In Vitro Screening of Cytotoxic, Antimicrobial and Antioxidant ...
African Journals Online (AJOL)
Purpose: To evaluate the in vitro cytotoxic, antioxidant and antimicrobial activities of Clinacanthus nutans extracts and semi-fractions. Method: The plant was subjected to cold solvent extraction to produce petroleum ether, ethyl acetate and methanol crude extracts, followed by isolation using bioassay-guided fractionation.
In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods
Directory of Open Access Journals (Sweden)
Claudia Patricia Cordero Camacho
2002-01-01
Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.
In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods
Directory of Open Access Journals (Sweden)
Claudia Patricia Cordero Camacho
2011-12-01
Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.
In vitro cytotoxic and in silico activity of piperine isolated from Piper nigrum fruits Linn.
Paarakh, Padmaa M; Sreeram, Dileep Chandra; D, Shruthi S; Ganapathy, Sujan P S
2015-12-01
Piper nigrum [Piperaceae], commonly known as black pepper is used as medicine fairly throughout the greater part of India and as a spice globally. To isolate piperine and evaluate in vitro cytotoxic [antiproliferative] activity and in silico method. Piperine was isolated from the fruits of P.nigrum. Piperine was characterized by UV,IR, (1)H-NMR, (13)C-NMR and Mass spectrum. Standardization of piperine was done also by HPTLC fingerprinting. In vitro cytotoxic activity was done using HeLa cell lines by MTT assay at different concentrations ranging from 20 to 100 μg/ml in triplicate and in silico docking studies using enzyme EGFR tyrosine kinase. Fingerprinting of isolated piperine were done by HPTLC method. The IC50 value was found to be 61.94 ± 0.054 μg/ml in in vitro cytotoxic activity in HeLa Cell lines. Piperine was subjected to molecular docking studies for the inhibition of the enzyme EGFR tyrosine kinase, which is one of the targets for inhibition of cancer cells. It has shown -7.6 kJ mol(-1) binding and 7.06 kJ mol(-1) docking energy with two hydrogen bonds. piperine has shown to possess in vitro cytotoxic activity and in silico studies.
Energy Technology Data Exchange (ETDEWEB)
Kwon, Young-Min; Xia Zhidao; Glyn-Jones, Sion; Beard, David; Gill, Harinderjit S; Murray, David W, E-mail: young-min.kwon@ndos.ox.ac.u [Nuffield Department of Orthopaedic Surgery, University of Oxford, Oxford OX3 7LD (United Kingdom)
2009-04-15
Despite the satisfactory short-term implant survivorship of metal-on-metal hip resurfacing arthroplasty, periprosthetic soft-tissue masses such as pseudotumours are being increasingly reported. Cytotoxic effects of cobalt or chromium have been suggested to play a role in its aetiology. The aim of this study was to investigate the effects of clinically relevant metal nanoparticles and ions on the viability of macrophages in vitro. A RAW 264.7 murine macrophage cell line was cultured in the presence of either: (1) cobalt, chromium and titanium nanoparticles sized 30-35 nm; or (2) cobalt sulphate and chromium chloride. Two methods were used to quantify cell viability: Alamar Blue assay and Live/Dead assay. The cytotoxicity was observed only with cobalt. Cobalt nanoparticles and ions demonstrated dose-dependent cytotoxic effects on macrophages in vitro: the cytotoxic concentrations of nanoparticles and ions were 1 x 10{sup 12} particles ml{sup -1} and 1000 {mu}M, respectively. The high concentration of cobalt nanoparticles required for cytotoxicity of macrophages in vitro suggests that increased production of cobalt nanoparticles in vivo, due to excessive MoM implant wear, may lead to local adverse biological effects. Therefore, cytotoxicity of high concentrations of metal nanoparticles phagocytosed by macrophages located in the periprosthetic tissues may be an important factor in pathogenesis of pseudotumours.
Effect of radiotherapy on lymphocyte cytotoxicity in vitro
Energy Technology Data Exchange (ETDEWEB)
Wasserman, J; Melen, B [Central Microbiological Laboratory, Stockholm County Council (Sweden); Blomgren, H; Glas, U; Perlmann, P
1975-11-01
The cytotoxic functions of highly purified blood lymphocytes from patients with breast cancer were studied before and after radiotherapy. Addition of PHA or of rabbit antibodies to target cells (chicken erythrocytes) were chosen as two means of inducing lymphocyte cytotoxicity in vitro. The proportion of T and non-T lymphocytes was determined by means of E and EAC rosette tests. The antibody-induced cytotoxicity of lymphocytes decreased following radiotherapy while that mediated by PHA remained unchanged. There was some reduction in the percentage of EAC rosette-forming cells. These results, as well as earlier observations, suggest that the decrease in the peripheral blood of the proportion of lymphocytes with receptors for activated complement is responsible for changes in the antibody-mediated lymphocyte cytotoxicity.
International Nuclear Information System (INIS)
Guelden, Michael; Seibert, Hasso
2003-01-01
In the present study an extrapolation model for estimating serum concentrations of chemicals equivalent to in vitro effective concentrations is developed and applied to median cytotoxic concentrations (EC 50 ) determined in vitro. Nominal concentrations of a chemical in serum and in vitro are regarded as equivalent, if they result in the same aqueous concentration of the unbound form. The algorithm used is based on equilibrium distribution and requires albumin binding data, the octanol-water partition coefficient (K ow ), and the albumin concentrations and lipid volume fractions in vitro and in serum. The chemicals studied cover wide ranges of cytotoxic potency (EC 50 : 2.5-530000 μM) and lipophilicity (log K ow : -5 to 7). Their albumin binding characteristics have been determined by means of an in vitro cytotoxicity test as described previously. The equivalent serum concentrations of 19 of the 33 compounds investigated, having high protein binding and/or lipophilicity, were substantially higher than the EC 50 -values, by factors of 2.5-58. Prominent deviations between the equivalent nominal concentrations in serum and in vitro were largely restricted to chemicals with higher cytotoxic potency (EC 50 ≤1000 μM). The results suggest that estimates of equivalent serum concentrations based on in vitro data are robust for chemicals with low lipophilicity (log K ow ≤2) and low potency (EC 50 >1000 μM). With more potent chemicals or those with higher lipophilicity partitioning into lipids and/or binding to serum proteins have to be taken into account when estimating in vivo serum concentrations equivalent to in vitro effective concentrations
Csóka, K; Tholander, B; Gerdin, E; de la Torre, M; Larsson, R; Nygren, P
1997-09-17
The fluorometric microculture cytotoxicity assay (FMCA), a short-term in vitro assay based on the concept of total tumor cell kill, was used for testing the cytotoxic drug sensitivity of tumor cells from patients with ovarian carcinoma. A total of 125 fresh specimens was obtained, 98 (78%) of which were analyzed successfully. Data from 45 patients were available for clinical correlations. The FMCA appeared to yield clinically relevant cytotoxic drug sensitivity data for ovarian carcinoma as indicated by a comparison with tumor samples obtained from patients with non-Hodgkin's lymphoma or kidney carcinoma. Considering the most active single agent in vitro actually given in vivo, and using the median drug activity among all ovarian carcinoma samples as a cut-off, the sensitivity of the assay and its specificity were 75 and 52%, respectively. Cross-resistance in vitro was frequently observed between standard drugs but not between standard drugs and Taxol. Ten percent of the specimens showed an extreme resistance for at least 4 of 6 of the drugs investigated.
Mechanisms Underlying Cytotoxicity Induced by Engineered Nanomaterials: A Review of In Vitro Studies
Nogueira, Daniele R.; Mitjans, Montserrat; Rolim, Clarice M. B.; Vinardell, M. Pilar
2014-01-01
Engineered nanomaterials are emerging functional materials with technologically interesting properties and a wide range of promising applications, such as drug delivery devices, medical imaging and diagnostics, and various other industrial products. However, concerns have been expressed about the risks of such materials and whether they can cause adverse effects. Studies of the potential hazards of nanomaterials have been widely performed using cell models and a range of in vitro approaches. In the present review, we provide a comprehensive and critical literature overview on current in vitro toxicity test methods that have been applied to determine the mechanisms underlying the cytotoxic effects induced by the nanostructures. The small size, surface charge, hydrophobicity and high adsorption capacity of nanomaterial allow for specific interactions within cell membrane and subcellular organelles, which in turn could lead to cytotoxicity through a range of different mechanisms. Finally, aggregating the given information on the relationships of nanomaterial cytotoxic responses with an understanding of its structure and physicochemical properties may promote the design of biologically safe nanostructures. PMID:28344232
Nygren, P; Fridborg, H; Csoka, K; Sundström, C; de la Torre, M; Kristensen, J; Bergh, J; Hagberg, H; Glimelius, B; Rastad, J
1994-03-01
The semi-automated fluorometric microculture cytotoxicity assay (FMCA), based on the measurement of fluorescence generated from cellular hydrolysis of fluorescein diacetate (FDA) by viable cells, was employed for cytotoxic drug sensitivity testing of tumor cells from patients with hematological or solid tumors. In total, 390 samples from 20 diagnoses were tested with up to 12 standard cytotoxic drugs. The technical success rate for different tumor types ranged from 67 to 95%. Fluorescence was linearly related to cell number but variably steep depending on tumor type. Samples from most solid tumors thus showed higher signal-to-noise ratios than hematological samples. A wide spectrum of in vitro drug activity was obtained, with acute leukemias and non-Hodgkin's lymphomas being sensitive to almost all tested drugs, whereas renal and adrenocortical carcinomas were essentially totally resistant. Between these extremes were samples of breast and ovarian carcinomas and sarcomas. When in vitro response was compared with known clinical response patterns, a good correspondence was observed. The results indicate that the FMCA is a rapid and efficient method for in vitro measurement of tumor-specific drug activity both in hematological and in solid tumors. The assay may be suitable for new drug development and direction of phase-2 trials to suitable patients.
In vitro Cytotoxic Activity of Four Plants Used in Persian Traditional Medicine
Directory of Open Access Journals (Sweden)
Fatemeh Zare Shahneh
2013-08-01
Full Text Available Purpose: The aim of this study was to investigate in vitro cytotoxic activity of four methanolic crude plant extracts against panel cell lines. Methods: Methanolic extracts were tested for their possible antitumor activity and cytotoxicity using the 3-(4,5-dimetylthiazol-2-yl-2,5- diphenyltetrazolium bromide (MTT assay on six cancer cell lines; non-Hodgkin’s B-cell lymphoma (Raji, human leukemic monocyte lymphoma (U937, human acute myelocytic leukemia (KG-1A, human breast carcinoma (MCF-7 cells, human Prostate Cancer (PC3 and mouse fibrosarcoma (WEHI-164 cell lines and one normal cell line; Human Umbilical Vein Endothelial Cells (HUVEC. Results: All species showed dose dependent inhibition of cell proliferation. IC50 values ranging from 25.66±1.2 to 205.11±1.3 μg/ml. The highest cytotoxic activity Chelidonium majus L> Ferulago Angulata DC> Echinophora platyloba DC> Salvia officinalis L, respectively. Conclusion: all extracts demonstrate promising cytotoxicity activity as a natural resource for future bio-guided fractionation and isolation of potential antitumor agents.
Evaluation of cytotoxic effect of photodynamic therapy in combination with electroporation in vitro
DEFF Research Database (Denmark)
Labanauskiene, J; Gehl, J; Didziapetriene, J
2007-01-01
14, emitted light from 660 nm). The fluence rate at the level of the cells was 3 mW/m(2). Cytotoxic effect on cells viability was evaluated using MTT assay. Our in vitro data showed that the cytotoxicity of PDT in combination with EP increases fourfold on the average. Based on the results we suggest...... tumor therapy (PDT)--the cancer treatment method based on the use of photosensitizers that localize selectively in malignant tumors and become cytotoxic when exposed to light, and EP, with the aim to enhance the delivery of photosensitizers into the tumor and therefore to increase the efficacy of PDT....... Thus, the aim of study was to evaluate the cytotoxic effect of PDT in combination with EP. A Chinese hamster lung fibroblast cell line (DC-3F) was used. The cells were affected by photosensitizers chlorin e(6) (C e(6)) at the dose of 10 mug/ml and aluminium phthalocyanine tetrasulfonate (AlPcS4...
International Nuclear Information System (INIS)
Guelden, Michael; Seibert, Hasso
2005-01-01
The lower sensitivity of in vitro cytotoxicity assays currently restricts their use as alternative to the fish acute toxicity assays for hazard assessment of chemicals in the aquatic environment. In vitro cytotoxic potencies mostly refer to nominal concentrations. The main objective of the present study was to investigate, whether a reduced availability of chemicals in vitro can account for the lower sensitivity of in vitro toxicity test systems. For this purpose, the bioavailable free fractions of the nominal cytotoxic concentrations (EC 50 ) of chemicals determined with a cytotoxicity test system using Balb/c 3T3 cells and the corresponding free cytotoxic concentrations (ECu 50 ) were calculated. The algorithm applied is based on a previously developed simple equilibrium distribution model for chemicals in cell cultures with serum-supplemented culture media. This model considers the distribution of chemicals between water, lipids and serum albumin. The algorithm requires the relative lipid volume of the test system, the octanol-water partition coefficient (K ow ) and the in vitro albumin-bound fraction of the chemicals. The latter was determined from EC 50 -measurements in the presence of different albumin concentrations with the Balb/c 3T3 test system. Organic chemicals covering a wide range of cytotoxic potency (EC 50 : 0.16-527000 μM) and lipophilicity (log K ow : -5.0-6.96) were selected, for which fish acute toxicity data (LC 50 -values) from at least one of the three fish species, medaka, rainbow trout and fathead minnow, respectively, were available. The availability of several chemicals was shown to be extensively reduced either by partitioning into lipids or by serum albumin binding, or due to both mechanisms. Reduction of bioavailability became more important with increasing cytotoxic potency. The sensitivity of the Balb/c 3T3 cytotoxicity assay and the correspondence between in vivo and in vitro toxic potencies were increased when the free cytotoxic
International Nuclear Information System (INIS)
Huang Haoyue; Shen Zhenya; Liu Hongcheng; Meng Zili; Teng Xiaomei
2004-01-01
Objective: To explore the change of the cytotoxicity of natural killer cells induced by vascular endothelial cells in vitro and the relationship between this change and the variety of cytokine level. Methods: After fixed by paraformaldehyde, vascular endothelial cells from pigs were co-cultured in vitro with natural killer cells from Chinese monkeys at different ratios. The change of the cytotoxicity of natural killer cells occurring after this contact and the content of IFN-γ and TNF-α in the supernatants were detected. Results: The cytotoxicity of natural killer cells improved gradually in accordance with the co-culture ratio after co-cultured with fixed vascular endothelial cells. The secretion of INF-γ and TNF-α also improved gradually. Conclusion: After contact with xeno-target cells, the cytotoxicity of natural killer cells and the secretion of cytokines are related to the ratio of effective cells and target cells
In vitro antiplasmodial and cytotoxic properties of some medicinal plants from western Burkina Faso
Directory of Open Access Journals (Sweden)
Souleymane Sanon
2013-03-01
Methods: Crude dichloromethane, methanol, water-methanol, aqueous and alkaloids extracts were prepared for 12 parts of 10 plants. Chloroquine-resistant malaria strain K1 was used for the in vitro sensibility assay. The Plasmodium lactacte dehydrogenase technique was used to determine the 50% inhibitory concentration of parasites activity (IC50. The cytotoxic effects were determined with HepG2 cells, using the tetrazolium-based colorimetric technique, and the selectivity index (SI was calculated. Results: Sixty crude extracts were prepared. Seven extracts from Terminalia avicenoides showed IC50 1. The other plants have mostly moderate or no antimalarial effects. Some extracts from Cordia myxa, Ficus capraefolia and Opilia celtidifolia showed cytotoxicity, with an SI ranging between 0.4 and 0.9. Conclusion: Our study showed a good antiplasmodial in vitro activity of Terminalia avicenoides, Combretum collinum and Ficus capraefolia. These three plants may contain antiplasmodial molecules that could be isolated by bio-guided phytochemical studies.
In vitro cytotoxic screening of selected Saudi medicinal plants.
Almehdar, Hussein; Abdallah, Hossam M; Osman, Abdel-Moneim M; Abdel-Sattar, Essam A
2012-04-01
Many natural products from plants have been identified to exert anticancer activity. It might be expected to be a challenge to look at the Saudi plants in order to discover new sources for new molecules which may have anticancer activity. The methanolic extracts of forty species of plants traditionally used in Saudi Arabia for the treatment of a variety of diseases were tested in vitro for their potential anticancer activity on different human cancer cell lines. The cytotoxic activity of the methanolic extracts of the tested plants were determined using three human cancer cell lines, namely, breast cancer (MCF7), hepatocellular carcinoma (HEPG2), and cervix cancer (HELA) cells. In addition, human normal melanocyte (HFB4) was used as normal nonmalignant cells. Sulforhodamine B colorimetric assay was used to evaluate the in vitro cytotoxic activity of the different extracts. The growth inhibition of 50% (IC(50)) for each extract was calculated from the optical density of treated and untreated cells. Doxorubicin, a broad-spectrum anticancer drug, was used as the positive control. Nine plant extracts were chosen for further fractionation based on their activity and availability. Interesting cytotoxic activity was observed for Hypoestes forskaolii, Withania somnifera, Solanum glabratum, Adenium obesum, Pistacia vera oleoresin, Caralluma quadrangula, Eulophia petersii, Phragmanthera austroarabica, and Asparagus officinalis. Other extracts showed poor activity.
Jansen, K; van Wachem, PB; Nicolai, JPA; de Leij, LFMH; van Luyn, MJA; van der Werf, J.F.A.
We investigated possible cytotoxic effects, biocompatibility, and degradation of a hyaluronan-based conduit for peripheral nerve repair. We subjected the conduits to an in vitro fibroblast cytotoxicity test and concluded that the conduits were not cytotoxic. Subsequently, we implanted the conduits
DEFF Research Database (Denmark)
Thomsen, Allan Randrup; Jensen, B L
1980-01-01
In a recent report it was shown that what appeared to be secondary cytotoxic T cells could be obtained from lymphocytic choriomeningitis virus (LCMV)-primed splenocytes after stimulation in vitro with the non-specific T cell mitogen concanavalin A (Con A). The present experiments attempt to chara......In a recent report it was shown that what appeared to be secondary cytotoxic T cells could be obtained from lymphocytic choriomeningitis virus (LCMV)-primed splenocytes after stimulation in vitro with the non-specific T cell mitogen concanavalin A (Con A). The present experiments attempt...... to characterize further these effector cells and, in particular, to establish whether the Con A-activated cytotoxic effectors are qualitatively different from the secondary cytotoxic T cells induced by restimulation with the homologous antigen. It was found that: (1) in vitro activation with Con A could......, since no evidence was found to indicate a role for other cell types or soluble (cytotoxic or arming) factors; (4) cytotoxicity was specific with regard to both virus and 'self'. By comparison with previous data on LCMV-induced cytotoxic T cells, it is concluded that Con A induces the generation...
