self-directed instruction, job…

  6. Revised Recommendation Concerning Technical and Vocational Education. (United States)

    United Nations Educational, Scientific, and Cultural Organization, Paris (France).

    The UNESCO (United Nations Education, Scientific, and Cultural Organization) revised recommendation setting forth general principles, goals, and guidelines concerning technical and vocational education (adopted by the General Conference at its 18th session in Paris, 19 November 1974) is presented under the following headings: (1) Technical and…

  7. Vocational and Technical Education Master's Employment-oriented Study

    Institute of Scientific and Technical Information of China (English)



    In recent years,as China's rapid economic development,vocational and technical education has been gradually recognized by the society.As highly educated people,vocational and technical education graduate is an important force in the development of vocational education.But in reality,their employment orientation deviate from the trend of the profession and only a small part of them do related work after graducation.Combined with the current development status of vocational education,the article analysis the reasons of this problem and give policy recommendations,so as to create a good environment for vocational and technical education talented people.

  8. History of Adult Vocational Education in New Brunswick. (United States)

    New Brunswick Dept. of Education, Fredericton (Canada).

    This paper traces the development of adult vocational education in New Brunswick from its beginning in 1918 to the present. Highlights summarize the adult vocational history before confederation and to World War I, when the first Vocational Education Act was passed in 1918. The paper then summarizes the events of World War I and the Depression…

  9. Recent Research on Labor Market Outcomes of Secondary Vocational Education. (United States)

    Lewis, Morgan V.

    This paper synthesizes the results of recent research on the labor market outcomes associated with participation in secondary vocational education. It is based on 10 studies conducted with national data and reported since passage of the 1976 amendments to the Vocational Education Act of 1963. Despite the problems of analyzing vocational outcomes…

  10. The Vocational Baccalaureate: A Gateway to Higher Education? (United States)

    Gendron, Benedicte


    Access to the baccalaureate and higher education in France has become more democratic. The introduction of the vocational baccalaureate has been part of this process, but remains a modest step forward given the very low take-up of vocational baccalaureate courses. If vocational education pathways in France are to become true gateways to higher…

  11. Effective Management of Wastages in Vocational Education for ...

    African Journals Online (AJOL)



    Jul 26, 2012 ... Abstract. This paper focused on the management of wastages in vocational Education for sustainable ... A number of strategies were proffered to curb wastages in vocational ..... CHEEBAL Global Prints, Ltd. Offiong A.A., Okon ...

  12. Global Reconstructions of Vocational Education and Training (United States)

    Avis, James


    In this introduction to the special issue, the author examines the wider context within which vocational education and training (VET) is set and the surrounding debates. He considers the prominence of neoliberalism and notions of competitiveness, crisis, skill and knowledge. Despite differences between systems of VET with respect to their reach…

  13. Research and Development Needs of Vocational Education. (United States)

    Lewis, Morgan V., Ed.

    Intended to provide information on applied research and development (R&D) priorities in vocational education and on the type of R&D required for each need, this report is divided into (1) an introduction to the problem and procedures, (2) a content analysis of selected documents, and (3) background papers for selected need areas. Chapter 1…

  14. Anticipating Future Influences on Vocational Education. (United States)

    Lewis, Morgan V.; And Others

    In a study conducted to identify the major forces that appear likely to influence vocational education in the next three to five years, a general model or conceptual framework was developed and modified by suggestions from a panel of experts. The following were identified as major influences: (1) a gradual decrease in the number of secondary…

  15. Vocational Education Curriculum Development. Final Report. (United States)

    Schlichting, Harley

    A project was conducted at the University of Missouri-Columbia to develop, revise, and complete curriculum materials for nine secondary vocational education programs and specialized areas: forestry, advanced crops, clerical/secretarial, junior high home economics, textile fibers, drafting and design, metals, licensed practical nursing/advanced…

  16. Vocational and Technical Education Reform in Turkey (United States)

    Kilic, Abdurrahman


    Turkey is a country where individual rights and freedom of people are improving. It is known that a free market economy is in its infancy. There is a strong relationship between developed human resources and the production sector. In this sense, vocational and technical education is very important. It cannot be said that the efforts for…

  17. Benchmarking Danish Vocational Education and Training Programmes

    DEFF Research Database (Denmark)

    Bogetoft, Peter; Wittrup, Jesper

    This study paper discusses methods whereby Danish vocational education and training colleges can be benchmarked, and presents results from a number of models. It is conceptually complicated to benchmark vocational colleges, as the various colleges in Denmark offer a wide range of course programmes....... This makes it difficult to compare the resources used, since some programmes by their nature require more classroom time and equipment than others. It is also far from straightforward to compare college effects with respect to grades, since the various programmes apply very different forms of assessment...

  18. From Vocational Training to Open Learning Environments: Vocational Special Needs Education during Change (United States)

    Hirvonen, Maija


    This paper describes the development of education of students with special needs in vocational education. The paper is based on a case study research conducted in 2001-2005 in Jyvaskyla Municipal Federation of Vocational Education in Central Finland. The study consisted of two parts: firstly of the historical analysis of special educational…

  19. Vocational Education. Report by the Secretary of Education to the Congress, 1981. (United States)

    Office of Vocational and Adult Education (ED), Washington, DC.

    This annual report provides an overview of the status of vocational education during school year 1980-81. It includes final data for school year 1979-80 obtained through the Vocational Education Data System (VEDS), the national vocational education reporting and accounting system. Part 1 of the report describes the status of vocational education…

  20. Reforming vocational didactics by implementing a new VET teacher education

    DEFF Research Database (Denmark)

    Duch, Henriette; Andreasen, Karen Egedal


    from backgrounds with no tradition for education. Despite historical changes, the education as vocational college teacher also struggles with the interplay between theory and practice in the program and great diversity among vocational college teachers. Based on empirical data from focus group......A new education program, Diploma of Vocational Pedagogy, has recently been implemented in Denmark to upskill vocational college teachers and improve didactics at VET colleges in general. Among many challenges, vocational college teachers have to adapt their pedagogy to a large number of students......, and the analysis uncovers several factors that are expected to hamper the development processes....

  1. Working Partnerships: A Joint Venture in Vocational Education. (United States)

    Campbell, Clifton P.

    Joint Ventures in Vocational Education projects link participating businesses with secondary vocational programs in a cooperative relationship. These are voluntary arrangements between vocational programs and a public or private sector agency that combine the energies and resources of the partners to enrich various aspects of the vocational…

  2. Working Partnerships: A Joint Venture in Vocational Education. (United States)

    Campbell, Clifton P.

    Joint Ventures in Vocational Education projects link participating businesses with secondary vocational programs in a cooperative relationship. These are voluntary arrangements between vocational programs and a public or private sector agency that combine the energies and resources of the partners to enrich various aspects of the vocational…

  3. Education in Values and Moral Education in Vocational Colleges (United States)

    Ludecke-Plumer, Sigrid


    On the assumption that education in values and moral education are necessary, moral competence (to make judgments) and the structure and development of the faculty of moral judgment should not be disregarded, even in the vocational education system. The main features of Lawrence Kohlberg's theory of moral development are described as a basis for…

  4. Reforming vocational didactics by implementing a new VET teacher education

    DEFF Research Database (Denmark)

    Duch, Henriette; Andreasen, Karen Egedal


    A new education program, Diploma of Vocational Pedagogy, has recently been implemented in Denmark to upskill vocational college teachers and improve didactics at VET colleges in general. Among many challenges, vocational college teachers have to adapt their pedagogy to a large number of students...... interviews with students from the Diploma of Vocational Pedagogy program and concepts developed by Bernstein and Bourdieu, the article analyzes how these aspects might affect the development of new vocational didactics. We know that it is not easy to change the culture of educational institutions...

  5. The Phoenix: Vocational Education and Training in Singapore. International Comparative Study of Leading Vocational Education Systems (United States)

    Tucker, Marc S.


    This is the first in a series of reports from the Center on International Education Benchmarking (CIEB) exploring the leading vocational and technical education systems from around the world to draw out what makes these systems great and what other countries can learn from them. This first report was based on a visit of several days to Singapore…

  6. Paradoxes in Danish Vocational Education and Training

    DEFF Research Database (Denmark)

    Louw, Arnt Vestergaard; Katznelson, Noemi


    teaching practices in VET that create unmotivated, weak students and unintentional push-out effects. Further, it is suggested that the marketization of education has a profound effect on the practice in VET such that good education has come to be more associated with retaining all students in the VET......All vocational education and training schools in Denmark are required to launch retention initiatives and report yearly on their efforts to increase retention and the completion rate of their students. This article argues that the structural conditions and incentive structure around VET produces...

  7. The Quality Assistance Plan for Vocational Education in Illinois. (United States)

    McCormick, Fred C.; McCormick, Eileen R.

    The Quality Assistance Plan (QAP) for Vocational Education in Illinois is a state-funded program for locally initiated, developed, implemented, and evaluated projects that was begun in Fiscal Year 1982. Its purpose is to build the capacity, in each educational setting, for the improvement of vocational education programs. That improvement should…

  8. Philosophical and Sociological Overview of Vocational Technical Education in Nigeria (United States)

    Kennedy, Odu Oji


    Vocational Technical Education is any kind of education which has the main purpose of preparing one for employment in recognized occupation. The foundation of vocational technical education is based on philosophy which was mainly established for self-employment and self-reliance of the individual(s) who partake in it. Viewing the philosophy and…

  9. Educating for Vocation: Weaving Educational Ideas with Institutional Practices (United States)

    Roels, Shirley J.


    Theologies of vocation are essential in order to explore questions of purpose, values, and direction with college and university students. Given that educational institutions have embedded values and perspectives, some higher education cultures are more effective than others in fostering a student's sense of life calling. In this article, I…

  10. Examining Education Qualifications for Australian Vocational Education Practitioners (United States)

    Williams, Kim Marianne


    This paper addresses the practice of professional development within the vocational education and training (VET) arena. The study objective was to explore appropriate education qualifications for Australian VET practitioners in the tourism and hospitality sector required for effective teaching practice. The study was conducted utilising…

  11. Students' Meaning-Making and Sense-Making of Vocational Knowledge in Dutch Senior Secondary Vocational Education (United States)

    Bijlsma, Nienke; Schaap, Harmen; de Bruijn, Elly


    Meaning-making and sense-making are generally assumed to be part of students' personal vocational knowledge development, since they contribute to both students' socialisation in a vocation and students' personalisation of concepts, values and beliefs regarding that vocation. However, how students in vocational education acquire meaning and make…

  12. The Analysis on Emotional Education in Vocational School English Teaching

    Institute of Scientific and Technical Information of China (English)

    兰州职业技术学院 730070


    In the time of advancing quality education, emotion education has been paid more and more attention. English teaching is both language teaching progress and emotional communication progress. Therefore, emotional education is extremely important and indispensable in vocational school classroom teaching. However, the current application of vocational school emotional education in English classroom teaching is still relatively weak. Based on the theory of emotional education, this paper attempts to explore the methods and strategies of applying emotional education in vocational school English classroom teaching. It has important theoretical significance on promoting the comprehensive development of the vocational school students, improving English teaching effect, promoting the healthy and sustainable development of the vocational school education, and enriching and developing the emotional teaching psychology and cognitive psychology theory.

  13. Reforming vocational didactics by implementing a new VET teacher education

    DEFF Research Database (Denmark)

    Duch, Henriette; Andreasen, Karen Egedal


    from backgrounds with no tradition for education. Despite historical changes, the education as vocational college teacher also struggles with the interplay between theory and practice in the program and great diversity among vocational college teachers. Based on empirical data from focus group...... interviews with students from the Diploma of Vocational Pedagogy program and concepts developed by Bernstein and Bourdieu, the article analyzes how these aspects might affect the development of new vocational didactics. We know that it is not easy to change the culture of educational institutions......, and the analysis uncovers several factors that are expected to hamper the development processes....

  14. A Portrait of Rural America: Conditions Affecting Vocational Education Policy. Vocational Education Study Publication No. 6. (United States)

    Rosenfeld, Stuart

    The monograph is an attempt to describe conditions existing today in rural America that can affect the operation and impact of vocational education in rural areas and, thus, should exercise an influence on policy making. It identifies statistical patterns and characteristics common to rural areas, both within regions and those that cut across…

  15. Learning in School and Out--General vs. Vocational Education. (United States)

    Achtenhagen, Frank

    The adequate way to discuss problems of vocational education more generally is that taken by Resnick (1987). She feels that the relationship between general and vocational education, and their respective and common aims, problems, and restrictions, must be outlined primarily substantially and not only organizationally. Resnick tries to combine the…

  16. Collaborative learning in a culturally diverse secondary vocational education

    NARCIS (Netherlands)

    Drs. Kennedy Aquilino Tielman; Prof. dr. Perry den Brok; Dr. Rutger van de Sande; Dr. S. Bolhuis


    Collaborative learning in a culturally diverse secondary vocational education. By K. Tielman (Fontys), P. den Brok (ESoE), S. Bolhuis (Fontys) and R. van de Sande (Fontys) This contribution discusses a descriptive study on the experiences of students and teachers in secondary vocational education

  17. The vocational education and training system in Denmark

    DEFF Research Database (Denmark)

    Cort, Pia; Wiborg, Susanne


    Analysis of developments in vocational education and training systems in Australia, Canada, Denmark, France, Germany, Korea, Mexico, Morocco, the UK and the US.......Analysis of developments in vocational education and training systems in Australia, Canada, Denmark, France, Germany, Korea, Mexico, Morocco, the UK and the US....

  18. The vocational education and training system in Denmark

    DEFF Research Database (Denmark)

    Cort, Pia; Wiborg, Susanne


    Analysis of developments in vocational education and training systems in Australia, Canada, Denmark, France, Germany, Korea, Mexico, Morocco, the UK and the US.......Analysis of developments in vocational education and training systems in Australia, Canada, Denmark, France, Germany, Korea, Mexico, Morocco, the UK and the US....

  19. Vocational Education in Singapore: Meritocracy and Hidden Narratives (United States)

    Chong, Terence


    This paper offers a broad overview of vocational education in Singapore. Looking at vocational education from Independence, it argues that the development of a skilled labour force was not only crucial in the age of globalisation and the dominance of multinational companies, but also an empirical litmus test of the newly elected post-colonial…

  20. Factors Influencing Assessment Quality in Higher Vocational Education (United States)

    Baartman, Liesbeth; Gulikers, Judith; Dijkstra, Asha


    The development of assessments that are fit to assess professional competence in higher vocational education requires a reconsideration of assessment methods, quality criteria and (self)evaluation. This article examines the self-evaluations of nine courses of a large higher vocational education institute. Per course, 4-11 teachers and 3-10…

  1. Factors influencing assessment quality in higher vocational education

    NARCIS (Netherlands)

    Baartman, L.; Gulikers, J.T.M.; Dijkstra, A.


    The development of assessments that are fit to assess professional competence in higher vocational education requires a reconsideration of assessment methods, quality criteria and (self)evaluation. This article examines the self-evaluations of nine courses of a large higher vocational education inst

  2. Learning in School and Out--General vs. Vocational Education. (United States)

    Achtenhagen, Frank

    The adequate way to discuss problems of vocational education more generally is that taken by Resnick (1987). She feels that the relationship between general and vocational education, and their respective and common aims, problems, and restrictions, must be outlined primarily substantially and not only organizationally. Resnick tries to combine the…

  3. Vocational Education in Singapore: Meritocracy and Hidden Narratives (United States)

    Chong, Terence


    This paper offers a broad overview of vocational education in Singapore. Looking at vocational education from Independence, it argues that the development of a skilled labour force was not only crucial in the age of globalisation and the dominance of multinational companies, but also an empirical litmus test of the newly elected post-colonial…

  4. Linear Programming for Vocational Education Planning. Interim Report. (United States)

    Young, Robert C.; And Others

    The purpose of the paper is to define for potential users of vocational education management information systems a quantitative analysis technique and its utilization to facilitate more effective planning of vocational education programs. Defining linear programming (LP) as a management technique used to solve complex resource allocation problems…

  5. The Challenges And Risk Of Development Vocational Education In Indonesia

    Directory of Open Access Journals (Sweden)

    Yadi Mulyadi


    Full Text Available The quality of human resources (human resources really depended on good and bad points of the educational agency that prepared him. By paying attention to this link, then the urgency of the quality educational agency had finally become the key strategy in order to gains the height of the quality of human resources. Vocational education that was quality became one of the most important answers for the Indonesian nation towards the demand of the globalisation. The quality of the graduate of Vocational Education that was high, required the adoption action and the adaptation of all the requirements for the work institution/the industry, furthermore reconciled the international standard of manpower, as well as filled the current legislation regulation. Vocational education aimed at increasing intelligence, knowledge, the identity, the noble moral, as well as participants’s skills educated to live independent and followed education further in accordance with the program Vocational education (Permendiknas No. 22 Th. 2006. There were two spectra of the territory that became the aim of Vocational Education, that is preparing participants educated to the world of the work and at the same time the academic world. Therefore, then the Vocational educational curriculum became more complex both planning and his implementation. In the Vocational educational curriculum the achievement was in two spectra of the territory, that his achievement through the application of the curriculum comprehensively. This curriculum it was hoped guaranteed fully the achievement from the aim of Vocational Education. Therefore, in his fact of Vocational Education needed the operational fund that was far more bigger than that was needed by middle education the public.

  6. World Wide Comparism of Technical and Vocational Education: Lessons for Nigerian Technical and Vocational Education Sector (I) (United States)

    Ayeni, Abiodun Olumide


    This paper compared technical/vocational education in: Germany, Australia, Finland, Hong Kong, Hungary, India, Japan, South Korea, Mexico, and Nigeria, and found that technical/vocational education was given proper attention in countries considered except Nigeria, where it was handled with laissez faire attitude. Set-Up of Technical/Vocational…

  7. Challenges and Reforms in Vocational Education: Aspects of Inclusion and Exclusion. Studies in Vocational and Continuing Education, Volume 11 (United States)

    Stolz, Stefanie, Ed.; Gonon, Philipp, Ed.


    In this collected edition, globalization and its consequences on vocational education systems are described and, at the same time, combined with the question of whether new phenomena of inclusion but also of exclusion are produced. Inclusion and exclusion are differentiations that predominate in all kinds of (vocational education) systems,…

  8. Common Core Curriculum for Vocational Education. Category D: Administration and Supervision. D-1: Fiscal Management of a Vocational Education Program. (United States)

    Bain, William

    This module on fiscal management of a vocational education program is one of a set of eight on administration and supervision and is part of a larger series of thirty-four modules constituting a core curriculum for use in the professional preparation of vocational educators in the areas of agricultural, business, home economics, and industrial…

  9. Training of Teachers/Trainers in Technical and Vocational Education. UNEVOC Studies in Technical and Vocational Education, Number 11. (United States)

    United Nations Economic, Scientific, and Cultural Organization, Paris (France). Section for Technical and Vocational Education.

    This document contains nine papers about and from an international roundtable on the training of teachers in technical and vocational education. The first paper, a Final Report of the "International Round Table on Training of Teachers in Technical and Vocational Education (Curitiba, Brazil, 7-10 April 1997)," examines the following:…

  10. The Effects of Vocational Leadership Development for Individuals Who Participated in the Ohio Vocational Education Leadership Institute. (United States)

    Leimbach, Gale John

    The effects of vocational leadership development were studied for 23 Fellows enrolled in the 1992 Ohio Vocational Education Leadership Institute (OVELI). A literature review focused on four components: leadership styles, educational leadership development, vocational leadership development, and visionary leadership development. The Leadership…

  11. The Role of Vocational Education in Economic Development in Malaysia: Educators' and Employers' Perspectives. (United States)

    Mustapha, Ramlee B.; Greenan, James P.


    Responses from 276 of 300 vocational educators and 53 of 120 employers in Malaysia indicated that both groups believed vocational education contributes to economic development and vocational graduates had good technical skills but needed better employability skills. They wanted more government collaboration with the private sector. (Contains 26…

  12. The Role of Vocational Education in Economic Development in Malaysia: Educators' and Employers' Perspectives. (United States)

    Mustapha, Ramlee B.; Greenan, James P.


    Responses from 276 of 300 vocational educators and 53 of 120 employers in Malaysia indicated that both groups believed vocational education contributes to economic development and vocational graduates had good technical skills but needed better employability skills. They wanted more government collaboration with the private sector. (Contains 26…

  13. Secondary Vocational Education in Working Environment

    Directory of Open Access Journals (Sweden)

    Gvido Melink


    Full Text Available The authors present a successful project of secondary vocational education carried out by our school for the occupation of a toolmaker and a machinist for the companies Domel, Indramat and Niko in Železniki, considering the modern methods of teaching adults and having consistently adjusted timetable of the lectures in accordance with the working hours of the candidates and the production process respectively. Lectures, training and practical work in the workshop were performed in the company and school's workshops and laboratories. In the additional chapter the authors draw attention to the problems of payment for the teachers of technical s ubjects, who enter the education process with great working experience from companies but start here as beginners since the school regulations do not define such cases.

  14. Public Relations Handbook for Vocational Education in Large Cities. (United States)

    Koble, Daniel E., Jr.; And Others

    Intended for use by urban vocational staff members who face public relations problems and need to facilitate the outreach process in their cities, this handbook contains guidelines for organizing the public. First, Sanford's definition of public relations is outlined, followed by an explanation of why vocational education needs public relations.…

  15. The Advantages and Disadvantages of Assessment in Higher Vocational Education

    Institute of Scientific and Technical Information of China (English)

    LIU Ya-tao


    Assessment is always considered to be an important component in the field of higher vocational education. It serves the purpose of evaluating students’achievement and supporting learning and teaching. Assessment plays a key role by relating the in-structional activities to increase students’capabilities. The purpose aims to consider the notion of assessment as a prerequisite and will attempt to explore certain strengths and weaknesses of assessment associated with higher vocational education. Some different types and techniques of assessment in higher vocational education alongside their advantages and disadvantages will also be ex-plored.

  16. Standardized Curriculum for Marketing and Cooperative Vocational Education. (United States)

    Mississippi State Dept. of Education, Jackson. Office of Vocational, Technical and Adult Education.

    Standardized course titles and core contents for seven marketing and cooperative vocational education courses in Mississippi are provided: (1) marketing education, part one; (2) marketing education, part two; (3) fashion merchandising; (4) marketing cooperative education, part one; (5) marketing cooperative education, part two; (6) diversified…

  17. Mindfulness, Therapy and Vocational Values: Exploring the Moral and Aesthetic Dimensions of Vocational Education and Training (United States)

    Hyland, Terry


    The devaluation and debilitation of education in general and vocational education and training (VET) in particular has been explored and described in recent years by a wide range of critical commentators. Education stands in dire need of therapy, and this paper suggests a therapeutic process for rejuvenating and enhancing VET through attention to…

  18. The Peripheralisation of the Danish Vocational Education System

    DEFF Research Database (Denmark)

    Larsen, Karin Topsø


    In the past decade, the Vocational Education Training System (VET) in Denmark has undergone a downturn in which fewer and fewer students apply for and complete a vocational education. Choosing a vocational education has become synonymous with choosing the losing team. The result is a drastic drop...... in metropolitan areas and support a migration flow of young educated people from rural municipalities toward metropolitan areas....... in the supply of vocationally trained labour. This is especially problematic for labour markets in non-metropolitan areas, where a number of production- and service- firms are still located. At the same time more and more youth are choosing and completing academic education programs, which target work places...

  19. A cultural turn? Vocational teacher education in Denmark

    DEFF Research Database (Denmark)

    Duch, Henriette

    teachers was a specialized and non-classified course, now it is classifies as a higher education at level six in the Danish Qualification Framework. The analysis is based on qualitative interviews with representatives of for example vocational teachers and of leaders at vocational colleges – different......As part of my Ph.D.-project the field of educational policy is analysed with a focus on the decision process on a change of vocational teacher education (Bourdieu, 1996; Duch and Rasmussen, XX). The process is seen in the light of the Bologna process. Originally, the education of Danish vocational....... The third is how to guarantee the possibility to attend a course on a lower level than six in EQF. However, the consequences of skilled workers jumping over several levels in the educational hierarchy was not discussed. The analysis is based on theories of professions using Evetts terms `from with in...

  20. Development and Implementation of Continuing Vocational Pedagogic Education

    Directory of Open Access Journals (Sweden)

    G. N. Zhukov


    Full Text Available The paper is devoted to organizing and ensuring the effectiveness of continuing vocational education. The author describes the general theoretical idea of a lifelong education that no longer raises any doubts and objections. The continuing education is regarded as a versatile process affecting psychological, social and professional spheres, and requiring therefore the integrative – i. e. personal, social and competence approach.Referring to the expertise of Kemerovo region, the author considers the functional aspects of continuing vocational teacher training. The main emphasis is on the advantages of the network cooperation of institutions representing different educational levels and structures. Such cooperation involves the qualitative changes of content, as well as economics and management of vocational education. The experimental project of the network lead-up for vocational training masters is described. 

  1. Students’ Preferred Characteristics of Learning Environments in Vocational Secondary Education

    Directory of Open Access Journals (Sweden)

    Ingeborg Placklé


    Full Text Available If teachers and teacher educators are willing to support the learning of students, it is important for them to learn what motivates students to engage in learning. Students have their own preferences on design characteristics of powerful learning environments in vocational education. We developed an instrument - the Inventory Powerful Learning Environments in Vocational Education - to measure students’ preferences on characteristics of powerful learning environments in vocational education. We investigated whether student preferences on the design of their learning environments are in line with what is described in the literature as beneficial for learning. Data of 544 students show that the preferences of students support most characteristics of PLEs in vocational education. Looking through the eyes of students, teachers have to challenge their students and encourage them to take their learning in their own hands. Adaptive learning support is needed. Remarkable, students do not prefer having reflective dialogues with teachers or peers.

  2. 38 CFR 1.517 - Disclosure of vocational rehabilitation and education information to educational institutions... (United States)


    ... rehabilitation and education information to educational institutions cooperating with the Department of Veterans... Disclosure of vocational rehabilitation and education information to educational institutions cooperating with the Department of Veterans Affairs. Requests from educational institutions and...

  3. On Improving Higher Vocational College Education Quality Assessment (United States)

    Wu, Xiang; Chen, Yan; Zhang, Jie; Wang, Yi

    Teaching quality assessment is a judgment process by using the theory and technology of education evaluation system to test whether the process and result of teaching have got to a certain quality level. Many vocational schools have established teaching quality assessment systems of their own characteristics as the basic means to do self-examination and teaching behavior adjustment. Combined with the characteristics and requirements of the vocational education and by analyzing the problems exist in contemporary vocational school, form the perspective of the content, assessment criteria and feedback system of the teaching quality assessment to optimize the system, to complete the teaching quality information net and offer suggestions for feedback channels, to make the institutionalization, standardization of the vocational schools and indeed to make contribution for the overall improvement of the quality of vocational schools.