International Nuclear Information System (INIS)
Mayhew, E.; Bennett, M.
1974-01-01
An in vitro reaction between mouse lymphoid cells and target fibroblastic cells in wells of microtest plates, which appears to simulate the in vivo rejection of hemopoietic allografts, has been analyzed for metabolic and physiologic requirements. Protein synthesis was required for only the first few hours of culture. Inhibition of RNA synthesis and alteration of cell surface charge with various agents were without obvious effects. Metabolic slowing at 4 0 C or deviation of the pH of the culture medium suppressed the reaction. Thymus cells, which are not cytotoxic in this system, significantly but not completely inhibited the cytotoxicity of lymph node cells. Antiserum directed against target cells specifically protected them from the cytotoxic lymphoid cells in the absence of complement. Precursors of cytotoxic lymphoid cells were radiosensitive, unlike the cytotoxic cells themselves. BALB/c anti-C57BL/6 spleen cell serum and 89 Sr both are able to prevent rejection of marrow allografts in vivo. Lymphoid cells incubated with this antiserum plus complement lost much of their cytotoxicity but were still effective at high ratios of aggressor to target cells. Lymphoid cells of mice treated with 89 Sr were effectively cytotoxic but lost practically all of their cytotoxicity after incubation with the antiserum plus complement. Thus, it appears that this reaction detects two different cytotoxic lymphoid cells, either of which can function in vitro. Both cell types may need to cooperate in vivo during marrow allograft rejections
Structural requirements for bioactivation of anticonvulsants to cytotoxic metabolites in vitro.
Riley, R J; Kitteringham, N R; Park, B K
1989-01-01
The formation of cytotoxic metabolites from the anticonvulsants phenytoin and carbamazepine was investigated in vitro using a hepatic microsomal enzyme system and human mononuclear leucocytes as target cells. Both drugs were metabolised to cytotoxic products. In order to assess the structural requirements for this bioactivation, a series of structurally related compounds was investigated. It was found that molecules which contain either an amide function or an aryl ring may undergo activation in vitro, but only the metabolism-dependent toxicity of the latter is potentiated by pre-treatment of the target cells with an epoxide hydrolase inhibitor. Taken collectively, these data are consistent with the concept that reactive epoxide metabolites of both phenytoin and carbamazepine may produce toxicity in individuals with an inherited deficiency in epoxide hydrolase. PMID:2590607
Diuron metabolites and urothelial cytotoxicity: In vivo, in vitro and molecular approaches
International Nuclear Information System (INIS)
Da Rocha, Mitscheli S.; Arnold, Lora L.; Dodmane, Puttappa R.; Pennington, Karen L.; Qiu, Fang; De Camargo, João Lauro V.; Cohen, Samuel M.
2013-01-01
Diuron is carcinogenic to the rat urinary bladder at high dietary levels. The proposed mode of action (MOA) for diuron is urothelial cytotoxicity and necrosis followed by regenerative urothelial hyperplasia. Diuron-induced urothelial cytotoxicity is not due to urinary solids. Diuron is extensively metabolized, and in rats, N-(3,4-dichlorophenyl)urea (DCPU) and 4,5-dichloro-2-hydroxyphenyl urea (2-OH-DCPU) were the predominant urinary metabolites; lesser metabolites included N-(3,4-dichlorophenyl)-3-methylurea (DCPMU) and trace levels of 3,4-dichloroaniline (DCA). In humans, DCPMU and DCPU have been found in the urine after a case of product abuse. To aid in elucidating the MOA of diuron and to evaluate the metabolites that are responsible for the diuron toxicity in the bladder epithelium, we investigated the urinary concentrations of metabolites in male Wistar rats treated with 2500 ppm of diuron, the urothelial cytotoxicity in vitro of the metabolites and their gene expression profiles. DCPU was found in rat urine at concentrations substantially greater than the in vitro IC50 and induced more gene expression alterations than the other metabolites tested. 2-OH-DCPU was present in urine at a concentration approximately half of the in vitro IC50, whereas DCPMU and DCA were present in urine at concentrations well below the IC50. For the diuron-induced MOA for the rat bladder, we suggest that DCPU is the primary metabolite responsible for the urothelial cytotoxicity with some contribution also by 2-OH-DCPU. This study supports a MOA for diuron-induced bladder effects in rats consisting of metabolism to DCPU (and 2-OH-DCPU to a lesser extent), concentration and excretion in urine, urothelial cytotoxicity, and regenerative proliferation
Diuron metabolites and urothelial cytotoxicity: in vivo, in vitro and molecular approaches.
Da Rocha, Mitscheli S; Arnold, Lora L; Dodmane, Puttappa R; Pennington, Karen L; Qiu, Fang; De Camargo, João Lauro V; Cohen, Samuel M
2013-12-15
Diuron is carcinogenic to the rat urinary bladder at high dietary levels. The proposed mode of action (MOA) for diuron is urothelial cytotoxicity and necrosis followed by regenerative urothelial hyperplasia. Diuron-induced urothelial cytotoxicity is not due to urinary solids. Diuron is extensively metabolized, and in rats, N-(3,4-dichlorophenyl)urea (DCPU) and 4,5-dichloro-2-hydroxyphenyl urea (2-OH-DCPU) were the predominant urinary metabolites; lesser metabolites included N-(3,4-dichlorophenyl)-3-methylurea (DCPMU) and trace levels of 3,4-dichloroaniline (DCA). In humans, DCPMU and DCPU have been found in the urine after a case of product abuse. To aid in elucidating the MOA of diuron and to evaluate the metabolites that are responsible for the diuron toxicity in the bladder epithelium, we investigated the urinary concentrations of metabolites in male Wistar rats treated with 2500ppm of diuron, the urothelial cytotoxicity in vitro of the metabolites and their gene expression profiles. DCPU was found in rat urine at concentrations substantially greater than the in vitro IC50 and induced more gene expression alterations than the other metabolites tested. 2-OH-DCPU was present in urine at a concentration approximately half of the in vitro IC50, whereas DCPMU and DCA were present in urine at concentrations well below the IC50. For the diuron-induced MOA for the rat bladder, we suggest that DCPU is the primary metabolite responsible for the urothelial cytotoxicity with some contribution also by 2-OH-DCPU. This study supports a MOA for diuron-induced bladder effects in rats consisting of metabolism to DCPU (and 2-OH-DCPU to a lesser extent), concentration and excretion in urine, urothelial cytotoxicity, and regenerative proliferation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
In vitro cytotoxicity of alpha conjugates for human pancreatic cancer cell lines
International Nuclear Information System (INIS)
Qu, C.; Li, Y.; Rizvi, M.A.; Allen, B.; Samra, J.; Smith, R.
2003-01-01
Targeted Alpha therapy (TAT) can inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The aim of this study is to demonstrate the cytotoxicity of different alpha conjugates in vitro to human metastatic pancreatic cancer cell lines (CAPAN-1, CFPAN-1 and PANC-1). We are labeling the C595 and J591 (non-specific controls) monoclonal antibodies (Mabs) with 213 Bi were performed according to the standard methods in our laboratory. 213 Bi-C595 is specifically cytotoxic to CAPAN-1, CFPAN-1 and PANC-1cell lines in a concentration-dependent fashion. While non-specific alpha conjugates only killed very small fractions of pancreatic cancer cells. These alpha conjugates might be useful agents for the treatment of micro-metastases in pancreatic cancer patients with over-expression of the targeted receptors
In vitro Antimalarial and Cytotoxic Activities of Leaf Extracts of ...
African Journals Online (AJOL)
efficacy of the plant leaves for treatment of malaria. Key Words: Antiplasmodial, cytotoxicity, Vernonia amygdalina leave, in vitro, Plasmodium falciparum, vero cell line. INTRODUCTION. Malaria constitutes one of the major public health problems in the world, especially in tropical. Africa, Asia and Latin America. The World.
Okur, Neslihan Üstündağ; Özdemir, Derya İlem; Kahyaoğlu, Şennur Görgülü; Şenyiğit, Zeynep Ay; Aşıkoğlu, Makbule; Genç, Lütfi; Karasulu, H Yeşim
2015-01-01
The object of the current study was to prepare novel microemulsion formulations of aprotinin for parenteral delivery and to compare in vitro characteristics and release behaviour of different Technetium-99m ((99m)Tc)-Aprotinin loaded microemulsion formulations. In addition, cytotoxicity of microemulsion formulation was evaluated with cell culture studies on human immortalized pancreatic duct epithelial-like cells. For this aim, firstly, pseudo-ternary phase diagrams were plotted to detect the formulation region and optimal microemulsions were characterized for their thermodynamic stability, conductivity, particle size, zeta potential, viscosity, pH and in vitro release properties. For in vitro release studies aprotinin was labelled with (99m)Tc and labelling efficiency, radiochemical purity and stability of the radiolabeled complex were determined by several chromatography techniques. Radiolabeling efficiency of (99m)Tc-Aprotinin was found over than 90% without any significant changes up to 6 hours after labelling at room temperature. After that, in vitro release studies of (99m)Tc-Aprotinin loaded microemulsions were performed with two different methods; dissolution from diffusion cells and dialysis bags. Both methods showed that release rate of (99m)Tc- Aprotinin from microemulsion could be controlled by microemulsion formulations. Drug release from the optimized microemulsion formulations was found lower compared to drug solution at the end of six hours. According to stability studies, the optimized formulation was found to be stable over a period of 12 months. Also, human immortalized pancreatic duct epithelial-like cells were used to evaluate the cytotoxicity of optimum formulation. Developed microemulsion did not reveal cytotoxicity. In conclusion the present study indicated that the M1-APT microemulsion is appropriate for intravenous application of aprotinin.
Calder, Elizabeth A.; Penhale, W. J.; Barnes, E. W.; Irvine, W. J.
1973-01-01
An in vitro method is described to detect lymphocytes in patients with Hashimoto thyroiditis that are cytotoxic to thyroglobulin-coated chicken red blood cells. Using this technique, the cytotoxic index of lymphocytes from patients with Hashimoto thyroiditis was 25·46±3·81 (SEM), which is significantly different from that obtained with lymphocytes from control subjects, 6·28±0·80. PMID:4740396
Directory of Open Access Journals (Sweden)
Garrido Federico
2008-03-01
Full Text Available Abstract Background Protein-bound polysaccharide (PSK is derived from the CM-101 strain of the fungus Coriolus versicolor and has shown anticancer activity in vitro and in in vivo experimental models and human cancers. Several randomized clinical trials have demonstrated that PSK has great potential in adjuvant cancer therapy, with positive results in the adjuvant treatment of gastric, esophageal, colorectal, breast and lung cancers. These studies have suggested the efficacy of PSK as an immunomodulator of biological responses. The precise molecular mechanisms responsible for its biological activity have yet to be fully elucidated. Methods The in vitro cytotoxic anti-tumour activity of PSK has been evaluated in various tumour cell lines derived from leukaemias, melanomas, fibrosarcomas and cervix, lung, pancreas and gastric cancers. Tumour cell proliferation in vitro was measured by BrdU incorporation and viable cell count. Effect of PSK on human peripheral blood lymphocyte (PBL proliferation in vitro was also analyzed. Studies of cell cycle and apoptosis were performed in PSK-treated cells. Results PSK showed in vitro inhibition of tumour cell proliferation as measured by BrdU incorporation and viable cell count. The inhibition ranged from 22 to 84%. Inhibition mechanisms were identified as cell cycle arrest, with cell accumulation in G0/G1 phase and increase in apoptosis and caspase-3 expression. These results indicate that PSK has a direct cytotoxic activity in vitro, inhibiting tumour cell proliferation. In contrast, PSK shows a synergistic effect with IL-2 that increases PBL proliferation. Conclusion These results indicate that PSK has cytotoxic activity in vitro on tumour cell lines. This new cytotoxic activity of PSK on tumour cells is independent of its previously described immunomodulatory activity on NK cells.
In vitro cytotoxicity of self-curing acrylic resins of different colors
Directory of Open Access Journals (Sweden)
Luciana Borges Retamoso
2014-08-01
Full Text Available OBJECTIVE: The aim of this study was to assess the in vitro cytotoxicity of acrylic resins of different colors over time. METHODS: Specimens were divided into 4 groups (n = 6 according to the color of the acrylic resin (Orto Class, Clássico, Campinas, São Paulo, Brazil: Group 1: clear acrylic resin; group 2: pink acrylic resin; group 3: blue acrylic resin and group 4: green acrylic resin. All specimens were fabricated according to the mass manipulation technique and submitted to mechanical polishing protocol. The control was performed with an amalgam specimen (C+, a glass specimen (C- and cell control (CC. Specimens were immersed in Minimum Eagle's Medium (MEM and incubated for 24 h at 37o C. The extracts from the experimental material were filtered and mixed with L929 fibroblast. Cytotoxicity was evaluated at 4 different times, 24, 48, 72 and 168 h. After contact, cells were incubated for 24 h and added to 100 µ of 0.01% neutral red dye. The cells were incubated for 3 h for pigment incorporation and fixed. Cells viability was determined by a spectroscopic (BioTek, Winooski, Vermont, USA with a 492-nm wavelength λ=492 nm. RESULTS: There were no statistical differences between the experimental groups and the CC and C- groups. CONCLUSION: Clear, pink, blue and green self-curing acrylic resins fabricated by means of the mass manipulation technique and mechanically polished are not cytotoxic. Neither the pigment added to the self-curing acrylic resin nor the factor of time influenced the cytotoxicity of the material.
Roy, Soumen; Pawar, Sandip; Chowdhary, Abhay
2016-01-01
To evaluate in vitro cytotoxicity and antioxidant activity of Datura metel L. and Cynodon dactylon L. extracts. The extraction of plants parts (datura seed and fruit pulp) and areal parts of durva was carried out using soxhlet and cold extraction method using solvents namely methanol and distilled water. The total phenolic content (TPC) and total flavonoid content (TFC) was determined by established methods. The in vitro cytotoxicity assay was performed in vero cell line by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay method. In vitro antioxidant activity of the extract was performed by 2, 2-diphenyl-1-picrylhydrazyl radical scavenging method. We found that the highest amount of TPC and TFC in methanolic extracts of seed (268.6 μg of gallic acid equivalence/mg of dry plant material) and fruit pulp (8.84 μg of quercetin equivalence/mg dry plant material) of D. metel, respectively prepared by Soxhlet method. The methanolic extract of C. dactylon prepared using soxhlation has shown potent free radical scavenging activity with 50% inhibitory concentration (IC50) value of 100 μg/ml. The IC50 of a methanolic cold extract of datura fruit was found to be 3 mg/ml against vero cell line. We observed that plant parts of C. dactylon and D. metel have a high antioxidant activity. Further research is needed to explore the therapeutic potential of these plant extracts. In the present study we observed a positive correlation was between the phenolic and flavanoid content of the Datura metel and cynodon doctylon (durva) extracts with the free radical scavenging activities. Both were found to have a high antioxidant activity. Abbreviations used: BHA: Butylated hydroxyanisole, BHT: Butylated hydroxytoluene, CC50: 50% cell cytotoxic concentration, CNS: Central nervous system, DPPH: 2, 2-diphenyl-1-picrylhydrazyl, IC50: 50% inhibitory concentration, MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), TFC: Total flavonoid content, TPC: Total
Cytotoxic and antibacterial activity of the mixture of olive oil and lime cream in vitro conditions.
Sumer, Zeynep; Yildirim, Gulay; Sumer, Haldun; Yildirim, Sahin
2013-01-01
The mixture of olive oil and lime cream has been traditionally used to treat external burns in the region of Hatay/Antakya and middle Anatolia. Olive oil and lime cream have been employed by many physicians to treat many ailments in the past. A limited number of studies have shown the antibacterial effect of olive oil and that it does not have any toxic effect on the skin. But we did not find any reported studies on the mixture of olive oil and lime cream. The aim of this paper is to investigate the cytotoxic and antibacterial activity of olive oil and lime cream individually or/and in combination in vitro conditions, by using disk-diffusion method and in cell culture. The main purpose in using this mixture is usually to clear burns without a trace. Agar overlay, MTT (Cytotoxicity assay) and antibacterial susceptibility tests were used to investigate the cytotoxic and antibacterial activity of olive oil and lime cream. We found that lime cream has an antibacterial activity but also cytotoxic on the fibroblasts. On the other hand olive oil has limited or no antibacterial effect and it has little or no cytotoxic on the fibroblasts. When we combined lime cream and olive oil, olive oil reduced its cytotoxic impact. These results suggest that mixture of olive oil and lime cream is not cytotoxic and has antimicrobial activity.
In vitro cytotoxicity testing of Ubiquicidin 29-41-99mTc
International Nuclear Information System (INIS)
Ocampo, Ivette Z.; Okazaki, Kayo; Dias, Luis Alberto Pereira; Higa, Olga Z.; Silva, Fabiana M. da; Vieira, Daniel P.; Passos, Priscila; Esteves-Pedro, Natalia M.
2015-01-01
The work carried out cytotoxicity tests using a radiopharmaceutical compound produced at IPEN/CNEN-SP to certify its safety through in vitro cytotoxicity tests. Since 2009, the Brazilian regulatory agency (ANVISA) requires that such tests have to be carried out following good laboratory practices (GLP) and in according to the OECD (Organisation for Economic Co-operation and Development) guidelines in order to certify its safety for medical use. Those guidelines comprises series of technical recommendations performed to assure quality of experiments. The study chose Ubiquicidin 29-41, an antimicrobial peptide used to discriminate bacterial infection foci from inflammatory sites. Amounts of UBI 29-41 were conjugated or not to 99m Tc and diluted to equivalent concentrations of 10, 100 and 1000% of the maximum dose (or activity) administered in adults. Possible cytotoxic effects were evaluated in comparison to untreated controls as well as positive and negative damage controls. Both full (radioactive) radiopharmaceuticals, as their precursors (only molecules without conjugation to isotopes) showed no significant cytotoxic effect (cytotoxicity ≤ 10%). The study was conducted for the first time in the country comprising preclinical testing of this radiopharmaceutical in accordance with internationally accepted quality parameters, ensuring the safety of its use and enabling inclusion in the pharmaceutical regulatory agenda. (author)
In vitro antiplasmodial and cytotoxic properties of some medicinal plants from western Burkina Faso.
Sanon, Souleymane; Gansane, Adama; Ouattara, Lamoussa P; Traore, Abdoulaye; Ouedraogo, Issa N; Tiono, Alfred; Taramelli, Donatella; Basilico, Nicoletta; Sirima, Sodiomon B
2013-01-01
Resistance of malaria parasites to existing drugs complicates treatment, but an antimalarial vaccine that could protect against this disease is not yet available. It is therefore necessary to find new effective and affordable medicines. Medicinal plants could be a potential source of antimalarial agents. Some medicinal plants from Burkina Faso were evaluated for their antiplasmodial and cytotoxic properties in vitro . Crude dichloromethane, methanol, water-methanol, aqueous and alkaloids extracts were prepared for 12 parts of 10 plants. Chloroquine-resistant malaria strain K1 was used for the in vitro sensibility assay. The Plasmodium lactacte dehydrogenase technique was used to determine the 50% inhibitory concentration of parasites activity (IC 50 ). The cytotoxic effects were determined with HepG2 cells, using the tetrazolium-based colorimetric technique, and the selectivity index (SI) was calculated. Sixty crude extracts were prepared. Seven extracts from Terminalia avicenoides showed IC 50 effect, with SI > 1. The other plants have mostly moderate or no antimalarial effects. Some extracts from Cordia myxa , Ficus capraefolia and Opilia celtidifolia showed cytotoxicity, with an SI ranging between 0.4 and 0.9. Our study showed a good antiplasmodial in vitro activity of Terminalia avicenoides, Combretum collinum and Ficus capraefolia . These three plants may contain antiplasmodial molecules that could be isolated by bio-guided phytochemical studies.
In vitro cytotoxicity of Indonesian stingless bee products against human cancer cell lines
Directory of Open Access Journals (Sweden)
Paula M. Kustiawan
2014-07-01
Conclusions: Propolis from T. incisa and Trigona fusco-balteata contain an in vitro cytotoxic activity against human cancer cell lines. Further study is required, including the isolation and characterization of the active antiproliferative agent(s.
In vitro antimycobacterial and cytotoxic data on medicinal plants used to treat tuberculosis
Directory of Open Access Journals (Sweden)
Joseph M. Nguta
2016-06-01
Full Text Available This article contains data on in vitro antimycobacterial activity and cytotoxicity of hydroethanolic crude extracts from five selected medicinal plant species traditionally used to treat tuberculosis in Ghanaian ethnomedicine, see “Medicinal plants used to treat TB in Ghana” [1]. The interpretation and discussion of these data and further extensive insights into drug discovery against tuberculosis from natural products of plant biodiversity can be found in “Antimycobacterial and cytotoxic activity of selected medicinal plant extracts” [2].
Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques
2018-01-01
In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.
In vitro cytotoxicity assessment of nanodiamond particles and their osteogenic potential.
Ibrahim, Mohamed; Xue, Ying; Ostermann, Melanie; Sauter, Alexander; Steinmueller-Nethl, Doris; Schweeberg, Sarah; Krueger, Anke; Cimpan, Mihaela R; Mustafa, Kamal
2018-02-16
Scaffolds functionalized with nanodiamond particles (nDP) hold great promise with regard to bone tissue formation in animal models. Degradation of the scaffolds over time may leave nDP within the tissues, raising concerns about possible long-term unwanted effects. Human SaOS-2 osteoblast-like cells and U937 monoblastoid cells were exposed to five different concentrations (0.002-2 mg/L) of nDP (size range: 2.36-4.42 nm) for 24 h. Cell viability was assessed by impedance-based methods. The differential expression of stress and toxicity-related genes was evaluated by polymerase chain reaction (PCR) super-array, while the expression of selected inflammatory and cell death markers was determined by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Furthermore, the expression of osteogenic genes by SaOS-2 cells, alkaline phosphatase activity and the extracellular calcium nodule deposition in response to nDP were determined in vitro. Cells responded differently to higher nDP concentrations (≥0.02 mg/L), that is, no loss of viability for SaOS-2 cells and significantly reduced viability for U937 cells. Gene expression showed significant upregulation of several cell death and inflammatory markers, among other toxicity reporter genes, indicating inflammatory and cytotoxic responses in U937 cells. Nanodiamond particles improved the osteogenicity of osteoblast-like cells with no evident cytotoxicity. However, concentration-dependent cytotoxic and inflammatory responses were seen in the U937 cells, negatively affecting osteogenicity in co-cultures. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A, 2018. © 2018 Wiley Periodicals, Inc.
In vitro cytotoxicity testing of Ubiquicidin 29-41-{sup 99m}Tc
Energy Technology Data Exchange (ETDEWEB)
Ocampo, Ivette Z.; Okazaki, Kayo; Dias, Luis Alberto Pereira; Higa, Olga Z.; Silva, Fabiana M. da; Vieira, Daniel P., E-mail: dpvieira@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Passos, Priscila; Esteves-Pedro, Natalia M., E-mail: fabiana@biosintesis.com.br [Laboratorio Biosintesis Ltda, Sao Paulo, SP (Brazil)
2015-07-01
The work carried out cytotoxicity tests using a radiopharmaceutical compound produced at IPEN/CNEN-SP to certify its safety through in vitro cytotoxicity tests. Since 2009, the Brazilian regulatory agency (ANVISA) requires that such tests have to be carried out following good laboratory practices (GLP) and in according to the OECD (Organisation for Economic Co-operation and Development) guidelines in order to certify its safety for medical use. Those guidelines comprises series of technical recommendations performed to assure quality of experiments. The study chose Ubiquicidin 29-41, an antimicrobial peptide used to discriminate bacterial infection foci from inflammatory sites. Amounts of UBI{sub 29-41} were conjugated or not to {sup 99m}Tc and diluted to equivalent concentrations of 10, 100 and 1000% of the maximum dose (or activity) administered in adults. Possible cytotoxic effects were evaluated in comparison to untreated controls as well as positive and negative damage controls. Both full (radioactive) radiopharmaceuticals, as their precursors (only molecules without conjugation to isotopes) showed no significant cytotoxic effect (cytotoxicity ≤ 10%). The study was conducted for the first time in the country comprising preclinical testing of this radiopharmaceutical in accordance with internationally accepted quality parameters, ensuring the safety of its use and enabling inclusion in the pharmaceutical regulatory agenda. (author)
In vitro analysis of cytotoxic T cell recruitment mediated by the DC-derived chemokine CCL17
sprotocols
2015-01-01
Dendritic cell (DC) licensing in cross-priming requires physical interaction of several rare immune cells, i.e. cytotoxic T cells (CTL), and cross-presenting DCs. Here we describe a novel in vitro method of analyzing chemokine effects on complex recruitment events in a multi-cellular system. To study CTL recruitment towards CCL17-producing DCs, we established a co-culture system of murine splenic DCs with polyclonal splenic CTL from donor mice, which enables visualization of cell motility and...
Cytotoxic Effects of Dillapiole on Embryonic Development of Mouse Blastocysts in Vitro and in Vivo
Directory of Open Access Journals (Sweden)
Wen-Hsiung Chan
2014-06-01
Full Text Available We examined the cytotoxic effects of dillapiole, a phenylpropanoid with antileishmanial, anti-inflammatory, antifungal, and acaricidal activities, on the blastocyst stage of mouse embryos, subsequent embryonic attachment and outgrowth in vitro, and in vivo implantation via embryo transfer. Blastocysts treated with 2.5–10 μM dillapiole exhibited a significant increase in apoptosis and corresponding decrease in total cell number. Notably, the implantation success rates of blastocysts pretreated with dillapiole were lower than those of their control counterparts. Moreover, in vitro treatment with 2.5–10 μM dillapiole was associated with increased resorption of post-implantation embryos and decreased fetal weight. Our results collectively indicate that dillapiole induces apoptosis and retards early post-implantation development, both in vitro and in vivo. However, the extent to which this organic compound exerts teratogenic effects on early human development is not known at present. Further studies are required to establish effective protection strategies against the cytotoxic effects of dillapiole.
Directory of Open Access Journals (Sweden)
JunFeng Dong
Full Text Available Reconstruction materials currently used in clinical for osteoarticular tuberculosis (TB are unsatisfactory due to a variety of reasons. Rifampicin (RFP is a well-known and highly effective first-line anti-tuberculosis (anti-TB drug. Poly-DL-lactide (PDLLA and nano-hydroxyapatite (nHA are two promising materials that have been used both for orthopedic reconstruction and as carriers for drug release. In this study we report the development of a novel anti-TB implant for osteoarticular TB reconstruction using a combination of RFP, PDLLA and nHA.RFP, PDLLA and nHA were used as starting materials to produce a novel anti-TB activity implant by the solvent evaporation method. After manufacture, the implant was characterized and its biodegradation and drug release profile were tested. The in vitro cytotoxicity of the implant was also evaluated in pre-osteoblast MC3T3-E1 cells using multiple methodologies.A RFP/PDLLA/nHA composite was successfully synthesized using the solvent evaporation method. The composite has a loose and porous structure with evenly distributed pores. The production process was steady and no chemical reaction occurred as proved by Fourier Transform Infrared Spectroscopy (FTIR and X-Ray Diffraction (XRD. Meanwhile, the composite blocks degraded and released drug for at least 12 weeks. Evaluation of in vitro cytotoxicity in MC3T3-E1 cells verified that the synthesized composite blocks did not affect cell growth and proliferation.It is feasible to manufacture a novel bioactive anti-TB RFP/PDLLA/nHA composite by the solvent evaporation method. The composite blocks showed appropriate properties such as degradation, drug release and biosafety to MC3T3-E1 cells. In conclusion, the novel composite blocks may have great potential for clinical applications in repairing bone defects caused by osteoarticular TB.
In vitro cytotoxicity of maxillofacial silicone elastomers: effect of accelerated aging.
Bal, Bilge Turhan; Yilmaz, Handan; Aydin, Cemal; Karakoca, Seçil; Yilmaz, Sükran
2009-04-01
The purpose of this in vitro study was to evaluate the cytotoxicity of three maxillofacial silicone elastomers at 24, 48, and 72 h on L-929 cells and to determine the effect of accelerated aging on the cytotoxicity of these silicone elastomers. Disc-shaped test samples of maxillofacial silicone elastomers (Cosmesil, Episil, Multisil) were fabricated according to manufacturers' instructions under aseptic conditions. Samples were then divided into three groups: (1) not aged; (2) aged for 150 h with an accelerated weathering tester; and (3) aged for 300 h. Then the samples were placed in Dulbecco's Modified Eagle Medium/Ham's F12 (DMEM/F12) for 24, 48, and 72 h. After the incubation periods, cytotoxicity of the extracts to cultured fibroblasts (L-929) was measured by MTT assay. The degree of cytotoxicity of each sample was determined according to the reference value represented by the cells with a control (culture without sample). Statistical significance was determined by repeated measurement ANOVA (p test (p test materials in each group demonstrated high survival rates in MTT assay (Episil; 93.84%, Multisil; 88.30%, Cosmesil; 87.50%, respectively); however, in all groups, Episil material demonstrated significantly higher cell survival rate after each of the experimental incubation periods (p Accelerated aging for 150 and 300 h had no significant effect on the biocompatibility of maxillofacial silicone elastomers tested (p > 0.05).
In vitro cytotoxicity of chemical preservatives on human fibroblast cells
Directory of Open Access Journals (Sweden)
Daniel Gonsales Spindola
2018-05-01
Full Text Available ABSTRACT Preservatives are widely used substances that are commonly added to various cosmetic and pharmaceutical products to prevent or inhibit microbial growth. In this study, we compared the in vitro cytotoxicity of different types of currently used preservatives, including methylparaben, imidazolidinyl urea (IMU, and sodium benzoate, using the human newborn fibroblast cell line CCD1072Sk. Of the tested preservatives, only IMU induced a reduction in cell viability, as shown using the MTT assay and propidium iodide staining (IMU>methylparaben>sodium benzoate. IMU was shown to promote homeostatic alterations potentially related to the initiation of programed cell death, such as decreased mitochondrial membrane potential and caspase-3 activation, in the treated cells. Methylparaben and sodium benzoate were shown to have a very low cytotoxic activity. Taken together, our results suggest that IMU induces programed cell death in human fibroblasts by a canonical intrinsic pathway via mitochondrial perturbation and subsequent release of proapoptotic factors.
In vitro bioactivity and cytotoxicity of chemically treated glass fibers
Directory of Open Access Journals (Sweden)
Ângela Leão Andrade
2004-12-01
Full Text Available Samples of a commercial glass fiber FM® (Fiber Max were used to test the efficacy of a chemical sol-gel surface treatment to enhance their bioactivity. After treatment with tetraethoxysilane (TEOS, individual fiber samples were soaked into a simulated body fluid (SBF solution, from which they were removed at intervals of 5 and 10 days. Micrographs obtained by scanning electron microscopy (SEM analysis of samples chemically treated with TEOS revealed the formation of a hydroxyapatite (HA coating layer after 5 days into SBF solution. Fourier transform infrared spectroscopic (FTIR analyses confirmed that the coating layer has P-O vibration bands characteristic of HA. The in vitro cytotoxicity was evaluated using a direct contact test, minimum essential medium elution test (ISO 10993-5 and MTT assay. Fibers immersed in SBF and their extracts exhibited lower cytotoxicity than the controls not subjected to immersion, suggesting that SBF treatment improves the biocompatibility of the fiber.
Zarai, Zied; Ben Chobba, Ines; Ben Mansour, Riadh; Békir, Ahmed; Gharsallah, Néji; Kadri, Adel
2012-08-13
The aim of the present study was to appraise the antimicrobial activity of Ricinus communis L. essential oil against different pathogenic microorganisms and the cytotoxic activity against HeLa cell lines. The agar disk diffusion method was used to study the antibacterial activity of Ricinus communis L. essential oil against 12 bacterial and 4 fungi strains. The disc diameters of zone of inhibition (DD), the minimum inhibitory concentrations (MIC) and the concentration inhibiting 50% (IC50) were investigated to characterize the antimicrobial activities of this essential oil. The in vitro cytotoxicity of Ricinus communis L. essential oil was examined using a modified MTT assay; the viability and the IC50 were used to evaluate this test. The essential oil from the leaves of Ricinus communis L. was analyzed by GC-MS and bioassays were carried out. Five constituents of the oil were identified by GC-MS. The antimicrobial activity of the oil was investigated in order to evaluate its efficacy against twelve bacteria and four fungi species, using disc diffusion and minimum inhibitory concentration methods. The essential oil showed strong antimicrobial activity against all microorganisms tested with higher sensitivity for Bacillus subtilis, Staphylococcus aureus and Enterobacter cloacae. The cytotoxic and apoptotic effects of the essential oil on HeLa cell lines were examined by MTT assay. The cytotoxicity of the oil was quite strong with IC50 values less than 2.63 mg/ml for both cell lines. The present study showed the potential antimicrobial and anticarcinogenic properties of the essential oil of Ricinus communis L., indicating the possibilities of its potential use in the formula of natural remedies for the topical treatment of infections.
In vitro cytotoxicity of the ternary PAMAM G3–pyridoxal–biotin bioconjugate
Directory of Open Access Journals (Sweden)
Uram Ł
2013-12-01
Full Text Available Łukasz Uram, Magdalena Szuster, Krzysztof Gargasz, Aleksandra Filipowicz, Elżbieta Wałajtys-Rode, Stanisław Wołowiec Cosmetology Department, University of Information Technology and Management in Rzeszów, Rzeszów, Poland Abstract: A third-generation polyamidoamine dendrimer (PAMAM G3 was used as a macromolecular carrier for pyridoxal and biotin. The binary covalent bioconjugate of G3, with nine molecules of biotin per one molecule of G3 (G39B, and the ternary covalent bioconjugate of G3, with nine biotin and ten pyridoxal molecules (G39B10P, were synthesized. The biotin and pyridoxal residues of the bioconjugate were available for carboxylase and transaminase enzymes, as demonstrated in the conversion of pyruvate to oxaloacetate and alanine to pyruvate, respectively, by in vitro monitoring of the reactions, using 1H nuclear magnetic resonance spectroscopy. The toxicity of the ternary bioconjugate (BC-PAMAM was studied in vitro on BJ human normal skin fibroblasts and human squamous cell carcinoma (SCC-15 cell cultures in comparison with PAMAM G3, using three cytotoxicity assays (XTT, neutral red, and crystal violet and an estimation of apoptosis by confocal microscopy detection. The tests have shown that BC-PAMAM has significantly lower cytotoxicity compared with PAMAM. Nonconjugated PAMAM was not cytotoxic at concentrations up to 5 µM (NR and 10 µM (XTT, and BC-PAMAM was not cytotoxic up to 50 µM (both assays for both cell lines. It has been also found that normal fibroblasts were more sensitive than SCC to both PAMAM and BC-PAMAM. The effect of PAMAM and BC-PAMAM on the initiation of apoptosis (PAMAM in fibroblasts at 5 µM and BC-PAMAM at 10 µM in both cell lines corresponded with cytotoxicity assays for both cell lines. We concluded that normal fibroblasts are more sensitive to the cytotoxic effects of the PAMAM G3 dendrimer and that modification of its surface cationic groups by substitution with biologically active molecules
Cytotoxic effects of betaxolol on healthy corneal endothelial cells both in vitro and in vivo
Directory of Open Access Journals (Sweden)
Ying Miao
2014-02-01
Full Text Available AIM: To demonstrate the cytotoxic effect of betaxolol and its underlying mechanism on human corneal endothelial cells(HCE cells in vitro and cat corneal endothelial cells(CCE cells in vivo, providing experimental basis for safety anti-glaucoma drug usage in clinic of ophthalmology.METHODS: In vivo and in vitro experiments were conducted to explore whether and how betaxolol participates in corneal endothelial cell injury. The in vitro morphology, growth status, plasma membrane permeability, DNA fragmentation, and ultrastructure of HCE cells treated with 0.021875-0.28g/L betaxolol were examined by light microscope, 3-(4,5-dimethylthiahiazo (-z-y1-3,5-di-phenytetrazoliumromide (MTT assay, acridine orange (AO/ethidium bromide (EB double-fluorescent staining, DNA agarose gel electrophoresis, and transmission electron microscope (TEM. The in vivo density, morphology, and ultrastructure of CCE cells, corneal thickness, and eye pressure of cat eyes treated with 0.28g/L betaxolol were investigated by specular microscopy, applanation tonometer, alizarin red staining, scanning electron microscope (SEM, and TEM.RESULTS: Exposure to betaxolol at doses from 0.0875g/L to 2.8g/L induced morphological and ultrastructural changes of in vitro cultured HCE cells such as cytoplasmic vacuolation, cellular shrinkage, structural disorganization, chromatin condensation, and apoptotic body appearance. Simultaneously, betaxolol elevated plasma membrane permeability and induced DNA fragmentation of these cells in a dose-dependent manner in AO/EB staining. Furthermore, betaxolol at a dose of 2.8g/L also induced decrease of density of CCE cells in vivo, and non-hexagonal and shrunk apoptotic cells were also found in betaxolol-treated cat corneal endothelia.CONCLUSION: Betaxolol has significant cytotoxicity on HCE cells in vitro by inducing apoptosis of these cells, and induced apoptosis of CCE cells in vivo as well. The findings help provide new insight into the apoptosis
Czajkowska-Kośnik, Anna; Wolska, Eliza; Chorążewicz, Juliusz; Sznitowska, Małgorzata
2015-01-01
The in vivo model on rabbit eyes and the in vitro cytotoxicity on fibroblasts were used to compare irritation effect of aqueous and oily (Miglyol 812) solutions of surfactants. Tween 20, Tween 80 and Cremophor EL were tested in different concentrations (0.1, 1 or 5%) and the in vitro test demonstrated that surfactants in oil are less cytotoxic than in aqueous solutions. In the in vivo study, the aqueous solutions of surfactants were characterized as non-irritant while small changes in conjunctiva were observed after application the oily solutions of surfactants and the preparations were classified as slightly irritant, however this effect was similar when Miglyol was applied alone. In conclusion, it is reported that the MTT assay does not correlate well with the Draize scores.