  4. Quality Education in English class in vocational college

    Institute of Scientific and Technical Information of China (English)



    Quality education in English teaching in elementary education should transit from examination-oriented education to quality education,which is an explicit requirement of CPC Central Committee and the State Council to the education in vocational colleges.Quality education in vocational colleges faces the challenges of the 21st century education and needs to be carried out in-depth reform.This paper collects different kinds of books and information about the Quality education.It tries to answer the following questions:what is the quality education in vocational college? What contents does it include? In the past years,many English teachers and educators have made a great effort in this area,and they have got great achievements in this field.Therefore,to strengthen the quality education in vocational college is the core and the key to the students.The reform and opening up to the world,the rapid economic development and the rapid expansion of foreign exchanges of China today demands the quality education in vocational college as particularly importance in English Teaching.

  5. The Implications of Theory Z for Departments of Vocational Education. (United States)

    Dillon, Linda S.


    Describes the Theory Z management approach as postulated by William G. Ouchi and presents steps to be considered by postsecondary departments of vocational education attempting to implement this approach. (NRJ)

  6. The Genesis and Evolution of Pre-vocational Education: England. (United States)

    Marshall, Stephanie


    Traces the history of English prevocational education since 1870, examining four pieces of educational legislation. Outlines the recurring debate over the extent utilitarianism should define education. Focuses on political and economic requirements that fostered utilitarianism. Evaluates the act's technical and vocational education initiative. (CH)

  7. The Genesis and Evolution of Pre-vocational Education: England. (United States)

    Marshall, Stephanie


    Traces the history of English prevocational education since 1870, examining four pieces of educational legislation. Outlines the recurring debate over the extent utilitarianism should define education. Focuses on political and economic requirements that fostered utilitarianism. Evaluates the act's technical and vocational education initiative. (CH)

  8. Proposed Newcastle Diploma in Vocational Education and Industrial Training (United States)

    Stanley, Brian


    For several years, Newcastle upon Tyne Institute of Education has provided a course toward a Diploma in Advanced Educational Studies (Further Education) and now proposes a full-time, year-long course for persons with training experience toward a Diploma in Vocational Education and Industrial Training. So far the necessary students to support the…

  9. 77 FR 48973 - Notice of Proposed Information Collection Requests; Office of Vocational and Adult Education... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF EDUCATION Notice of Proposed Information Collection Requests; Office of Vocational and Adult Education; Perkins... and financial reports for the Office of Vocational Adult Education office (OVAE) Division of...

  10. Technical and Vocational Education and Training in Peace Education: Solomon Islands (United States)

    Maebuta, Jack


    Technical and vocational education and training programs as a form of peace education are examined in this paper. It explores the notion of educating for a culture of peace through refocusing technical and vocational education and training programs on sustainable community development in the Solomon Islands. It further highlights the policy and…

  11. Technical and Vocational Education and Training in Peace Education: Solomon Islands (United States)

    Maebuta, Jack


    Technical and vocational education and training programs as a form of peace education are examined in this paper. It explores the notion of educating for a culture of peace through refocusing technical and vocational education and training programs on sustainable community development in the Solomon Islands. It further highlights the policy and…

  12. Higher Vocational Education and Social Mobility: Educational Participation in Australia and England (United States)

    Webb, Sue; Bathmaker, Ann-Marie; Gale, Trevor; Hodge, Steven; Parker, Stephen; Rawolle, Shaun


    This article explores the issue of social mobility in relation to the recent expansion of higher vocational education (HIVE) by non-university providers. The post-school vocational education sector has become the object of policies to widen access to higher education to ensure greater social mobility and provide second chance education to those…

  13. 34 CFR 411.1 - What is the Vocational Education Research Program? (United States)


    ... the world economy by developing more fully the academic and occupational skills of all segments of the... 34 Education 3 2010-07-01 2010-07-01 false What is the Vocational Education Research Program? 411...) OFFICE OF VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION VOCATIONAL EDUCATION RESEARCH...

  14. Distance Education of Vocational High Schools in Turkey

    Directory of Open Access Journals (Sweden)

    Tuğçe GÜNTER


    Full Text Available The aim of vocational high schools is to teach qualified, high self-sufficient, self-confident, technical staff who have critical and mathematical thinking competence and who can utilize science and technology efficiently. However, because of the limitations of traditional education, students can not take enough education attendance. In this context; along with the advances in science and technology area, “Web- Based Distance Education Programme”, which provides equal education conditions to students, is developed. This programme has got great progresses in abroad, and has also started to practice in Turkish Vocational High Schools. It is determined that some Vocational High Schools have applied Web-Based Distance Education in Medical Documentation and Secretarial (MDS and Medical Laboratory Techniques (MLT Associate Degree Programmes which are also existed in Bülent Ecevit University (BEU Ahmet Erdoğan Health Services Vocational High School. It is observed that the universities, that implemented distance education in these associate degree programmes, have higher technical infrastructure and they design a constructivism-based modules. It is considered that this distance education programme for MDS and MLT Associate Degree Programmes in certain Vocational Schools, can also be implemented for students in Medical Documentation and Secretarial (MDS and Medical Laboratory Techniques (MLT which continues education by computers and overhead projector that is slightly different from traditional education.

  15. Restrictions and Countermeasures of Rural Vocational Education in Urban-rural Integration

    Institute of Scientific and Technical Information of China (English)


    Developing rural vocational education is of great significance to urban-rural integration: developing rural vocational education is helpful to cultivating new farmers for construction of new socialist countryside,favorable to improving farmers’ ability of finding jobs and starting undertaking, and beneficial to transfer of rural surplus labor and acceleration of urbanization. Restrictions on development rural vocational education mainly include: low value cognition of society and social assessment of rural vocational education; out of balance of cost and expected return of rural vocational education; the quality of supply of rural vocational education failure to satisfy demand of socio-economic development; imperfect rural vocational education system. In view of these,following countermeasures and suggestions are put forward: strengthen propaganda and guidance to build environment of public opinion for rural vocational education; push forward rural vocational compulsory education system to lay social foundation for rural vocational education; reinforce policy support to assist in building rural vocational education system; improve education system to build overall framework of rural vocational education; perfect laws and regulations to establish system and norm for development of rural vocational education.

  16. Sustaining Teacher Educators: Finding Professional Renewal through Vocation and Avocation (United States)

    Winter, Jeffrey S.


    This paper examines motivations for becoming a teacher educator and explores ways in which teacher educators can find renewal, revitalization, and sustenance during times of challenge. The field of teacher education is discussed through the lens of the classical notion of "calling" or vocation. The article provides a context for examining the…

  17. Vocational Education and Training in Belgium. Second Edition. (United States)

    Saint-Hubert, Roselyne Simon; van Griethuysen, Claire-Anne; Hellemans, Jacques; Verhelpen, Pierre; De Streel, Jean-Marc

    Belgium's vocational education and training (VET) was examined. The following topics were considered: (1) the VET environment (political and administrative structures; the economy; the labor force; unemployment); (2) Belgium's educational system (funding principles; the structure and objectives of basic, secondary, and higher education); (3) the…

  18. A Longitudinal Study on Internship Effectiveness in Vocational Higher Education (United States)

    Wan, Chin-Sheng; Yang, Jen-te; Cheng, Shu-yun; Su, Chiakai


    A cooperative education experience (or internship placement) is an essential component of the curricula of vocational higher education. The efficacy of internship placements has become one of the major concerns facing those who develop education curricula. The purpose of this longitudinal study was to explore the relationships among the…

  19. Vocational Education of Handicapped Students: A Guide for Policy Development. (United States)

    Davis, Sharon; Ward, Michael

    Designed to assist state and local educational agencies and intermeidate educational units in developing administrative policies for the vocational education of handicapped students, the manual address present policy areas and administrative concerns. Guidelines are presented for policy development in the following nine areas (examples of…

  20. Teaching vocation versus teaching profession in educational organisations

    Directory of Open Access Journals (Sweden)

    Faustino Larrosa Martínez


    Full Text Available This paper on training prospective teachers investigates the meaning of teaching vocation and teaching profession within educational organisations, in the context of the knowledge society and in the midst of European convergence. The elements that have influenced and still influence teachers’ professional situations are analysed: tradition, social transformation, advances in research and teachers’ current needs. Then how teaching has evolved as a vocation is studied and the nature and characteristics of teaching as a profession are examined. We conclude that teaching is a vocational profession in an environment of ethical and moral pluralism.

  1. Context-Driven Entrepreneurial Education in Vocational Schools

    Directory of Open Access Journals (Sweden)

    Sharmila Sandirasegarane


    Full Text Available Vocational Education and Training (VET is offered throughout the world to students of various educational backgrounds and career aspirations in an effort to create a skilled workforce. The structure of VET varies greatly across different fields and countries with high-growth, low-growth, and transitional economies. However, a common critique of many vocational institutions is that they focus on skills training without addressing related business systems. Thus, students may not understand the business strategies related to their field, which stifles job readiness and entrepreneurial potential. To counter this, a more context-driven and integrated entrepreneurial approach is proposed for VET. Benefits, disadvantages, and exemplars of various types of vocational and entrepreneurial programs are evaluated to determine how their strengths might be leveraged. Such integrated entrepreneurial and vocational training would more suitably address context-specific market needs via both practical and transferrable skills, thus helping to reduce unemployment, particularly among youth in sub-Saharan Africa.

  2. 34 CFR 403.1 - What is the State Vocational and Applied Technology Education Program? (United States)


    ... 34 Education 3 2010-07-01 2010-07-01 false What is the State Vocational and Applied Technology... TECHNOLOGY EDUCATION PROGRAM General § 403.1 What is the State Vocational and Applied Technology Education Program? (a) Under the State Vocational and Applied Technology Education Program, the Secretary...

  3. Vocational Education for the Handicapped: A Model for Appropriate Placement and Effective Teaching. (United States)

    Arko, Carl; And Others

    Three papers discuss issues in providing vocational education services to handicapped children. In the first, "Vocational Education Speaks to Special Education," G. Rackliffe and N. Pearson consider aspects of appropriate placement and describe a handbook produced to address vocational issues for special educators. The handbook covers such topics…

  4. Adult Education and Vocational Education: Implications for Research on Distance Delivery. (United States)

    McClelland, Jerry; Saeed, Fouzia

    The literature on adult, vocational, and distance education was reviewed to identify areas needing research in order to guide decisions on the use of distance delivery in adult vocational education in Minnesota. Literature on participation in and barriers to participation in adult education was reviewed as was literature on the clientele served by…

  5. As the EBacc Education Beds Down, Pressures Grow for Vocational Alternatives (United States)

    Allen, Martin


    Though upper secondary education is increasingly dominated by the EBacc, there are growing calls for vocational alternatives and for schools to be more than "exam factories". This short contribution examines whether vocational education provides an alternative way forward.

  6. Learning at work in Higher Vocational Education

    Directory of Open Access Journals (Sweden)

    Kerstin Littke


    Full Text Available Higher vocational training (HVE is a new form of post-secondary education that was introduced in 2009 in Sweden. The aim for HVE is to address the demands of a highly skilled Swedish workforce. Compared to other forms of adult and higher education it is less institutionalized and, based on Swedish standards, gives great opportunities for the provider to decide regarding the contents and design. The purpose of this study was to analyze a the quality of the course, Learning at Work (LIA, and (b to develop instruments and indicators to explore the quality of the student learning in working life as part of HVE. The design of research instruments was based on hypotheses to uncover the background, the learning process and effect parameters In LIA offered at 12 different HVE sites in Sweden within the areas of health care, computer science, technology and business administration. The survey data of forty-two students and thirty-six workplace supervisors were analyzed. The results of the study show that the quality of the learning at work (LIA varies considerably between different programs and different students. In most programs, it has a significant development potential. A well-functioning LIA is characterized by adequate learning content, an open work climate between colleagues, accuracy and dedication, frequent supervisor feedback, and regular communication between the Program Director and the supervisors. It is important that the educational provider requires workplaces with capacity to offer the students relevant and qualified work content. LIA should offer qualified work content providing knowledge of breadth and depth. Knowledge gained from school-based training should be challenged and must achieve curriculum goals. An important finding is the lack of definitions and criteria for quality, and the risk of quality differences between educational providers. Another significant problem identified in the study is the unclear division of

  7. Vocational Pedagogical Competencies of a Professor in the Secondary Vocational Education System: Approbation of Monitoring Model (United States)

    Andryukhina, Lyudmila M.; Dneprov, Sergey ?.; Sumina, Tatyana G.; Zimina, Elena Yu.; Utkina, Svetlana N.; Mantulenko, Valentina V.


    The relevance of the researched issue is preconditioned by the strategic changes in the secondary vocational education system taking place not only in Russia, but also in the majority of industrially developed countries. Provision of the system with qualified pedagogical staff is the leading strategic objective of development of the secondary…

  8. The Model of Monitoring of Vocational Pedagogical Competences of Professors in Secondary Vocational Education (United States)

    Andryukhina, Lyudmila M.; Dneprov, Sergey ?.; Sumina, Tatyana G.; Zimina, Elena Yu.; Utkina, Svetlana N.; Mantulenko, Valentina V.


    The relevance of the researched issue is preconditioned by the strategic changes in the secondary vocational education system taking place not only in Russia, but also in majority of industrially developed countries. Provision of the system with qualified pedagogical staff is the leading strategic objective of development of the secondary…

  9. 34 CFR 403.120 - How does a State reallocate funds under the Secondary School Vocational Education Program and the... (United States)


    ... Secondary School Vocational Education Program and the Postsecondary and Adult Vocational Education Programs... 34 Education 3 2010-07-01 2010-07-01 false How does a State reallocate funds under the Secondary School Vocational Education Program and the Postsecondary and Adult Vocational Education Programs?...

  10. 34 CFR 403.113 - How does a State allocate funds under the Secondary School Vocational Education Program to area... (United States)


    ... under the Secondary School Vocational Education Program to area vocational education schools and... 34 Education 3 2010-07-01 2010-07-01 false How does a State allocate funds under the Secondary School Vocational Education Program to area vocational education schools and intermediate...

  11. Teacher Preparation for Vocational Education and Training in Germany: A Potential Model for Canada? (United States)

    Barabasch, Antje; Watt-Malcolm, Bonnie


    Germany's vocational education and training (VET) and corresponding teacher-education programmes are known worldwide for their integrated framework. Government legislation unifies companies, unions and vocational schools, and specifies the education and training required for students as well as vocational teachers. Changing from the Diplom…

  12. National Observatory Report on Vocational Education and Training in Moldova. (United States)


    The state of vocational education and training (VET) in Moldova was examined. The study focused on the following topics: Moldova's socioeconomic conditions; Moldova's labor market; governance of VET; Moldova's VET system; and anticipation of skill needs and standards. Selected findings were as follows: (1) the educational share of state…

  13. The Roles and Functions of Vocational Education: Some Current Perspectives. (United States)

    Pratzner, Frank C.; Russell, Jill Frymier

    This report examines information from a broad base of literature and research and from three Delphi surveys of the views and opinions of small, highly select groups of knowledgeable educational leaders in order to highlight a number of key issues and arguments related to the appropriate roles and functions of public vocational education. It…

  14. Efficiency and Equity in Vocational Education and Training Policies. (United States)

    Carnoy, Martin


    Addresses the question of how to determine the overall effect of the vocational education and training system on efficiency and equity. Suggests criteria to guide allocation of public resources for education and training to meet efficiency and equity goals. (Author/JOW)

  15. Vocational Education and Connecticut's Common Core of Learning. (United States)

    Connecticut State Dept. of Education, Hartford. Div. of Vocational, Technical, and Adult Education.

    The Connecticut State Board of Education policy known as the Common Core of Learning, outlines the skill, knowledge and attitudinal attainments expected of the state's secondary school graduates. This guide identifies the common core elements that can and should be reinforced through the vocational education curriculum. Information on the common…

  16. Extended Teams in Vocational Education: Collaboration on the Border (United States)

    Mazereeuw, Marco; Wopereis, Iwan; McKenney, Susan


    Extended Teams (ETs), in which teachers and workplace supervisors are jointly responsible for the quality of education, were established to solve problems concerning school-workplace connections in vocational and professional education. Six ETs were investigated during their 1st year of collaboration. In addition to recordings of ET meetings,…

  17. Extended Teams in Vocational Education: Collaboration on the Border (United States)

    Mazereeuw, Marco; Wopereis, Iwan; McKenney, Susan


    Extended Teams (ETs), in which teachers and workplace supervisors are jointly responsible for the quality of education, were established to solve problems concerning school-workplace connections in vocational and professional education. Six ETs were investigated during their 1st year of collaboration. In addition to recordings of ET meetings,…

  18. Exploring Professional Development Practices for Vocational Education and Training Practitioners (United States)

    Williams, Kim


    This paper addresses the practice of professional development within the Vocational Education and Training (VET) arena. The study object was to gain the perceptions held by a selected group of VET educators in the tourism and hospitality sector of the professional teaching/training competencies required for effective practice. The study was…

  19. State Vocational Education Resource Document: Planning for the Intermediate Future. (United States)

    Broadbent, William

    This report, which presents various economic and demographic data about Hawaii, is intended to assist persons responsible for the short-term planning of vocational-technical education programs in the state. The report is organized in terms of a series of potentially relevant concerns that should be considered during the educational planning…

  20. Students' Preferred Characteristics of Learning Environments in Vocational Secondary Education (United States)

    Placklé, Ingeborg; Könings, Karen D.; Jacquet, Wolfgang; Struyven, Katrien; Libotton, Arno; van Merriënboer, Jeroen J. G.; Engels, Nadine


    If teachers and teacher educators are willing to support the learning of students, it is important for them to learn what motivates students to engage in learning. Students have their own preferences on design characteristics of powerful learning environments in vocational education. We developed an instrument--the Inventory Powerful Learning…

  1. Promising Programs for Sex-Fair Vocational Education. (United States)

    Butler, Matilda; And Others

    This collection of program descriptions consists of case studies of 47 programs that contain promising approaches to sex-fair vocational education. The case studies (which represent programs in 39 states and the District of Columbia) describe programs that address the educational and job-skill training needs of such groups as displaced homemakers,…

  2. Philosophy of Vocational Education in China: A Historical Overview (United States)

    Schmidtke, Carsten; Chen, Peng


    Historically, Chinese educational philosophy has been dominated by Confucianism and, since 1949, by Marxism. However, rapid industrialization, ideological demands, and loyalty to traditions have now led to a situation where various Western philosophies have been adopted into vocational education in hopes of moving the country forward without…

  3. Vocational Education in Turkey: The Past, Changes and the Future (United States)

    Demirbilek, Muhammet


    This study explores the present conditions and emerging issues about the future of vocational teacher education in Turkey. The paper discusses the background and historic legacies that have led to the restructuring of Faculties of Teacher Education in Turkey. The influence of the reforms from the foundation of the Turkish Republic are discussed as…

  4. Philosophy of Vocational Education in China: A Historical Overview (United States)

    Schmidtke, Carsten; Chen, Peng


    Historically, Chinese educational philosophy has been dominated by Confucianism and, since 1949, by Marxism. However, rapid industrialization, ideological demands, and loyalty to traditions have now led to a situation where various Western philosophies have been adopted into vocational education in hopes of moving the country forward without…

  5. Learning from vocational education in the Nordic countries

    DEFF Research Database (Denmark)


    are interrelated, and how four Nordic VET-systems have coped with the contradictory requirements and policy aims. In addition, the chapter explores what consequences the different ways of managing these challenges have on social equality, inclusion and the esteem of vocational education. By comparing strengths......The challenges for initial vocational education, VET, have been growing. Policy makers and stakeholders have assigned VET an increasing number of diverse and even contradictory obligations and responsibilities. The aim of this chapter is to examine how some of the key challenges and policies...... and weaknesses of the four VET-systems in relation to specific challenges and dilemmas, the aim is to encourage transnational policy learning in the field of vocational education and training....

  6. [Florida State Department of Education] Division of Vocational Education Dissemination and Diffusion Handbook. (United States)

    Florida State Dept. of Education, Tallahassee. Div. of Vocational Education.

    This dissemination and diffusion handbook for the Florida State Department Division of Vocational Education is divided into ten chapters. Chapter 1 describes the functions of the dissemination and diffusion (D&D) section of the division of vocational education. Identifying the procedures and processes to be followed, chapter 2 focuses on the…

  7. Vocational Education and Zakat: The Case Study of Punjab Vocational Training Council

    Directory of Open Access Journals (Sweden)

    Iqbal M. KHAN


    Full Text Available The aim of this research is to explore the prospect of teaching Entrepreneurship Education to those who acquire vocational skills at Punjab Vocational Training Council (PVTC. It is also to explore whether PVTC has promoted entrepreneurship through its vocational training institutes located all over Punjab. This study also deals with the concept of utilization of ‘Zakat' for the purpose of vocational education as a mode for possible replication. The research objective has been to follow the progress of this institution. It has also been to record the successes of this model of a public-private ownership, a model of utilizing the ‘Zakat' to fund education projects, a value based organization, a learning organization and a highly innovative institution. The other objective is to explore the evidence of entrepreneurship education and its effectiveness in PVTC. Literature has been reviewed on vocational training and entrepreneurship education. It also reviews experience and evidence of such practice prevailing in other environment. Combined with this is the review and conceptualization of a model based on ‘zakat'. Research Methodology used is basically qualitative; data has been collected through semi structured intensive interviews and from focus groups of stakeholders. The strategies adopted to collect data in this study are “survey”, “case study” and “grounded theory.” The data collected from semi structured interviews were concluded by thematic analysis, analyzing technique of writing reports from data. NVivo software was utilized for triangulation to reduce the data bias and increase validity by comparing primary and secondary data. The findings of this research have been that the pedagogical skills offered by PVTC's are not effective for entrepreneurial potential development. Work is required for entrepreneurial curriculum development and training of PVTCs' instructors, students and practitioners. The research also reveals

  8. Vocation or Vocational? Reviewing European Union Education and Mobility Structures (United States)

    Hadfield, Amelia; Summerby-Murray, Robert


    This article examines the role that education plays in European Union (EU) integration. We ask whether efforts which historically have been designed to endow European students with a "knowledge of Europe" in terms of an understanding of culture, politics and sensibility have been circumscribed by, or augmented, by the recently…

  9. Schools and Work: Developments in Vocational Education. Cassell Education Series. (United States)

    Coffey, David

    This book assesses the developing vocational functions of schools in Britain, identifies vocational values and policies, and discovers gaps in provision. Chapter 1 gives a summary analysis of school structural and curricular developments between medieval times and the reign of Victoria that were inspired by vocational or economic influences or had…

  10. From apprenticeship to higher vocational education in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms


    policy problem in Denmark. Secondly, it explores political initiatives taken to ‘build bridges’ to higher education. Thirdly, it examines the development of technical higher vocational education, which has been a main destination for the former apprentices. Lastly, it examines changes in the transition......Upper secondary vocational education in Denmark is based on the apprenticeship model, which is recognised as a valuable route to employment for young people, who are not aiming for higher education. However, the apprenticeship model has a major weakness: it does not provide eligibility for higher...... education. The purpose of this article is to examine this problem in a historical perspective. The article builds on a combination of policy studies, statistical cohort studies and interview studies. First, the article explores why progression from apprenticeship to higher education has become a major...

  11. Determination of Self-Development in the Vocational Educational Environment

    Directory of Open Access Journals (Sweden)

    E. F. Zeer


    Full Text Available The paper explores the concept of vocational educational environment combining vocational training, professional development and professional world. The research is aimed at the self-determination analysis of an individual in the above environment. The authors observe the two existing trends of self-development analysis, corresponding with the subjective activity and culturally historical approaches. The empirical research results involve the students’ subjective individual characteristics and factors influencing the self-development strategy selection. The research findings prove the earlier hypothesis of the self- development phenomenon being determined by the two mutually conditioned factors: personal self-control ability and interrelation of the above mentioned components of the vocational educational environment. The authors make the conclusion that the self-development prospects are determined by the internal and external motivation, professional mobility and striving for success. The determination specificity of professional self- development, identified by the authors, can provide the psychological basis for future specialists training. 

  12. An Analysis of Teacher's Professional Development of Higher Vocational Education

    Institute of Scientific and Technical Information of China (English)



    Teachers are the backbones of any educational institutions. They not only play vital roles in students'development;they also directly affect the stature of their respective scholastic organizations. Highly qualified instructors produce competent and well-rounded students—learners who are more than ready to face the quirks and challenges of the labor force. This paper primarily discusses the following questions:What is teacher's professional development? What is higher vocational teacher's professional development? And how can scholastic institutions promote it? The conclusion states that the characteristics of high-er vocational education directly influence the higher vocational teacher's professional development;therefore, it must be nur-tured and promoted for the development of all the stakeholders of learning institutions–students, teachers, management staff, the learning institution itself, and the nation as a whole.

  13. From apprenticeship to higher vocational education in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms


    Upper secondary vocational education in Denmark is based on the apprenticeship model, which is recognised as a valuable route to employment for young people, who are not aiming for higher education. However, the apprenticeship model has a major weakness: it does not provide eligibility for higher...... to strengthen the links from apprenticeship to higher education involves a risk of weakening the current strong links to the labour market....

  14. Reflections on Developing Secondary Vocational Education in High-Poverty Areas (United States)

    Liu, Jiang; Chen, Guofeng


    Developing vocational education is a necessity for the economic and social development of high-poverty areas in China. But vocational education in impoverished areas lacks social recognition and faces funding shortages, along with difficulties in recruiting students. Vocational high schools themselves also have shortcomings. This article considers…

  15. Reflections on Developing Secondary Vocational Education in High-Poverty Areas (United States)

    Liu, Jiang; Chen, Guofeng


    Developing vocational education is a necessity for the economic and social development of high-poverty areas in China. But vocational education in impoverished areas lacks social recognition and faces funding shortages, along with difficulties in recruiting students. Vocational high schools themselves also have shortcomings. This article considers…

  16. 78 FR 68987 - Guides for Private Vocational and Distance Education Schools (United States)


    ... CFR Part 254 Guides for Private Vocational and Distance Education Schools AGENCY: Federal Trade... the ``Guides for Private Vocational and Home Study Schools'') in May 1972, and they became effective... private vocational or distance education schools. The Guides provide the basis for voluntary compliance...

  17. The False Promises of Community Colleges: Class Conflict and Vocational Education. (United States)

    Pincus, Fred L.