In vitro cytotoxicity of nanoparticles in mammalian germline stem cells.
Braydich-Stolle, Laura; Hussain, Saber; Schlager, John J; Hofmann, Marie-Claude
2005-12-01
Gametogenesis is a complex biological process that is particularly sensitive to environmental insults such as chemicals. Many chemicals have a negative impact on the germline, either by directly affecting the germ cells, or indirectly through their action on the somatic nursing cells. Ultimately, these effects can inhibit fertility, and they may have negative consequences for the development of the offspring. Recently, nanomaterials such as nanotubes, nanowires, fullerene derivatives (buckyballs), and quantum dots have received enormous national attention in the creation of new types of analytical tools for biotechnology and the life sciences. Despite the wide application of nanomaterials, there is a serious lack of information concerning their impact on human health and the environment. Thus, there are limited studies available on toxicity of nanoparticles for risk assessment of nanomaterials. The purpose of this study was to assess the suitability of a mouse spermatogonial stem cell line as a model to assess nanotoxicity in the male germline in vitro. The effects of different types of nanoparticles on these cells were evaluated by light microscopy, and by cell proliferation and standard cytotoxicity assays. Our results demonstrate a concentration-dependent toxicity for all types of particles tested, whereas the corresponding soluble salts had no significant effect. Silver nanoparticles were the most toxic while molybdenum trioxide (MoO(3)) nanoparticles were the least toxic. Our results suggest that this cell line provides a valuable model with which to assess the cytotoxicity of nanoparticles in the germ line in vitro.
International Nuclear Information System (INIS)
Jiménez-Medina, Eva; Berruguilla, Enrique; Romero, Irene; Algarra, Ignacio; Collado, Antonia; Garrido, Federico; Garcia-Lora, Angel
2008-01-01
Protein-bound polysaccharide (PSK) is derived from the CM-101 strain of the fungus Coriolus versicolor and has shown anticancer activity in vitro and in in vivo experimental models and human cancers. Several randomized clinical trials have demonstrated that PSK has great potential in adjuvant cancer therapy, with positive results in the adjuvant treatment of gastric, esophageal, colorectal, breast and lung cancers. These studies have suggested the efficacy of PSK as an immunomodulator of biological responses. The precise molecular mechanisms responsible for its biological activity have yet to be fully elucidated. The in vitro cytotoxic anti-tumour activity of PSK has been evaluated in various tumour cell lines derived from leukaemias, melanomas, fibrosarcomas and cervix, lung, pancreas and gastric cancers. Tumour cell proliferation in vitro was measured by BrdU incorporation and viable cell count. Effect of PSK on human peripheral blood lymphocyte (PBL) proliferation in vitro was also analyzed. Studies of cell cycle and apoptosis were performed in PSK-treated cells. PSK showed in vitro inhibition of tumour cell proliferation as measured by BrdU incorporation and viable cell count. The inhibition ranged from 22 to 84%. Inhibition mechanisms were identified as cell cycle arrest, with cell accumulation in G 0 /G 1 phase and increase in apoptosis and caspase-3 expression. These results indicate that PSK has a direct cytotoxic activity in vitro, inhibiting tumour cell proliferation. In contrast, PSK shows a synergistic effect with IL-2 that increases PBL proliferation. These results indicate that PSK has cytotoxic activity in vitro on tumour cell lines. This new cytotoxic activity of PSK on tumour cells is independent of its previously described immunomodulatory activity on NK cells
Cadagan, David; Merry, Stephen
2013-10-01
Modulating agents are used to circumvent drug resistance in the clinical setting. However achievable serum concentrations are often lower than those which are optimal in vitro. Combination of modulating agents with non-overlapping toxicities may overcome this obstacle. We have investigated combinations of three modulating agents (quinine, verapamil, and cinnarizine) to circumvent inherent or acquired resistance to the cytotoxic drugs doxorubicin, vincristine and paclitaxel. Dose-response curves to cytotoxic drugs in the presence/absence of modulating agents were determined using colony formation and cell proliferation assays. Doxorubicin accumulation into cell monolayers was measured by fluorescence spectrophotometry. Greater (1.9-fold) sensitisation to particular cytotoxic drugs was observed for certain combinations of modulating agents compared to individual effects. The most effective combination was quinine-plus-verapamil with the cytotoxic drug doxorubicin. This increase in sensitivity was associated with increased doxorubicin accumulation. Such enhanced activity was, however, not observed for all combinations of modulating agents or for all studied cytotoxic drugs. The findings of the present study suggest certain combinations of modulating agents to have a clinical role in circumventing drug resistance. Particular combinations of modulating agents must be carefully chosen to suit particular cytotoxic drug treatments.
Directory of Open Access Journals (Sweden)
Ricardo C. Calhelha
2014-01-01
Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.
Ige, Pradum P; Pardeshi, Sagar R; Sonawane, Raju O
2018-04-17
The aim of this work was to evaluate the in vitro performance of nebulized nanosuspension formulation when nebulized using ultrasonic nebulizer. The present investigation deals with successful formulation of Beclomethasone dipropionate loaded HPMCP nanospheres prepared by solvent evaporation technique using PEG 400 as a stabilizer. Beclomethasone dipropionate is a water insoluble drug molecule was encapsulated in HPMCP nanospheres to have pH dependent solubility at basic pH for targeted drug delivery in lung and studied for in vitro cytotoxicity and immediate release capability. The synthesized nanospheres were characterized through drug excipient compatibility, surface topography; mean particle size , zeta potential, PDI, entrapment efficiency and drug loading, in vitro diffusion, aerodynamic, in vitro cytotoxicity and stability studies. The mean particle size and PDI of the optimized batch (F1) had 197.6±0.40 nm and 0.324 ±0.35, respectively. The % entrapment efficiency and % drug loading was found to be 86.56±1.32 and 8.30±0.27, respectively. The optimized batch F1 showed % cumulative drug release 94.77±0.24 at 1 h. The formulation showed cell viability up to 91.28%. It can be concluded that, Beclomethasone dipropionate loaded HPMCP nanospheres was found to be safe, stable with significant increase in solubility and bypass the liver. © Georg Thieme Verlag KG Stuttgart · New York.
In vitro anthelmintic and cytotoxicity activities the Digitaria insularis (Poaceae).
Santos, Francianne Oliveira; de Lima, Hélimar Gonçalves; de Souza Santos, Nathália Silva; Serra, Taiane Menezes; Uzeda, Rosângela Soares; Reis, Isabella Mary Alves; Botura, Mariana Borges; Branco, Alexsandro; Batatinha, Maria José Moreira
2017-10-15
This study aimed to evaluate the in vitro activity of D. insularis extracts and fractions against gastrointestinal nematodes of goats and its cytotoxicity on Vero cells. The egg hatch (EHT) and larval motility (LMT) tests were conducted to investigate the anthelmintic effects of the crude hydroethanolic (CH), ethyl acetate (EA), butanolic (BT) and residual hydroethanolic (RH) extracts. The elution of the active extract (EA) on column chromatography (SiO 2 ) using organic solvents furnished six fractions (FR1 to FR6), which were also tested. Cytotoxicity was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and Trypan Blue exclusion assays. All extracts, FR2 and FR3, inhibited egg hatching in a concentration-dependent manner. The EHT led to EC 50 values (effective concentration 50%) of 0.64; 0.69; 0.77; 0.96; 0.27 and 0.65mg/mL for CH, EA, BT, RH, FR2 and FR3, respectively. However, the extracts exhibited low effect on the motility of L 3. In the cytotoxicity evaluation (MTT assay), the IC 50 (inhibitory concentration 50%) was 1.18 (EA), 1.65 (FR2) and 1.59mg/mL (FR3), which was relatively high (low toxicity) in comparison to the EC 50 values in EHT, mainly for FR2. The chemical analyses of most active fractions (FR2) by Liquid Chromatography coupled to Mass Spectrometry (LC-MS) led the characterization of the flavones tricin and diosmetin. These results showed the high anthelmintic effect and low cytotoxicity of D. insularis and also that the flavones can be probably responsible for the nematocidal activity of this plant. Copyright © 2017 Elsevier B.V. All rights reserved.
Genotoxicity and cytotoxicity induced by eluates from orthodontic glass ionomer cements in vitro
Directory of Open Access Journals (Sweden)
Fernanda Angelieri
2018-01-01
Full Text Available The aim of this study was to investigate genotoxicity and cytotoxicity of some orthodontic glass ionomer cements commercially available by means of the single cell gel (comet assay. For this purpose, five commercial orthodontic glass ionomer cements (Vidrion C®, Meron®, Optiband®, Multicure® and Ultra Band Lok® were tested in murine fibroblasts in vitro. For this purpose, eluates from each cement were prepared according manufactures instructions at 0, 2, 4, 8, 18, 32 and 64 days of immersion in artificial saliva at 37 °C. All orthodontic glass ionomer cements failed to induce cytotoxicity to murine fibroblasts for all periods evaluated in this study. However, Vidrion C® was able to induce genotoxicity after 64 days of exposure to eluates. Meron® also demonstrated genotoxicity as depicted by increasing DNA damage on 2nd day. Multicure® demonstrated genotoxicity on 32nd day and Ultra band Lok on 18th, 32nd days of exposure. Taken together, our results demonstrated that orthodontic cements derived from resin-modified glass ionomer composite (Multicure® and compomer (Ultra Band Lok® cause genetic damage in mammalian cells in vitro.
Directory of Open Access Journals (Sweden)
Fatemeh Zeraati
2010-12-01
Full Text Available Background: One of the major paths for drug development isthe study of bioactivities of natural products. Therefore, theaim of this study was to compare the cytotoxic effects ofaqueous extract of whole Cuscuta chinensis Lam., which is atraditional medicinal herb commonly used in Iran and otheroriental countries, on the human caucasian acute lymphoblasticleukemia (CCRF-CEM and another human lymphocyte,Jurkat (JM cell lines.Methods: In vitro cytotoxic screening with various concentrations(0, 0.1, 1, 10, 25 and 50 μg/ml of the extract wasperformed using microscope and methyl tetrazolium bromidetest (MTT.Results: The minimum effective concentration of the plantextract was 1 μg/ml, and increasing the dose to 10 μg/mlinduced increasingly stronger effects. The inhibitory concentration50% (IC50 of the extract against CCRF wasabout 3 μg/ml in 24 hours and 2.5 μg/ml in 48 hrs. In contrast,the extract did not have cytotoxic effect for the JMcells at these doses.Conclusion: The findings of the present study suggest that C.chinensis is toxic against CCRF-CEM and JM tumor cells.Whether or not such effects can be employed for the treatmentof such tumors must await future studies.Iran J Med Sci 2010; 35(4: 310-314.
Guo, Xiaoqing; Li, Yan; Yan, Jian; Ingle, Taylor; Jones, Margie Yvonne; Mei, Nan; Boudreau, Mary D; Cunningham, Candice K; Abbas, Mazhar; Paredes, Angel M; Zhou, Tong; Moore, Martha M; Howard, Paul C; Chen, Tao
2016-11-01
The physicochemical characteristics of silver nanoparticles (AgNPs) may greatly alter their toxicological potential. To explore the effects of size and coating on the cytotoxicity and genotoxicity of AgNPs, six different types of AgNPs, having three different sizes and two different coatings, were investigated using the Ames test, mouse lymphoma assay (MLA) and in vitro micronucleus assay. The genotoxicities of silver acetate and silver nitrate were evaluated to compare the genotoxicity of nanosilver to that of ionic silver. The Ames test produced inconclusive results for all types of the silver materials due to the high toxicity of silver to the test bacteria and the lack of entry of the nanoparticles into the cells. Treatment of L5718Y cells with AgNPs and ionic silver resulted in concentration-dependent cytotoxicity, mutagenicity in the Tk gene and the induction of micronuclei from exposure to nearly every type of the silver materials. Treatment of TK6 cells with these silver materials also resulted in concentration-dependent cytotoxicity and significantly increased micronucleus frequency. With both the MLA and micronucleus assays, the smaller the AgNPs, the greater the cytotoxicity and genotoxicity. The coatings had less effect on the relative genotoxicity of AgNPs than the particle size. Loss of heterozygosity analysis of the induced Tk mutants indicated that the types of mutations induced by AgNPs were different from those of ionic silver. These results suggest that AgNPs induce cytotoxicity and genotoxicity in a size- and coating-dependent manner. Furthermore, while the MLA and in vitro micronucleus assay (in both types of cells) are useful to quantitatively measure the genotoxic potencies of AgNPs, the Ames test cannot.
Directory of Open Access Journals (Sweden)
Claudio Costa Oliveira Filho
2018-04-01
Full Text Available ABSTRACT The objective was to investigate the total saponin and protodioscin concentrations and the cytotoxicity in vitro, of five samples of the plant Tribulus terrestris, commercially available in the metropolitan region of Vitória - Espirito Santo, Brazil, and to compare them with the aqueous extract of the plant. The chromatographic profile and quantification of protodioscin in commercial samples and plant extract were evaluated by LC-MS/MS. The percentage of total saponins were determined by the colorimetric method. Extracts and protodioscin cytotoxicity were analyzed by the MTT assay in three cell lineages: fibroblasts (L929, ovarian cancer (Ovcar3 and murine hepatoma (Hepa1c1c7. All extracts displayed high levels of total saponins (207.2 to 780.3 mg g-1 of dry extract. The chromatographic profile revealed a wide diversity of compounds, and the saponin protodioscin was detected in only two extracts. One extract displayed high cytotoxicity, with IC50 values of 157.0, 38.2 and 7.4 µg mL-1 for the Ovcar3, Hepa1c1c7 and L929 cell lines, respectively. The other extracts displayed cytotoxic effects only at concentrations equal to or greater than 125.0 µg mL-1. Surprisingly, the most cytotoxic extract displayed the highest protodioscin concentration. Therefore, it is suggested that these products be marketed with caution, and followed-up by a certified healthcare professional.
Directory of Open Access Journals (Sweden)
Collado Antonia
2006-05-01
Full Text Available Abstract Background Phytopharmacological studies of different Calendula extracts have shown anti-inflamatory, anti-viral and anti-genotoxic properties of therapeutic interest. In this study, we evaluated the in vitro cytotoxic anti-tumor and immunomodulatory activities and in vivo anti-tumor effect of Laser Activated Calendula Extract (LACE, a novel extract of the plant Calendula Officinalis (Asteraceae. Methods An aqueous extract of Calendula Officinalis was obtained by a novel extraction method in order to measure its anti-tumor and immunomodulatory activities in vitro. Tumor cell lines derived from leukemias, melanomas, fibrosarcomas and cancers of breast, prostate, cervix, lung, pancreas and colorectal were used and tumor cell proliferation in vitro was measured by BrdU incorporation and viable cell count. Effect of LACE on human peripheral blood lymphocyte (PBL proliferation in vitro was also analyzed. Studies of cell cycle and apoptosis were performed in LACE-treated cells. In vivo anti-tumor activity was evaluated in nude mice bearing subcutaneously human Ando-2 melanoma cells. Results The LACE extract showed a potent in vitro inhibition of tumor cell proliferation when tested on a wide variety of human and murine tumor cell lines. The inhibition ranged from 70 to 100%. Mechanisms of inhibition were identified as cell cycle arrest in G0/G1 phase and Caspase-3-induced apoptosis. Interestingly, the same extract showed an opposite effect when tested on PBLs and NKL cell line, in which in vitro induction of proliferation and activation of these cells was observed. The intraperitoneal injection or oral administration of LACE extract in nude mice inhibits in vivo tumor growth of Ando-2 melanoma cells and prolongs the survival day of the mice. Conclusion These results indicate that LACE aqueous extract has two complementary activities in vitro with potential anti-tumor therapeutic effect: cytotoxic tumor cell activity and lymphocyte activation
In vitro cytotoxity of silver: implication for clinical wound care.
Poon, Vincent K M; Burd, Andrew
2004-03-01
In this study, we look at the cytotoxic effects of silver on keratinocytes and fibroblasts. We have assessed the viability of monolayer cultures using the MTT and BrdU assays. The composition of the culture medium and also the culture technique were modified to assess the effects of culture 'environment' on the susceptibility of the cells to the toxic action of silver. Further in vitro, experiments were performed using tissue culture models to allow cellular behavior in three dimensional planes which more closely simulated in vivo behavior. The silver source was both silver released from silver nitrate solution but also nanocrystalline silver released from a commercially available dressing. The results show that silver is highly toxic to both keratinocytes and fibroblasts in monolayer culture. When using optimized and individualized culture the fibroblasts appear to be more sensitive to silver than keratinocytes. However, when both cell types were grown in the same medium their viability was the same. Using tissue culture models again indicated an 'environmental effect' with decreased sensitivity of the cells to the cytotoxic effects of the silver. Nevertheless in these studies the toxic dose of skin cells ranging from 7 x 10(-4) to 55 x 10(-4)% was similar to that of bacteria. These results suggest that consideration of the cytotoxic effects of silver and silver-based products should be taken when deciding on dressings for specific wound care strategies. This is important when using keratinocyte culture, in situ, which is playing an increasing role in contemporary wound and burn care.
Natural mineral particles are cytotoxic to rainbow trout gill epithelial cells in vitro.
Directory of Open Access Journals (Sweden)
Christian Michel
Full Text Available Worldwide increases in fluvial fine sediment are a threat to aquatic animal health. Fluvial fine sediment is always a mixture of particles whose mineralogical composition differs depending on the sediment source and catchment area geology. Nonetheless, whether particle impact in aquatic organisms differs between mineral species remains to be investigated. This study applied an in vitro approach to evaluate cytotoxicity and uptake of four common fluvial mineral particles (quartz, feldspar, mica, and kaolin; concentrations: 10, 50, 250 mg L(-1 in the rainbow trout epithelial gill cell line RTgill-W1. Cells were exposed for 24, 48, 72, and 96 h. Cytotoxicity assays for cell membrane integrity (propidium iodide assay, oxidative stress (H2DCF-DA assay, and metabolic activity (MTT assay were applied. These assays were complemented with cell counts and transmission electron microscopy. Regardless of mineral species, particles ≤ 2 µm in diameter were taken up by the cells, suggesting that particles of all mineral species came into contact and interacted with the cells. Not all particles, however, caused strong cytotoxicity: Among all assays the tectosilicates quartz and feldspar caused sporadic maximum changes of 0.8-1.2-fold compared to controls. In contrast, cytotoxicity of the clay particles was distinctly stronger and even differed between the two particle types: mica induced concentration-dependent increases in free radicals, with consistent 1.6-1.8-fold-changes at the 250 mg L(-1 concentration, and a dilated endoplasmic reticulum. Kaolin caused concentration-dependent increases in cell membrane damage, with consistent 1.3-1.6-fold increases at the 250 mg L(-1 concentration. All effects occurred in the presence or absence of 10% fetal bovine serum. Cell numbers per se were marginally affected. Results indicate that (i. natural mineral particles can be cytotoxic to gill epithelial cells, (ii. their cytotoxic potential differs between mineral
In Vitro antibacterial and in Vivo cytotoxic activities of Grewia paniculata
Directory of Open Access Journals (Sweden)
Mahmuda Nasrin
2015-02-01
Full Text Available Objectives: Grewia paniculata (Family: Malvaceae has been used to treat inflammation, respiratory disorders and fever. It is additionally employed for other health conditions including colds, diarrhea and as an insecticide in Bangladesh. The aim of the present study was to investigate the antibacterial and cytotoxic activities of different extracts of Grewia paniculata. Materials and Methods: The antibacterial activity was evaluated against both gram negative and gram positive bacteria using disc diffusion method by determination of the diameter of zone of inhibition. Cytotoxic activity was performed by brine shrimp (Artemia salina lethality bioassay. Results: In disc diffusion method, all the natural products (400 μg/disc showed moderate to potent activity against all the tested bacteria. The ethanol extract of bark (EEB and ethanol fraction of bark (EFB (400 μg/disc exhibited highest activity against Shigella dysenteriae with a zone of inhibition of 23±1.63 mm and 23±1.77 mm respectively. In the brine shrimp lethality bioassay all the extracts showed moderate cytotoxic activity when compared with the standard drug vincristin sulphate. For example, LC50 value of the ethanol fraction of bark (EFB was 3.01 μg/ml while the LC50 of vincristine sulphate was 0.52 μg/ml. Conclusions: The results suggest that all the natural products possess potent antibacterial and moderate cytotoxic.
An in vitro evaluation of cytotoxicity of curcumin against human dental pulp fibroblasts
Directory of Open Access Journals (Sweden)
Praveenkumar S Mandrol
2016-01-01
Full Text Available Objective: The objective of this study was to evaluate the cytotoxicity of curcumin to primary dental pulp fibroblasts in vitro. Materials and Methods: Dental pulp fibroblasts from primary maxillary central incisors were cultured and used for cytotoxicity tests after the fourth passage. Ninety-five percent curcumin was diluted with dimethylsulfoxide to prepare 100%, 50%, and 25% concentrations. Each concentration of curcumin was added in triplicate into 96-well microtiter plate containing the fibroblast culture at 104/well. Cells without treatment served as a control group. The number of viable cells after 48 hrs incubation at 37°C in a humidified atmosphere of 5 % CO2 and 95 % air was determined by the 3-(4, 5-dimethyl-thiazol-2-yl-2, 5-diphenyl-tetrazolium bromide (MTT assay. The relative viability of pulp cells was expressed as color intensity of the number in the experimental wells relative to that of the control group. Absorbances were read at 492 nm on a microplate reader with a background subtraction at 620 nm. Results: Cell viability of primary dental pulp fibroblasts to 25%, 50%, and 100% curcumin concentration was 174%, 310%, and 317%, respectively. Conclusions: Curcumin promotes cell viability and induces proliferation of primary dental pulp fibroblasts and has the potential to be developed into an economical and reliable medicament for vital pulp therapy.
Directory of Open Access Journals (Sweden)
Patrícia Mathias Döll-Boscardin
2012-01-01
Full Text Available Eucalyptus L. is traditionally used for many medicinal purposes. In particular, some Eucalyptus species have currently shown cytotoxic properties. Local Brazilian communities have used leaves of E. benthamii as a herbal remedy for various diseases, including cancer. Considering the lack of available data for supporting this cytotoxic effect, the goal of this paper was to study the in vitro cytotoxic potential of the essential oils from young and adult leaves of E. benthamii and some related terpenes (α-pinene, terpinen-4-ol, and γ-terpinene on Jurkat, J774A.1 and HeLa cells lines. Regarding the cytotoxic activity based on MTT assay, the essential oils showed improved results than α-pinene and γ-terpinene, particularly for Jurkat and HeLa cell lines. Terpinen-4-ol revealed a cytotoxic effect against Jurkat cells similar to that observed for volatile oils. The results of LDH activity indicated that cytotoxic activity of samples against Jurkat cells probably involved cell death by apoptosis. The decrease of cell DNA content was demonstrated due to inhibition of Jurkat cells proliferation by samples as a result of cytotoxicity. In general, the essential oils from young and adult leaves of E. benthamii presented cytotoxicity against the investigated tumor cell lines which confirms their antitumor potential.
Döll-Boscardin, Patrícia Mathias; Sartoratto, Adilson; Sales Maia, Beatriz Helena Lameiro de Noronha; Padilha de Paula, Josiane; Nakashima, Tomoe; Farago, Paulo Vitor; Kanunfre, Carla Cristine
2012-01-01
Eucalyptus L. is traditionally used for many medicinal purposes. In particular, some Eucalyptus species have currently shown cytotoxic properties. Local Brazilian communities have used leaves of E. benthamii as a herbal remedy for various diseases, including cancer. Considering the lack of available data for supporting this cytotoxic effect, the goal of this paper was to study the in vitro cytotoxic potential of the essential oils from young and adult leaves of E. benthamii and some related terpenes (α-pinene, terpinen-4-ol, and γ-terpinene) on Jurkat, J774A.1 and HeLa cells lines. Regarding the cytotoxic activity based on MTT assay, the essential oils showed improved results than α-pinene and γ-terpinene, particularly for Jurkat and HeLa cell lines. Terpinen-4-ol revealed a cytotoxic effect against Jurkat cells similar to that observed for volatile oils. The results of LDH activity indicated that cytotoxic activity of samples against Jurkat cells probably involved cell death by apoptosis. The decrease of cell DNA content was demonstrated due to inhibition of Jurkat cells proliferation by samples as a result of cytotoxicity. In general, the essential oils from young and adult leaves of E. benthamii presented cytotoxicity against the investigated tumor cell lines which confirms their antitumor potential. PMID:22645627
Bano, Shaista; Siddiqui, Bina Shaheen; Farooq, Ahsana Dar; Begum, Sabira; Siddiqui, Faheema; Kashif, Muhammad; Azhar, Mudassar
2017-12-01
Several Euphorbia species have been used in folklore as cancer remedies, however, scientific studies on the cytotoxicity (in vitro studies) of Euphorbia caducifolia are lacking. In present study, anticancer potential of E. caducifolia aerial parts ethanol extract and its fractions were evaluated against human lung (NCI-H460), breast (MCF-7), prostate (PC-3) and cervical (HeLa) cancer cell lines, using sulphorhodamine-B in vitro cytotoxicity (in vitro studies) assay. The ethanol extract demonstrated growth inhibitory effect against all aforementioned cancer cell lines with IC 50 , 19-135 μg/mL and LC 50 , ~220 μg/mL, and its petroleum ether fraction obtained on bioactivity guided fraction showed highest activity with IC 50 , 28-70 μg/mL and LC 50 , 71 μg/mL against NCI-H460 and MCF-7 cell lines. Its phytochemicals were analysed by gas chromatography-mass spectrometry (GC-MS). The present study provides scientific justification for its traditional use against cancer.
Energy Technology Data Exchange (ETDEWEB)
Behnam Motlagh, P. [Dept. of Oncology, Umeaa Univ. Hospital (Sweden); Henriksson, R. [Dept. of Oncology, Umeaa Univ. Hospital (Sweden); Grankvist, K. [Dept. of Clinical Chemistry, Umeaa Univ. Hospital (Sweden)
1995-12-31
At cancer treatment, the use of antiemetics are often needed due to induction of nausea and vomiting. Some antiemetics have been shown to interact with the direct cytotoxic effects. The newly developed antiemetics have, so far as we know, not been studied in this respect. In the present study, the effects of the 5-HT{sub 3} receptor antagonists ondansetron and granisetron were evaluated on the cytotoxicity, induced by irradiation, bleomycin, epirubicin, estramustine, and cisplatin using fibroblasts (V79) and lung cancer cells (P31) in vitro. Ondansetron or granisetron (10{sup -5} mol/l) had no effect on the survival of irradiated cells. Granisetron (10{sup -5} mol/l) significantly potentiated cytoxocity of 2.5 mg/l epirubicin on fibroblasts whereas the effect of granisetron (10{sup -7} mol/l) on the cytotoxic effect of 25 mg/l bleomycin, and estramustine (80 mg/l) seemed additive to lung cancer cells. Ondansetron was non-interactive with the cytotoxicity induced by any of the anti-cancer drugs. Although the encountered observation with an enhancing effect of granisetron on the epirubicin-induced cytotoxicity is seen in a specific experimental situation in vitro, the fact that 5-HT{sub 3} receptor antagonists are routinely used during cancer treatment indicate that attention should be given to a possible interaction with the antineoplastic action of cancer treatment. (orig.).
International Nuclear Information System (INIS)
Behnam Motlagh, P.; Henriksson, R.; Grankvist, K.
1995-01-01
At cancer treatment, the use of antiemetics are often needed due to induction of nausea and vomiting. Some antiemetics have been shown to interact with the direct cytotoxic effects. The newly developed antiemetics have, so far as we know, not been studied in this respect. In the present study, the effects of the 5-HT 3 receptor antagonists ondansetron and granisetron were evaluated on the cytotoxicity, induced by irradiation, bleomycin, epirubicin, estramustine, and cisplatin using fibroblasts (V79) and lung cancer cells (P31) in vitro. Ondansetron or granisetron (10 -5 mol/l) had no effect on the survival of irradiated cells. Granisetron (10 -5 mol/l) significantly potentiated cytoxocity of 2.5 mg/l epirubicin on fibroblasts whereas the effect of granisetron (10 -7 mol/l) on the cytotoxic effect of 25 mg/l bleomycin, and estramustine (80 mg/l) seemed additive to lung cancer cells. Ondansetron was non-interactive with the cytotoxicity induced by any of the anti-cancer drugs. Although the encountered observation with an enhancing effect of granisetron on the epirubicin-induced cytotoxicity is seen in a specific experimental situation in vitro, the fact that 5-HT 3 receptor antagonists are routinely used during cancer treatment indicate that attention should be given to a possible interaction with the antineoplastic action of cancer treatment. (orig.)
International Nuclear Information System (INIS)
Radhakrishna Pillai, M.; Balaram, P.; Padmanabhan, T.K.; Abraham, T.; Nair, M.K.; Regional Cancer Centre, Trivandrum
1989-01-01
In vitro modulation of spontaneous cell mediated cytotoxicity by interferon and interleukin 2 was carried out using peripheral blood lymphocytes from patients with cancer of the uterine cervix before and at different intervals after commencement of radiation treatment. A total of 150 patients with various stages of the disease were included and cytotoxicity was measured using the single cell cytotoxic assay. These results indicate a beneficial effect in vitro of interleukin 2 and interferon in augmenting spontaneous cell mediated cytotoxicity, a possibly vital antitumour immune mechanism in patients with relatively early cervix cancer. Natural killer cell, lymphokine activated killer cell and interferon activated killer cell activity was depressed immediately following radiotherapy. The activity of these cell types later on increased above pretreatment levels in patients with stages I, IIA and IIB. A similar rebound above pretreatment levels was not observed in patients with stages III and IV. (orig.)
Size-dependent cytotoxicity of yttrium oxide nanoparticles on primary osteoblasts in vitro
Energy Technology Data Exchange (ETDEWEB)
Zhou, Guoqiang, E-mail: zhougq1982@163.com; Li, Yunfei; Ma, Yanyan; Liu, Zhu; Cao, Lili; Wang, Da; Liu, Sudan; Xu, Wenshi; Wang, Wenying [Hebei University, Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of Ministry of Education, Key Laboratory of Chemical Biology of Hebei Province, College of Chemistry and Environmental Science (China)
2016-05-15
Yttrium oxide nanoparticles are an excellent host material for the rare earth metals and have high luminescence efficiency providing a potential application in photodynamic therapy and biological imaging. In this study, the effects of yttrium oxide nanoparticles with four different sizes were investigated using primary osteoblasts in vitro. The results demonstrated that the cytotoxicity generated by yttrium oxide nanoparticles depended on the particle size, and smaller particles possessed higher toxicological effects. For the purpose to elucidate the relationship between reactive oxygen species generation and cell damage, cytomembrane integrity, intracellular reactive oxygen species level, mitochondrial membrane potential, cell apoptosis rate, and activity of caspase-3 in cells were then measured. Increased reactive oxygen species level was also observed in a size-dependent way. Thus, our data demonstrated that exposure to yttrium oxide nanoparticles resulted in a size-dependent cytotoxicity in cultured primary osteoblasts, and reactive oxygen species generation should be one possible damage pathway for the toxicological effects produced by yttrium oxide particles. The results may provide useful information for more rational applications of yttrium oxide nanoparticles in the future.
International Nuclear Information System (INIS)
Jiménez-Medina, Eva; Garcia-Lora, Angel; Paco, Laura; Algarra, Ignacio; Collado, Antonia; Garrido, Federico
2006-01-01
Phytopharmacological studies of different Calendula extracts have shown anti-inflamatory, anti-viral and anti-genotoxic properties of therapeutic interest. In this study, we evaluated the in vitro cytotoxic anti-tumor and immunomodulatory activities and in vivo anti-tumor effect of Laser Activated Calendula Extract (LACE), a novel extract of the plant Calendula Officinalis (Asteraceae). An aqueous extract of Calendula Officinalis was obtained by a novel extraction method in order to measure its anti-tumor and immunomodulatory activities in vitro. Tumor cell lines derived from leukemias, melanomas, fibrosarcomas and cancers of breast, prostate, cervix, lung, pancreas and colorectal were used and tumor cell proliferation in vitro was measured by BrdU incorporation and viable cell count. Effect of LACE on human peripheral blood lymphocyte (PBL) proliferation in vitro was also analyzed. Studies of cell cycle and apoptosis were performed in LACE-treated cells. In vivo anti-tumor activity was evaluated in nude mice bearing subcutaneously human Ando-2 melanoma cells. The LACE extract showed a potent in vitro inhibition of tumor cell proliferation when tested on a wide variety of human and murine tumor cell lines. The inhibition ranged from 70 to 100%. Mechanisms of inhibition were identified as cell cycle arrest in G0/G1 phase and Caspase-3-induced apoptosis. Interestingly, the same extract showed an opposite effect when tested on PBLs and NKL cell line, in which in vitro induction of proliferation and activation of these cells was observed. The intraperitoneal injection or oral administration of LACE extract in nude mice inhibits in vivo tumor growth of Ando-2 melanoma cells and prolongs the survival day of the mice. These results indicate that LACE aqueous extract has two complementary activities in vitro with potential anti-tumor therapeutic effect: cytotoxic tumor cell activity and lymphocyte activation. The LACE extract presented in vivo anti-tumoral activity in nude
Anti-inflammatory, cytotoxic and antioxidant effects of methanolic ...
African Journals Online (AJOL)
... 67.05μg/ml (ABTS). Methanol extract was able to inhibit inflammation by in vitro about 85-90% (HRBC stabilization method) and in vivo about 40-45% (Paw oedema method) anti-inflammatory assays compared to standard produced 50.04% at 6h period. In cytotoxicity assay (MTT assay) methanolic extract exhibited IC50 ...
International Nuclear Information System (INIS)
Nogueira, Grinia M.; Rodas, Andrea C.D.; Weska, Raquel F.; Aimoli, Cassiano G.; Higa, Olga Z.; Maizato, Marina; Leiner, Adolfo A.; Pitombo, Ronaldo N.M.; Polakiewicz, Bronislaw; Beppu, Marisa M.