    Pincus argues that vocational education has been developed in response to the rising educational aspirations of the working class. He claims that vocational training provides a poor payoff under the present economic system, and that the promotion of vocational programs raises unrealistic expectations in students. (Author/SK)

  18. Designing Innovative Learning Environments to Foster Communities of Learners for Students in Initial Vocational Education (United States)

    Boersma, Annoesjka; ten Dam, Geert; Wardekker, Willem; Volman, Monique


    In this study, the concept of "community of learners" was used to improve initial vocational education. The framework of a 'community of learners for vocational orientation' that we present offers both a theoretical understanding of teaching-learning processes in initial vocational education and heuristics for the design of innovative…

  19. Designing Innovative Learning Environments to Foster Communities of Learners for Students in Initial Vocational Education (United States)

    Boersma, Annoesjka; ten Dam, Geert; Wardekker, Willem; Volman, Monique


    In this study, the concept of "community of learners" was used to improve initial vocational education. The framework of a 'community of learners for vocational orientation' that we present offers both a theoretical understanding of teaching-learning processes in initial vocational education and heuristics for the design of innovative…

  20. Does the Vocational Focus of Community Colleges Hinder Students' Educational Attainment? (United States)

    Roksa, Josipa


    This study examines the effects of vocational focus of community colleges on students' educational attainment. By examining different aspects of vocational education and three distinct student outcomes, the results demonstrate variation in the extent to which institutional focus on vocational training influences students' progress through higher…

  1. Resumes of Exemplary Programs in the States. State Planning for Vocational Education Innovative Programs. (United States)

    Ward, Darrell L., Comp.; Kazarian, Edward N., Comp.

    Contained in this report are brief descriptions of 68 innovative vocational education programs which are presently underway in 42 states. These resumes are intended to help State leadership personnel in planning improved vocational programs. (BH)

  2. Extended Teams in vocational education: Slow starters but worth the wait

    NARCIS (Netherlands)

    Mazereeuw, Marco; McKenney, Susan; Wopereis, Iwan


    This study was undertaken due to the notorious frustrations of vocational educators and workplace supervisors concerning (mis)alignment between school and work contexts. Extended teams, consisting of vocational teachers and workplace supervisors, were established to share responsibility for the

  3. Feasibility Study of Impact of the Proposed National Vocational Education Data Reporting and Accounting System (VEDS) Forms on Reporting Systems for Secondary Vocational Education in Wisconsin. Project Report. (United States)

    Poehlmann, M. M.

    A study was conducted to determine the feasibility of implementing a reporting system, the National Vocational Education Reporting and Accounting System (VEDS), for secondary vocational education in Wisconsin. As proposed by the National Center for Educational Statistics, the VEDS system is a comprehensive information collection package to provide…

  4. An Overview of Vocational Education and Training in Malta. (United States)

    European Training Foundation, Turin (Italy).

    Data for studies of vocational education and training systems in Malta and five other countries in the region were gathered through an analysis of existing studies and visits to the main stakeholders in the countries. Some of the main conclusions reached by the study of Malta include the following: (1) since the island has limited natural…

  5. Vocational and General Education: New Relationship or Shotgun Marriage? (United States)

    Jacobs, James


    Trends in the workplace and legislative mandates have forced community colleges to consider how to integrate general education with vocational training successfully. The technological base of American industry has changed dramatically in the direction of greater complexity and interdependence, requiring workers to possess not only higher levels of…

  6. Technical-Vocational Education and Language Policy in Ghana (United States)

    Adogpa, James Nsoh


    Technical and vocational graduates in Ghana are often ill-equipped to become self-reliant or well-fitted into the demands of the job market. This pattern can be examined in terms of the educational language policy implementation that disregards regional linguistic needs. This seems to arise as a result of the medium of instruction that is…

  7. Vocational Education and Training in Cyprus. Short Description (United States)

    Cedefop - European Centre for the Development of Vocational Training, 2012


    Cyprus takes over the European Union Presidency in the second half of 2012 in a period of continuing uncertainty due to the world economic crisis. The vocational education and training (VET) system of Cyprus is playing a significant role in dealing with the immediate adverse effects of the crisis on the labour market as well as in laying the…

  8. Business as a Vocation: Catholic Social Teaching and Business Education (United States)

    Turkson, Peter K. A.


    Building on "Vocation of the Business Leader," the recently released document from the Pontifical Council for Justice and Peace, along with input from Catholic business and educational leaders from around the world, this essay examines five pillars on which a Catholic business school should build its mission: foundations; the purpose of…

  9. External efficiency of schools in pre-vocational secondary education

    NARCIS (Netherlands)

    Timmermans, A. C.; Rekers-Mombarg, L. T. M.; Vreeburg, B. A. N. M.


    The extent to which students from a prevocational secondary school are placed in training programmes in senior secondary vocational education that match with their abilities can be estimated by an indicator called External Efficiency. However, estimating the external efficiency of secondary schools

  10. Vocational Education for American Indians: Then and Now. (United States)

    Lockart, Barbetta L.

    Vocational training has traditionally been a part of the services provided to Indian people by the Bureau of Indian Affairs, but for many decades the training offered was inadequate and inappropriate and students completing programs were unemployable either on or off the reservation. In 1975 as Indian education began to move from federal control…

  11. Multimedia-based performance assessment in Dutch vocational education

    NARCIS (Netherlands)

    de Klerk, Sebastiaan


    In this PhD thesis, a new method of assessment, which we have called Multimedia-based Performance Assessment (MBPA) is presented and studied in the context of Dutch vocational education. An MBPA is an assessment that incorporates multiple types of multimedia and is used to assess the skills that are

  12. Vocational Education and Training in Denmark. Short Description (United States)

    Cedefop - European Centre for the Development of Vocational Training, 2012


    Vocational education and training in Denmark has embarked on a process of modernisation aiming at, primarily, increasing flexibility, and individualisation, quality and efficiency. Assessment and recognition of informal and non-formal learning, competence-based curricula, innovative approaches to teaching, and increased possibilities for partial…

  13. 20 CFR 220.129 - Education as a vocational factor. (United States)


    ... claimant's ability to meet vocational requirements, for example, reasoning ability, communication skills... to work. (b) How the Board evaluates the claimant's education. The importance of the claimant's... years before the claimant's impairment(s) began, or unused skills and knowledge that were a part of...

  14. National Observatory Report on Vocational Education and Training in Ukraine. (United States)

    Shcherbak, O. I.; Tomashenko, V.; Berizko, M.; Golik, L.; Yanevich, L.; Nichkalo, N.; Simak, A.; Zaytseva, O.

    The state of vocational education and training (VET) in Ukraine was examined. The study focused on the following topics: Ukraine's socioeconomic conditions; Ukraine's labor market; general VET policy and legislation; and Ukraine's VET system. Selected findings were as follows: (1) although Ukraine's socioeconomic situation continues to be…

  15. Effects of Welfare Reform on Vocational Education and Training (United States)

    Dave, Dhaval M.; Reichman, Nancy E.; Corman, Hope; Das, Dhiman


    Exploiting variation in welfare reform across states and over time and using relevant comparison groups, this study estimates the effects of welfare reform on an important source of human capital acquisition among women at risk for relying on welfare: vocational education and training. The results suggest that welfare reform reduced enrollment in…

  16. Involving the Young: The German Approach to Vocational Education (United States)

    Hirche, Walter


    Youth unemployment is a huge challenge for sustainable development in our societies. Statistics offer an alarming picture of the involvement of youth in the labour markets on a global scale. Germany, due to a strong tradition in vocational education and training deeply rooted in its culture, has very low rates of youth unemployment. The so-called…

  17. Business as a Vocation: Catholic Social Teaching and Business Education (United States)

    Turkson, Peter K. A.


    Building on "Vocation of the Business Leader," the recently released document from the Pontifical Council for Justice and Peace, along with input from Catholic business and educational leaders from around the world, this essay examines five pillars on which a Catholic business school should build its mission: foundations; the purpose of…

  18. Technical and Vocational Education in the Philippines: Challenges and Alternatives. (United States)

    Pada, Frederick So.


    Technical-vocational education increasingly carries the burden of providing the needed labor force for the attainment of an industrialized economy. More collaboration is necessary to implement the best possible programs, strengthen intellectual and development, and promote their relevance to national development. (Author/JOW)

  19. Multimedia-based performance assessment in Dutch vocational education

    NARCIS (Netherlands)

    Klerk, de Sebastiaan


    In this PhD thesis, a new method of assessment, which we have called Multimedia-based Performance Assessment (MBPA) is presented and studied in the context of Dutch vocational education. An MBPA is an assessment that incorporates multiple types of multimedia and is used to assess the skills that are

  20. Rescaling Vocational Education: Workforce Development in a Metropolitan Region (United States)

    Lakes, Richard D.


    This article profiles a vocational charter school located in Atlanta as an institutional model for customized industry training in the high-tech production firms located nearby. Social partnerships with business and industry, parents and educators, and elected officials will be illuminated, exhibiting new forms of neoliberalism that reconstitute…

  1. Collaborative Business Planning in Initial Vocational Education and Training (United States)

    Laine, Kati; Hämäläinen, Raija


    There is a growing demand to enhance entrepreneurship. This study aims at producing knowledge that can assist teachers in designing and supporting collaborative learning of entrepreneurship in vocational education. A qualitative case study approach was adopted. The outcome of this study provides a better understanding of the factors that hinder…

  2. Vocational and Technical Education in Lebanon: Strategic Issues and Challenges (United States)

    Karam, Gebran


    The current status of the Lebanese vocational and technical education (VTE) system is assessed and the strategic issues and challenges facing it are identified. In addition to the economic and social challenges that are common to many developing countries, the Lebanese system suffers from idiosyncratic problems, which may require innovative and…

  3. Enhance Academic Study in Vocational Education in China (United States)

    Sun, Ling


    The increase in international trade and the information technology boom led us to begin to face the previously unthinkable of academic shortage towards vocational education. The main objective of this paper is to present the problem and find ways to solve it. The main finding included lack of investment from society and high degree involvement of…

  4. Career Guidance and Student Success in Dutch Higher Vocational Education (United States)

    te Wierik, Mark L. J.; Beishuizen, Jos; van Os, Willem


    To enhance student success, a growing number of vocational education and training institutions in the Netherlands are nowadays implementing new career guidance practices in their competence-based approaches to learning. Based on individual-level data of undergraduate first-year full-time students from a Dutch university of applied sciences, this…

  5. Dimensions of Occupational Stress: Implications for Vocational Education. (United States)

    Hopps, Zona Joyce

    Since vocational education normally deals with potential workers, it needs to include courses whose content focuses on developing effective coping strategies to deal with occupational stressors that affect job satisfaction. Occupational stress is defined as a dynamic reciprocal relationship between an individual and the work environment.…

  6. Maladaptive social behaviour of students in secondary vocational education

    NARCIS (Netherlands)

    Koerhuis, Marie-José


    The aim of this thesis was twofold: Firstly to create a reliable and valid new instrument to measure maladaptive social behaviour (MSB) of students in secondary vocational education, and secondly to assess which school context variables could predict MSB at school. Three data-waves were conducted

  7. Market Research Manual for Providers of Vocational Education and Training. (United States)

    Tamblyn, Annette; Shelton, Diane

    This manual, which is intended for vocational education and training (VET) providers, does the following: explains fundamental market research concepts; highlights situations where market research can help VET providers with their planning and policy development; and illustrates the uses of market research in VET institutions. The following topics…

  8. Cursos in Educacion Vocacional (Courses in Vocational Education): A Spanish Language Introduction to the Various Areas of Vocational and Technical Education Commonly Available in the Vocational Secondary Schools of Pennsylvania. (United States)

    Smith, Philip D., Jr.

    This manual presents an introduction in Spanish to the various areas of vocational and technical education commonly available in the vocational secondary schools of Pennsylvania. It discusses course requirements, future possibilities in the particular vocation, and related jobs. Included among the fields discussed are auto mechanics, electrical…

  9. METHODOLOGY OF PROFESSIONAL PEDAGOGICAL EDUCATION: THEORY AND PRACTICE (theoretical and methodological foundations of vocational teacher education

    Directory of Open Access Journals (Sweden)

    Evgeny M. Dorozhkin


    Full Text Available The study is aimed at investigating a justification of the new approach to the problem of vocational education development through the prism of interdependence research methodology and practice. This conceptual setup allows determining the main directions for teacher training modernization of vocational schools. The authors note that the current socio-economic situation in our country has actualized the problem of personnel training. Politicians, economists and scientists’ speeches are all about the shortage of skilled personnel. They see the main reason of this catastrophic situation in the present system of primary and secondary vocational education. At least they concern over the current practice of pedagogical personnel training of vocational education who are to restore the system of vocational education. Our country, Russia has a great positive experience in solving this problem. Scientific-methodological centre for vocational teacher education is the Russian State Vocational Pedagogical University under the scientific direction of Academician of the Russian Academy of Education, G. M. Romantsev. The reflection of scientifictheoretical bases of this education led the authors to the analysis and designing (formation of existent and new professional and pedagogical methodology. Methods. The fundamental position of A. M. Novikov on the generality of the research (scientific and practical activity methodology has become the theoretical platform of the present study. Conceptual field, conceptual statements and professional model are presented as the whole system (or integrating factor. The theoretical framework has determined the logic of the study and its results. Scientific and educational methodology differentiation in terms of the subject of cognitive activity has allowed identifying the main scientific and practical disciplines of vocational teacher education. The creative concept as the subject ground is instrumental analysis of

  10. Modern Industrialist Zhang Jian Advocated Women’s Vocational Education

    Institute of Scientific and Technical Information of China (English)


    IN 1914, China’s modern industrialist Zhang Jian used his own money to set up The Nantong Women’s Training School in Jiangsu Province. This school specialized in teaching embroidery, one of the more than 20 specialities taught in the vocational schools he set up. By looking at the way the school was established, and its curriculum, we can get a glimpse of Zhang Jian’s concept for vocational education. He thougbt it was important to train women to be knowledgeable and skillful workers.

  11. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  12. The Role of Technical and Vocational Education in the Education System of the Russian Federation. (United States)

    Smirnov, I.; And Others

    The deep economic and social problems associated with the Russian Federation's move to a market economy have extended to Vocational Education (VE). Nearly 50% of 1994's VE graduates could not get a job, and Russia's new constitution has thrown vocational schools into the market without any state support, thereby forcing many schools to become…

  13. Experiences of Educational Content in Swedish Technical Vocational Education: Examples from the Energy and Industry Programmes (United States)

    Kilbrink, Nina; Bjurulf, Veronica; Olin-Scheller, Christina; Tengberg, Michael


    In this study, teachers and workplace supervisors in two vocational programmes at a Swedish upper secondary school were interviewed about their experiences of what is important to teach and learn during vocational education. The interviews were analysed thematically by the qualitative method analysis of narratives concerning what the informants…

  14. Mathematics in agriculture and vocational education for agricultures



    International audience; This paper presents some of the results from a research study about mathematics in agriculture and agricultural education. The purpose of the study is to investigate the role of mathematics as a professional knowledge, and how to organize vocational secondary school education so that students receive the math knowledge and skills they need for their future profession. The study is done from a curricula theoretical perspective with concepts from Bernstein (2000). The re...

  15. Effective and Ethical Recruitment of Vocational Education Students. Overview. ERIC Digest No. 61. (United States)

    Naylor, Michele

    Vocational education has suffered enrollment problems simply because there are fewer students today than a few years ago. Other factors that have hurt vocational enrollments include recent efforts to increase the number of academic credits required for graduation, and in the case of area vocational-technical schools, negative attitudes toward…

  16. The Financing of Vocational Education and Training in Portugal. Financing Portrait. CEDEFOP Panorama Series. (United States)

    Centeno, Luis Gomes; Sarmento, Ana Leonor

    The financing of vocational education and training (VET) in Portugal was examined. The examination focused on the following topics: (1) the economic, political, legal, and administrative contexts of funding; (2) the funding framework for VET in Portugal; (3) initial vocational training (IVT); (4) continuing vocational training (CVT); and (5)…

  17. 34 CFR 400.9 - What additional requirements govern the Vocational and Applied Technology Education Programs? (United States)


    ... Applied Technology Education Programs? 400.9 Section 400.9 Education Regulations of the Offices of the... VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAMS-GENERAL PROVISIONS § 400.9 What additional requirements govern the Vocational and Applied Technology Education Programs? In addition to the Act,...

  18. Annual Evaluation of Vocational-Technical Education in American Samoa. 1975. (United States)

    American Samoa Advisory Council on Vocational Education, Pago Pago.

    Activities of the American Samoa Advisory Council on Vocational Education upon which the annual report is based include observations, participation in conferences and workshops on education and training, review of reports from educational and manpower agencies, results of special studies, and review of the State plan for vocational education. The…

  19. Hearings on Reauthorization of the Vocational Education Act of 1963. Part 10: Vocational Education Data System. Hearing before the Subcommittee on Elementary, Secondary, and Vocational Education of the Committee on Education and Labor. House of Representatives. Ninety-Seventh Congress. First Session (December 10, 1981). (United States)

    Congress of the U.S., Washington, DC. House Committee on Education and Labor.

    This is a report of a hearing on December 10, 1981, before the Subcommittee on Elementary, Secondary, and Vocational Education of the Committee on Education and Labor, House of Representatives, regarding reauthorization of the Vocational Education Act of 1963. It focuses on the vocational education data system known as VEDS. Testimony includes…

  20. Distributive Education and Occupational Work Adjustment. Topic Analysis for Vocational Teacher Education. (United States)

    Ohio State Dept. of Education, Columbus. Div. of Vocational Education.

    Six papers on distributive education and occupational work adjustment (OWA) which were presented at a teacher education leadership conference on the development of common core curriculum for vocational education teachers are contained in this booklet. The title and authors are as follow: "Methods of Teaching Distributive Education," by John…

  1. 34 CFR 403.140 - What activities does the Secretary support under the State Assistance for Vocational Education... (United States)


    ... VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION... special prevocational education programs. (5) Career intern programs. (6) Model programs for school dropouts. (7) The assessment of students' needs in relation to vocational education and jobs. (8) Guidance...

  2. Forming personal brand of the head of vocational education institution

    Directory of Open Access Journals (Sweden)

    Lunev Alexander


    Full Text Available The article topicality is conditioned by the increase of competitiveness of professional education institutions at the international and regional markets of services. Selection of management personnel for institutions of vocational education, ensuring its competitiveness, is one of the main challenges facing the education authorities. The article reveals the essence of competitiveness of professional education institutions as its advantage in relation to other similar objects, characterized by the ability to meet the educational needs of the population, by providing it with appropriate services to update its activity in accordance with comprehensive security. The article describes the stages of formation of the personal brand of the head of professional education institution. The article can be useful to managers of professional educational institutions and specialists of education management bodies.

  3. On Teaching Modes of English Reading for Higher Vocational Education

    Institute of Scientific and Technical Information of China (English)



    Whatever their majors are, the capability of English reading will benefit students a lot in their future careers. This paper aims to introduce two teaching modes of English reading for Higher Vocational Education and make a comparison between the two modes: the traditional teaching mode based on Discourse teaching theory and the teaching model based on Schema Theory. In the end, the writer suggests that teachers adopt the two modes with flexibility.

  4. Innovative Approaches to Vocational Education Teachers′ Training Within the Educational Space of European Countries

    Directory of Open Access Journals (Sweden)

    Marynchenko Yevhenii


    Full Text Available The article examines the main approaches to content, forms and methods of training future teachers of vocational education in Europe. It has been found that the structure and content according to national traditions and European standards have led to success of European vocational education. It has been proved that training is practiceoriented, has a solid fundamental basis and is interdisciplinary, effectively contributes to the forming of a professional outlook. We have identified common trends in training teachers of vocational education: flexible training programs based on a broad concept of competence and establishment of closer links between education institutions and research laboratories; greater attention to quality control through a large diversity in the education content; increasing autonomy of education institutions that widens their perspectives, obligatory research and innovation projects within training of future vocational education teachers, diversity of forms and methods of professional training that develops creative innovative thinking, the importance of using ICTs in the training. All these aspects prove innovative nature of European education and great opportunities for training future vocational education teachers′ readiness for creative professional activity.

  5. Toward Self-Regulated Learning in Vocational Education: Difficulties and Opportunities

    NARCIS (Netherlands)

    Jossberger, Helen


    Jossberger, H. (2011). Toward Self-Regulated Learning in Vocational Education: Difficulties and Opportunities. Doctoral Thesis. June, 24, 2011, Heerlen, The Netherlands: Open Universiteit in the Netherlands.

  6. Perceptions of Vocational Training with Elementary Special Education Students: A Case Study (United States)

    Jones, Beth A.; Williams, Kashunda L.


    The present study sought to determine the perceived utility of initiating vocational training in primary education by implementing a student-operated restaurant. Specifically, this study examined the extent to which vocational education training affected school professionals', parents', and elementary special education students' perceptions of…

  7. Prospects for China's Rural Vocational Education and the Role of Higher Agricultural Institutions. (United States)

    Ganzi, Peng; Xianguang, Liu

    The 1980s saw significant development in China's rural vocational education and the continuation of some problems. Most Chinese secondary (92 percent) and postsecondary (82 percent) students are educated in the countryside. However, only 60 percent of vocational high school students are educated there. There is insufficient enrollment at many…

  8. Reconstructing Vocational Education and Training for the 21st Century

    Directory of Open Access Journals (Sweden)

    Terry Hyland


    Full Text Available The unfavorable comparisons between English and European vocational education and training (VET systems made in the Wolf Report—and indeed in many national reviews of VET in Britain since the Royal Commission on Technical Education reported in 1884—point toward the low status of vocational pursuits in the United Kingdom compared with that in Continental Europe and elsewhere. In the light of these cultural differences, it is unlikely that structural, funding, or curriculum reforms alone will succeed in enhancing VET provision without corresponding changes in the value foundation of vocational studies. The reconstruction of VET requires a re-orientation of its foundational values if the reforms proposed by Wolf and others are to have any chance of lasting success. By the same token—although European and other national systems have their own peculiar problems—the global policy agenda concerned only with cognitive outcomes expressed as behaviorist skills and competences is, arguably, unlikely to meet the key challenges. A reconstructed model of VET needs to foreground the values, craft, and aesthetic features of vocationalism if the perennial problems are to be dealt with adequately. A reconstruction plan is suggested below, informed and inspired by the concept of “mindfulness”—non-judgmental, present-moment attention, and awareness—drawn from Buddhist contemplative traditions. Mindfulness-based interventions (MBIs in areas such as psychology, psychotherapy, medical science, and education have grown exponentially over the last decade or so, and interesting work is now emerging in relation to the value of mindfulness in workplace training.

  9. 34 CFR 412.1 - What is the National Network for Curriculum Coordination in Vocational and Technical Education? (United States)


    ... Coordination in Vocational and Technical Education? 412.1 Section 412.1 Education Regulations of the Offices of... EDUCATION NATIONAL NETWORK FOR CURRICULUM COORDINATION IN VOCATIONAL AND TECHNICAL EDUCATION General § 412.1 What is the National Network for Curriculum Coordination in Vocational and Technical......

  10. 34 CFR 403.112 - How does a State allocate funds under the Secondary School Vocational Education Program to local... (United States)


    ... Education Programs § 403.112 How does a State allocate funds under the Secondary School Vocational Education... of providing services under the Secondary School Vocational Education Program in order to meet the... formula for the Secondary School Vocational Education Program, three LEAs earn $5,000 each (which is...

  11. 34 CFR 403.111 - How must funds be used under the Secondary School Vocational Education Program and the... (United States)


    ... 34 Education 3 2010-07-01 2010-07-01 false How must funds be used under the Secondary School..., Postsecondary, and Adult Vocational Education Programs § 403.111 How must funds be used under the Secondary School Vocational Education Program and the Postsecondary and Adult Vocational Education Programs?...

  12. Australian Vocational Education: Learning from Past Mistakes? (United States)

    Stevenson, John


    Competing pressures on Australian educational managers include pressure to implement competency-based training, to manage using the industrial model, and to husband resources, conflicting with traditional educational goals, government policies, and demands for accountability. (SK)

  13. Great Expectations: Students' Educational Attitudes upon the Transition to Post-Secondary Vocational Education (United States)

    Elffers, Louise; Oort, Frans J.


    In this study, we examine students' educational attitudes upon the transition to Dutch senior vocational education (SVE), a transition associated with high dropout rates in the first year. Prior studies have identified differences in educational attitudes between sociodemographic groups. However, the mechanisms underlying those differences remain…

  14. Great expectations: students' educational attitudes upon the transition to post-secondary vocational education

    NARCIS (Netherlands)

    Elffers, L.; Oort, F.J.


    In this study, we examine students’ educational attitudes upon the transition to Dutch senior vocational education (SVE), a transition associated with high dropout rates in the first year. Prior studies have identified differences in educational attitudes between sociodemographic groups. However, th

  15. Vocational technical and adult education: Status, trends and issues related to electronic delivery (United States)

    Rothenberg, D.


    Data are analyzed, and trends and issues are discussed to provide information useful to the systems designer who wishes to identify and assess the opportunities for large scale electronic delivery in vocational/technical and adult education. Issues connected with vocational/technical education are investigated, with emphasis on those issues in the current spotlight which are relevant to the possibilities of electronic delivery. The current role of media is examined in vocational/technical instruction.

  16. Comprehensive Planning or Vocational Education. A Guide for Administrators. [8th Yearbook of the American Vocational Association]. (United States)

    Lamar, Carl S., Ed.

    This book was designed to serve as a guide for vocational education administrators in implementing comprehensive program planning (the process of forecasting the future and then preparing for it) as called for in the Education Amendments of 1976. The content is presented in ten chapters. The first provides an overview of comprehensive planning in…


    Department of National Education, Saigon (South Vietnam).


  18. A Phenomenological Study Exploring the Educational, Vocational and Social Experiences of College Educated Individuals Who Are Visually Impaired (United States)

    Joseph, Mary-Anne M.


    Students who are visually impaired have significantly lower educational and vocational success rates than their nondisabled peers (Hasazi, Johnson, Hasazi, Gordon, & Hull, 1989; Nagle, 2001). A qualitative phenomenological study was conducted to explore the educational, vocational and social experiences of college educated individuals who were…

  19. Analysis on Vocational Education and Social Mobility of New Generation Migrant Workers:A Case Study of Shijiazhuang City

    Institute of Scientific and Technical Information of China (English)

    Hongyan; LIU


    Based on survey data of current situations of new generation migrant workers vocational education and its influence on social mobility in Shijiazhuang City, the author believes that there are many drawbacks in vocational education of new generation migrant workers, including low participationt and varied training environment of enterprises. In addition, the influence of vocational education of migrant workers on social mobility is not very satisfactory. Finally, it presents countermeasures for improving vocational education, to promote social mobility of new generation migrant workers.

  20. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  1. Revitalizing Technical and Vocational Education Training for ...

    African Journals Online (AJOL)


    Sustainable Development through Agricultural. Education. ... This paper therefore focused on the ... this backdrop that this paper seeks to highlight the relevance of TVET ... products. 3. Training in basic literacy, numeracy and life skills should.

  2. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  3. Returns to General, Technical, and Vocational Education in Developing Countries: Recent Evidence from Suriname. (United States)

    Horowitz, Andrew W.; Schenzler, Christopher


    Employing a new Surinam data set, estimates private and social returns to technical, vocational, and two general-education tracks (mathematics and language). For both genders, returns to either track exceed returns to general or vocational education. Female returns to the language track exceed those to mathematics; males show the reverse. (36…

  4. Education, Employment and Income of High School Vocational Agriculture Graduates. Final Report. (United States)

    Quesada, R. M.; Seaver, S. K.