2010-01-01
Bovine pericardium, for cardiac valve fabrication, was coated with either chitosan or silk fibroin film. In vitro calcification tests of coated and non coated bovine pericardium were performed in simulated body fluid solution in order to investigate potential alternatives to minimize calcification on implanted heart valves. Complementary, morphology was assessed by scanning electron microscopy - SEM; X-ray diffraction (XRD) and infrared spectroscopy (FTIR-ATR) were performed for structural characterization of coatings and biocompatibility of chitosan. Silk fibroin films were assayed by in vitro cytotoxicity and endothelial cell growth tests. Bovine pericardium coated with silk fibroin or chitosan did not present calcification during in vitro calcification tests, indicating that these biopolymeric coatings do not induce bovine pericardium calcification. Chitosan and silk fibroin films were characterized as non cytotoxic and silk fibroin films presented high affinity to endothelial cells. The results indicate that bovine pericardium coated with silk fibroin is a potential candidate for cardiac valve fabrication, since the affinity of silk fibroin to endothelial cells can be explored to induce the tissue endothelization and therefore, increase valve durability by increasing their mechanical resistance and protecting them against calcification.
Linares, Daniel M; del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; Fernandez, Maria; Ruas-Madiedo, Patricia; Alvarez, Miguel A
2016-04-15
Tyramine and histamine, the most toxic biogenic amines (BA), are often found in high concentrations in certain foods. Prompted by the limited knowledge of BA toxicity, and increasing awareness of the risks associated with high intakes of dietary BA, the in vitro cytotoxicity of tyramine and histamine was investigated. Tyramine and histamine were toxic for HT29 intestinal cell cultures at concentrations commonly found in BA-rich food, as determined by real-time cell analysis. Surprisingly, tyramine had a stronger and more rapid cytotoxic effect than histamine. Their mode of action was also different, while tyramine caused cell necrosis, histamine induced apoptosis. To avoid health risks, the BA content of foods should be reduced and legal limits established for tyramine. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jones William
2006-03-01
Full Text Available Abstract Background Synthetic vitreous fibers (SVFs are inorganic noncrystalline materials widely used in residential and industrial settings for insulation, filtration, and reinforcement purposes. SVFs conventionally include three major categories: fibrous glass, rock/slag/stone (mineral wool, and ceramic fibers. Previous in vitro studies from our laboratory demonstrated length-dependent cytotoxic effects of glass fibers on rat alveolar macrophages which were possibly associated with incomplete phagocytosis of fibers ≥ 17 μm in length. The purpose of this study was to examine the influence of fiber length on primary human alveolar macrophages, which are larger in diameter than rat macrophages, using length-classified Manville Code 100 glass fibers (8, 10, 16, and 20 μm. It was hypothesized that complete engulfment of fibers by human alveolar macrophages could decrease fiber cytotoxicity; i.e. shorter fibers that can be completely engulfed might not be as cytotoxic as longer fibers. Human alveolar macrophages, obtained by segmental bronchoalveolar lavage of healthy, non-smoking volunteers, were treated with three different concentrations (determined by fiber number of the sized fibers in vitro. Cytotoxicity was assessed by monitoring cytosolic lactate dehydrogenase release and loss of function as indicated by a decrease in zymosan-stimulated chemiluminescence. Results Microscopic analysis indicated that human alveolar macrophages completely engulfed glass fibers of the 20 μm length. All fiber length fractions tested exhibited equal cytotoxicity on a per fiber basis, i.e. increasing lactate dehydrogenase and decreasing chemiluminescence in the same concentration-dependent fashion. Conclusion The data suggest that due to the larger diameter of human alveolar macrophages, compared to rat alveolar macrophages, complete phagocytosis of longer fibers can occur with the human cells. Neither incomplete phagocytosis nor length-dependent toxicity was
Directory of Open Access Journals (Sweden)
María Elena Calderón-Segura
2012-01-01
Full Text Available Calypso (thiacloprid, Poncho (clothianidin, Gaucho (imidacloprid, and Jade (imidacloprid are commercial neonicotinoid insecticides, a new class of agrochemicals in México. However, genotoxic and cytotoxic studies have not been performed. In the present study, human peripheral blood lymphocytes (PBL were exposed in vitro to different concentrations of the four insecticides. The genotoxic and cytotoxic effects were evaluated using the alkaline comet and trypan blue dye exclusion assays. DNA damage was evaluated using two genotoxicity parameters: tail length and comet frequency. Exposure to 9.5×10-6 to 5.7×10-5 M Jade; 2.8×10-4 to 1.7×10-3 M Gaucho; 0.6×10-1 to 1.4×10-1 M Calypso; 1.2×10-1 to 9.5×10-1 M Poncho for 2 h induced a significant increase DNA damage with a concentration-dependent relationship. Jade was the most genotoxic of the four insecticides studied. Cytotoxicity was observed in cells exposed to 18×10-3 M Jade, 2.0×10-3 M Gaucho, 2.0×10-1 M Calypso, 1.07 M Poncho, and cell death occurred at 30×10-3 M Jade, 3.3×10-3 M Gaucho, 2.8×10-1 M Calypso, and 1.42 M Poncho. This study provides the first report of genotoxic and cytotoxic effects in PBL following in vitro exposure to commercial neonicotinoid insecticides.
Kızılşahin, Sadi; Nalbantsoy, Ayşe; Yavaşoğlu, N Ülkü Karabay
2015-01-01
The aim of this study was to determine in vitro synergistic efficacy of conjugated linoleic acid (CLA), oleic acid (OLA), safflower oil and taxol (Tax) cytotoxicity on human prostate cancer (PC3) cell line. To determine synergistic efficacy of oil combinations, PC3 treated with different doses of compounds alone and combined with 10 μg/mL Tax. The MTT results indicated that OLA-Tax combinations exhibited cytotoxicity against PC3 at doses of 30 nM+10 μg-Tax, 15 nM+5 μg-Tax and 7.5 nM+2.5 μg-Tax. The treatment of OLA or Tax did not show significant inhibition on PC3, while OLA-Tax combinations showed effective cytotoxicity at treated doses. CLA-Tax combinations demonstrated the same effect on PC3 as combined form with 45.72% versus the alone form as 74.51% viability. Cytotoxic synergy between Tax, OLA and CLA shows enhanced cytotoxicity on PC3 which might be used in the therapy of prostate cancer.
Preparation and in-vitro cytotoxicity of zinc oxide nanoparticles ...
African Journals Online (AJOL)
The cytotoxicity of the NPs against human osteoarthritic chondrocytes was studied using eosin Y test method. Results: The change in color of the reaction solution from colorless to pale white within 1 h indicated the formation of ZnO NPs. FTIR results revealed coating of plant polyphenols on ZnO NPs surface while XRD and ...
Cytotoxic activity of the neurotoxin anatoxin-a on fish leukocytes in vitro and in vivo studies
Directory of Open Access Journals (Sweden)
Anna Rymuszka
2012-01-01
Full Text Available The aim of this study was to investigate the potential cytotoxic effects of different concentrations (0.01, 0.025, 0.05, 0.1 and 1 µg/ml medium of pure anatoxin-a on carp immune cells (in vitro study. Furthermore, changes in the cell immune functions isolated from 10 carp exposed by immersion to anatoxin-a (25 µg/l for 5 days have been examined. Cytotoxicity of the toxin to leukocytes was determined by measuring intracellular adenosine triphosphate and glutathione concentrations. Lymphocyte proliferation was determined by measurement of bromodeoxyuridine incorporation during DNA synthesis. The phagocytes were assayed for intracellular production of reactive oxygen species. The in vitro results showed that pure toxin induced adverse effects on immune cells only after application of the higher concentrations (0.05, 0.1 and 1 µg/ml. Phagocytes exposed to anatoxin-a exhibited a significant (P < 0.05 reduction in glutathione concentration. The lymphocyte proliferation was decreased by the toxin, and B cells were more sensitive than T cells. The present study showed for the first time that anatoxin-a administered to fish by immersion, had suppressive effects on lymphocyte proliferation and the antioxidant potential of phagocytes.
Cytotoxicity Testing: Cell Experiments
Grünert, Renate; Westendorf, Aron; Buczkowska, Magdalena; Hänsch, Mareike; Grüunert, Sybil; Bednarski, Patrick J.
Screening for new anticancer agents has traditionally been done with in vitro cell culture methods. Even in the genomic era of target-driven drug design, screening for cytotoxic activity is still a standard tool in the search for new anticancer agents, especially if the mode of action of a substance is not yet known. A wide variety of cell culture methods with unique end-points are available for testing the anticancer potential of a substance. Each has its advantages and disadvantages, which must be weighed in the decision to use a particular method. Often several complementary methods are used to gain information on the mode of action of a substance.
Cytotoxicity of nano-hydroxyapatite on human-derived oral epithelium cell line: an in vitro study
Directory of Open Access Journals (Sweden)
Farid Abassi
2016-08-01
Full Text Available Background: Hydroxyapatite nanoparticles have a more surface contact and solubility than conventional hydroxyapatite. Hydroxynanoparticles enhances the biological and mechanical properties of new regenerated tissues. The hydroxyapatite nanoparticles have received attention as a new and effective osseous graft for using as scaffolds in bone regeneration. The reports on hydroxyapatite nanoparticles biocompatibility are controversial. It has been shown that hydroxyapatite nanoparticles induces inflammatory reaction and apoptosis. The aim of the present study was to evaluate the cytotoxicity of nano-hydroxyapatite on the human epithelial cells. Methods: The study was experimental and completed in vitro. The study was carried out in department of Immonulogy, Faculty of Medicine, Shahid Beheshti University of Medical Sciences in November 2014. The human-derived oral epithelium cell line (KB obtained from Pasteur Institute, Tehran, Iran were exposed to hydroxyapatite nanoparticles at 0.01, 0.05, 0.1, 0.5, 0.75, 1, 2.5 and 5 mg/ml concentrations in 24, 48 and 72 hours. Rod-shaped hydroxyapatite nanoparticles with 99% purity and maximum 100 nm sized particles were used. Methylthiazol tetrazolium bromide (MTT method was employed for cell vitality evaluation. Enzyme-linked immunosorbent assay (ELISA was used for assessing the viability of cells. Distilled water and fetal bovine serum (FBS were positive and negative controls. ANOVA and Duncan tests were used for statistical analysis. Results: The cytotoxicity of different concentrations of hydroxyapatite nanoparticles on human-derived oral epithelium cell line in 24 (P< 0.001, 48 (P< 0.001 and 72 hours (P< 0.001 was significantly different. The nano-hydroxyapatite particles at 0.5 to 1 mg/ml had the highest cytotoxicity effect on human-derived oral epithelium cells in 24, 48 and 72 hours. Lower concentrations than 0.05 mg/ml had the best biocompatibility properties in 24, 48 and 72 hours. Conclusion
Santana, Jeferson S; Sartorelli, Patricia; Guadagnin, Rafael C; Matsuo, Alisson L; Figueiredo, Carlos R; Soares, Marisi G; da Silva, Adalberto M; Lago, João Henrique G
2012-10-01
In folk medicine, Schinus terebinthifolius Raddi (Anacardiaceae), has been used as a remedy for ulcers, respiratory problems, wounds, rheumatism, gout, diarrhea, skin ailments and arthritis, as well as to treat tumors and leprosy. To investigate the chemical composition and cytotoxicity of essential oil from leaves of S. terebinthifolius as well as the identification of active compounds from this oil. Essential oil from S. terebinthifolius leaves, obtained by hydrodistillation using a Clevenger-type apparatus, was characterized in terms of its chemical composition. Also, the crude oil was subjected to chromatographic separation procedures to afford an active fraction composed of α- and β-pinenes. These compounds, including hydrogenation (pinane) and epoxydation (α-pinene oxide) derivatives from α-pinene, were tested in vitro against murine melanoma cell line (B16F10-Nex2) and human melanoma (A2058), breast adenocarcinoma (MCF7), leukemia (human leukemia (HL-60) and cervical carcinoma (HeLa) cell lines. Forty-nine constituents were identified in the oil (97.9% of the total), with germacrene D (23.7%), bicyclogermacrene (15.0%), β-pinene (9.1%) and β-longipinene (8.1%) as the main compounds. The crude essential oil showed cytotoxic effects in several cell lines, mainly on leukemia and human cervical carcinoma. Fractions composed mainly of α- and β-pinenes as well as those composed of individually pinenes showed effective activities against all tested cell lines. Aiming to determinate preliminary structure/activity relationships, α-pinene was subjected to epoxydation and hydrogenation procedures whose obtained α-pinene oxide showed an expressive depression in its cytotoxicity effect, similar as observed to pinane derivative. The obtained results indicated that the monoterpenes α- and β-pinenes could be responsible to the cytotoxic activity detected in the crude oil from leaves of S. terebinthifolius. In addition, it was possibly inferred that the presence
Directory of Open Access Journals (Sweden)
Emmanuel E. Essien
2015-12-01
Full Text Available Curcuma longa (turmeric has been used in Chinese traditional medicine and Ayurvedic medicine for many years. Methods: The leaf essential oil of C. longa from southern Nigeria was obtained by hydrodistillation and analyzed by gas chromatography–mass spectrometry (GC-MS. The essential oil was screened for in vitro antibacterial, antifungal, and cytotoxic activities. The major components in C. longa leaf oil were ar-turmerone (63.4%, α-turmerone (13.7%, and β-turmerone (12.6%. A cluster analysis has revealed this to be a new essential oil chemotype of C. longa. The leaf oil showed notable antibacterial activity to Bacillus cereus and Staphylococcus aureus, antifungal activity to Aspergillus niger, and cytotoxic activity to Hs 578T (breast tumor and PC-3 (prostate tumor cells. The ar-turmerone-rich leaf essential oil of C. longa from Nigeria has shown potent biological activity and therapeutic promise.
Essien, Emmanuel E.; Newby, Jennifer Schmidt; Walker, Tameka M.; Setzer, William N.; Ekundayo, Olusegun
2015-01-01
Curcuma longa (turmeric) has been used in Chinese traditional medicine and Ayurvedic medicine for many years. Methods: The leaf essential oil of C. longa from southern Nigeria was obtained by hydrodistillation and analyzed by gas chromatography–mass spectrometry (GC-MS). The essential oil was screened for in vitro antibacterial, antifungal, and cytotoxic activities. The major components in C. longa leaf oil were ar-turmerone (63.4%), α-turmerone (13.7%), and β-turmerone (12.6%). A cluster analysis has revealed this to be a new essential oil chemotype of C. longa. The leaf oil showed notable antibacterial activity to Bacillus cereus and Staphylococcus aureus, antifungal activity to Aspergillus niger, and cytotoxic activity to Hs 578T (breast tumor) and PC-3 (prostate tumor) cells. The ar-turmerone-rich leaf essential oil of C. longa from Nigeria has shown potent biological activity and therapeutic promise. PMID:28930216
Kandanur, Sai Giridhar Sarma; Golakoti, Nageswara Rao; Nanduri, Srinivas
2015-12-15
Andrographolide, the major labdane diterpenoid from Andrographis paniculata has been reported to be cytotoxic against various cancer cells in vitro. Our research efforts led to the discovery of novel 12-phenyl thio and 12-aryl amino-14-deoxy-andrographolide derivatives (III q and III r) with potent cytotoxic activity, 12-benzyl amino-14-deoxy-andrographolide analogues showing broad range of cytotoxic activity against most of the cell lines and 12-alkyl amino-14-deoxy-andrographolide derivatives being selective to few cell lines (PC-3 and HOP-92), when the selected analogues were evaluated against 60 human cancer cell line panel at National Cancer Institute (N.C.I.), USA. The SAR (structure activity relationship) studies demonstrated potent activity for the compounds containing the following functionalities at C-12: substituted aryl amino/phenyl thio>benzylamine>alkyl amine. The significant cytotoxic activity observed for compounds III q and III r suggest that these could serve as templates for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cytotoxicity detection of poly(lactic-co-glycolic acid/tricalcium phosphate
Directory of Open Access Journals (Sweden)
Meng SUN
2011-12-01
Full Text Available Objective To detecte the cytotoxicity of the PLGA/TCP(poly(lactic-co-glycolic acid/Tricalcium phosphate composite that based on the precedent experiments conducted in Tsinghua University.Methods Compared with the PLGA scaffold material,observated the surface and interior structure of the PLGA/TCP scaffold material by SEM(scanning electron microscope,the surface and interior of PLGA/TCP scaffold material appeared to be homogeneous porous under SEM,with fairly even porosity distribution.The pore diameter was approximately 400μm.The interpenetrative micro-pores were scattered over bigger pores’ periphery with approximately circular contour and 3~5 μm in diameter.These pores were interpenetrative,the average factor of porosity was 89.6%.And which selected rat L929 cell strain,and detected the cytotoxicity of the PLGA/TCP composite in vitro by MTT method.Results The surface and interior of PLGA/TCP scaffold material appeared to be homogeneous porous under SEM,with fairly even porosity distribution.The pore diameter was approximately 400μm.The interpenetrative micro-pores were scattered over bigger pores’ periphery with approximately circular contour and 3~5 μm in diameter.These pores were interpenetrative,the average factor of porosity was 89.6%.On rat L929 cell strain,used MTT Method to detect the cytotoxicity of the composite PLGA/ TCP in vitro,the result showed that the cytotoxicity of the PLGA/TCP composite was level I,according to the criterion,it can be considered as non cytotoxic.Conclusion This research has proved that the PLGA/TCP compound scaffold material has a more homogeneous structure,with the vesicular interior and the structure of PLGA/TCP composite is similar to natural bone trabecula,PLGA/TCP is non cytotoxicity,which satisfy the basic requirement of biological material application and provides a good experimental foundation for repairing autologous bone defect in the near future.
Yoshino, Patrícia; Nishiyama, Celso Kenji; Modena, Karin Cristina da Silva; Santos, Carlos Ferreira; Sipert, Carla Renata
2013-01-01
The aim of this study was to compare the in vitro cytotoxicity of white mineral trioxide aggregate (MTA), MTA Fillapex® and Portland cement (PC) on human cultured periodontal ligament fibroblasts. Periodontal ligament fibroblast culture was established and the cells were used for cytotoxic tests after the fourth passage. Cell density was set at 1.25 X10 4 cells/well in 96-well plates. Endodontic material extracts were prepared by placing sealer/cement specimens (5x3mm) in 1mL of culture medium for 72 h. The extracts were then serially two-fold diluted and inserted into the cell-seeded wells for 24, 48 and 72 h. MTT assay was employed for analysis of cell viability. Cell supernatants were tested for nitric oxide using the Griess reagent system. MTA presented cytotoxic effect in undiluted extracts at 24 and 72 h. MTA Fillapex® presented the highest cytotoxic levels with important cell viability reduction for pure extracts and at ½ and ¼ dilutions. In this study, PC did not induce alterations in fibroblast viability. Nitric oxide was detected in extract-treated cell supernatants and also in the extracts only, suggesting presence of nitrite in the soluble content of the tested materials. In the present study, MTA Fillapex displayed the highest cytotoxic effect on periodontal ligament fibroblasts followed by white MTA and PC.
The antioxidant properties, cytotoxicity and monoamine oxidase ...
African Journals Online (AJOL)
ajl yemi
2011-11-28
Nov 28, 2011 ... and the nitroblue tetrazolium (NBT) assay. The cytotoxicity ... The antioxidant activity and cytotoxic effect of the extracts increased with increase ... supplements are concoctions of plants and/or plant .... In vitro antioxidant assay.
Directory of Open Access Journals (Sweden)
Ali RAMAZANI
2016-10-01
Full Text Available Background: Aurones are naturally occurring compounds that belong to flavenoids family and have antiplasmodial effects. This study investigated some new aurones derivatives against chloroquine sensitive Plasmodium falciparum. Here we report the synthesis, in vitro antiplasmodial activity and cytotoxic evaluation of 11 compound from derivatives of (Z-2- benzylidene-4, 6-dimethoxybenzofuran-3(2H-one.Methods: The cytotoxic evaluations of active compounds were performed with MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyltetrazolium bromide assay on human breast cancer cell lines; MCF7 and T47D.Results: From 11 compounds M3, M6 and M7 compounds showed good antiplasmodial effect against chloroquine-sensitive 3D strain of P. falciparum with IC50 (50% inhibitory concentration values of 7.82, 7.27 and 2.3 µM respectively. No noticeable toxicity was observed with these compounds when tested against tested cell lines. Conclusion: The replacement of the 4 and 5 positions at ring B of aurone derivatives, with propoxy and bromide (Br respectively was revealed highly advantageous for their antiplasmodial effect.
Novel HER2 Aptamer Selectively Delivers Cytotoxic Drug to HER2-positive Breast Cancer Cells in Vitro
Directory of Open Access Journals (Sweden)
Liu Zhe
2012-07-01
Full Text Available Abstract Background Aptamer-based tumor targeted drug delivery system is a promising approach that may increase the efficacy of chemotherapy and reduce the related toxicity. HER2 protein is an attractive target for tumor-specific drug delivery because of its overexpression in multiple malignancies, including breast, gastric, ovarian, and lung cancers. Methods In this paper, we developed a new HER2 aptamer (HB5 by using systematic evolution of ligands by exponential enrichment technology (SELEX and exploited its role as a targeting ligand for delivering doxorubicin (Dox to breast cancer cells in vitro. Results The selected aptamer was an 86-nucleotide DNA molecule that bound to an epitope peptide of HER2 with a Kd of 18.9 nM. The aptamer also bound to the extracellular domain (ECD of HER2 protein with a Kdof 316 nM, and had minimal cross reactivity to albumin or trypsin. In addition, the aptamer was found to preferentially bind to HER2-positive but not HER2-negative breast cancer cells. An aptamer-doxorubicin complex (Apt-Dox was formulated by intercalating Dox into the DNA structure of HB5. The Apt-Dox complex could selectively deliver Dox to HER2-positive breast cancer cells while reducing the drug intake by HER2-negative cells in vitro. Moreover, Apt-Dox retained the cytotoxicity of Dox against HER2-positive breast cancer cells, but reduced the cytotoxicity to HER2-negative cells. Conclusions The results suggest that the selected HER2 aptamer may have application potentials in targeted therapy against HER2-positive breast cancer cells.
Inhibition of galactosamine cytotoxicity in an in vivo/in vitro hepatocellular toxicity model
International Nuclear Information System (INIS)
MacDonald, J.R.; Thayer, K.J.; White, C.
1987-01-01
A combined in vivo/in vitro model of galactosamine hepatotoxicity was employed to test whether previously reported cytoprotective actions of cystamine administration on galactosamine-induced hepatic injury in vivo could be attributed to a direct action of cystamine on toxicant-challenged hepatocytes. In this model, male Sprague-Dawley rats received a 400 mg/kg galactosamine challenge via intraperitoneal injection 1 hr prior to portal vein cannulation for hepatocyte isolation. Isolated cells are established in monolayer culture and galactosamine-induced cellular injury is then expressed over the ensuing 24-48 hr in culture. Consistent with the biochemical basis of galactosamine-induced hepatocellular injury in vivo, cytotoxicity could be prevented by in vitro uridine treatments within 3 hr of the in vivo galactosamine challenge, but not when added 12 hr later. Cystamine, in contrast, exhibited a cytoprotective effect even when added to cultures 12 hr after the in vivo toxicant challenge. Post-toxicant cytoprotection by cystamine in vitro was concentration dependent and did not produce an alteration of hepatocyte nonprotein sulfhydryl content. Post-toxicant cytoprotection by uridine and cystamine in this in vivo/in vitro model of toxicity were fully consistent with in vivo protection from galactosamine-induced necrosis by these agents. This model eliminates potential extrahepatic mechanisms for cystamine's hepatoprotective effect and demonstrates a direct cytoprotective action on galactosamine-challenged hepatocytes
Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul
2015-11-01
Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.
Directory of Open Access Journals (Sweden)
Koffi Koba
2009-06-01
Full Text Available The leaf essential oils of Cymbopogon citratus L. and Cymbopogon nardus L.(Poaceae from Togo were steam-distilled, analyzed for percentage composition and investigated in vitro for their potential cytotoxic activity on human epidermic cell line HaCat. The percentage composition showed that the main constituents of essential oils samples were respectively geranial (45.2%, neral(32.4% and myrcène (10.2% for C. citratus essential oil and citronellal (35.5%, geraniol (27.9% and citronellol (10.7% for that of C. nardus. The in vitro cytotoxicity bioassays on human epidermic cell line HaCaT revealed that the toxicityof the essential oil from C. citratus (IC50: 150 μL.mL-1 was higher than that of the essential oil from C. nardus (IC50: 450 μL.mL-1. Pure commercial neral, geranial, and citronellal standards showed respectively the following IC50 values: 100, 250 and 300 μL.mL-1. Conversely, pure citronellol standard appeared almost non-toxic (IC50>1000 μL.mL-1, proving the major role played in synergyby neral and geranial in the overall toxicity showed by the citratus oil sample tested in this work.
Directory of Open Access Journals (Sweden)
Koffi Koba
2009-03-01
Full Text Available The leaf essential oils of Cymbopogon citratus L. and Cymbopogon nardus L. (Poaceae from Togo were steam-distilled, analyzed for percentage composition and investigated in vitro for their potential cytotoxic activity on human epidermic cell line HaCat. The percentage composition showed that the main constituents of essential oils samples were respectively geranial (45.2%, neral (32.4% and myrc¨ne (10.2% for C. citratus essential oil and citronellal (35.5%, geraniol (27.9% and citronellol (10.7% for that of C. nardus. The in vitro cytotoxicity bioassays on human epidermic cell line HaCaT revealed that the toxicity of the essential oil from C. citratus (IC50: 150 µL.mL-1 was higher than that of the essential oil from C. nardus (IC50: 450 µL.mL-1. Pure commercial neral, geranial, and citronellal standards showed respectively the following IC50 values: 100, 250 and 300 µL.mL-1. Conversely, pure citronellol standard appeared almost non-toxic (IC50>1000 µL.mL-1, proving the major role played in synergy by neral and geranial in the overall toxicity showed by the citratus oil sample tested in this work.
Neilson, Louise; Mankus, Courtney; Thorne, David; Jackson, George; DeBay, Jason; Meredith, Clive
2015-10-01
Development of physiologically relevant test methods to analyse potential irritant effects to the respiratory tract caused by e-cigarette aerosols is required. This paper reports the method development and optimisation of an acute in vitro MTT cytotoxicity assay using human 3D reconstructed airway tissues and an aerosol exposure system. The EpiAirway™ tissue is a highly differentiated in vitro human airway culture derived from primary human tracheal/bronchial epithelial cells grown at the air-liquid interface, which can be exposed to aerosols generated by the VITROCELL® smoking robot. Method development was supported by understanding the compatibility of these tissues within the VITROCELL® system, in terms of airflow (L/min), vacuum rate (mL/min) and exposure time. Dosimetry tools (QCM) were used to measure deposited mass, to confirm the provision of e-cigarette aerosol to the tissues. EpiAirway™ tissues were exposed to cigarette smoke and aerosol generated from two commercial e-cigarettes for up to 6 h. Cigarette smoke reduced cell viability in a time dependent manner to 12% at 6 h. E-cigarette aerosol showed no such decrease in cell viability and displayed similar results to that of the untreated air controls. Applicability of the EpiAirway™ model and exposure system was demonstrated, showing little cytotoxicity from e-cigarette aerosol and different aerosol formulations when compared directly with reference cigarette smoke, over the same exposure time. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Cytotoxicity study of plant Aloe vera (Linn
Directory of Open Access Journals (Sweden)
Atul N Chandu
2012-01-01
Full Text Available Background: The objective of this study has been to evaluate the in-vitro antitumor activity of Aloe vera extract of in cultured B16F10 melanoma cell line by measuring cell viability using "Trypan blue exclusion assay" method. Aim: To find out such kind of anticancer drug which is a cheap, safe, less toxic, and more potent drug compared to chemotherapy drug. Materials and Methods: In-vitro antitumor activity cell culture1, drug treatment (standard and test extract and Trypan blue exclusion assay growth and viability test 1 were used. Treatment of Aloe vera extract against B16F10 melanoma cell line, in all concentration range, showed decrease in percent cell viability, as compared to that of negative when examined by "Trypan blue exclusion assay". Results: In overall variation of test samples, Aloe vera extract showed its best activity in the concentration of 300 μg/ml, which was approximately equal to the activity of standard drug doxorubicin. Evaluation of in-vitro antitumor activity revealed that Aloe vera extract exhibits good cytotoxic activity. The best cytotoxic activity by Aloe vera was shown at 200 μg/ml concentration. Conclusion: The study of cytoprotection against normal cells by micronucleus assay has shown that the herbal extracts have less toxic effects to the normal blood lymphocytes, as compared to that of standard anticancer drug.
Nygren, P; Hagberg, H; Glimelius, B; Sundström, C; Kristensen, J; Christiansen, I; Larsson, R
1994-01-01
Tumor cell drug sensitivity is an important determinant of chemotherapy response. Its measurement in vitro would aid in therapy individualization and new drug development. The fluorometric microculture cytotoxicity assay (FMCA), based on production by viable cells of fluorescent fluorescein after 3 days of culture, was used for cytotoxic drug sensitivity testing of 73 samples of tumor cells from patients with non-Hodgkin's lymphoma (NHL). The technical success rate was 92%, and FMCA data showed good correlation to the Disc assay. NHL samples were considerably more drug sensitive than were samples from in vivo resistant tumors. There was no obvious difference in drug sensitivity for high- vs. low-grade or untreated vs. previously treated low-grade NHL. For 26 patients, clinical outcome was correlated to in vitro response giving a sensitivity and specificity of 93 and 48%, respectively. Cross-resistance between standard drugs was frequent in vitro. Resistance modulators potentiated the effect of vincristine and doxorubicin in 10-29% of the samples, most frequently from previously treated patients. The FMCA seems to report clinically relevant drug sensitivity data for NHL, and thus it could serve as a tool for optimization of chemotherapy in the future.
In vitro Antifungal, Antioxidant and Cytotoxic Activities of a Partially ...
African Journals Online (AJOL)
Purpose: To determine the in vitro antifungal and antioxidant activities of the aqueous extract and protein fraction of Atlantia monophylla Linn (Rutaceae) leaf. Methods: Ammonium sulphate (0 – 80 %) precipitation method was used to extract protein from the leaves of A. monophylla Linn (Rutaceae). In vitro antifungal ...
Directory of Open Access Journals (Sweden)
Mingshun Chen
2016-06-01
Full Text Available Three polyphenols were isolated and purified from sugar beet molasses by ultrasonic-aid extraction and various chromatographic techniques, and their structures were elucidated by spectral analysis. Cytotoxicity and the molecular mechanism were measured by methyl thiazolyl tetrazolium (MTT assay, flow cytometry, caspase-3 activity assay and Western blot assay. The results showed that gallic acid, cyanidin-3-O-glucoside chloride and epicatechin have cytotoxicity to the human colon, hepatocellular and breast cancer cells. Cyanidin-3-O-glucoside chloride showed its cytotoxicity against various tumor cell lines, particularly against colon cancer Caco-2 cells with half maximal inhibitory concentration (IC50 value of 23.21 ± 0.14 μg/mL in vitro. Cyanidin-3-O-glucoside chloride may be a potential candidate for the treatment of colon cancer. In the mechanism study, cyanidin-3-O-glucoside chloride increased the ratio of cell cycle at G0/G1 phase and reduced cyclin D1 expression on Caco-2 cells. Cyanidin-3-O-glucoside chloride decreased mutant p21 expression, and increased the ratio of Bax/Bcl-2 and the activation of caspase-3 to induce apoptosis.
Gundala, Naveen K V; Naidu, Vegi G M; Das, Undurti N
2017-03-01
We studied whether polyunsaturated fatty acids (PUFAs) can protect rat insulinoma (RIN5F) cells against alloxan-induced apoptosis in vitro and type 1 diabetes mellitus (type 1 DM) in vivo and if so, mechanism of this beneficial action. In vitro study was conducted using RIN5F cells while in vivo study was performed in Wistar rats. The effect of PUFAs, cyclo-oxygenase and lipoxygenase inhibitors, various eicosanoids and PUFAs metabolites: lipoxin A4 (LXA4), resolvin D2 and protectin against alloxan-induced cytotoxicity to RIN5F cells and type 1 DM was studied. Expression of PDX1, P65 NF-kB and IKB in RIN5F cells and Nrf2, GLUT2, COX2, iNOS protein levels in the pancreatic tissue and plasma glucose, insulin and tumor necrosis factor-α and antioxidants, lipid peroxides and nitric oxide were measured. Of all, arachidonic acid (AA) was found to be the most effective against alloxan-induced cytotoxicity to RIN5F cells and preventing type 1 DM. Both cyclo-oxygenase and lipoxygenase inhibitors did not block the beneficial actions of AA in vitro and in vivo. Alloxan inhibited LXA4 production by RIN5F cells and in alloxan-induced type 1 DM Wistar rats. AA-treatment restored LXA4 levels to normal both in vitro and in vivo. LXA4 protected RIN5F cells against alloxan-induced cytotoxicity and prevented type 1 DM and restored expression of Nrf2, Glut2, COX2, and iNOS genes and abnormal antioxidants to near normal. AA seems to bring about its beneficial actions against alloxan-induced cytotoxicity and type 1 DM by enhancing the production of LXA4. © 2016 BioFactors, 43(2):251-271, 2017. © 2016 International Union of Biochemistry and Molecular Biology.
In vitro anticancer activity and cytotoxicity of some papaver alkaloids ...
African Journals Online (AJOL)
Materials and Methods: The Vero and HeLa cell lines were treated with various concentrations (1-300 μg/mL) of alkaloids for 48 h. Values for cytotoxicity measured by MTT assay were expressed as the concentration that causes a 50% decrease in cell viability (IC50) (μg/mL). Results: Berberine and macranthine were the ...
BK/TD models for analyzing in vitro impedance data on cytotoxicity.
Teng, S; Barcellini-Couget, S; Beaudouin, R; Brochot, C; Desousa, G; Rahmani, R; Pery, A R R
2015-06-01
The ban of animal testing has enhanced the development of new in vitro technologies for cosmetics safety assessment. Impedance metrics is one such technology which enables monitoring of cell viability in real time. However, analyzing real time data requires moving from static to dynamic toxicity assessment. In the present study, we built mechanistic biokinetic/toxicodynamic (BK/TD) models to analyze the time course of cell viability in cytotoxicity assay using impedance. These models account for the fate of the tested compounds during the assay. BK/TD models were applied to analyze HepaRG cell viability, after single (48 h) and repeated (4 weeks) exposures to three hepatotoxic compounds (coumarin, isoeugenol and benzophenone-2). The BK/TD models properly fit the data used for their calibration that was obtained for single or repeated exposure. Only for one out of the three compounds, the models calibrated with a single exposure were able to predict repeated exposure data. We therefore recommend the use of long-term exposure in vitro data in order to adequately account for chronic hepatotoxic effects. The models we propose here are capable of being coupled with human biokinetic models in order to relate dose exposure and human hepatotoxicity. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Procházka, Erik; Escher, Beate I; Plewa, Michael J; Leusch, Frederic D L
2015-10-19
The process of disinfecting drinking water inadvertently leads to the formation of numerous disinfection byproducts (DBPs). Some of these are mutagenic, genotoxic, teratogenic, and cytotoxic, as well as potentially carcinogenic both in vivo and in vitro. We investigated the in vitro biological activity of five DBPs: three monohaloacetic acids (monoHAAs) [chloroacetic acid (CAA), bromoacetic acid (BAA), and iodoacetic acid (IAA)] and two novel halobenzoquinones (HBQs) [2,6-dichloro-p-benzoquinone (DCBQ) and 2,6-dibromo-p-benzoquinone]. We focused particularly on cytotoxicity and induction of two adaptive stress response pathways: the oxidative stress responsive Nrf2/ARE and DNA-damage responsive p53 pathways. All five DBPs were cytotoxic to the Caco-2 cell line after a 4 h exposure, and all DBPs induced both of the adaptive stress response pathways, Nrf2/ARE and p53, in the micromolar range, as measured by two β-lactamase-based reporter gene assays. The decreasing order of potency for all three endpoints for the five DBPs was IAA ∼ BAA > DCBQ ∼ DBBQ > CAA. Induction of oxidative stress was previously proposed to be the molecular initiating event (MIE) for both classes of DBPs. However, comparing the levels of activation of the two pathways uncovered that the Nrf2/ARE pathway was the more sensitive endpoint for HAAs, whereas the p53 pathway was more sensitive in the case of HBQs. Therefore, the DNA damage-responsive p53 pathway may be an important piece of information to fill in a gap in the adverse outcome pathway framework for the assessment of HBQs. Finally, we cautiously compared the potential risk of the two novel HBQs using a benchmarking approach to that of the well-studied CAA, which suggested that their relative risk may be lower than that of BAA and IAA.