    In order to evaluate vocational agriculture education in 21 Connecticut high schools for the purposes of developing or updating curriculums, this study intended to: (1) determine employment rates of vocational agriculture graduates in agricultural areas, (2) determine post-secondary educational attainment levels, (3) determine variables affecting…

  5. Vocational Fisheries Education Workshop Proceedings (Portland, Oregon, April 18-19, 1973). (United States)

    Oregon State Univ., Corvallis. Cooperative Extension Service.

    This publication is a compilation of nine studies presented at the Vocational Fisheries Education Workshop where commercial fishermen, educators, government officials, and extension agents were gathered for examination of the subject of vocational fisheries training. The studies dealt with commercial fisheries and current training programs. An…

  6. Valor de la Informacion en la Orientacion Vocacional (The Value of Information in Vocational Education). (United States)

    Rossi Etchelouz, Nelly Yvis

    Information services in vocational education should describe for the student the reality of different professions--current characteristics and socio-economic conditions--and the chances for development in particular professions. This document discusses the need for such information in vocational education for making intelligent career choices and…

  7. Raising the Profile of Career Guidance: Educational and Vocational Guidance Practitioner (United States)

    Hiebert, Bryan


    In 2007 the International Association for Educational and Vocational Guidance (IAEVG) launched the Educational and Vocational Guidance Practitioner credential (EVGP) as one means of formally acknowledging the knowledge, skills, and personal attributes that practitioners need in order to provide quality career development services to clients. This…

  8. The Impact of Vocational Education Research and Development: A Literature Review. (United States)

    Ricketts, Samuel Clifton

    Literature on vocational education research and development (R&D) was reviewed to determine the distribution, utilization, and impact of R&D information and products. The literature indicated both slightly and strongly negative findings on the dissemination of vocational education R&D products. Many of the studies described strategies for product…

  9. A Development Dilemma for Secondary Vocational Education: Instrumentalist Tendencies in Human Resource Development (United States)

    Wang, Dong


    Human resource development is one of the theories guiding China's development of secondary vocational education. Secondary vocational education has always played a role in human resource training and development from the nation's founding to the present. In Chinese society today, however, there is a clear instrumentalist tendency in secondary…

  10. Issues in Strategic Planning for Vocational Education: Lessons from Algeria, Egypt, and Morocco. (United States)

    Salmi, Jamil


    Although Algeria, Egypt, and Morocco have followed substantially different development strategies, they exhibit similar signs of crisis in vocational education. An integrated approach to planning that acknowledges social, financial, technological, and economic constraints could help coordinate general and vocational education and specialized…

  11. Strategic Management for Competitive Advantage: A Case Study of Higher Technical and Vocational Education in Taiwan (United States)

    Huang, Hsun-I; Lee, Cheng-Fei


    Higher technical and vocational education institutions in Taiwan face the pressure of an oversupply of student places and fierce competition from domestic and international institutions. To cope with these challenges, higher technical and vocational education institutions that are better equipped to respond to market requirements are expected to…

  12. A Development Dilemma for Secondary Vocational Education: Instrumentalist Tendencies in Human Resource Development (United States)

    Wang, Dong


    Human resource development is one of the theories guiding China's development of secondary vocational education. Secondary vocational education has always played a role in human resource training and development from the nation's founding to the present. In Chinese society today, however, there is a clear instrumentalist tendency in secondary…

  13. IVA (Illinois Vocational Association) Workshops--An Innovative Approach to Inservice Education (United States)

    Anderson, Edward T.


    A joint effort in inservice education between the Illinois Division of Vocational and Technical Education and the Illinois Vocational Association (IVA) created ten diversified mini workshops which were conducted at the 1973 IVA convention in Chicago. The overall, average participant rating for the workshop was 3.76 on a one-to-four continuum. (EA)

  14. A Development Dilemma for Secondary Vocational Education: Instrumentalist Tendencies in Human Resource Development (United States)

    Wang, Dong


    Human resource development is one of the theories guiding China's development of secondary vocational education. Secondary vocational education has always played a role in human resource training and development from the nation's founding to the present. In Chinese society today, however, there is a clear instrumentalist tendency in…

  15. The Third Annual Composite Evaluation Report for Secondary Vocational Education in Wisconsin, 1979-80. (United States)

    Dale, Dorothy; Klitzke, Elizabeth

    Prepared to aid decision makers at local, state, and national levels in planning and assessing vocational education in Wisconsin, this composite report presents data from the first phase of the evaluation system of secondary vocational education--the Self Evaluation Phase. Chapter 1 overviews the evaluation activities and the remainder of this…

  16. How Vocational Psychologists Can Make a Difference in K-12 Education (United States)

    Perry, Justin C.; Shannon, Lisa


    In general, vocational psychologists have not been engaged in applied research that demonstrates how career interventions can improve educational problems that matter to relevant decision-makers and stakeholders. This article describes how vocational psychology can make a difference in K-12 education by embracing an interdisciplinary…

  17. Repositioning Technical and Vocational Education and Training (TVET) for Youths Employment and National Security in Nigeria (United States)

    Ogbunaya, T. C.; Udoudo, Ekereobong S.


    The paper focused on repositioning Technical and Vocational Education and Training (TVET) for youth's employment and national security in Nigeria. It examined briefly the concepts of technical vocational education and training (TVET), youths, unemployment and national security as well as the effects of unemployment on national security in Nigeria.…

  18. Quality Assurance in the Teaching and Examination of Vocational and Technical Education in Nigeria (United States)

    Idialu, E. Ethel


    The vital role of Vocational and Technical Education in the production of skilled and competent manpower for economic, industrial and social development cannot be achieved if an efficient and effective teaching and examination is not maintained. Therefore, this paper examines the objectives of Vocational and Technical Education in Nigeria, factors…

  19. Strategic Management for Competitive Advantage: A Case Study of Higher Technical and Vocational Education in Taiwan (United States)

    Huang, Hsun-I; Lee, Cheng-Fei


    Higher technical and vocational education institutions in Taiwan face the pressure of an oversupply of student places and fierce competition from domestic and international institutions. To cope with these challenges, higher technical and vocational education institutions that are better equipped to respond to market requirements are expected to…

  20. The Impact of Vocational Education Research and Development: A Literature Review. (United States)

    Ricketts, Samuel Clifton

    Literature on vocational education research and development (R&D) was reviewed to determine the distribution, utilization, and impact of R&D information and products. The literature indicated both slightly and strongly negative findings on the dissemination of vocational education R&D products. Many of the studies described strategies…

  1. 48 CFR 853.271 - Loan Guaranty, Education and Vocational Rehabilitation and Counseling Programs. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Loan Guaranty, Education and Vocational Rehabilitation and Counseling Programs. 853.271 Section 853.271 Federal Acquisition... Guaranty, Education and Vocational Rehabilitation and Counseling Programs....

  2. IVA (Illinois Vocational Association) Workshops--An Innovative Approach to Inservice Education (United States)

    Anderson, Edward T.


    A joint effort in inservice education between the Illinois Division of Vocational and Technical Education and the Illinois Vocational Association (IVA) created ten diversified mini workshops which were conducted at the 1973 IVA convention in Chicago. The overall, average participant rating for the workshop was 3.76 on a one-to-four continuum. (EA)

  3. Introducing a critical dialogical model for vocational teacher education

    Directory of Open Access Journals (Sweden)

    Daniel Alvunger


    Full Text Available The purpose with this article is to conceptualise and present what is referred to as a critical dialogical model for vocational teacher education that takes into account the interaction between theory/research and practice/experiential knowledge. The theoretical framework for the model is based on critical hermeneutics and the methodology of dialogue seminars with the aim to promote the development of a 'critical self' among the vocational teacher students. The model enacts an interface between theory and practice where a number of processes are identified: a reflective-analogical process, a critical-analytical process and an interactive critical self-building process. In order to include a theoretical argument concerning the issue of content, the concept of 'learning capital' and its four sub-categories in terms of curricular capital, instructional capital, moral capital and venture capital is used. We point at content-related aspects of student learning and how a critical self has the potential to promote various kinds of 'capital' and capacity building that may be of importance in the future work-life of the vocational teacher student.

  4. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  5. The Conceptual Model of Future Teachers Training to Dual Education in VET (Vocational Education & Training) (United States)

    Zholdasbekova, Saule; Nurzhanbayeva, Zhanat; Karatayev, Galymzhan; Akhmet, Laura Smatullaevna; Anarmetov, Bahitzhan


    In the article the author presents the theoretical understanding of research problems of training of the future teachers-organizers of the dual training system in vocational education & training (VET) in the conditions of the credit technology of education. The author's vision of way to solve the problem is discussed in the description of the…

  6. Post-Secondary Vocational Education and Training: Pathways and Partnerships. Institutional Management in Higher Education (United States)

    OECD Publishing (NJ3), 2012


    Rapid growth of tertiary education is partly due to the expansion of post-secondary vocational education and training (PSV). A well developed post-secondary PSV system and links between universities and VET institutions improve skills and employment opportunities. What is post-secondary PSV and how does it relate to other components of the…

  7. Impact of the Special Education Vocational Education Program (VEP) on Student Career Success (United States)

    Ofoegbu, Nelly E.; Azarmsa, Reza


    The Vocational Education Program (VEP) was established by the special education department in the Long Beach Unified School District (LBUSD) in an effort to assist students with disabilities to graduate from high school and be gainfully employed. This study investigated the impact of VEP on students' careers success after graduation. The…

  8. A new Model of Vocational Education and Training in Brasov County

    Directory of Open Access Journals (Sweden)

    Ivan, M.


    Full Text Available The purpose of the paper is to describe the vocational system and its benefits from both the economic and social perspective, and analyze its implementation in Romania, the German Vocational School Kronstadt being the first vocational school in our country. The results of the research at the Schaeffler Romania company, the top economic agent that provides the practical training for many students involved in this educational system, have emphasized the specific contributions of vocational education and training which are beneficial not only for students but also for the company itself, as well as for the entire society.

  9. Competency Profiles for Vocational Education. Final Report. (United States)

    Missouri Univ., Columbia. Instructional Materials Lab.

    This document contains a brief report describing the development of validated competency profiles for business, home economics, and industrial education at the University of Missouri-Columbia, as well as a set of the profiles. The profiles are used to evaluate students' levels of mastery of competencies in the content areas of each course. Two…

  10. Technical Degrees and Higher Vocational Education (United States)

    Hordern, Jim


    This paper focuses on the proposals for the introduction of "technical degrees" in English higher education institutions advanced by the Labour Party's Liam Byrne in a document entitled "Robbins Rebooted" which was published in August 2014 by the Social Market Foundation. The context and rationale for the proposed technical…

  11. Multimedia-based performance assessment in Dutch vocational education


    Klerk, Sebastiaan


    In this PhD thesis, a new method of assessment, which we have called Multimedia-based Performance Assessment (MBPA) is presented and studied in the context of Dutch vocational education. An MBPA is an assessment that incorporates multiple types of multimedia and is used to assess the skills that are usually measured through Performance-based Assessment (PBA). The goal of the research presented in this thesis was to investigate whether MBPA is a more efficient and effective way of assessing st...

  12. Explicating students’ personal professional theories in vocational education through multi-method triangulation

    NARCIS (Netherlands)

    Schaap, Harmen; De Bruijn, Elly; Van der Schaaf, Marieke; Baartman, Liesbeth; Kirschner, Paul A.


    Schaap, H., De Bruijn, E., Van der Schaaf, M. F., Baartman, L. K. J., & Kirschner, P. A. (2011). Explicating students’ personal professional theories in vocational education through multi-method triangulation. Scandinavian Journal of Educational Research, 55, 567-586.

  13. Determinants of Idaho Hispanic Female Participation in Adult Vocational Education Programs. (United States)

    Wirsching, Teresa; Stenberg, Laurie


    In group interviews with 32 Idaho Hispanic females participating in adult vocational education and 31 nonparticipants, length of residency, marital status, and educational attainment predicted participation. Age, barriers, and degree of acculturation related to nonparticipation. (SK)

  14. Explicating students’ personal professional theories in vocational education through multi-method triangulation

    NARCIS (Netherlands)

    Schaap, Harmen; De Bruijn, Elly; Van der Schaaf, Marieke; Baartman, Liesbeth; Kirschner, Paul A.


    Schaap, H., De Bruijn, E., Van der Schaaf, M. F., Baartman, L. K. J., & Kirschner, P. A. (2011). Explicating students’ personal professional theories in vocational education through multi-method triangulation. Scandinavian Journal of Educational Research, 55, 567-586.

  15. The role and meaning of vocations in the transition from education to work

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms

    complex, and with growing problems of dropout and low retention rates. Secondary vocational education and training based on a Dual System and occupational labour markets are generally noted for having low levels of youth unemployment and a smooth transition to work. This is assumed to be an effect...... of the central institution of this regime, the vocation (‘Beruf') that provides a close link between education and work and a specific form of socialisation to working life. The Danish system of VET is based on this type of transition regime. Still the drop out rate of secondary vocational education has remained...... discusses some of the properties of this regime and reports the results of two studies on school to work transition that have followed the former vocational student 6 years after they completed their educations. A special interest was given to the role of vocations both considered as social institutions...

  16. Use of Career Education and Occupation Information Services in Boosting Enrolment into Vocational and Technical Education Programs in Nigeria (United States)

    Igbinedion, V. I.; Ojeaga, I. J.


    The major thrust of technical and vocational education (TVE) worldwide is to address issues of youth unemployment, poverty and international competitiveness in skills development towards current and projected opportunities and challenges. The paper posits that despite the evidence of numerous reforms in vocational and technical education programs…

  17. Transforming Employment-Oriented Adult Education to Foster Arendtian Action: Rebuilding Bridges between Community and Vocational Education (United States)

    Kreber, Carolin


    "Vocational education" and "community education" have evolved into largely separate fields. Bridges are reconstructed by adopting a view of vocation that recognizes the meaning people find in their work and the public value of the work they do. While these considerations underpin recent initiatives to revive a civic spirit…

  18. Transfer of Rural Surplus Labor and Vocational Education

    Institute of Scientific and Technical Information of China (English)


    The paper introduces about the rural surplus labor transfer.According to the paper,the transfer of rural surplus labor in China presents such fundamental characteristics as randomness and non-thoroughness,scope and field constraint,and hysteretic nature of employment and industrial structure conversion.Besides,the causes of the difficulties in the transfer of rural surplus labor lie in the barriers from the system and policy,structural imbalance of industry and low quality of rural labor.The paper studies the correlation between the quality and the transfer of rural surplus labor FORCE in a systematical way from three aspects,which are the correlations between rural labor quality and the transfer difficulty & speed,the transfer scope & field and the employment stability & income after transfer respectively.Moreover,the paper carries out analysis of the special effects of vocational education on the transfer of rural surplus labor in China,which shows that vocational education is a help in the improvement of cultural qualities,labor skills and physical & mental health of rural labor.

  19. Composite Evaluation Report for Secondary Vocational Education in Wisconsin. 1986-87. Secondary Vocational Program Evaluation Project. (United States)

    Klitzke, Elizabeth; And Others

    An evaluation of secondary vocational education in Wisconsin was made using self-evaluation data from 55 schools. Each school gathered data from graduates, employers, advisory committee members, staff, and current students. Findings from the data were synthesized under five outcome areas: employment, postsecondary training, training satisfaction,…


    Directory of Open Access Journals (Sweden)

    Ahmad Aliyu Deba


    Full Text Available This paper examines the contribution of entrepreneurship education course towards cultivating entrepreneurial skills of undergraduate Science, Technical and Vocational students. The subjects consist of 309 students from the School of Technology Education. Entrepreneurial skills development assessment questionnaire (ESDAQ was used for data collection. The ESDAQ was validated by experts and internal consistency of 0.80 was obtained using the Cronbach’s Alpha method. The t-test and ANOVA were used for testing hypotheses at the 0.05 significance level. The study reveals that students' participation in the entrepreneurship education during their undergraduate education stimulates the acquisition of entrepreneurial skills. Entrepreneurial skills of technical education students is higher compared to vocational and science students. Diversification of instructional approach in teaching entrepreneurship education was recommended, especially the use of experiential learning methods interchangeably with the conventional style.

  1. The competence-based didactic approach in initial vocational education

    Directory of Open Access Journals (Sweden)

    Skubic-Ermenc Klara


    Full Text Available This article examines a didactic and curricular model that was developed to support the implementation of a competence-based approach, today prevailing in the European (initial vocational education and training (VET. It starts by presenting contemporary developments in the Slovenian VET, and then continues with a study of some of the underlying pedagogical concepts influencing the contemporary educational practice. The concept of competence, as it relates to the Slovenian VET, is discussed, and the new didactic model is presented in terms of its conceptualisation, realisation and evaluation. The model is built around the concepts of the competence- based didactic unit, and has been produced to help teachers support students in developing the ability to integrate knowledge, skills and attitudes, so that they are able to solve complex and unpredictable professional tasks and challenges. The article concludes with a discussion on the methodological limitations of the evaluation, and its transferability to other contexts.

  2. Game play in vocational training and engineering education

    Directory of Open Access Journals (Sweden)

    Bjarne A. Foss


    Full Text Available Educational games may create a new and improved learning culture by drawing advantage of the new knowledge and skills of today’s students obtained from extensive use of interactive game software. This paper presents a design basis and online learning resources taking advantage of game-related features like a high degree of interactivity, attractive graphics, a dynamical virtual universe, and an incentive system to promote prolonged and more advanced use. The educational resources, denoted PIDstop, are targeted towards the engineering domain. Feedback from over 2000 users clearly indicates that PIDstop has a positive learning effect. Training packages for vocational training of Automation Technicians is emphasized in this paper. Such learning resources must have a limited mathematical complexity; hence, the representation should be rather descriptive. Evaluation of learning resources to assess the actual learning effect is important, and a two-step procedure based on formative and summative evaluation is proposed for this purpose.

  3. Improving Vocational Education with Mentally Retarded Persons: A Conversation with L. Allen Phelps. (United States)

    Thomas, M. Angele


    Special vocational educator L. Allen Phelps identifies major issues in vocational programing for mentally retarded students (including implementing technology and expanding integration); comments on the effects of the changing federal role; notes changes in staffing patterns; cites the need for advocacy by professional associations; and suggests…

  4. A System for Providing Relevant Metrics Education for Vocational Teachers in Kentucky. Final Report. (United States)

    Crosby, Richard K.

    A project conducted in four vocational regions of Kentucky developed a system for providing vocational teachers with relevant metrics education and developed and identified materials to support and enhance the system. Ten occupational training areas selected as a focus of the project were air conditioning, auto body, auto mechanics, diesel…

  5. The Role of Vocational and Technical Education in Nigeria Economic Development (United States)

    Ohiwerei, Franklin Ohiole; Nwosu, Basil Ogomeziem


    The researchers tried to ascertain the role of vocational and technical education in the Nigeria economic development using historical survey in analyzing the views of various academic authors in an attempt to inform researchers' on current issues on the field. The research reveals that there was a defect in the curriculum of vocational and…

  6. A Partial and Informal History of Vocational Education in Hawaii: 1809-1995. (United States)

    Broadbent, William A.

    This paper presents a partial history of some of the more relevant aspects of vocational education in the state of Hawaii from its inception in 1809 until the end of 1995. It discusses the following topics: (1) methodology; (2) general historical context; (3) national context; (4) federal legislation; (5) the first 20 years of vocational education…

  7. Student Autonomy and Awareness: Vocational Education and Student-Centred Learning in China (United States)

    Hua, Zhong; Harris, Ann; Ollin, Ros


    This article reports on research into Chinese students' perceptions of a pilot key skills' communication course introduced in three vocational education institutions in China. The course was based on key skills' criteria formulated in 2004 by China's Vocational Qualification Appraisal Committee and produced in response to the changing demands of…

  8. Student Autonomy and Awareness: Vocational Education and Student-Centred Learning in China (United States)

    Hua, Zhong; Harris, Ann; Ollin, Ros


    This article reports on research into Chinese students' perceptions of a pilot key skills' communication course introduced in three vocational education institutions in China. The course was based on key skills' criteria formulated in 2004 by China's Vocational Qualification Appraisal Committee and produced in response to the changing demands of…

  9. Selected Evaluation Findings for Secondary Vocational Education--The Wisconsin Evaluation Model. (United States)

    Dale, Dorothy; Klitzke, Elizabeth


    Fifty-eight Wisconsin high schools have undergone a comprehensive evaluation of their total vocational education program, including program management and administration as well as capstone, sequence, and exploratory programs in all vocational discipline areas. All aspects discussed--employability, job relatedness to training, employer hiring…

  10. Vocationalism in Higher Education: Explanations from Social Theory. ASHE Annual Meeting 1980 Paper. (United States)

    Roemer, Robert E.

    Three social theories (status-competition theory, functionalism, and legitimation theory) are considered as explanations of a growing vocationalism in higher education. Vocationalism is used to refer to an increasing interest among undergraduate students in pursuing studies that lead directly to occupational competence. Status-competition theory…

  11. The Role of Vocational and Technical Education in Nigeria Economic Development (United States)

    Ohiwerei, Franklin Ohiole; Nwosu, Basil Ogomeziem


    The researchers tried to ascertain the role of vocational and technical education in the Nigeria economic development using historical survey in analyzing the views of various academic authors in an attempt to inform researchers' on current issues on the field. The research reveals that there was a defect in the curriculum of vocational and…

  12. Expanding Access to Vocational-Technical Education in Massachusetts. White Paper No. 136 (United States)

    Ardon, Ken; Fraser, Alison L.


    It is clear from assessment, graduation, and follow-up data that career-vocational technical education (CVTE), as it is practiced in Massachusetts, is a success. CVTE is becoming so popular that there are up to 5,000 more applicants for places in Massachusetts' vocational technical schools than there are openings, creating waiting lists. This…

  13. Educating for Vocational Excellence: The Auto/Biographical Exploration of Enacted Craft Pedagogy (United States)

    Tyson, Ruhi


    The focus of this article is on education for vocational excellence (the combination of virtue and good judgment or phronesis/practical wisdom) through an examination of episodes from the auto/biographical study of master craftsman Wolfgang B. Vocational excellence is an issue sometimes discussed with regard to teacher training for schools and…

  14. Extended Teams in vocational education: Slow starters but worth the wait

    NARCIS (Netherlands)

    Mazereeuw, Marco; McKenney, Susan; Wopereis, Iwan


    This study was undertaken due to the notorious frustrations of vocational educators and workplace supervisors concerning (mis)alignment between school and work contexts. Extended teams, consisting of vocational teachers and workplace supervisors, were established to share responsibility for the qual

  15. Profitability of Vocational vs. Formal Education for Men and Women in Singapore Using Quantile Regressions


    Chris Sakellariou


    Singapore is among the countries who have well-developed vocational education and training programs. It follows a centralized planning model in which the needs of industry and business are closely matched to the output of the education system. This study examines the pattern of returns to formal vs. vocational education across quantiles. It is hypothesized that heterogeneity in “abilities” which contribute to higher earnings is related to schooling acquisition. It is found that marginal retur...

  16. Blended Learning in the Vocational Education and Training System in Tanzania: Understanding Vocational Educators’ Perceptions

    Directory of Open Access Journals (Sweden)

    Haruni J. Machumu


    Full Text Available In a constructivist world of teaching and learning, opportunities to acquire and develop the knowledge and practical skills necessary to design, establish, and deploy blended learning in vocational education and training (VET programs delivery is a labour-market-driven. The paper examines VET educator’s pleas about the need for the design, adoption and deployment of blended learning in VET programs delivery in Tanzania. A single case study design with an in-depth interview and focus group discussion was conducted with 15 VET educators in three VET colleges in both Morogoro and Dar es Salaam regions. Snowball and purposive sampling were used to obtain sample respondents. For the data analysis, content analysis was employed to condense data obtained from interviews and focus group discussion. It was found that continuous professional development, institutional arrangements, and support should be provided online to facilitate the design, adoption and use of blended learning in VET. We recommend that locally designed blended learning should be relevant to the environment of both students and teachers. In reality, the interplay between blended learning, imparting knowledge and practical skills remain the key focus of future research.

  17. Return to General Education and Vocational Education & Training in Indian Context: Policy Implications (United States)

    Ahmed, Tutan; Chattopadhyay, Raghabendra


    Purpose: Measurement of returns to vocational education has always remained a matter of controversy (Psacharopoulos, 1994; Bennell and Segerstrom, 1998; Ziderman, 1997). Based upon the return evidence many World Bank projects were scrapped (Middleton and Ziderman, 1997, Bennell and Segerstrom, 1998). However, there is again a growing interest for…

  18. An exploration of students’ own explanations about dropout in vocational education in a danish context

    DEFF Research Database (Denmark)

    Tanggaard, Lene


    The present paper addresses the phenomenon of student dropout from vocational education in Denmark. It does so by addressing the need to critically discuss the term ‘drop-out’ taking the perspective of students’ own reflections on the topic. The empirical findings indicate that dropout is conside......The present paper addresses the phenomenon of student dropout from vocational education in Denmark. It does so by addressing the need to critically discuss the term ‘drop-out’ taking the perspective of students’ own reflections on the topic. The empirical findings indicate that dropout...... interviews with students in eight different basic vocational educational courses in Denmark....

  19. Occupational Home Economics. Access Skills. Vocational Readiness Skills. Missouri LINC. Accessing Vocational Education. (United States)

    Missouri Univ., Columbia. Dept. of Practical Arts and Vocational-Technical Education.

    This document contains home economics occupations-related materials to help teachers and parents teach access skills to Missouri junior high and high school special needs students who want to pursue a vocational program in child care, custom sewing, or food service. Access skills are defined as those skills needed to access vocational education…

  20. 构建中-高-本零距离衔接的铜仁大职教思考%Thoughts on Buildingthe Zero Distance Connection of VocationalSchools, Vocational College and Universitiesin TongrenVocationalEducation

    Institute of Scientific and Technical Information of China (English)



    Tongren is a typical agricultural area in Guizhou Province. The government pays high attention to vocational education, so the reis aqualified university, two vocational colleges (including one national key vocational colleges), and fourteen vocational schools in Tongren, which has trained large number of talents for local economic development. This paper discussed how to integrate Tongren vocational education resources, and how the university was the guide for vocational colleges and vocational schools. Therefore, it put forward in the building the zero distance connection of vocational schools, vocational colleges and universities in Tongren vocational education.%要提升职教办学水平,就必须整合铜仁职业教育资源,发挥好本科对高职高专及中职的带动作用,构建中-高-本零距离衔接的大职教体系,其对策主要有:以本科院校为龙头,形成中-高-本贯通的职业技术教育集团学校;激活行业企业的参与度,把集团化办学从学校联盟向校企联合体转型,健全职业教育整体发展的体系,促进职业教育良性发展。

  1. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  2. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  3. How would Vocational Education Lead Contemporary Vocational Education%高职教育如何引领现代职业教育体系建设

    Institute of Scientific and Technical Information of China (English)

    吴宪洲; 佘菖弘


    高等职业教育在现代职业教育体系中具有特殊的地位,高职教育的发展动向影响整个职业教育的全局,在现代职业教育体系的办学理念、人才培养模式、社会服务、职业教育科学研究、合作办学诸方面发挥着引领作用。%Vocational education has unique position in the modem vocational education whose developing orientation affect the entire tendency of vocational education and execute system, leading role in schooling concept, talent nourishing mode, social service, educational science research and corporative schooling.

  4. The effectiveness of vocational education in promoting equity and occupational mobility amongst young people

    Directory of Open Access Journals (Sweden)

    Bartlett Will


    Full Text Available This paper reviews current knowledge about the impact of vocational education and training on the labor market outcomes for young people in advanced market economies, and asks whether the results can be extrapolated to countries in the Western Balkans and the EU neighborhood. It draws four main policy conclusions. First, in transition countries, specialized vocational education should not be replaced by streaming or tracking within comprehensive school systems or integrated into general education programmes. Abandoning effective vocational schooling may worsen the labor market outcomes for the less able and disadvantaged young people. Inadequate vocational school systems should be strengthened, while ensuring effective pathways to higher levels of education. Second, while apprenticeship systems enable lower ability students and minorities to access the labor market, they may lock women into traditional female occupations. Well-organized and resourced school-based vocational education may be preferred by women who feel they could benefit from them, and may furthermore reduce school drop-out rates. Third, occupational mobility can be improved by effective school-based vocational education. If returns to such education are sufficiently high, they can incentives mobility. While for developed economies there is little difference in rates of return between general and vocational education, in transition economies, returns to vocational education are higher than returns to general education. Fourth, while occupational mobility is needed for countries undergoing structural change, it should be noted that too much mobility can also be harmful to the skill retention, especially for women. Special attention should therefore be given to providing complementary opportunities for retraining and for lifelong learning to all workers, but especially to women, to encourage and support the desired degree of mobility in the labor market.

  5. Using AHP Method for Educational and Vocational Guidance

    Directory of Open Access Journals (Sweden)

    Essaid EL HAJI


    Full Text Available This work focuses on the use of multi-criteria decision-making method AHP for using in educational and vocational guidance. Analytical Hierarchy Process (AHP, proposed by the mathematician Thomas Saaty in 1980, is a method of analysis greatly used in the context of a multi-criteria analysis; it allows the comparison and the choice between the preset options. To achieve this goal, a vital work, preceded the use of the AHP method, which consists in doing a prototyping of trades according to the guidance criteria and sub-criteria. The IT system based on this method allows the student to find, firstly, the activities' sectors which are the most appropriate to his/her profile, to choose subsequently the trades and finally, to identify, the potential training paths


    Directory of Open Access Journals (Sweden)

    Irdayanti Mat Nashir


    Full Text Available Empirical studies conducted within the Technical and Vocational Education (TVE discipline in Malaysia tends to give greater emphasis to quantitative data collection techniques. Aware of the potential usefulness of combination of techniques, this paper discusses the application of the Delphi technique where qualitative and quantitative data collection techniques are used to reach useful results. The Delphi technique provides the opportunity for researchers to gather input from participants without requiring them to work face-to-face. Often, the process is used to find consensus among experts who have differing views and perspectives. The Delphi technique enables group problem-solving using an iterative process of problem definition, discussion, feedback, and revisions.This paper discusses the basics of the Delphi techniques, its application potential, the selection of expert panels and the means on how consensus can be reached among the participants using examples from our past research using the technique.


    Directory of Open Access Journals (Sweden)

    E. M. Dorozhkin


    Full Text Available Introduction. Nowadays, there is no evidence-based strategy of upgrade of system of preparation of pedagogical personnel for continuous professional education in the Russian Federation. At the same time, scientists recognize that smoothly running regular high-quality replenishment of education by the skilled heads and teachers having fundamental psychology and pedagogical knowledge and being specialists in one of economic industries has crucial importance for successful development of post-industrial society. Hence, the need for creation of multichannel system of professional and pedagogical preparation has emerged.The aim of the present publication is to provide the complex overview of problems of reforming of professional pedagogical education and to show possible ways of their decision.Methods. The methodological basis of the study involves the concept of professional development of an individual; the thesis on the integration of the system-based, process and project approaches; the principles for the development of professional pedagogical education. Panoramic approach to the discussed problems of modernization of professional and pedagogical school has defined the logic of our research.Results. Psychological and pedagogical problems of professional education are analysed. Multidimensional metaprofessional qualities of teachers of vocational school are considered. The conceptual model of vocational structure of preparation of pedagogical personnel is developed for the system of continuous professional education.The debatable aspect of the research is reflected in the project of a psychological and pedagogical platform – the autonomous modular educational program including massive open online courses, management systems of educational process, supports of innovative infrastructure of education, humanitarian technologies of high education.Practical significance. The vocational structure of training of teachers of vocational

  8. The Role of Vocational Education and Training in the Labour Market Outcomes of People with Disabilities. A National Vocational Education and Training Research and Evaluation Program Report (United States)

    Polidano, Cain; Mavromaras, Kostas


    Low levels of education generally among people with a disability is one of the factors contributing to their lower rate of labour market participation. What role vocational education and training (VET) plays in ameliorating this is the focus of this report. Using data from the Household, Income and Labour Dynamics of Australia surveys, the report…

  9. The Development of Technical and Vocational Education for Vietnam--A Case Study in Quality Improvement. Case Studies on Technical and Vocational Education in Asia and the Pacific. (United States)

    Nguyen, Duong

    This report provides a general overview of technical and vocational education in Vietnam, with information on the country's economy, climate, population, and culture. It summarizes the history and present practices of these types of education in the country, and suggests measures to improve the quality of teachers and instructors. Some of the…

  10. Collaborative learning in multicultural classrooms: a case study of Dutch senior secondary vocational education

    NARCIS (Netherlands)

    Tielman, Kennedy; Brok, Perry den; Bolhuis, Sanneke; Vallejo, Bertha


    Abstract This research presents a descriptive study regarding collaborative learning in a multicultural classroom at a vocational education school in The Netherlands. The study bridges two domains of research: research on culturally diverse learning environments - which has mostly concerned primary

  11. Acculturation, adaptation and multiculturalism among immigrant adolescents in junior vocational education

    NARCIS (Netherlands)

    Geel, Mitch van


    This thesis deals with the adaptation and acculturation of immigrant adolescents in junior vocational education. The adaptation of immigrant adolescents fits the notion of an 'immigrant paradox'. Maintaining aspects of the ethnic culture was found positively related to immigrant adolescents'

  12. Smart management in effective schools : effective management configurations in general and vocational education in the Netherlands

    NARCIS (Netherlands)

    Hofman, W.H.A.; Hofman, R.H.


    Purpose: In this study the authors focus on different (configurations of) leadership or management styles in schools for general and vocational education. Findings: Using multilevel (students and schools) analyses, strong differences in effective management styles between schools with different stud

  13. Smart management in effective schools : effective management configurations in general and vocational education in the Netherlands

    NARCIS (Netherlands)

    Hofman, W.H.A.; Hofman, R.H.


    Purpose: In this study the authors focus on different (configurations of) leadership or management styles in schools for general and vocational education. Findings: Using multilevel (students and schools) analyses, strong differences in effective management styles between schools with different


    Directory of Open Access Journals (Sweden)

    Mimi Mohaffyza Binti Mohamad


    Full Text Available Individual learning preferences and learning styles have been defined in several different ways according to theoretical models. In the context of vocational education, students have different characteristics compared to their counterparts in other fields of education, since learning orientation is more on job focused. However, the cognitive dimension is still need to be measured especially for learners at school level. This article addresses the relationship between learning styles and cognitive dimension in vocational education at secondary school level. Based on the Felder-Silverman Learning Styles and Cognitive Dimension Model, the authors highlighted students’ dimension of learning styles, students’ preferences on learning preference, and the conceptual of knowledge, skills and problem solving construct according to taxonomy. It is concluded that the vocational students are more incline to be visual learner. This learning preference and learning styles will contribute to their engagement on the concept of learning in vocational education.

  15. Discourses on Inclusion, Citizenship and Categorizations of "Special" in Education Policy: The Case of Negotiating Change in the Governing of Vocational Special Needs Education in Finland (United States)

    Hakala, Katariina


    This article deals with the negotiation process deciding the institutional organization of vocational special needs education and training in Finland. Traditionally, the state has been a strong actor in organizing vocational special needs education in Finland. At the beginning of 2009, however, all five state-maintained vocational special schools…

  16. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  17. Regenerating Technical and Vocational Education for Sustainable Youth Empowerment in Nigeria (United States)

    Ogbuanya, Tessy; Arimonu, Maxwell Onyenwe


    Technical and Vocational Education as enshrined in the Nigeria National Policy on Education is used as a comprehensive term referring to those aspects of the educational process involving, in addition to general education, the study of technologies and related sciences and the acquisition of practical skills, attitudes, understanding and knowledge…

  18. 34 CFR 400.1 - What is the purpose of the Vocational and Applied Technology Education Programs? (United States)


    ... Technology Education Programs? 400.1 Section 400.1 Education Regulations of the Offices of the Department of... APPLIED TECHNOLOGY EDUCATION PROGRAMS-GENERAL PROVISIONS § 400.1 What is the purpose of the Vocational and Applied Technology Education Programs? (a) The purpose of the Vocational and Applied Technology...

  19. Some issues influencing the planning and implementation of vocational education in Nepal (United States)

    Belbase, Lekh Nath; Jung, Loren B.


    This study attempted to analyze the perceptions of selected Nepali educators and administrators concerning certain basic issues which have been influencing the planning and implementation of vocational education in Nepal. The issues were determined after a review of the relevant research and literature. A questionnaire with 13 items was mailed to Nepali educators, administrators, experts and headmasters involved with vocational education. A total of 142 (53.18%) usable questionnaires were returned, and two groups of respondents were identified from the nature of their work, namely `planners' and `implementors'. The responses were interpreted using the analysis of variance statistical test (ANOVA). Findings indicated that planners and implementors, respectively, had significantly different attitudes concerning issues related to the characteristics of students, employment, and financial aspects of vocational programs. A higher proportion of planners than implementors dissented from the proposition that vocational education should be designed for less intelligent students. Implementors felt that the students could make vocational choices at the age of 14 or 15, whereas the planners were uncertain. The implementors were also more of the opinion that vocational education was too expensive for Nepal, while the planners tended to disagree with them about this. Regarding other matters, however, all the respondents indicated general agreement with the issues as stated.

  20. Introduction of a Quality Management System for Vocational Education and Training in Slovakia

    Directory of Open Access Journals (Sweden)

    Martin Podařil


    Full Text Available The issue of the quality of vocational education, school, teaching and learning of students should be in the interests of all participants in the education process. The quality of secondary school is the critical element in enhancing the attractiveness of vocational education in Slovakia. Finding an offcial scale that would provide such a information in Slovakia is unfortunately impossible. There is no system for evaluating the quality of vocational education and training (VET at vocational schools. There are no clearly defined criterias, rules or any standards. Speaking of an assessing the level of quality of vocational education on the base of existing outcomes in formal education such as monitoring, final exams, graduation exams is resulting in one-sided evaluation and does not address the systematic coherence and complexivity of this issue. An essential step os to create a functional system of evaluation of VET in Slovakia. The article describes importance of VET which can play a central role in preparing young people for work, developing the skills of adults and responding to the labour market needs of the economy and presents the project Model of the quality evaluation of vocational education and training at secondary vocational schools in Slovakia that is currently ongoing on many secondary vocational schools in western Slovakia and Austria. The aim of the project is to develop and apply an open, flexible and adaptable quality management system. The article not only presents indicators for evaluation but also the way how can be evaluated each of them. The effort of this project is also to create specialized portal with support services that provide transparent, clear and specific information from this area of interest. The introduction of the evaluation framework, the selection of indicators that take established criteria into consideration and assembling of the scale is therefore more than relevant and required

  1. Overconfidence of Vocational Education Students When Entering Higher Education (United States)

    Bowden, Mark P.; Abhayawansa, Subhash; Bahtsevanoglou, John


    Purpose: There is evidence that students who attend Technical and Further Education (TAFE) prior to entering higher education underperform in their first year of study. The purpose of this paper is to examine the role of self-efficacy in understanding the performance of students who completed TAFE in the previous year in a first year subject of…

  2. AERA Vocational Education Special Interest Group Proceedings (Chicago, Illinois, March 24-28, 1997). (United States)

    Jackman, Diane H., Ed.

    This proceedings consists of five research papers presented during the 1997 annual meeting of the American Educational Research Association (AERA). The papers were presented during the sessions of the AERA Vocational Education Special Interest Group. "Predictors of Occupational Choice among Rural Youth: Implications for Career Education and…

  3. 75 FR 34298 - Office of Special Education and Rehabilitative Services; Overview Information; Vocational... (United States)


    .... 75, No. 115 / Wednesday, June 16, 2010 / Notices#0;#0; ] DEPARTMENT OF EDUCATION Office of Special Education and Rehabilitative Services; Overview Information; Vocational Rehabilitation Services Projects for... Secretary for Special Education and Rehabilitative Services. BILLING CODE 4000-01-P ...

  4. The Shifting Relationship between Vocational and Higher Education in France and Germany: Towards Convergence? (United States)

    Powell, Justin J. W.; Graf, Lukas; Bernhard, Nadine; Coutrot, Laurence; Kieffer, Annick


    In Europe, the Bologna and Copenhagen Processes in higher education (HE) and vocational education and training (VET) are on the agenda, aiming to create a European educational area. Acknowledging important differences between countries, we compare the evolving relationship between HE and VET. We ask whether and how these two distinct…

  5. The Role of Vocational and Technical Education in the Industrialization of Malaysia. (United States)

    Mustapha, Ramlee B.

    The Industrialized Needs study identified the perceptions of Malaysian educators and employers regarding the role of vocational and technical education (VTE) in the economic development of Malaysia. The first survey used a random sample of 300 (276 responses) from the population of 4,316 VTE educators in public VT schools and polytechnics in…

  6. Non-Formal Vocational Education in Uganda: Practical Empowerment through a Workable Alternative (United States)

    Blaak, Marit; Openjuru, George L.; Zeelen, Jacques


    This article reflects on the potential of non-formal vocational education in Uganda to improve the quality of life of those excluded from formal education. Based on an exploration of humanizing development theorists Sen, Freire and Nyerere, together with two case studies, practical empowerment is described as a desirable outcome of education for…

  7. The Value Orientation of Higher Vocational Education Evaluation: A Textual Analysis of an Evaluation Program (United States)

    Wang, Yonglin; Wang, Zhanjun


    Education evaluation should be based on human development and revolve around educational institutions integrating two dimensions, the development needs of the nation and society, and the logic and laws of self-development. The value orientation of higher vocational education evaluation in China is actually expressed through enhancing quality…

  8. Beyond Competence: An Essay on a Process Approach to Organising and Enacting Vocational Education (United States)

    Billett, Stephen


    The competency-based approach to vocational education is premised on narrow and dated conceptions of human functioning, performance and development. Its adoption is more driven by administrative concerns about measurable outcomes than educational processes and outcomes. Informed by educational science and earlier debates, this article discusses…

  9. Entrepreneurship in Vocational Education: A Case Study of the Brazilian Context (United States)

    Stadler, Adriano; Smith, Anne M. J.


    Vocational entrepreneurship education is associated with specific techniques and teaching methods, including face-to-face student contact and knowledge alignment with labour market needs. The authors argue that entrepreneurship education provides particular benefits in different educational conditions and modes because it allows students to…

  10. Technical and Vocational Education in Nigeria: Issues, Challenges and a Way Forward (United States)

    Okoye, Reko; Arimonu, Maxwell Onyenwe


    Technical education, as enshrined in the Nigerian national policy on education, is concerned with qualitative technological human resources development directed towards a national pool of skilled and self reliant craftsmen, technicians and technologists in technical and vocational education fields. In Nigeria, the training of technical personnel…

  11. 34 CFR 403.115 - What appeal procedures must be established under the Secondary School Vocational Education Program? (United States)


    ... 34 Education 3 2010-07-01 2010-07-01 false What appeal procedures must be established under the Secondary School Vocational Education Program? 403.115 Section 403.115 Education Regulations of the Offices... § 403.115 What appeal procedures must be established under the Secondary School Vocational...

  12. The importance of vocational ethics in paramedic education, vocational ethics course for paramedics

    Directory of Open Access Journals (Sweden)

    Pakdemirli Ahu


    Full Text Available Ethics are rules of behaviors which morally good or bad. Bioethics is the study of ethics about by advances in biology and medicine. Health care providers should have knowledge about health professional ethics principles, public officials’ ethical behavior principles and ethical principles concerned about other legislation. They should find the required information to make logical, objective and accurate decisions where they may face with ethical problems in their professional life. Unfortunately in our country there isn’t any special vocational ethics course designed for paramedics. Our aim is to design a Vocational Ethics Course for Paramedics which includes all issues of bioethics.

  13. Neoliberal Economic Markets in Vocational Education and Training: Shifts in Perceptions and Practices in Private Vocational Education and Training in Melbourne, Australia (United States)

    Pasura, Rinos


    This article argues that the adoption of the competitive Vocational Education and Training (VET) markets in Australia resulted in shifts in institutional perceptions and practices. Using situated experiences and perspectives from quality assurance auditors, training managers, international students and VET teachers from seven commercial for-profit…

  14. Third Annual National Leadership Development Seminar for State Directors of Vocational Education. Articulation of Vocational Education Planning with Comprehensive State Planning. (United States)

    Ward, Darrell L., Comp.; Kazarian, Edward N., Comp.

    More than 100 state directors and other leaders from 45 states, the District of Columbia, and Puerto Rico attended a 3-day inservice leadership development seminar to exchange information and examine coordinated state planning as it relates to programing in vocational-technical education. Seminar activities included group work sessions, a…

  15. Narrow versus broad vocational education: labour market position and curriculum characteristics of specialised versus less specialised vocational education programmes in the Netherlands

    NARCIS (Netherlands)

    Coenen, J.B.; Heijke, J.A.M.; Meng, C.M.


    This paper compares narrow, or specialised, and broad, or less specialised, upper-secondary vocational education (VE) programmes in the Netherlands with respect to their graduates’ position in the labour market and how they assess a number of aspects of the programme they completed. The data used ar

  16. The Development of Technical and Vocational Education in Indonesia--A Case Study in Quality Improvement. Case Studies on Technical and Vocational Education in Asia and the Pacific. (United States)

    Bakri, Mohamad

    After its independence in 1969, Indonesia studied and analyzed its previous colonial system of technical and vocational education (TVE) and took steps to overcome the shortcomings. TVE was required to provide expansion of work opportunities and industrial development to promote national development. Until 1989, attention was given to further…




    The present article is intended to evaluate the quality of training and initial vocational qualification of young people, of professional courses secondary levels, with school accreditation and professional qualification of level IV. In that sense, it´s intended to know the perspective of students of professional courses in various areas of knowledge, their perceptions and expectations about the quality observed in a vocational education organization in Alentejo – Portugal through...

  18. Development of Vocational Secondary School Students Competitiveness for Studies in the European Area of Higher Education


    Olga Dementjeva


    ABSTRACT OF THE PROMOTION THESIS DEVELOPMENT OF VOCATIONAL SECONDARY SCHOOL STUDENTS’ COMPETITIVENESS FOR STUDIES IN THE EUROPEAN AREA OF HIGHER EDUCATION The promotion thesis „Development of Vocational Secondary School Students’ Competitiveness for Studies in the European Area of Higher Education” in the field of general pedagogy of pedagogical science has been worked out by Olga Dementjeva under the supervision of Dr. chem. Professor Andrejs Rauhvargers at the Depart...

  19. A comparative study of classroom and online distance modes of official vocational education and training.

    Directory of Open Access Journals (Sweden)

    Miguel Vicente López Soblechero

    Full Text Available The study discussed in this paper had two principal objectives. The first was to evaluate the distance model of official vocational education and training offered by means of a virtual learning platform. The second was to establish that both on-site classroom and online distance modes of vocational education and training can be seen as complementary in terms of responding to the majority of modern educational needs. We performed a comparative study using data and results gathered over the course of eleven academic years for 1,133 of our students enrolled in an official vocational education and training program, leading to the awarding of a certificate as an Administrative Management Expert. The classes were offered by the Alfonso de Avellaneda Vocational Education and Training School, located in the city of Alcalá de Henares near Madrid, Spain. We offered classes both in traditional classroom mode and through online distance learning. This paper begins with a descriptive analysis of the variables we studied; inferential statistical techniques are subsequently applied in order to study the relationships that help form the basis for the conclusions reached. This study's results provide evidence that a broad offering of vocational education and training opportunities will facilitate access to such learning for students who require it, regardless of their age, employment status, or personal circumstances, with the online distance mode playing a fundamental role while also yielding results equivalent to those observed for classroom instruction.

  20. A comparative study of classroom and online distance modes of official vocational education and training. (United States)

    López Soblechero, Miguel Vicente; González Gaya, Cristina; Hernández Ramírez, Juan José


    The study discussed in this paper had two principal objectives. The first was to evaluate the distance model of official vocational education and training offered by means of a virtual learning platform. The second was to establish that both on-site classroom and online distance modes of vocational education and training can be seen as complementary in terms of responding to the majority of modern educational needs. We performed a comparative study using data and results gathered over the course of eleven academic years for 1,133 of our students enrolled in an official vocational education and training program, leading to the awarding of a certificate as an Administrative Management Expert. The classes were offered by the Alfonso de Avellaneda Vocational Education and Training School, located in the city of Alcalá de Henares near Madrid, Spain. We offered classes both in traditional classroom mode and through online distance learning. This paper begins with a descriptive analysis of the variables we studied; inferential statistical techniques are subsequently applied in order to study the relationships that help form the basis for the conclusions reached. This study's results provide evidence that a broad offering of vocational education and training opportunities will facilitate access to such learning for students who require it, regardless of their age, employment status, or personal circumstances, with the online distance mode playing a fundamental role while also yielding results equivalent to those observed for classroom instruction.

  1. Trade and Technical. Volume II. Access Skills. Vocational Readiness Skills. Missouri LINC. Assessing Vocational Education. (United States)

    Missouri Univ., Columbia. Dept. of Practical Arts and Vocational-Technical Education.

    This document contains trade and industrial occupations-related materials to help teachers and parents teach access skills to Missouri junior high and high school special needs students who want to pursue a vocational program in auto body repair, auto mechanics, building maintenance and custodial work, diesel mechanics, machinist, small engine…

  2. Re-Contextualizing Vocational Didactics in Norwegian Vocational Education and Training (United States)

    Nore, Haege


    This article explores teachers and trainers didactical practices in different contexts in Norwegian VET: schools and workplaces. With the introduction of e-resources and e-portfolios in VET, learners as well as teachers and trainers experience a more hybrid learning-arena, which claims for a re-contextualization of vocational didactics as well as…

  3. Reflection on Quality Assurance System of Higher Vocational Education under Big Data Era

    Directory of Open Access Journals (Sweden)

    Jiang Xinlan


    Full Text Available Big data has the features like Volume, Variety, Value and Velocity. Here come the new opportunities and challenges for construction of Chinese quality assurance system of higher vocational education under big data era. There are problems in current quality assurance system of higher vocational education, such as imperfect main body, non-formation of internally and externally incorporated quality assurance system, non-scientific security standard and insufficiency in security investment. The construction of higher vocational education under big data era requires a change in the idea of quality assurance system construction to realize the multiple main bodies and multiple layers development trend for educational quality assurance system, and strengthen the construction of information platform for quality assurance system.

  4. Vocational Education and Training for the Hotel and Catering Industry in the Federal Republic of Germany. Report of a Visiting Party. Studies in Vocational Education and Training in the Federal Republic of Germany. Number Eight. (United States)

    Ripper, Chris, Ed.; Russell, Russ, Ed.

    A party of vocational educators from the United Kingdom (UK) traveled to the Federal Republic of Germany (FRG) to examine West German vocational education and training for the hotel and catering industry. During the study, the investigators examined the training with respect to regulations, the content of training, and the structure of the…

  5. Vocational Education and Training for the Hotel and Catering Industry in the Federal Republic of Germany. Report of a Visiting Party. Studies in Vocational Education and Training in the Federal Republic of Germany. Number Eight. (United States)

    Ripper, Chris, Ed.; Russell, Russ, Ed.

    A party of vocational educators from the United Kingdom (UK) traveled to the Federal Republic of Germany (FRG) to examine West German vocational education and training for the hotel and catering industry. During the study, the investigators examined the training with respect to regulations, the content of training, and the structure of the…

  6. Informing Policy and Practice in Australia's Vocational Education and Training Sector: Reflections and Futures. Proceedings of the 25th Anniversary Forum of the National Centre for Vocational Education Research (Adelaide, South Australia, Australia, March 21, 2007) (United States)

    Curtin, Penelope, Ed.; Loveder, Phil, Ed.


    To mark the occasion of its 25th anniversary, the National Centre for Vocational Education Research (NCVER) brought together policy, industry and academic leaders to reflect on the role that research and statistics have played in the development of Australia's vocational education and training (VET) sector. This publication includes the original…


    Directory of Open Access Journals (Sweden)

    Evald F. Zeer


    , the purpose of tutor guiding is maintenance of personal and professional development of trainees with due consideration of their individual psychological features and socially-professional specificity. Scientific novelty. The authors single out and summarize the methodological background necessity of psychological guiding process of the development and implementation of individually-oriented professional education. The semantic value of such guiding implementation developed by the authors performs structural and substantial model of the process. The requirement for the new methodology of vocational training based on network interaction of members of education is highlighted. The new network is considered as a platform technology of multidimensional professional of a specialist. Practical significance. The authors believe that the research findings will promote the approval of foresight technology through designing of individual educational trajectories; also the research implementations can be helpful for the tutors supervising process of professional development of trainees. 


    Directory of Open Access Journals (Sweden)

    Evald F. Zeer


    , the purpose of tutor guiding is maintenance of personal and professional development of trainees with due consideration of their individual psychological features and socially-professional specificity. Scientific novelty. The authors single out and summarize the methodological background necessity of psychological guiding process of the development and implementation of individually-oriented professional education. The semantic value of such guiding implementation developed by the authors performs structural and substantial model of the process. The requirement for the new methodology of vocational training based on network interaction of members of education is highlighted. The new network is considered as a platform technology of multidimensional professional of a specialist. Practical significance. The authors believe that the research findings will promote the approval of foresight technology through designing of individual educational trajectories; also the research implementations can be helpful for the tutors supervising process of professional development of trainees. 

  9. Study on English MOOC in Vocational Colleges from Educational Ecolo-gy Theory

    Institute of Scientific and Technical Information of China (English)



    From the programmed instruction method in the 1960s and 1970s to the emergence of open courses at the beginning of the 21st century and then to the fast growth of massive open online course(MOOC),online education never stops its pace on the road of research and practice with the continuous upgrade of the Internet.As the hot education revolutionary,MOOC has aroused a large number of researchers'attention.So how English MOOC develop in vocational colleges? Is there any education theory contributing to MOOC's development? What's the special MOOC mode for English in vocational colleges? These are the research topics of this thesis.

  10. The role and meaning of vocations in the transition from education to work

    DEFF Research Database (Denmark)

    Jørgensen, Christian Helms


    The purpose of this paper is to explore current patterns of transition from education to work in the Dual System of VET in Denmark. First it will explore some of the significant changes that have taken place in the transition process. Then it will discuss two dimensions of the role of vocations...... and occupations in the transition process. One dimension is to connect the edu-cational system with the employment system. The other is to offer imagined future identities for young people entering vocational education. The last part of the paper will present some findings from two research projects on the role...

  11. Evaluation of transition in Dutch senior secondary vocational education

    NARCIS (Netherlands)

    Lazonder, A.W.; Jong, F.P.C.M. de


    Survey responses from 55 Dutch agricultural vocational schools show that administrators believe that transition, the ability of students to change between training modes or qualification levels easily, has enhanced the flexibility of the qualification system developed under recent national reforms.

  12. Vocational Education and the Training of Industrial Labour in Brazil. (United States)

    Moura Castro, Claudio de


    Focusing on issues related to the training of industrial workers in Brazil, this article reports the findings of a study which evaluated the effectiveness of vocational training offered by the National Industrial Apprenticeship Service. (LRA)

  13. Emotional Education in English Teaching in Vocational Colleges

    Institute of Scientific and Technical Information of China (English)



    English teaching in vocational colleges must manifest its essence and help students feel the spirit of the language.Looking from the humanism of language,we cannot abandon the humanity attribute of the language,study environment and the humanities concern.Therefore,we must pay more attention to students'emotion,conduct a series of humanities concern throughout the whole teaching process in vocational colleges.

  14. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  15. MICRO-VERS. Micro-computer Software for the Vocational Education Reporting System. Version 3.1. Radio Shack TRS-80 Model III. (United States)

    Illinois State Board of Education, Springfield. Dept. of Adult, Vocational and Technical Education.

    This manual is intended to accompany a software system for the TRS-80 Model III computer that is designed to aid local districts in completing vocational education enrollment claims and Vocational Education Data System (VEDS) reports. Part I, Introduction, gives a brief overview of the Microcomputer Vocational Education Reporting System…

  16. MICRO-VERS. Micro-computer Software for the Vocational Education Reporting System. User's Guide and Reference Manual. Version 3.1. Apple II. (United States)

    Illinois State Board of Education, Springfield. Dept. of Adult, Vocational and Technical Education.

    This manual is intended to accompany a software system for the Apple II microcomputer that is designed to aid local districts in completing vocational education enrollment claims and Vocational Education Data System (VEDS) reports. Part I, Introduction, gives a brief overview of the Microcomputer Vocational Education Reporting System (MICRO-VERS),…

  17. A Pennsylvania State Plan for the Administration of Vocational-Technical Education Programs. Part I--Administrative Provisions. Fiscal Year 1974. (United States)

    Pennsylvania State Dept. of Public Instruction, Harrisburg. Bureau of Vocational, Technical, and Continuing Education.

    The first of two parts, this portion concerns itself with administrative provisions according to these categories: general provisions, fiscal control and funding accounting procedure, State vocational education programs, vocational education programs for the disadvantaged, vocational education research and personnel training, exemplary programs…

  18. Exploring the Misrepresentation of Nigerian Women in Technical and Vocational Education in Polytechnic Institution (United States)

    Akor, Robert; Bakar, Ab Rahim Bin; Hamzah, Azim B. Hj.; Rashid, Abdullah Bin Mat


    Nigerian government is making frantic efforts to drive her economy by laying emphasis on technical and vocational education to enable her compete favorably in the global market. Emphasis of government is in Polytechnic education where skills for self-reliant and economic growth are a priority. However, women are not embracing this opportunity by…

  19. R&D Outcomes: An Examination of Product Distribution, Use and Impact in Vocational Education. (United States)

    Hull, William L.

    A study examined the distribution, use, and impact of vocational education research and development (R&D) products developed with Federal monies during fiscal years 1981 and 1982. Distribution data for the study were obtained from responses to questionnaires from 22 of the 32 states with products accepted by the Educational Resources…

  20. Technical and Vocational Education Transformation in Malaysia: Shaping the Future Leaders (United States)

    Sauffie, Nur Fatin Binti Mohd


    In accordance with the concept of lifelong education, the Technical and Vocational Education (TVE) system is one flaw of that is recognized or known as a system whose role is to develop individuals with high technical skills as desired by the industry nowadays. Changing times and technology development at this time require changes to the TVET…

  1. Future Expert’s Competitiveness as a Determinant Factor of Higher Vocational Education


    Irina A. Levitskaya


    The value and importance of such indices of competitive training of modern expert, as strong qualifications, moral and social maturity, mobility and readiness for innovative activity increases in today’s world. Implementation of this approach in higher vocational education requires interdisciplinary integrative approach, enabling the integrity of general educational training of modern specialists.

  2. Despite Its Many Benefits, Vocational Education and Training Lacks Esteem. Briefing Note (United States)

    Cedefop - European Centre for the Development of Vocational Training, 2011


    While the benefits of education have been widely researched, little attention has been paid to the specific benefits of vocational education and training (VET). These benefits are shared by individuals and enterprises as well as the economy and society more generally. Training provided by an enterprise increases workers' satisfaction and increases…

  3. Commonalities in the Professional Education Competencies of Selected Community College Vocational Instructors. (United States)

    Lindahl, Donald Gene

    To determine the nature of common professional education competencies of community college vocational teachers, 160 teachers from four western states and from program areas of agriculture, health, home economics, and service occupations were administered a professional education competency questionnaire. Analysis of data revealed that there was no…

  4. Community-Based Vocational Education: Guidelines for Complying with the Fair Labor Standards Act. (United States)

    Simon, Marlene; Halloran, William


    This paper describes guidelines issued by the U.S. departments of Education and Labor to ensure that community-based vocational education programs operate in compliance with the Fair Labor Standards Act. Federal guidelines are clarified in terms of student eligibility (especially as it relates to disabilities), documentation requirements, program…

  5. Improving Vocational Education for Mentally Retarded Persons: A Conversation with L. Allen Phelps. (United States)

    Thomas, M. Angele


    Through an interview format, L. A. Phelps identifies three major issues confronting vocational educational programing for the mentally retarded in the 1980s; discusses change in the roles of the federal government, professionals, and professional associations; and makes recommendations for interagency cooperation in education and employment of the…

  6. Collaborative Learning in Multicultural Classrooms: A Case Study of Dutch Senior Secondary Vocational Education (United States)

    Tielman, Kennedy; den Brok, Perry; Bolhuis, Sanneke; Vallejo, Bertha


    This research presents a descriptive study regarding collaborative learning in a multicultural classroom at a vocational education school in The Netherlands. The study bridges two domains of research: research on culturally diverse learning environments--which has mostly concerned primary and general secondary education--and studies on…

  7. Internship in Vocational Education and Training: Stakeholders' Perceptions of Its Organisation (United States)

    Akomaning, Edward; Voogt, Joke M.; Pieters, Jules M.


    Polytechnic education in Ghana is an offshoot of technical and vocational education and training, which makes internship a sine qua non for its students. The implementation of internships in the departments of hotel catering and institutional management in Ghanaian polytechnics is examined in this study. The perceptions of the stakeholders suggest…

  8. Vocational Education and Training Manager Discursive Practices at the Frontline: Alternative Possibilities in a Victorian Setting (United States)

    Foley, Annette


    This article looks at how the neoliberal reform process is affecting the professional identity of frontline managers in the Australian vocational education and training sector. The article examines how frontline managers are required to negotiate their working practices between their understandings and experiences as educators and the new…

  9. Marketization in the Dutch vocational education and training sector: hybrids and their behaviour

    NARCIS (Netherlands)

    Honingh, M.; Karsten, S.


    Significant educational reforms have resulted in Dutch schools for vocational education and training having to operate in a complex, more market-oriented environment, as if they were entrepreneurial organizations while remaining in the public sector. That makes these schools hybrid organizations. To

  10. Approaches to ICT-Enhanced Teaching in Technical and Vocational Education: A Phenomenographic Perspective (United States)

    Khan, Md. Shahadat Hossain; Markauskaite, Lina


    This paper presents the results of a study undertaken from a phenomenographic perspective, which examines teachers' approaches to information communication technology (ICT)-enhanced teaching in vocational tertiary education. Twenty-three teachers from three Australian Technical and Further Education (TAFE) institutions participated in…

  11. Report on the Vocational Education and Training System in Hungary. National Observatory Country Report, 1999. (United States)

    Bocz, Tamas Kopeczi

    An intrinsic part of the transition to a modern market economy in Hungary has been the restructuring of the vocational education and training (VET) system. A positive side effect of the socioeconomic transition is the emergence of human resources development (HRD). The transition process has been successful in the school-based education system,…

  12. The Unknown Story: Vocational Education for Adults in Sweden 1918-1968 (United States)

    Nilsson, Anders


    Adult education is often defined to emphasise cultural and societal development. This paper proposes that the concept should be more inclusive and that vocational education and training for adults has played a bigger role than is usually recognised. This has not been subject to much research and basic facts are often virtually unknown. In this…

  13. Vocational Education in Algeria, Egypt, and Morocco: The Crisis and its Lessons. (United States)

    Salmi, Jamil


    Examines developments in vocational and technical education systems in Algeria, Egypt, and Morocco. Argues each system faces critical problems resulting from demographic pressures, educational demand, lack of funding, and job placement difficulties. Recommends programs should reflect industry's needs, urging integration between general and…

  14. Non-formal vocational education in Uganda : Practical empowerment through a workable alternative

    NARCIS (Netherlands)

    Blaak, Marit; Openjuru, George L.; Zeelen, Jacques


    This article reflects on the potential of non-formal vocational education in Uganda to improve the quality of life of those excluded from formal education. Based on an exploration of humanizing development theorists Sen. Freire and Nyerere, together with two case studies, practical empowerment is de

  15. The Indian Vocational Education and Training (VET) System: Status, Challenges, and Options (United States)

    Kotamraju, Pradeep


    India is at the cusp of becoming an economic powerhouse. For that to happen, however, the country needs to alter its workforce education system by reengineering the Indian Vocational Education and Training (VET) System. India's VET strategy includes creating basic work-centered common curriculum for the unskilled; developing a more flexible…

  16. Collaborative Learning in Multicultural Classrooms: A Case Study of Dutch Senior Secondary Vocational Education (United States)

    Tielman, Kennedy; den Brok, Perry; Bolhuis, Sanneke; Vallejo, Bertha


    This research presents a descriptive study regarding collaborative learning in a multicultural classroom at a vocational education school in The Netherlands. The study bridges two domains of research: research on culturally diverse learning environments--which has mostly concerned primary and general secondary education--and studies on…

  17. Vocational Education and Active Citizenship Behavior in Cross-National Perspective

    NARCIS (Netherlands)

    H.G. van de Werfhorst


    Educational systems should provide students with job-relevant skills as well as prepare students for active citizenship. These two core functions of schools may be in conflict with each other, as diversified and vocationally specific educational systems usually do well in terms of labor market prepa

  18. Comparison of Economic Benefits of University and Vocational High School Education among Different Majors in Turkey (United States)

    Aydede, Yigit; Orbay, Benan Zeki


    This paper aims to develop a better understanding about the labour market dynamics behind the unparalleled demand in higher education and dragging growth rates in vocational high school (VHS) education in Turkey. While estimating labour market outcomes of fields of study has been the subject of many studies in the West, such studies are lacking in…

  19. The Cuban Vocational Education and Training System and Its Current Changes (United States)

    Wolf, Stefan; Penton, Felipe A. Hernandez; Marin, Anna Lidia Beltran; Romero, Osvaldo


    The main purpose of the article is to inform about the Cuban Vocational Education and Training System. Based on the analyse of different studies, on expert interviews and on field experiences the authors give a clear overview of the Cuban VET-System. This description is embedded in the presentation of the general education system in Cuba and in a…

  20. Globalization and Its Impact on Technical-Vocational Education and Training in Malaysia. (United States)

    Mustapha, Ramlee; Abdullah, Abu

    In Malaysia, vocational education and training (VET) is accorded a high priority in the nation's industrialization agenda. With the vision of becoming an industrialized nation in 2020, Malaysia must prepare a well-educated, skilled, and competitive workforce. The government has placed human resource development as a major emphasis and strategic…

  1. Students' Preferred Characteristics of Learning Environments in Vocational Secondary Education (United States)

    Placklé, Ingeborg; Könings, Karen D.; Jacquet, Wolfgang; Struyven, Katrien; Libotton, Arno; van Merriënboer, Jeroen J. G.; Engels, Nadine


    If teachers and teacher educators are willing to support the learning of students, it is important for them to learn what motivates students to engage in learning. Students have their own preferences on design characteristics of powerful learning environments in vocational education. We developed an instrument - the Inventory Powerful Learning…

  2. Vocational Education and Active Citizenship Behavior in Cross-National Perspective

    NARCIS (Netherlands)

    van de Werfhorst, H.G.


    Educational systems should provide students with job-relevant skills as well as prepare students for active citizenship. These two core functions of schools may be in conflict with each other, as diversified and vocationally specific educational systems usually do well in terms of labor market prepa

  3. CLIL in Junior Vocational Secondary Education: Challenges and Opportunities for Teaching and Learning (United States)

    Denman, Jenny; Tanner, Rosie; de Graaff, Rick


    In many countries, Content and Language Integrated Learning (CLIL) in secondary education, whether by default or design, focuses primarily on high-achieving students. This paper presents a study of CLIL programs for a different population: junior vocational students in the lower streams of secondary education in the Netherlands. On the basis of a…

  4. Adult Learning in Vocational Education. EEE700 Adults Learning: The Changing Workplace A. (United States)

    Little, David; And Others

    This monograph is part of the study materials for the one-semester distance education unit, Adults Learning: The Changing Workplace A, in the Open Campus Program at Deakin University (Australia). It explores four complex and interrelated issues: how vocational educators view their own practice, the characteristics and aspirations that distinguish…

  5. Participation in Formal Technical and Vocational Education and Training Programmes Worldwide: An Initial Statistical Study (United States)

    UNESCO-UNEVOC International Centre for Technical and Vocational Education and Training, 2006


    There is a common perception that technical and vocational education and training (TVET) is diversifying and expanding in terms of its supply and demand. Practitioners and policymakers often believe that educational systems are offering a wider array of programmes at different levels and in various fields of study. They also assume that these…

  6. Technical and Vocational Education and Training (TVET): Understanding the Nigerian Experience (United States)

    Dike, Victor Ebipuruonwu


    The descriptive mixed-methods study explores and describes the challenges and prospects of the growth and development of technical and vocational education and training (TVET) schools and science-based technology education in Nigeria. It is not understood how Nigerians in the United States perceive the impacts of governmental policies on education…

  7. Internship in Vocational Education and Training: Stakeholders' Perceptions of Its Organisation (United States)

    Akomaning, Edward; Voogt, Joke M.; Pieters, Jules M.


    Polytechnic education in Ghana is an offshoot of technical and vocational education and training, which makes internship a sine qua non for its students. The implementation of internships in the departments of hotel catering and institutional management in Ghanaian polytechnics is examined in this study. The perceptions of the stakeholders suggest…

  8. Greek Technical-Vocational Education (1870-1940): Intentions and Failed Aspirations (United States)

    Kiprianos, Pandelis


    From 1870 until the outbreak of the Second World War there were various attempts at educational reform in Greece, one of the most significant being the intention to establish a national technical-vocational education. The aim of this study is to examine why such a reform was deemed necessary and yet failed to be implemented. The first part…

  9. The Research on Several Critical Issues in the Development of Higher Vocational Education (United States)

    Long, Yufei; Zhang, Tingqin


    Based on the pondering over the establishment of a large educational concept, the implementation of "two-certificate" system, the training of "Double-Professional title teacher staff and some other issues in the development of the vocational and technical education personnel training mode, this paper discusses the issues about their…

  10. The (Un)Attractiveness of Vocational and Technical Education: Theoretical Background (United States)

    Lovšin, Miha


    This paper considers the problem of the lack of attractiveness of vocational and technical education via a review of legislation on counselling practices, implementing documents, and the social factors by means of which the education system can influence the individual's decision. It is apparent that legislation regulating the organisation and…

  11. Rates of Return to Investments in Formal and Technical/Vocational Education in Singapore. (United States)

    Sakellariou, Chris


    Explores relationship between education and earnings in Singapore. Uses Labor Force data to obtain estimates of private returns to investment in formal and technical/vocational education. Some results confirm earlier patterns from other countries, whole others make Singapore a world outlier, with very high private returns to schooling in relation…

  12. General Education vs. Vocational Training: Evidence from an Economy in Transition. NBER Working Paper No. 14155 (United States)

    Malamud, Ofer; Pop-Eleches, Cristian


    This paper examines the relative benefits of general education and vocational training in Romania, a country which experienced major technological and institutional change during its transition from Communism to a market economy. To avoid the bias caused by non-random selection, we exploit a 1973 educational reform that shifted a large proportion…

  13. CLIL in Junior Vocational Secondary Education: Challenges and Opportunities for Teaching and Learning (United States)

    Denman, Jenny; Tanner, Rosie; de Graaff, Rick


    In many countries, Content and Language Integrated Learning (CLIL) in secondary education, whether by default or design, focuses primarily on high-achieving students. This paper presents a study of CLIL programs for a different population: junior vocational students in the lower streams of secondary education in the Netherlands. On the basis of a…

  14. Applying the Fair Labor Standards Act When Placing Students into Community-Based Vocational Education. A Trainer's Manual. (United States)

    Love, Laura

    This manual, intended as a training module for professionals involved in providing community-based vocational education, provides a thorough review of the Fair Labor Standards Act (FLSA) as it applies to vocational education, training, and employment of students. Individual sections address the following topics: (1) relationship of the FLSA to…

  15. What makes teacher teams in a vocational education context effective? A qualitative study of managers' view on team working

    NARCIS (Netherlands)

    Truijen, K.J.P.; Sleegers, P.J.C.; Meelissen, Martina R.M.; Nieuwenhuis, Loek


    Purpose – At a time when secondary vocational education is implementing competence-based education (CBE) on a large scale, to adapt to the needs of students and of the labour market in a modern society, many vocational schools have recognised that interdisciplinary teacher teams are an important

  16. The Inspiration Given by the Successful Practice of Development of Higher Vocational Education in the Developed Countries (United States)

    Wu, Gaoling


    Higher vocational education is the product of economic development, scientific and technological progress. If the country does not have a well-developed vocational education, it is impossible to make a good advanced science and technology into productive forces, it is also impossible to achieve economy development in a high speed. In turn, powers…

  17. Blended Learning in Vocational Education: Teachers' Conceptions of Blended Learning and Their Approaches to Teaching and Design (United States)

    Bliuc, Ana-Maria; Casey, Grant; Bachfischer, Agnieszka; Goodyear, Peter; Ellis, Robert A.


    This paper presents research exploring teachers' experiences of using blended learning in vocational education. Teachers involved in designing and teaching using blended learning from a major Australian vocational education provider participated in the study. They received open-ended questionnaires asking to describe their conceptions of blended…

  18. Vocations: The Link between Post-Compulsory Education and the Labour Market. What the Research Says For... Industry (United States)

    Wheelahan, Leesa; Buchanan, John; Yu, Serena


    This summary brings together the relevant key findings for industry from the research program "Vocations: The Link between Post-Compulsory Education and the Labour Market." The program was comprised of three different strands: (1) pathways from VET in Schools, (2) pathways within and between vocational education and training (VET) and…

  19. What makes teacher teams in a vocational education context effective? A qualitative study of managers' view on team working

    NARCIS (Netherlands)

    Truijen, K.J.P.; Sleegers, P.J.C.; Meelissen, M.R.M.; Nieuwenhuis, A.F.M.


    Purpose – At a time when secondary vocational education is implementing competence-based education (CBE) on a large scale, to adapt to the needs of students and of the labour market in a modern society, many vocational schools have recognised that interdisciplinary teacher teams are an important con

  20. Students’ personal professional theories in competence-based vocational education: the construction of personal knowledge through internalisation and socialisation

    NARCIS (Netherlands)

    Schaap, Harmen; De Bruijn, Elly; Van der Schaaf, Marieke; Kirschner, Paul A.


    Schaap, H., De Bruijn, E., Van der Schaaf, M. F., & Kirschner, P. A. (2009). Students' personal professional theories in competence-based vocational education: the construction of personal knowledge through internalisation and socialisation. Journal of Vocational Education & Training, 61(4), 481-494

  1. Impacts on Schools and Team Members of Participating in a Wisconsin Secondary Vocational Education Evaluation during 1978-80. (United States)

    Klitzke, Elizabeth

    A study assessed impacts on 58 schools and 286 On-Site Visitation team members of participating in a Wisconsin Secondary Vocational Education Evaluation during 1978-80. Quantitative data were collected through 402 questionnaires; 116 were sent to Local Vocational Education Coordinators (LVECs), and 286 to On-Site team members. Qualitative data…

  2. Strong Vocational Education--A Safe Way to the Labour Market? A Case Study of the Czech Republic (United States)

    Straková, Jana


    Background: In its communications, the European Commission stresses the importance of vocational education and endorses apprenticeship training. Educational systems that have dual tracks of academic alongside vocational learning routes have been shown to generate better labour market outcomes for school leavers and smooth the school-to-work…

  3. Blended Learning in Vocational Education: Teachers' Conceptions of Blended Learning and Their Approaches to Teaching and Design (United States)

    Bliuc, Ana-Maria; Casey, Grant; Bachfischer, Agnieszka; Goodyear, Peter; Ellis, Robert A.


    This paper presents research exploring teachers' experiences of using blended learning in vocational education. Teachers involved in designing and teaching using blended learning from a major Australian vocational education provider participated in the study. They received open-ended questionnaires asking to describe their conceptions of blended…

  4. Students’ personal professional theories in competence-based vocational education: the construction of personal knowledge through internalisation and socialisation

    NARCIS (Netherlands)

    Schaap, Harmen; De Bruijn, Elly; Van der Schaaf, Marieke; Kirschner, Paul A.


    Schaap, H., De Bruijn, E., Van der Schaaf, M. F., & Kirschner, P. A. (2009). Students' personal professional theories in competence-based vocational education: the construction of personal knowledge through internalisation and socialisation. Journal of Vocational Education & Training, 61(4), 481-494

  5. What Makes Teacher Teams in a Vocational Education Context Effective?: A Qualitative Study of Managers' View on Team Working (United States)

    Truijen, K. J. P.; Sleegers, P. J. C.; Meelissen, M. R. M.; Nieuwenhuis, A. F. M.


    Purpose: At a time when secondary vocational education is implementing competence-based education (CBE) on a large scale, to adapt to the needs of students and of the labour market in a modern society, many vocational schools have recognised that interdisciplinary teacher teams are an important condition for this implementation. In order to…

  6. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  7. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  8. Effects of Human Resources Development Through Vocational Education Curriculum on the Academic Achievements of the Students in Vocational Schools: The Case of Erzincan University

    Directory of Open Access Journals (Sweden)

    Durmuş ÖZDEMİR


    Full Text Available Qualified and productive labor shortage is one of the main problems in today's business world. This situation shows the importance of vocational and technical education for business life and economy of the countries. Therefore, it is important to note that the vocational education programs should ensure the coherence between students' existing knowledge and expectations of the business world. The purpose of this study is to analyze the effects of new education program (HRD-VET; Human Resources Development through Vocational Education and Training on the academic success of vocational school students. Differently from the literature, this research is important for the reason that it is performed on either the students studying with former educational program or the students studying new İKMEP educational program. The participants of the study are composed of 167 students studying at Computer Programming program in Erzincan University. In this study, we used comparative method of research technique and the average point of the students' grade is analyzed with t-test. The results of the study illustrated that İKMEP education program has positive effect on student academic success for students who are admitted to the vocational school without entrance exam.

  9. Get a vocation: keeping on top of studies Reducing the drop-out rate in vocational upper secondary education and training



    European business life is in constant need of a skilled labour force; however, in some sectors there is starting to be a shortage of people with good skills. One of the problems is the drop-out rate in vocational upper secondary education and training. The Finnish Ministry of Education commissioned a study in 2006–2007 on reducing the number of drop-outs, GET A VOCATION – KEEPING ON TOP OF STUDIES. 14 education providers whose educational institutions had a low drop-out percent...

  10. Vocational Dual Education System: comparison between the German model and the new Spanish vocational training

    Directory of Open Access Journals (Sweden)

    Laura Rego Agraso


    Full Text Available The German dual system of vocational training has been object of transfer in some countries all over the world, among them Spain. Indeed, in this article we try to clarify the key elements in the adapting process of this Dual System to our country, analyzing its chances of success. To do this, we contribute a descriptive study of the main elements of the German Dual System. Then, the focus will be in the changes in our country, from the LOMCE project to the legislation governing apprenticeship and training. As a kind of discussion, we pretend to clarify how cultural and organizational elements of the production system have a strongly influence in the chances of success on the Vocational Training reform policy initiatives. Finally, we completed a series of proposals for action that would contribute to the employment and an increase in the qualification among Spanish young people.

  11. An Identification and Analysis of the Existing Needs for Teacher Aides in Programs of Vocational Education in Agriculture and a Suggested Program for Teacher Aide Education. (United States)

    Durkee, James R.

    This study identified and analyzed the various aspects of the responsibilities and education of teacher aides assigned to work in programs of agricultural vocational education. Vocational agricultural teachers, high school administrators, and state supervisors of agricultural education in the United States were surveyed to obtain information on…

  12. SWOT Analysis of China's Vocational Education%我国职业教育的SWOT分析

    Institute of Scientific and Technical Information of China (English)



    Vocational education schools implementing market operations is a key to adapt to the socialist market economy system and develop vocational education, is also a necessary prerequisite for maintaining prosperity of vocational education. This paper uses the market view to examine educational issues, introduces the market philosophy into education, makes organic integration between the law of value and the education law, in a dynamic market system to study, through the SWOT analysis method, and provides development strategy for all types of vocational education.%职业教育学校实行市场化经营,是适应社会主义市场经济机制发展职业教育的关键,也是职业教育保持兴旺发达的必要前提。用市场的观点审视教育问题,将市场经营理念引入教育,使价值规律与教育规律有机地整合,在一个动态的市场系统中来研究,通过SWOT分析方法,为各类职业教育提供其发展战略思路。

  13. “Professional, approachable, and fair” – Students’ perceptions of the vocational education teacher’s authority

    Directory of Open Access Journals (Sweden)

    Anne Koski-Heikkinen


    Full Text Available How do students perceive vocational education teachers and their authority? The purpose of this study was to describe the vocational education teacher’s authority and the basis of authority relationship. Finnish vocational education students (N = 65 were recruited in this study. They were asked to write about vocational education teachers through a method of empathy-based stories. The students depicted the authority relationship by describing a good or unsuccessful teacher’s actions in vocational teaching situations. The data were analyzed with qualitative content analysis method. In the students’ writings, the teacher authority were viewed from four dimensions that were pedagogical skills, professional expertise, social skills, and personal characteristics. Based on the results, a typology of vocational education teacher’s authority was created and presented in this article. The typology can be used in teacher training and as a tool for vocational education teachers to contemplate on their position and to develop a functional authority relationship with vocational education students.

  14. Restrictive Factors of Vocational Education Development in Cultivation of Rural Practical Skilled Personnel and Countermeasures

    Institute of Scientific and Technical Information of China (English)

    Ning; WANG; Fang; LIU


    Kunming City is accelerating the process of agricultural modernization,industrialization,informationization and ecological development. In this process,it needs speeding up building new high level and advanced rural practical skilled personnel team suitable for development demand. By empirical analysis method,this paper discussed the factors restricting vocational education in cultivation of rural practical skilled personnel. Then,it came up with countermeasures in cultivation objective of rural vocational education,arrangement of specialized disciplines,key development tasks,and establishment of diversified investment system.

  15. Connecting Secondary Education to Higher Vocational Education Smoothly and Accelerating the Construction of Modern Vocational Education System%畅通中高职衔接加快建设现代职业教育体系

    Institute of Scientific and Technical Information of China (English)

    顾志刚; 吴建平


    畅通中高职教育衔接,促进中高职教育的协调发展,是建设现代职业教育体系基本目标和特定要求。目前,中高职衔接不畅通主要表现在招考渠道不畅通、人才培养目标衔接不畅通、课程体系及教学内容衔接不畅通等方面。应采取有效措施,解决存在的问题,确保中高职教育衔接的畅通。同时,要通过强化政府职责、加强行业指导、创新集团化办学、构建职教和普教的立交桥等举措,建立畅通中高职衔接的长效机制。%Connecting secondary education to higher vocational education smoothly ,promoting secondary and higher vocational education development coordinatly ,is the basic objective and specific requirements of building a modern vocational education system.Currently ,secondary and higher vocational education is not smooth ,recruitment channel is not smooth ,personnel train-ing objectives is not smooth ,curriculum system and teaching content and other aspects are not smooth.We should take effective measures to solve the existing problems ,secondary and higher vocational education to ensure the connection smooth.At the same time ,by strengthening the responsibility of government to strengthen the industry guidance ,innovate group running schools ,build overpasses of vocational education and general education ,establish long -term mechanism in connecting secondary education to higher vocational education smoothly.

  16. HR policies and practices in vocational education and training institutions: understanding the implementation gap through the lens of discourses

    NARCIS (Netherlands)

    Runhaar, P.R.; Runhaar, H.


    Vocational education and training (VET) institutions face serious challenges, like educational innovations and upcoming teacher shortages, which require them to invest in their human capital. However, the implementation of human resources (HR) policies and practices often stagnates. Using the Dutch

  17. HR policies and practices in vocational education and training institutions. Understanding the implementation gap through the lens of discourses

    NARCIS (Netherlands)

    Runhaar, P.R.; Runhaar, H.A.C.


    Vocational education and training (VET) institutions face serious challenges, like educational innovations and upcoming teacher shortages, which require them to invest in their human capital. However, the implementation of human resources (HR) policies and practices often stagnates. Using the Dutch

  18. HR policies and practices in vocational education and training institutions. Understanding the implementation gap through the lens of discourses

    NARCIS (Netherlands)

    Runhaar, P.R.; Runhaar, H.A.C.


    Vocational education and training (VET) institutions face serious challenges, like educational innovations and upcoming teacher shortages, which require them to invest in their human capital. However, the implementation of human resources (HR) policies and practices often stagnates. Using the

  19. 34 CFR 403.18 - What are the membership requirements of a State council on vocational education? (United States)


    ... institutions); (ii) Career guidance and counseling organizations within the State; and (iii) Individuals who have special knowledge and qualifications with respect to the special educational and career... VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What Are the State's Organizational and Planning...

  20. On Vocational Success Education%职业成功教育浅论

    Institute of Scientific and Technical Information of China (English)



    As an important comer stone of professional training mode intended to meet the needs of the job markets, vocational success education is an essential pivot to push the reform and innovation of vocational education. Therefore, the basic connotations of such concepts as "success" , "success education" and "vocational success education" should be made clear; Secondly, the significance to implement the "four contributions" of vocational success education should be explicit; Thirdly, fourteen basics of vocational success education should be identified; Besides, eight basic approaches and eight basic methods should be followed to implement vocational success education.%职业成功教育,是构建适应职场需要的职业人才培养模式的一块重要基石,是推进职业教育改革创新的一个重要支点。为此,一要弄清“成功”、“成功教育”、“职业成功教育”的基本涵义;二要明确实施职业成功教育“四个有助于”的重要意义;三要选择与安排实施职业成功教育的14项基本内容;四要把握与遵循实施职业成功教育的八种基本途径;五要把握与运用实施职业成功教育的八种基本方法。

  1. Students’ Experiences of Ability-based Streaming in Vocational Education

    DEFF Research Database (Denmark)

    Tanggaard, Lene; Nielsen, Klaus; Helms Jørgensen, Christian


    Since 2007, it has been mandatory for all vocational schools in Denmark to assess the prior qualifications of all students when they begin at the school and to use this assessment to divide students into different ability-based courses (streaming) with the aim of increasing the retention of stude......Since 2007, it has been mandatory for all vocational schools in Denmark to assess the prior qualifications of all students when they begin at the school and to use this assessment to divide students into different ability-based courses (streaming) with the aim of increasing the retention...... of students. The purpose of this paper is to explore students’ experiences of being placed on a low-ability course by using case studies of two classes from separate vocational schools in Denmark with different practices regarding the streaming of students....

  2. 职业幸福感:职业教育的终极关怀%Vocational Well-being as the Ultimate Concern of Vocational Education

    Institute of Scientific and Technical Information of China (English)



    Vocation is the product created in the process of pursuing a happy life. Once the vocation is integrated with a person's future development potential, there will be a sense of happiness out from work, which is called "vocational well-being." According to the fundamental significance of education, this kind of well-being can be acquired from education. Nonetheless, nowadays the misunderstanding in vocational education in China is that it merely emphasizes the education of skills superficially instead of leading students to a higher sphere of aesthetic in their vocational life. Thus it is important to address that vocational well-being should be the ultimate concern of vocational education.%职业是人类在追寻幸福生活的过程中创造出来的,当职业与一个人的发展潜能相合的时候,职业幸福感就会产生。在教育的原初意义上,职业幸福感可以通过教育获得,但是,当下中国职业教育的误区是仅仅停留在外在的技术性追求上培养学生。职业教育创造职业生活的审美境界,职业幸福感应当是职业教育的终极关怀。

  3. An overview of the social image of Vocational Education: a path towards its appreciation

    Directory of Open Access Journals (Sweden)

    Enrique García Jiménez


    Full Text Available Historically, Vocational Education in Spain has suffered a situation of political oversight that, unlike other industrialized countries, it has been conferred a social discredit that is reflected in the lower levels of enrollment in these teachings, traditionally considered "second class" in comparison to university studies. While it is true, it has been developed in recent decades political initiatives to prestige Vocational Education. We point out, hence, what these initiatives are and characteristics of these teachings which, together with the current economic and social situation have helped to positively transform their social image and, therefore, have contributed to a significant increase in enrollment. Also, in this paper the results of an investigation is presented that allow to think that this evolution of the social image of Vocational Educationis perceived by teachers that, as we shall see, consider that it has made good progress in the dignity of these teachings.


    Directory of Open Access Journals (Sweden)

    Paulo Roberto Prado Constantino


    Full Text Available This paper presents an experiment in uses of virtual learning environments (VLE in the vocational education, evaluated by the Educational Supervision of Vocational and Secondary Schools of Paula Souza Center. The experience occurred in Etec "Jacinto Ferreira de Sá", São Paulo, Brazil, between 2009 and 2011, where the reported activities were organized and developed in the degree of Music, with students of different ages. Using specifics instruments to qualitative research for data collection were selected class record books, the reports to the virtual environment, the records of the participants' personal reflections, interviews and examination of the minutes of class councils involved. The experience has served as a basis for replication in other contexts and vocational courses presented by the institution.

  5. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  6. Exploring the Misrepresentation of Nigerian Women in Technical and Vocational Education in Polytechnic Institution

    Directory of Open Access Journals (Sweden)

    Robert Akor


    Full Text Available Nigerian government is making frantic efforts to drive her economy by laying emphasis on technical and vocational education to enable her compete favorably in the global market. Emphasis of government is in Polytechnic education where skills for self-reliant and economic growth are a priority. However, women are not embracing this opportunity by participating in the program that will equip them with skills and contribute to national development. In all 14 female participants were purposefully selected from Polytechnic. Phenomenological methodology was adopted and data collected were transcribed and analyzed. Results from the study include math/science phobia, perceived social support, and contextual roles among reasons for misrepresentation of women in technical and vocational education. Unless women have increased access to technical and vocational education in order to build diverse technical skills their vulnerability to unemployment and poverty will be on the rise. The findings of this study will guide stakeholders to develop a framework for improving the enrollment of women in this field. Keywords: women, technical and vocational education, self-reliant and unemployment

  7. Get a Vocation: Keeping on Top of Studies--Reducing the Drop-Out Rate in Vocational Upper Secondary Education and Training (United States)

    Jappinen, Aini-Kristiina


    The Finnish Ministry of education commissioned a study in 2006-07 on reducing the number of drop-outs, "Get a vocation--keeping on top of studies". The aim of the study was to establish the good practices and operating models underpinning reduction in drop-outs. The study indicates that an educational institution that fosters commitment…


    Directory of Open Access Journals (Sweden)

    Khadijah Alavi


    Full Text Available The main purpose of this study is to understand the perception of the image and pride of working in the technical and vocational fields from the perspective of parents and teachers in secondary schools. This study was conducted in two zones, namely North (Kedah and central zone (Selangor. Two schools were chosen from each zone, one from the city (Kajang and the other one from rural (Dengkil, which are sufficient to obtain the views of parents and teachers. Purposive sampling was selected for the focus group discussions in schools with the participation of PTA members, i.e., parents, teachers, career counselors teachers. The results showed that there were two main themes, namely, positive and negative image of technical education and vocational training among parents and teachers. However, the negative image remained resilient among parents and teachers, especially in deciding on career paths in technical and vocational fields. The researcher also identified several new issues, for example, wastage of manpower in the country, among them due to the weak prerequisite set in selecting students in technical and vocational education system; Students who do not meet the Malay Language (Bahasa Melayu prerequisite are unable to continue studying skills at higher certificate level. Students of Islamic studies and Arabic Language, students with academic excellence and girls who are interested in technical education and vocational training should be considered as a highly skilled workforce in the future. Some implications of this study were presented as suggestion in formulating policies to improve the image of technical education and vocational training.

  9. Re-Contextualizing Vocational Didactics in Norwegian Vocational Education and Training

    Directory of Open Access Journals (Sweden)

    Hæge Nore


    Full Text Available This article explores teachers and trainers didactical practices in different contexts in Norwegian VET: schools and workplaces. With the introduction of e-resources and e-portfolios in VET, learners as well as teachers and trainers experience a more hybrid learning-arena, which claims for a recontextualization of vocational didactics as well as re-defining roles and responsibilities of the actors. The article discuss new forms of boundary crossing, dealing with e-portfolios as boundary objects, increasing learner autonomy, transformative learning outcomes, interaction between actors and designing learning processes in hybrid learning-arenas. Vocational didactics as understood in a teacher-training context are challenged by more actors and new forms of interactivity with technological tools crossing sites. The study is based on a longitudinal study in a national project on quality assessment, interviews with teachers and trainers as well as apprenticeship training offices supported by documentary evidence from three trades: sales, plumbing and industrial mechanics.

  10. Returns on vocational education over the life cycle: Between immediate labour market preparation and lifelong employability (United States)

    Lavrijsen, Jeroen; Nicaise, Ides


    An important issue in the design of secondary-level education is the balance between conveying general and occupation-specific (vocational) skills. On the one hand, vocationally oriented programmes, providing occupation-specific skills with immediate labour market relevance, have repeatedly been shown to secure safe pathways into employment. On the other hand, these programmes tend to put less emphasis on developing general knowledge, skills and competencies, including numeracy and literacy, which are foundational to lifelong learning. Hence, when the needs of the labour market change, employees who opted for a vocational track when they were at secondary school risk being less flexible in adapting to such changes later in their career. The authors of this article examine whether this results in a trade-off between short-term gains and long-term losses by considering differences in the labour market careers of vocationally and generally educated respondents in the 2012 Programme for the International Assessment of Adult Competencies (PIAAC). Their results suggest that early labour market benefits of vocational specialisation decrease over time; the authors relate this to its lower ability to equip secondary school students - future employees - with skills for lifelong learning.

  11. Analysis of Teaching Methods Innovation of Legal Professions of Higher Vocational Education

    Directory of Open Access Journals (Sweden)

    Xu Hui


    Full Text Available With the needs of economic and social development, the legal system of China has been constantly improved. As a result, our country is in increasingly urgent demand for legal professionals. Legal professions of higher vocational colleges are responsible for the training of a variety of application-oriented legal talents for our country, which plays a very important role for the construction of the legal system. However, at present, there are some disadvantages in teaching methods of higher vocational legal professions, such as the imitation of general education while lack of vocational characteristics, the rigid and single teaching methods, and theory divorced from reality. The paper will start from these drawbacks, and will propose such appropriate solutions as the introduction of teaching method of case study, the implementation of "Clinic-style" practical teaching, and the conduction of "Law-article" teaching method, in the hope of offering some help to the development of higher vocational legal professions and cultivating truly practical legal talents with professional capacity, able to take up the mission of the law, and able to make a significant contribution to the legal system construction of the country, in cooperation with this wide range of vocational legal education models.

  12. Returns on vocational education over the life cycle: Between immediate labour market preparation and lifelong employability (United States)

    Lavrijsen, Jeroen; Nicaise, Ides


    An important issue in the design of secondary-level education is the balance between conveying general and occupation-specific (vocational) skills. On the one hand, vocationally oriented programmes, providing occupation-specific skills with immediate labour market relevance, have repeatedly been shown to secure safe pathways into employment. On the other hand, these programmes tend to put less emphasis on developing general knowledge, skills and competencies, including numeracy and literacy, which are foundational to lifelong learning. Hence, when the needs of the labour market change, employees who opted for a vocational track when they were at secondary school risk being less flexible in adapting to such changes later in their career. The authors of this article examine whether this results in a trade-off between short-term gains and long-term losses by considering differences in the labour market careers of vocationally and generally educated respondents in the 2012 Programme for the International Assessment of Adult Competencies (PIAAC). Their results suggest that early labour market benefits of vocational specialisation decrease over time; the authors relate this to its lower ability to equip secondary school students - future employees - with skills for lifelong learning.

  13. Students' Experiences of Ability-Based Streaming in Vocational Education (United States)

    Tanggaard, Lene; Nielsen, Klaus; Jørgensen, Christian Helms


    Purpose: Since 2007, it has been mandatory for all vocational schools in Denmark to assess the prior qualifications of all students when they begin at the school and to use this assessment to divide students into different ability-based courses (streaming) with the aim of increasing the retention of students. The purpose of this paper is to…

  14. Applying the ARCS Motivation Model in Technological and Vocational Education (United States)

    Liao, Hung-Chang; Wang, Ya-huei


    This paper describes the incorporation of Keller's ARCS (Attention, Relevance, Confidence, and Satisfaction) motivation model into traditional classroom instruction-learning process. Viewing that technological and vocational students have low confidence and motivation in learning, the authors applied the ARCS motivation model not only in the…

  15. Vocational Indecision in College Graduates. Educational Assessment Center Reports. (United States)

    Lunneborg, Patricia W.

    This study compared 127 vocationally undecided college graduates matched by sex, age, and major with graduates who had selected an occupation on a Survey of Graduating Seniors. Undecideds had a significantly lower GPA than decideds, intended noncareer activities following graduation, less often were going to graduate school, and were far less…

  16. Vocational Home Economics Education Classes as Non-Profit Businesses. (United States)

    Morgan, Vesta C.


    Suggests organizing one or more vocational home economics classes by the entrepreneur system to operate the class as a nonprofit business. Lists activities for planning and implementing the operation, benefits for the students, and ideas to develop skills in professional sewing, food service production, and occupational homemaking. (MF)

  17. Students' Experiences of Ability-Based Streaming in Vocational Education (United States)

    Tanggaard, Lene; Nielsen, Klaus; Jørgensen, Christian Helms


    Purpose: Since 2007, it has been mandatory for all vocational schools in Denmark to assess the prior qualifications of all students when they begin at the school and to use this assessment to divide students into different ability-based courses (streaming) with the aim of increasing the retention of students. The purpose of this paper is to…

  18. he (UnAttractiveness of Vocational and Technical Education: Theoretical Background

    Directory of Open Access Journals (Sweden)

    Miha Lovšin


    Full Text Available This paper considers the problem of the lack of attractiveness of vocational and technical education via a review of legislation on counselling practices, implementing documents, and the social factors by means of which the education system can influence the individual’s decision. It is apparent that legislation regulating the organisation and content of career counselling services in educational sector is inadequate. The organisation of career counselling at the level of implementation is also inadequate. Counsellors advise individuals on the basis of their academic results and the results of aptitude tests. Counselling practices deriving from theories that place career planning and management skills in the foreground are more rarely represented. Theories that treat career decisions as a social process show that at the level of the student population the choice of the type of school is a rational decision based primarily on the economic position and level of education to which a specific educational pathway is generally supposed to lead. The lower attractiveness of vocational and technical education coincides with the fact that representatives of lower social classes have a weaker economic position and more frequently have vocational and technical education qualifications than representatives of higher social classes. Nevertheless, the trend of high unemployment among young people with academic qualifications, which opposite of the traditional situation, indicates that it will be necessary to include career planning and management skills in the educational contents of institutionalised and formal education as a whole.

  19. The purpose and content of vocational curriculum for entrepreneurship education: a case study in Iran

    Directory of Open Access Journals (Sweden)

    Abdolrasoul Jamshidian


    Full Text Available Purpose: Since in technical and vocational secondary education, much of the general and special talents related to students’ vocation and life will flourish, and it provides the background to acquire the abilities such as entrepreneurship and entrepreneurial behavior, the purpose of this article is the evaluation of Technical and Vocational Education for Teaching Entrepreneurship. The main purpose of this research is the evaluation of the role of vocational education regarding the goal and content of the curriculum for entrepreneurship education. Materials and Methods: According to statistics, the number of trainers in the educational year 89-90 in Isfahan is 501 and the number of technical vocational trainees at the third grade level is 1439.The method of sampling utilized, is a two-stage cluster. A sample size of 210 people was estimated for trainer community, and one of 303 members for trainees. To collect data from two designed questionnaires, one was used for the trainer community and the other was used for the trainee community. For the validity of questionnaires, the views of teachers, students, and experts in the field of entrepreneurship curriculum were used. A reliability coefficient of 0.91 for trainers and of 0.89 for trainees was calculated. The Analysis of data obtained from research was performed in descriptive and inferential statistic levels. For Descriptive statistics, the indices of abundance, percent of the mean and standard deviation and for inferential statistics, the single-sample t-test, independent T, two-way ANOVA and Tukey test were used. Finding: The results obtained from the research is a proof that that the concepts of entrepreneurship in the curriculum has been developed and compiled. Between the views of the two groups (trainers and trainees regarding the goal and content, there is no difference. The difference between the views of the two groups in the area of content depends on demographic variables of sex

  20. Application prospects of distance learning technologies in the system of additional vocational education

    Directory of Open Access Journals (Sweden)

    Demina Svetlana


    Full Text Available In modern times the educational institutions of additional vocational education have to take into account mainly conflicting factors. On the one hand, these are the demands of employers to the quality of the educational process, on the other – the need to cut costs on employee training. This article states the basic features of use of distance technologies that allow to optimize training costs and to solve the problem of development of practical skills of listeners. The demand structure for programs of additional vocational education is presented on the example of several business schools. Besides the application topicality of remote educational technologies to support the learning process on-the-job is substantiated.

  1. Higher Vocational Entrepreneurship Education Analysis%高职创业教育分析探索

    Institute of Scientific and Technical Information of China (English)



    The fundamental purpose of vocational education is to enhance students' various skills to enhance students' creativ-ity, to develop students' thinking, to ensure that students through a variety of channels, a variety of ways for the community to bring greater economic value. However, the problem of multiple vocational entrepreneurship, entrepreneurship education varies, strengthening entrepreneurship education in problem analysis, strengthening the roots of control has been imperative in voca-tional education reform. This paper on entrepreneurship education in vocational content analysis of the vocational education system to build entrepreneurial conduct a comprehensive inquiry, the results of the present study are as follows.%高职教育的根本目的是为了提升学生各项技能,提高学生创造力,开拓学生思维,保证学生能够通过多种渠道、多种方式为社会带来更大的经济价值。但是我国高职创业问题多发,创业教育水平高低不一,强化创业教育中的问题分析,加强根源控制已经在高职教育改革中势在必行。本文就高职创业教育中的内容进行分析,对高职创业教育体系构建内容进行全面探究,现研究结果如下。

  2. Towards competence-based technical-vocational education and training in Ethiopia

    NARCIS (Netherlands)

    Solomon, Getachew Habtamu


    In the human development effort, different countries are underscoring the role of technical-vocational education and training (TVET) in providing relevant knowledge and skills to improve productivity, increase access to employment opportunities and raise the standard of living. It is in recognition

  3. Medical Laboratory Technician--Microbiology, 10-3. Military Curriculum Materials for Vocational and Technical Education. (United States)

    Ohio State Univ., Columbus. National Center for Research in Vocational Education.

    This course, the second of three courses in the medical laboratory technician field adapted from military curriculum materials for use in vocational and technical education, was designed as a refresher course for student self-study and evaluation. It is suitable for use by advanced students or beginning students participating in a supervised…

  4. Vocational education and training (VET) as a career path for young people

    DEFF Research Database (Denmark)

    Kersh, Natasha; Juul, Ida

    This paper aims to contribute to a better understanding of the issues of perceptions and motivations of young people towards Vocational Education and Training (VET) in England and Denmark. It specifically focuses on factors that facilitate their either positive or negative attitudes. Complex...... in Knowledge Economies and Societies (LLAKES)....

  5. Development of an E-Learning Platform for Vocational Education Systems in Germany (United States)

    Schober, Andreas; Müller, Frederik; Linden, Sabine; Klois, Martha; Künne, Bernd


    This paper describes an existing web-based learning platform named "Third Place of Learning" (TPL)--"Dritter Lernort". This project's aim is to connect the system of vocational education with digital media by a web-based learning platform. TPL supports student's digital learning by means of interactive examples and exercises.…

  6. Report on the Vocational Education and Training in Bosnia and Herzegovina. National Observatory Country Report. (United States)

    Jabucar, Abdulah; Gakovic, Aleksandra; Hadrovic, Armin; Prohaska, Donald; Dokic, Gordana; Vlasic, Marija; Markotic, Mario; Mandic, Milena; Merlo, Mira; Praso, Murat; Jovic, Nebojsa; Leto, Ramiz; Sarajcic, Sahrudin; Mulac, Salih; Vlasic, Silvio; Numic, Suada; Licina, Svetozar; Gakovic, Vojislav

    The state of the vocational education and training (VET) system in Bosnia and Herzegovina was reviewed to identify needed changes in policy and practice. The analysis focused on the following topics: (1) existing socioeconomic conditions; (2) existing labor market policies and employment patterns, unemployment, and employability; (3) modernization…


    Directory of Open Access Journals (Sweden)

    M.I. Odo


    Full Text Available The study seeks to understand the issues and challenges related to the implementations of activity-based instructions on vocational and technical education student in Nigeria. A survey was carried out involving vocational and technical education teachers in all six government owned technical colleges in Lagos State of Nigeria. A total of 150 teachers were selected randomly as respondents for the study. A four point scale items were designed to elicit information from the respondents. The findings of the study indicated that the techniques and the strategies adopted by the teachers of vocational education include: demonstration, field trips, projects, experiments and assignments. Various methods to evaluate students outcome include: process-product through systematic observation. It was evident from the study that constantly focusing on activity to make learning fun can actually hamper those students who make good progress without it. Based on the findings the researcher therefore concluded that good vocational and technical education teachers require the right attitude, have years of professional and practical skills and entrepreneurial experience at the workshop floor of industry and good background knowledge of engineering design.

  8. Safety and Health for Industrial/Vocational Education; for Supervisors and Instructors. (United States)

    Firenze, Robert J.; Walters, James B.

    This course is designed to enable industrial/vocational education supervisors and instructors to establish and administer effective safety and health programs in their schools. Although the course is intended as complete training to be given over a 3-day period, it may be divided into individual units for presentation over longer periods of time.…

  9. Exploring Technical Vocational Education and Training Systems in Emerging Markets. A Case Study on Ghana (United States)

    Arthur-Mensah, Nana; Alagaraja, Meera


    Purpose: The purpose of this study was to explore trends and changes in technical vocational education and training (TVET) in emerging economies as a national human resource development (NHRD) approach and its practical applications using Ghana as an example. Design/methodology/approach: A case study approach was used to develop an in-depth…

  10. Operating a Microwave Radiation Detection Monitor. Module 10. Vocational Education Training in Environmental Health Sciences. (United States)

    Consumer Dynamics Inc., Rockville, MD.

    This module, one of 25 on vocational education training for careers in environmental health occupations, contains self-instructional materials on operating a microwave radiation detection monitor. Following guidelines for students and instructors and an introduction that explains what the student will learn are three lessons: (1) testing the…

  11. Using Air-Purifying Respirators. Module 9. Vocational Education Training in Environmental Health Sciences. (United States)

    Consumer Dynamics Inc., Rockville, MD.

    This module, one of 25 on vocational education training for careers in environmental health occupations, contains self-instructional materials on using air-purifying respirators. Following guidelines for students and instructors and an introduction that explains what the student will learn are three lessons: (1) describing how air flows through an…

  12. Construction Surveying, 3-27. Military Curriculum Materials for Vocational and Technical Education. (United States)

    Ohio State Univ., Columbus. National Center for Research in Vocational Education.

    This short course on construction surveying was developed from military curriculum materials for use in technical and vocational education programs. Students completing the course should be able to perform engineering surveys related to area and route surveying (knowledge of basic survey techniques is a prerequisite). The course is divided into…

  13. Jordanian Vocational, Secondary Education Teachers and Acquisition of the National Professional Standards (United States)

    Al-Dajeh, Hesham I.


    The main purpose of this study was to estimate the level of acquisition of the Jordanian national professional standards by vocational, secondary education teachers. Two hundred teachers participated in the study. The data were collected by questionnaire and analyzed using SPSS version 15.0. Questionnaire validity was assessed by content validity,…

  14. Accommodating Learning Styles: Relevance and Good Practice in Vocational Education and Training--Supporting Documents (United States)

    Smith, Peter; Dalton, Jennifer; Henry, John


    This document was produced by the author(s) based on their research for the Australian report, "Accommodating Learning Styles: Relevance and Good Practice in Vocational Education and Training," and contains three parts. Part 1, Research Methodology and Findings (Peter Smith and Jennifer Dalton), contains: (1) Research Questions; (2)…

  15. A Skills beyond School Review of Switzerland. OECD Reviews of Vocational Education and Training (United States)

    Fazekas, Mihaly; Field, Simon


    Higher level vocational education and training (VET) programmes are facing rapid change and intensifying challenges. What type of training is needed to meet the needs of a changing economies? How should the programmes be funded? How should they be linked to academic and university programmes? How can employers and unions be engaged? This report…

  16. Employer Engagement with the Vocational Education and Training System in Australia. Occasional Paper (United States)

    Stanwick, John


    This paper is a review of literature on employer engagement with vocational education and training (VET). The main conclusion is that the major form of engagement is through the competency-based training system, which is manifested through training packages. Another way employers are encouraged to engage with VET is through competition amongst…

  17. A Skills beyond School Review of the Slovak Republic. OECD Reviews of Vocational Education and Training (United States)

    Fazekas, Mihály; Kurekova, Lucia Mytna


    Higher level vocational education and training (VET) programmes are facing rapid change and intensifying challenges. What type of training is needed to meet the needs of changing economies? How should the programmes be funded? How should they be linked to academic and university programmes? How can employers and unions be engaged? The country…

  18. Students' personal professional theories in vocational education : developing a knowledge base

    NARCIS (Netherlands)

    Schaap, H.


    Senior secondary vocational education needs to deliver reflective practitioners who possess an adequate knowledge base, who are able to solve complex problems and who have the ability to acquire and develop new knowledge during their further professional career. It is assumed that all types of knowl

  19. Teacher interpersonal behaviour and student motivation in competence-based vocational education : Evidence from Indonesia

    NARCIS (Netherlands)

    Misbah, Z.; Gulikers, J.T.M.; Maulana, J.; Mulder, M.


    Competence-based education requires changing teacher roles probably affecting teacher–student interactions and student motivation. This study examines how students (N = 1469) from competence-based and less-competence-based vocational schools perceive their teachers' interpersonal behaviour and its r

  20. Government-Funded Students and Courses, 2015. Australian Vocational Education and Training Statistics (United States)

    National Centre for Vocational Education Research (NCVER), 2016


    This publication provides a summary of 2015 and time-series data relating to students, programs, subjects, training providers and funding in Australia's government-funded vocational education and training (VET) system (broadly defined as all activity delivered by government providers and government-funded activity delivered by community education…

  1. AERA Vocational Education Special Interest Group Proceedings (San Diego, California, April 13-17, 1998). (United States)

    Jackman, Diane H., Ed.

    This document contains six research papers: "Articulation Practices among Secondary and Postsecondary Vocational-Technical Education Programs" (Bob R. Stewart, Sandra Eckert-Stewart); "What Message Are We Sending to Counselors about Their Role in Tech Prep?" (Paula Puckett); "From School-to-Work: Secretaries' and Machinists' Representations of…

  2. Trends in Vocational Education in the Arts 1980. Fast Response Survey System. (United States)

    Wright, Douglas A.; Farris, Elizabeth

    A study examined the nature and extent of vocational arts education programs throughout the 50 states. During the study, data were sought concerning those programs designed to prepare students for occupations in 14 arts areas: dance; vocal music; instrumental music; theater; radio, television, and video; cinematography; photography; graphic arts;…

  3. The Inculcation of Generic Skills among Juveniles through Technical and Vocational Education (United States)

    Wan-Mohamed, Wan Azlinda; Yunus, Mohamed Hafis


    Generic skills are skills which contribute towards individual's effective and successful participation in the workplace. For juveniles, Technical and Vocational Education (TVE) is one of the platforms that provide them generic skills which enable them to compete for job market. The purpose of this study is to investigate the level of generic…

  4. Obtaining Heat Stress Measurements. Module 15. Vocational Education Training in Environmental Health Sciences. (United States)

    Consumer Dynamics Inc., Rockville, MD.

    This module, one of 25 on vocational education training for careers in environmental health occupations, contains self-instructional materials on obtaining heat stress measurements. Following guidelines for students and instructors and an introduction that explains what the student will learn are three lessons: (1) naming and describing the…

  5. A Holistic Approach to Evaluating Vocational Education: Traditional Chinese Physicians (TCP) Model. (United States)

    Lee, Lung-Sheng; Chang, Liang-Te

    Conventional approaches to evaluating vocational education have often been criticized for failing to deal holistically with the institution or program being evaluated. Integrated quantitative and qualitative evaluation methods have documented benefits; therefore, it would be useful to consider possibility of developing a model for evaluating…

  6. Dualism and Vocational Education and Training: Creating the People Who Require Training (United States)

    Zoellner, Don


    Governments in advanced liberal democracies have assigned Vocational Education and Training (VET) a critical role in preparing a productive workforce for the broader economy. This linkage opens the way to use economic theories to expand the understanding of VET. Noted economic theorists have described the use of one economic reductionist technique…

  7. Interactions in vocational education: negotiation of meaning of students and teaching strategies

    NARCIS (Netherlands)

    Schaap, H.; Schaaf, M.F. van der; Bruijn, E. de


    This study aimed to describe verbal student–teacher interactions in vocational education from a socio-cultural perspective on negotiation of meaning. Teaching as part of these interactions is addressed by a combination of diagnosing, checking and intervening strategies. A study was conducted

  8. Interactions in Vocational Education: Negotiation of Meaning of Students and Teaching Strategies (United States)

    Schaap, Harmen; van der Schaaf, Marieke; de Bruijn, Elly


    This study aimed to describe verbal student--teacher interactions in vocational education from a socio-cultural perspective on negotiation of meaning. Teaching as part of these interactions is addressed by a combination of diagnosing, checking and intervening strategies. A study was conducted in which students (n students = 20) and teacher (n…

  9. Integrating Authentic Assessment with Competence-Based Learning in Vocational Education: The Protocol Portfolio Scoring (United States)

    Sluijsmans, Dominique M. A.; Straetmans, Gerard J. J. M.; van Merrienboer, Jeroen J. G.


    This article describes how competence-based learning (CBL) can be organised in vocational education by integrating elements from a holistic instructional design model with recent ideas on assessment. A curriculum based on this model is pre-eminently suitable for an assessment approach emphasising that proof of competence is gathered by having…

  10. Development and Evaluation of a Vocational Experience Curriculum for Educable and Disadvantaged Students. Final Report. (United States)

    Hardin County Board of Education, Elizabethtown, KY.

    A project was designed to measure the effects of integrating basic reading and mathematical instruction with prevocational instruction through the addition of a basic skills resource room, a technical simulation unit, and guidance and counseling to the ninth grade vocational experience program for educable mentally handicapped and disadvantaged…




  12. Research for Performance Based Vocational Education in Indiana. A Position Paper. Information Series Number Five. (United States)

    West, Bill R.

    This position paper describes Indiana's research goals and efforts to develop a student-centered, industry-referenced approach to performance based vocational education (PBVE) programs and curricula. The introductory section traces the state's efforts to establish priorities and systematically develop performance based programs and describes…

  13. Some Solutions to Vocational Education Problems of Minority, Disadvantaged and Handicapped Students. (United States)

    Broussard, Vernon; Wulf, Kathleen

    Society must take steps to provide desirable employment for disadvantaged minority youth. Since vocational education is the largest of the public-supported training programs, it must be in the vanguard to ensure development of job and career opportunities for all citizens who want to work, especially racial and ethnic minorities, handicapped…

  14. An R & D Agenda to Respond to Future Needs in Vocational Education. (United States)

    Lewis, Morgan V.

    This is the final report from a three-year project to develop and provide information to assist in setting national priorities for research and development in vocational education. The major objective of the third year was to obtain a more future-oriented perspective on needed research and development. To accomplish this objective, papers and…

  15. Internationalisation of Vocational Education and Training: An Adapting Curve for Teachers and Learners (United States)

    Tran, Ly Thi


    Competency-based training and training packages are mandatory for Australian vocational education and training (VET). VET qualifications are designed to provide learners with skills, knowledge, and attributes required for Australian workplaces. Yet, toward the end of December 2011, there were 171,237 international student enrolments in the…

  16. Attractiveness of Initial Vocational Education and Training: Identifying What Matters. Research Paper No 39 (United States)

    Cedefop - European Centre for the Development of Vocational Training, 2014


    Stereotypes prevail: many Europeans still opt for a vocational educational pathway as second choice when deciding about a future career. Despite being high on European and national policy agendas for more than a decade, and despite all efforts made, VET is no more attractive in most countries today than it was some years ago. Building on a system…

  17. Two Rival Conceptions of Vocational Education: Adam Smith and Friedrich List. (United States)

    Winch, Christopher


    Examines and discusses two views of political economy: (1) the classical model of Adam Smith; and (2) the social capitalist model associated with Friedrich List. Explores two varieties of vocational education and training that emerge from a comparison of Smith's and List's ideas. (CMK)

  18. Status Report on Female Enrollment in New Jersey Vocational Education 1988. (United States)

    Montclair State Coll., Upper Montclair, NJ. Life Skills Center.

    The New Jersey Occupational Information Coordinating Committee's statistics for average annual predicted job openings for 1984-87 are presented, along with the New Jersey Division of Vocational Education's enrollment statistics for the same period. The number of males and females enrolled in secondary programs for each of the 29 job categories…

  19. Smart Management in Effective Schools: Effective Management Configurations in General and Vocational Education in the Netherlands (United States)

    Hofman, W. H. Adriaan; Hofman, Roelande H.


    Purpose: In this study the authors focus on different (configurations of) leadership or management styles in schools for general and vocational education. Findings: Using multilevel (students and schools) analyses, strong differences in effective management styles between schools with different student populations were observed. Conclusions: The…

  20. Learning Outcomes in Vocational Education: A Business Plan Development by Production-Based Learning Model Approach (United States)

    Kusumaningrum, Indrati; Hidayat, Hendra; Ganefri; Anori, Sartika; Dewy, Mega Silfia


    This article describes the development of a business plan by using production-based learning approach. In addition, this development also aims to maximize learning outcomes in vocational education. Preliminary analysis of curriculum and learning and the needs of the market and society become the basic for business plan development. To produce a…

  1. Using Precision Rotameters. Module 6. Vocational Education Training in Environmental Health Sciences. (United States)

    Consumer Dynamics Inc., Rockville, MD.

    This module, one of 25 on vocational education training for careers in environmental health occupations, contains self-instructional materials on using precision rotameters. Following guidelines for students and instructors and an introduction that explains what the student will learn are three lessons: (1) naming the parts of a low-flow precision…

  2. Students' personal professional theories in vocational education : developing a knowledge base

    NARCIS (Netherlands)

    Schaap, H.


    Senior secondary vocational education needs to deliver reflective practitioners who possess an adequate knowledge base, who are able to solve complex problems and who have the ability to acquire and develop new knowledge during their further professional career. It is assumed that all types of knowl

  3. E-Business and Online Learning: Connections and Opportunities for Vocational Education and Training. (United States)

    Mitchell, John

    Australian vocational education and training (VET) providers show increasing interest in using electronic technology to provide online learning, student services, and business functions, according to a study that included a literature review, Internet search, interviews with organizations that use e-business models for online learning, analysis of…

  4. Effects of Welfare Reform on Vocational Education and Training. NBER Working Paper No. 16659 (United States)

    Dave, Dhaval M.; Reichman, Nancy E.; Corman, Hope; Das, Dhiman


    Exploiting variation in welfare reform across states and over time and using relevant comparison groups, this study estimates the effects of welfare reform on an important source of human capital acquisition among women at risk for relying on welfare: vocational education and training. The results indicate that welfare reform reduced enrollment in…

  5. New Perspectives on Documenting Employment and Earnings Outcomes in Vocational Education. (United States)

    Stevens, David W.; Shi, Jinping

    This guide is designed for local and state authorities who seek a better understanding of the performance of their vocational education programs. Its basic theme is management diagnostics. The first section provides a brief introduction to three decades of research that has been conducted on wage records submitted by employers under unemployment…

  6. Developments in Pedagogic Nomenclature in Australian Vocational Education: Evolution of Revolution? (United States)

    Robertson, Ian


    Over recent decades the nomenclature of "innovative" pedagogic approaches in vocational education and training (VET) has undergone a number of changes. In almost all cases "traditional face-to-face" teaching is set as the comparative benchmark and painted in pejorative terms. Using aspects of Basil Bernstein's theoretical…

  7. Exploring Technical Vocational Education and Training Systems in Emerging Markets. A Case Study on Ghana (United States)

    Arthur-Mensah, Nana; Alagaraja, Meera


    Purpose: The purpose of this study was to explore trends and changes in technical vocational education and training (TVET) in emerging economies as a national human resource development (NHRD) approach and its practical applications using Ghana as an example. Design/methodology/approach: A case study approach was used to develop an in-depth…

  8. Restrictive Factors of Vocational Education Development in Cultivation of Rural Practical Skilled Personnel and Countermeasures



    Kunming City is accelerating the process of agricultural modernization, industrialization, informationization and ecological development. In this process, it needs speeding up building new high level and advanced rural practical skilled personnel team suitable for development demand. By empirical analysis method, this paper discussed the factors restricting vocational education in cultivation of rural practical skilled personnel. Then, it came up with countermeasures in cultivation objective ...

  9. E-Business and Online Learning: Connections and Opportunities for Vocational Education and Training. (United States)

    Mitchell, John

    Australian vocational education and training (VET) providers show increasing interest in using electronic technology to provide online learning, student services, and business functions, according to a study that included a literature review, Internet search, interviews with organizations that use e-business models for online learning, analysis of…

  10. Focus on the Future of Vocational Education & Training: Scenario Planning Project. An ANTA National Project. (United States)

    Johnston, Ron

    The future of vocational education and training (VET) in Australia was explored in a project that was designed to identify emerging issues in VET, identify challenges and opportunities for strategic thinking about the future of VET, and establish a basis for ongoing consideration of strategic issues. The major project activities were as follows:…

  11. Vocational education in the Netherlands: in search of a new identity

    NARCIS (Netherlands)

    Dr. Jan Geurts; dr. Frans Meijers


    When the Netherlands developed a national system of vocational education at the end of the 19th century, it was a direct answer to obvious shortcomings in the technical and trade professions (De Jonge, 1968). It concentrated on training craftsmen for the traditional, mainly agrarian economy, and

  12. Vocational Imagination and Labour Market Literacy: Young New Zealanders Making Education-Employment Linkages (United States)

    Higgins, Jane; Nairn, Karen; Sligo, Judith


    This paper explores the concepts of vocational imagination and labour market literacy, arguing that these are important elements in the crafting of effective education-employment linkages. Evidence of truncated understandings of both is found in the talk of 93 young New Zealanders in transition from secondary school to their post-school lives. We…

  13. Entomology Specialist 1-1. Military Curriculum Materials for Vocational and Technical Education. (United States)

    Jones, Jimmie L.

    This individualized, self-paced course for training an entomology specialist was adapted from military curriculum materials for use in vocational and technical education. Completion of the course should provide students with basic information needed to accomplish the following duties of an entomology specialist: perform entomological work, apply…

  14. Characteristics of Hands-On Simulations with Added Value for Innovative Secondary and Higher Vocational Education (United States)

    Khaled, Anne; Gulikers, Judith; Biemans, Harm; van der Wel, Marjan; Mulder, Martin


    The intentions with which hands-on simulations are used in vocational education are not always clear. Also, pedagogical-didactic approaches in hands-on simulations are not well conceptualised from a learning theory perspective. This makes it difficult to pinpoint the added value that hands-on simulations can have in an innovative vocational…

  15. Trading Places: The Impact and Outcomes of Market Reform in Vocational Education and Training (United States)

    Anderson, Damon


    The purpose of this study is to evaluate, from a national perspective, the impact and outcomes of market reform in vocational education and training (VET), particularly the introduction of competitive tendering and "user choice". It does so by examining the structure, composition and dynamics of contestable or "quasi-markets"…

  16. Determinants of Entrepreneurial Intentions: Technical-Vocational Education and Training Students in Ethiopia (United States)

    Buli, Bereket Mamo; Yesuf, Wasihun Mohammed


    Purpose: The purpose of this paper is to examine factors that could explain the difference in entrepreneurial intention (EI) among technical-vocational education and training (TVET) program students. Centered on the theory of planned behavior (TPB), the paper aims to contribute to the understanding of factors that affect EIs of students and offer…

  17. Aesthetic Bildung in Vocational Education: The Biographical Case of Bookbinding Master Wolfgang B. and His Apprenticeship (United States)

    Tyson, Ruhi


    In the present article I will be discussing the importance attributed to aesthetic experiences in the vocational education of bookbinding master Wolfgang B. using the philosophy of Friedrich Schiller both to understand what constitutes these processes and to examine Schiller's thoughts in the light of his recollections. By doing this I hope…

  18. Measuring the Outcomes of Vocational Education and Training. Review of Research. (United States)

    Dumbrell, Tom

    Outcome measures are one of three key dimensions of the performance of Australia's vocational education and training (VET) system. The government, employers, students, and the broader community all share an interest in ensuring that Australia's VET system produces skills needed in the labor market. However, each group's views of what constitutes a…

  19. Interactions in vocational education : negotiation of meaning of students and teaching strategies

    NARCIS (Netherlands)

    Schaap, Harmen; van der Schaaf, Marieke; de Bruijn, Elly


    This study aimed to describe verbal student–teacher interactions in vocational education from a socio-cultural perspective on negotiation of meaning. Teaching as part of these interactions is addressed by a combination of diagnosing, checking and intervening strategies. A study was conducted in

  20. Interactions in Vocational Education: Negotiation of Meaning of Students and Teaching Strategies (United States)

    Schaap, Harmen; van der Schaaf, Marieke; de Bruijn, Elly


    This study aimed to describe verbal student--teacher interactions in vocational education from a socio-cultural perspective on negotiation of meaning. Teaching as part of these interactions is addressed by a combination of diagnosing, checking and intervening strategies. A study was conducted in which students (n students = 20) and teacher (n…

  1. Interactions in vocational education: negotiation of meaning of students and teaching strategies

    NARCIS (Netherlands)

    Schaap, H.; Schaaf, M.F. van der; Bruijn, E. de


    This study aimed to describe verbal student–teacher interactions in vocational education from a socio-cultural perspective on negotiation of meaning. Teaching as part of these interactions is addressed by a combination of diagnosing, checking and intervening strategies. A study was conducted in

  2. Crisis in the Restructuring of China's Vocational Education System, 1980-2010 (United States)

    Luo, Yan


    This article examines the origins of China's vocational education system and the restructuring of the system since 1980, finding that this thirty-year systemic restructuring was based on a framework of instrumental rationalism, but did not connect effectively with the building of a modern enterprise system. During this critical period in…

  3. Relationship of Job Satisfaction and Productivity to Work Values of Vocational Education Graduates (United States)

    Kazanas, H. C.


    Relationships of job satisfaction and job productivity to work values of beginning workers who graduated from public vocational education programs were investigated. Workers with intrinsic work value orientation seem to be more satisfied with their job and are more productive than are those with extrinsic work value orientation. (Author)

  4. Learner Success, Retention and Power in Vocational Education: A Snapshot from Research (United States)

    Zepke, Nick; Isaacs, Peter; Leach, Linda


    In this paper we explore whether power issues enhance and/or inhibit retention of foundation-learners in vocational education in Aotearoa New Zealand. After surveying reasons given for early departure in the retention literature, the paper offers Foucault's notion of governmentality as another possible factor in early departure. The paper explores…

  5. The Role of Family in Vocational Education and Training Choices: A Case Study in Vietnam (United States)

    Dormeier Freire, Alexandre; Giang, Hong Trinh


    This article examines the role of family in vocational education and training (VET) choices, using primary qualitative data collected in the commune of Hung An, Vietnam. The authors demonstrate that, next to issues relating to income, it is family characteristics that are the predominant influence on an individual's choice of the VET track,…

  6. The Contribution of Vocational Education and Training to the Integration of Refugee Returnees in Vietnam. (United States)

    Duong, Le Bach; Morgan, W. J.


    Reviews major developments in Vietnam over the past decade as it moves from a socialist to a market economy. Examines the labor market, the Technical and Vocational Education and Training (TVET) system and its role in helping returned exiles find employment. Concludes there was limited success in reintegration of returnees. (CAJ)

  7. Teacher/Student Classroom Interaction in Vocational Education. A Sex Bias/Sex Stereotyping Project. (United States)

    Omvig, Clayton P.

    A study examined teacher-student interaction in Kentucky's secondary and postsecondary vocational education classrooms. It investigated whether sex bias or inequities were present and what might explain such differences. A literature review focused on studies conducted at different grade levels with relation to sex bias and classroom interactions.…

  8. Teaching Entrepreneurship in Vocational Education Viewed from the Regional and Field Perspectives (United States)

    Jarvi, Taina


    Very little research has been conducted on the teaching of entrepreneurship, in particular in vocational education. Entrepreneurship is included in the national curriculum of many European countries, but there is concern over the competence of its teachers and their training in entrepreneurship (European Commission 2009, 14). This article explores…

  9. The Social Benefits of Initial Vocational Education and Training for Individuals in Europe (United States)

    Sabates, Ricardo; Salter, Emma; Obolenskaya, Polina


    This article investigates the social benefits of initial vocational education and training (VET) for individuals in different European contexts. Drawing on data from the European Community Household Panel, results show that initial VET is associated with positive changes in social outcomes for individuals across Europe. Health benefits were mainly…

  10. Geography teachers’ Practices regarding Summative Assessment : A Study of Pre-Vocational Education in the Netherlands

    NARCIS (Netherlands)

    Bijsterbosch, Erik; van der Schee, Joop; Kuiper, Wilmad; Beneker, T.


    To start a teacher professional development programme on the relationship between classroom summative assessment and learning, the current practices and dispositions of geography teachers towards internal school-based examinations in pre-vocational education in the Netherlands were investigated. A q

  11. Ethics: The Role of Adult and Vocational Education. Trends and Issues Alert No. 24. (United States)

    Wonacott, Michael E.

    Ethics and social responsibility are the subject of both curriculum materials and research in adult and vocational education. State academic standards and curriculum frameworks address citizenship and personal and social responsibility. Ethical and legal issues for specific occupations are addressed in curricula issued by states, professional…

  12. Teaching Entrepreneurship in Vocational Education Viewed from the Regional and Field Perspectives (United States)

    Jarvi, Taina


    Very little research has been conducted on the teaching of entrepreneurship, in particular in vocational education. Entrepreneurship is included in the national curriculum of many European countries, but there is concern over the competence of its teachers and their training in entrepreneurship (European Commission 2009, 14). This article explores…

  13. Vocational Education and Training--An Engine for Economic Growth and a Vehicle for Social Inclusion? (United States)

    Nilsson, Anders


    Vocational education and training (VET) has in recent years enjoyed a revival for two major reasons. Firstly, it is regarded as a suitable means of promoting economic growth. Secondly, it is seen as a potentially powerful tool for fostering social inclusion. In this review, these assumed effects are critically examined on the basis of the vastly…

  14. Crisis in the Restructuring of China's Vocational Education System, 1980-2010 (United States)

    Luo, Yan


    This article examines the origins of China's vocational education system and the restructuring of the system since 1980, finding that this thirty-year systemic restructuring was based on a framework of instrumental rationalism, but did not connect effectively with the building of a modern enterprise system. During this critical period in upgrading…

  15. Military Curriculum Materials for Vocational and Technical Education. Builders School, Ceramic Tile Setting 3-9. (United States)

    Ohio State Univ., Columbus. National Center for Research in Vocational Education.

    This course, for individualized or group instruction on ceramic tile setting, was developed from military sources for use in vocational education. The course provides students with skills in mortar preparation, surface preparation, tile layout planning, tile setting, tile cutting, and the grouting of tile joints. Both theory and shop assignments…

  16. Characteristics of hands-on simulations with added value for innovative secondary and higher vocational education

    NARCIS (Netherlands)

    Khaled, A.E.; Gulikers, J.T.M.; Biemans, H.J.A.; Wel, van der M.; Mulder, M.


    The intentions with which hands-on simulations are used in vocational education are not always clear. Also, pedagogical-didactic approaches in hands-on simulations are not well conceptualised from a learning theory perspective. This makes it difficult to pinpoint the added value that hands-on simula

  17. Determinants of Entrepreneurial Intentions: Technical-Vocational Education and Training Students in Ethiopia (United States)

    Buli, Bereket Mamo; Yesuf, Wasihun Mohammed


    Purpose: The purpose of this paper is to examine factors that could explain the difference in entrepreneurial intention (EI) among technical-vocational education and training (TVET) program students. Centered on the theory of planned behavior (TPB), the paper aims to contribute to the understanding of factors that affect EIs of students and offer…

  18. Vocational education in the Netherlands: in search of a new identity

    NARCIS (Netherlands)

    Geurts, Jan; Meijers, Frans


    When the Netherlands developed a national system of vocational education at the end of the 19th century, it was a direct answer to obvious shortcomings in the technical and trade professions (De Jonge, 1968). It concentrated on training craftsmen for the traditional, mainly agrarian economy, and tec

  19. Technical and Vocational Education in Cameroon and Critical Avenues for Development (United States)

    Che, S. Megan


    Technical and vocational education (TVE) can influence development and economic progress for post-colonial societies. Some newly independent sub-Saharan African countries attempted curricular transformation that might produce a skilled workforce through widespread access to versions of TVE. In Cameroon, no such post-colonial curricular revolution…

  20. Towards Quality Technical Vocational Education and Training (Tvet) Programmes in Nigeria: Challenges and Improvement Strategies (United States)

    Ayonmike, Chinyere Shirley; Okwelle, P. Chijioke; Okeke, Benjamin Chukwumaijem


    Technical Vocational Education and Training (TVET) is widely recognized as a vital driving force for the socio-economic growth and technological development of nations. In achieving the goals and objectives of TVET in Nigeria, the quality of the programme needs to be improved and sustained. The purpose of this study is to ascertain the challenges…