Directory of Open Access Journals (Sweden)
Minakshi Jha
2018-06-01
Full Text Available An eco-friendly green approach was proposed to synthesise stable, cytotoxic colloidal silver nanoparticles (AgNPs using Momordica charantia (M. charantia fruit extract. Bioinspired green method adopted for fabrication of AgNPs because of easy, fast, low-cost and benign bioprocess. Phytocomponents played the crucial role in capping, stabilisation and inherent cytotoxic potential of colloidal nanosilver. The physiochemical, crystalline, optical and morphological properties of AgNPs were characterized using UV-vis, FT-IR, XRD, SEM, TEM, EDX and AFM. FT-IR reveals the presence of carbonyl, methyl, polyphenol (flavonoid, primary and secondary amine (protein, carboxyl group, ester as major functional groups over the surface of nanomaterials. Mechanistic pathway for formation and stabilisation of colloidal nanosilver has been discussed. Average crystalline size of AgNPs was found to be 12.55 nm from XRD. TEM shows AgNPs nanosphere with size range 1–13.85 nm. Consistency in spherical morphology was also confirmed through Atomic Force Microscopy (AFM. AFM measurement provided image Rq value 3.62, image Ra 2.47, roughness Rmax 36.4 nm, skewness 1.99 and kurtosis 9.87. The SRB assay revealed substantial in vitro noticeable anti-cancer activity of colloidal nanosilver on A549 and HOP-62 human lung cancer cells in a dose dependent manner with IC50 value of 51.93 µg/ml and 76.92 µg/ml. In addition, M. charantia capped AgNPs were found to be more biocompatible in comparison to M. charantia FE. Our study demonstrated the integration of green chemistry principle in nanomaterials fabrication and focused on the potential use of M. charantia fruit extract as an efficient precursor for biocompatible AgNPs anodrug formulation with improved cytotoxic applications. Keywords: M. charantia, Silver nanoparticles, TEM, Anticancer activity, A549, HOP-62
Cytotoxic Activity of the Leaf and Stem Extracts of Hibiscus rosa ...
African Journals Online (AJOL)
Methods: The crude petroleum ether, ethyl acetate and methanol extracts of the leaf and stem of Hibiscus rosa sinensis were prepared using cold extraction method. The in vitro cytotoxic activity of the extracts (20 - 100 μg/ml) was evaluated on leukaemic cancer cell line (K-562) and Mardin-Darby kidney cell line (MDBK) ...
In vitro cytotoxicity of zinc oxide, iron oxide and copper nanopowders prepared by green synthesis
Directory of Open Access Journals (Sweden)
Saranya S.
Full Text Available In vitro cytotoxic effects of ZnO, FeO and Cu metallic nanopowders (NPs on Vero (African green monkey kidney cell line, PK 15 (Pig kidney cell line and Madin Darby Bovine Kidney (MDBK cell lines were investigated at different time intervals (24 and 48 h. MTT (3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay was used to determine the cytotoxic effects of green synthesized (plant based nanopowders. The comparative effects of exposure period and concentration of nanopowders on cell viability were studied. Green synthesized nanopowders showed varying activity on different type of cells and the effect was generally based on the concentration and exposure time. In MDBK cells, only ZnO nanopowder (NP showed significant effect on cell viability. The ZnO NP showed improved cell viability at lower concentration (10 μg/100 μl in all type of cells (Vero, PK 15 and MDBK cells. In contrast, FeO NP showed better activity at the concentration of 10 μg/100 μl, 50 μg/100 μl and 40 μg/100 μl after 24 h exposure time in Vero, PK 15 and MDBK cells respectively. However better cell viability was observed in Cu NP treated Vero, PK 15 and MDBK cells at 40 μg/100 μl, 20 μg/100 μl and 10 μg/100 μl correspondingly. These studies suggested that the activity of green synthesized NPs were highly dependent on concentration, exposure time and type of cells. Keywords: ZnO, FeO, Cu, Nanopowders, MTT, in vitro cytotoxicity
Lima, Helimar Gonçalves; Gomes, Danilo Cavalcante; Santos, Nathália Silva; Dias, Êuder Reis; Botura, Mariana Borges; Batatinha, Maria José Moreira; Branco, Alexsandro
2017-10-01
This study was designed to assess the in vitro anthelmintic activity of the fraction containing alkaloid from Prosopis juliflora pods on goat gastrointestinal nematodes using the egg hatch assay (EHA), larval migration inhibition assay (LMIA), and larval motility assay (LMA). The alkaloid-rich fraction (AF) - content juliprosopine as major alkaloid - was obtained from ethyl acetate extract after fractionation in Sephadex LH-20 chromatography column and its characterization were made by nuclear magnetic resonance analysis together with literature data comparison. The concentrations tested were 4.0, 2.67, 1.78, 1.19, and 0.79 mg/mL (EHA) and 4 mg/mL (LMIA and LMA). The in vitro cytotoxicity on Vero cell cultures was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and trypan blue tests. High ovicidal activity was observed with IC 50 and IC 90 values at 1.1 and 1.43 mg/mL for AF. On the other hand, this fraction showed low larvicidal activity and high toxic effect. Thus, P. juliflora pod alkaloid rich-fraction has ovicidal activity in vitro against goat gastrointestinal nematodes and cytotoxic in Vero cell cultures. Prosopis juliflora alkaloid-rich fraction (AF) showed in vitro anthelmintic effect against gastrointestinal nematodes of goatsThe AF was more effective against eggs than third larval stage (L 3 ) of gastrointestinal nematodesThe AF showed cytotoxicity activity on Vero cell lineThe juliprosopine was the main alkaloid found in the AF from P. juliflora pods. Abbreviations used: AF: Alkaloid-rich fraction; DMSO: Dimethyl sulfoxide; EE: Ethyl acetate extract; EHA: Egg hatch assay; IC50: Inhibitory concentration 50%; IC90: Inhibitory concentration 90%; L3: Infective larvae; LMA: Larval motility assay; LMIA: Larval migration inhibition assay; MTT: Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; PBS: Phosphate buffered saline; RPMI: Roswell Park Memorial Institute médium; TLC
Directory of Open Access Journals (Sweden)
Rosa Raybaudi-Massilia
2017-10-01
Full Text Available Alcoholic and aqueous extracts were obtained from red sweet pepper (Capsicum annuum L. by different methodologies to evaluate their cytotoxic, antioxidant and antimicrobial properties. Alcoholic extracts (MFP, MSd, SFP, SDP, SSd from fresh red sweet pepper (FP and dry pulp (DP and seed (Sd were obtained by maceration (M and Soxhlet (S equipment using methanol as extraction solvent; whereas aqueous extracts (LFP, LSd were obtained by decoction followed by lyophilization (L. Human tumoral cell lines from breast (MCF-7 and SKBr3, prostate (PC3 and cervix (HeLa, and fibroblasts (as control were used to determine the cytotoxic properties by the MTT assay. Antioxidant and antimicrobial properties were determined by DPPH and disc diffusion method, respectively. The extracts SDP and SFP showed the higher cytotoxic activity. The SDP extract had a significant (P < 0.05 in-vitro effect on HeLa (1.9 ± 1.4 µg/mL and PC3 (< 1 µg/mL cells with a moderated impact on fibroblasts (26.1 ± 1.2 µg/mL; whereas, SFP had a significant (p < 0.05 effect on MCF-7 cell line (2.1 ± 1.2 µg/mL with a moderated impact on fibroblasts (25.9 ± 1.0 µg/mL. The higher antioxidant activity was found for MFP (80.3 ± 0.2% and SFP extracts (75.5 ± 0.5%. Mild antimicrobial activity was only observed for alcoholic extracts. The results showed the potential of red sweet pepper (C. annuum L. as a source of antioxidant and cytotoxic compounds, and suggest the need of further studies to isolate and characterize the bioactive compounds that impart those properties.
Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application
International Nuclear Information System (INIS)
Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun
2005-01-01
We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic
International Nuclear Information System (INIS)
Woodward, J.G.; Daynes, R.A.
1978-01-01
A primary in vitro sensitization system employing a chromium release assay was utilized to investigate reactivity of murine spleen cells toward syngeneic ultraviolet (uv) light induced fibrosarcomas. These tumors are immunologically rejected in vivo when implanted into normal syngeneic mice but grow progressively when implanted into syngeneic mice that had previously been irradiated with subcarcinogenic levels of uv light. Following appropriate sensitization, spleen cells from both normal and uv irradiated mice are capable of developing cytotoxic lymphocytes in vitro against the uv induced tumors. It was subsequently discovered that in situ uv induced tumors all contained macrophages of host origin that became demonstrable only after enzymatic dissociation of the tumor tissue. These macrophages were immunologically active in vitro as their presence in the stimulator cell population was necessary to achieve an optimum anti-tumor cytotoxic response following in vitro sensitization. Anti-tumor reactivity generated by mixing spleen cells and tumor cells in the absence of tumor derived macrophages could be greatly enhanced by the addition of normal syngeneic peritoneal macrophages. When in vitro anti-tumor reactivity of spleen cells from normal and uv treated mice was compared under these conditions we again found no significant difference in the magnitude of the responses. In addition, the cytotoxic cells generated in response to uv induced tumors appeared to be highly cross reactive with respect to their killing potential
Directory of Open Access Journals (Sweden)
Knight Louise A
2004-11-01
Full Text Available Abstract Background Activation of the epidermal growth factor receptor (EGFR triggers downstream signaling pathways that regulate many cellular processes involved in tumour survival and growth. Gefitinib ('Iressa' is an orally active tyrosine kinase inhibitor (TKI targeted to the ATP-binding domain of EGFR (HER1; erbB1. Methods In this study we have used a standardised ATP-based tumour chemosensitivity assay (ATP-TCA to measure the activity of gefitinib alone or in combination with different cytotoxic drugs (cisplatin, gemcitabine, oxaliplatin and treosulfan against a variety of solid tumours (n = 86, including breast, colorectal, oesophageal and ovarian cancer, carcinoma of unknown primary site, cutaneous and uveal melanoma, non-small cell lung cancer (NSCLC and sarcoma. The IC50 and IC90 were calculated for each single agent or combination. To allow comparison between samples the IndexSUM was calculated based on the percentage tumour growth inhibition (TGI at each test drug concentration (TDC. Gefitinib was tested at concentrations ranging from 0.0625–2 microM (TDC = 0.446 microg/ml. This study represents the first use of a TKI in the assay. Results There was heterogeneity in the degree of TGI observed when tumours were tested against single agent gefitinib. 7% (6/86 of tumours exhibited considerable inhibition, but most showed a more modest response resulting in a low TGI. The median IC50 value for single agent gefitinib in all tumours tested was 3.98 microM. Interestingly, gefitinib had both positive and negative effects when used in combination with different cytotoxics. In 59% (45/76 of tumours tested, the addition of gefitinib appeared to potentiate the effect of the cytotoxic agent or combination (of these, 11% (5/45 had a >50% decrease in their IndexSUM. In 38% of tumours (29/76, the TGI was decreased when the combination of gefitinib + cytotoxic was used in comparison to the cytotoxic alone. In the remaining 3% (2/76 there was no
Cytotoxicity of metal and semiconductor nanoparticles indicated by cellular micromotility.
Tarantola, Marco; Schneider, David; Sunnick, Eva; Adam, Holger; Pierrat, Sebastien; Rosman, Christina; Breus, Vladimir; Sönnichsen, Carsten; Basché, Thomas; Wegener, Joachim; Janshoff, Andreas
2009-01-27
In the growing field of nanotechnology, there is an urgent need to sensitively determine the toxicity of nanoparticles since many technical and medical applications are based on controlled exposure to particles, that is, as contrast agents or for drug delivery. Before the in vivo implementation, in vitro cell experiments are required to achieve a detailed knowledge of toxicity and biodegradation as a function of the nanoparticles' physical and chemical properties. In this study, we show that the micromotility of animal cells as monitored by electrical cell-substrate impedance analysis (ECIS) is highly suitable to quantify in vitro cytotoxicity of semiconductor quantum dots and gold nanorods. The method is validated by conventional cytotoxicity testing and accompanied by fluorescence and dark-field microscopy to visualize changes in the cytoskeleton integrity and to determine the location of the particles within the cell.
Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr
2005-05-15
We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.
Barapatre, Anand; Meena, Avtar Singh; Mekala, Sowmya; Das, Amitava; Jha, Harit
2016-05-01
Lignin is one of the most important phytomacromolecule with diverse therapeutic properties such as anticancer, antimicrobial, anti-inflammatory and immune-stimulatory. The present study was carried out to evaluate the in vitro antioxidant, free radical scavenging and anti-proliferative/cytotoxic activities of eleven different lignin fractions, extracted from the wood of Acacia nilotica by pressurized solvent extraction (PSE) and successive solvent extraction (SSE) methods. Results indicate that the PSE fractions have high polyphenolic content and reducing power. However, the antioxidant efficiency examined by DPPH and ABTS radical scavenging assay was higher in SSE fractions. All lignin fractions revealed a significant ability to scavenge nitric oxide, hydroxyl and superoxide radicals. The extracted lignin fractions display high ferric ion reducing capacity and also possess excellent antioxidant potential in the hydrophobic (linoleic acid) system. Fractions extracted by polar solvent has the highest iron (Fe(2+)) chelating activity as compared to other factions, indicating their effect on the redox cycling of iron. Four lignin fractions depicted higher cytotoxic potential (IC50: 2-15 μg/mL) towards breast cancer cell line (MCF-7) but were ineffective (IC50: ≥ 100 μg/mL) against normal primary human hepatic stellate cells (HHSteCs). These findings suggest that the lignin extracts of A. nilotica wood has a remarkable potential to prevent disease caused by the overproduction of radicals and also seem to be a promising candidate as natural antioxidant and anti-cancer agents. Copyright © 2016 Elsevier B.V. All rights reserved.
In vitro cytotoxic activity of Brazilian Middle West plant extracts
Directory of Open Access Journals (Sweden)
Talal Suleiman Mahmoud
2011-06-01
Full Text Available Cytotoxic activity of eight plant extracts, native from the Mid-West of Brazil comprising Cerrado, Pantanal and semideciduous forest, was evaluated for MDA-MB-435, SF-295, and HCT-8 cancer cell strains. A single 100 µg.mL-1 dose of each extract was employed with 72 h of incubation for all tests. Doxorubicin (1 µg.mL-1 was used as the positive control and the MTT method was used to detect the activity. Cytotoxicity of distinct polarities was observed in thirty extracts (46%, from different parts of the following species: Tabebuia heptaphylla (Vell. Toledo, Bignoniaceae, Tapirira guianensis Aubl., Anacardiaceae, Myracrodruon urundeuva Allemão, Anacardiaceae, Schinus terebinthifolius Raddi, Anacardiaceae, Gomphrena elegans Mart., Amaranthaceae, Attalea phalerata Mart. ex Spreng., Arecaceae, Eugenia uniflora L., Myrtaceae, and Annona dioica A. St.-Hil., Annonaceae. Extracts of at least two tested cell strains were considered to be highly active since their inhibition rate was over 75%.
Directory of Open Access Journals (Sweden)
Itharat Arunporn
2010-09-01
Full Text Available Abstract Background Cholangiocarcinoma is a serious public health in Thailand with increasing incidence and mortality rates. The present study aimed to investigate cytotoxic activities of crude ethanol extracts of a total of 28 plants and 5 recipes used in Thai folklore medicine against human cholangiocarcinoma (CL-6, human laryngeal (Hep-2, and human hepatocarcinoma (HepG2 cell lines in vitro. Methods Cytotoxic activity of the plant extracts against the cancerous cell lines compared with normal cell line (renal epithelial cell: HRE were assessed using MTT assay. 5-fluorouracil was used as a positive control. The IC50 (concentration that inhibits cell growth by 50% and the selectivity index (SI were calculated. Results The extracts from seven plant species (Atractylodes lancea, Kaempferia galangal, Zingiber officinal, Piper chaba, Mesua ferrea, Ligusticum sinense, Mimusops elengi and one folklore recipe (Pra-Sa-Prao-Yhai exhibited promising activity against the cholangiocarcinoma CL-6 cell line with survival of less than 50% at the concentration of 50 μg/ml. Among these, the extracts from the five plants and one recipe (Atractylodes lancea, Kaempferia galangal, Zingiber officinal, Piper chaba, Mesua ferrea, and Pra-Sa-Prao-Yhai recipe showed potent cytotoxic activity with mean IC50 values of 24.09, 37.36, 34.26, 40.74, 48.23 and 44.12 μg/ml, respectively. All possessed high activity against Hep-2 cell with mean IC50 ranging from 18.93 to 32.40 μg/ml. In contrast, activity against the hepatoma cell HepG2 varied markedly; mean IC50 ranged from 9.67 to 115.47 μg/ml. The only promising extract was from Zingiber officinal (IC50 = 9.67 μg/ml. The sensitivity of all the four cells to 5-FU also varied according to cell types, particularly with CL-6 cell (IC50 = 757 micromolar. The extract from Atractylodes lancea appears to be both the most potent and most selective against cholangiocarcinoma (IC50 = 24.09 μg/ml, SI = 8.6. Conclusions The
An In Vitro Assessment of Antimicrobial and Cytotoxic Effects of Nanosilver
Directory of Open Access Journals (Sweden)
Rokhsareh Sadeghi
2015-10-01
Full Text Available Background: The antimicrobial activity of silver nanoparticles has been investigated in medical fields in recent years, but there are few studies regarding its effect on oral microorganisms. The aim of the present study was to evaluate the in vitro antimicrobial and toxicity properties of nanosilver against two dental plaque microorganisms and Human Gin- gival Fibroblast (HGF cell line.Methods: Antibacterial effects of nanosilver colloidal solution were de-termined by minimal inhibitory concentration (MIC and minimal bacte- ricidal concentration (MBC using microdilution method. Standard strains of Streptococcus sanguis and Actinomyces viscosus were used. For toxicity assessment, MTT and LDH tests were performed under con- trolled conditions. Different concentrations of nanosilver were prepared and their toxic effects on HGF were determined after 24, 48 and 72 hours.Results: The MIC of nanosilver solution for S. sanguis and A. viscosuswere 16 and 4 µ g/ml, respectively. The MBC of nanosilver was 64 µ g/ml for S. sanguis and 16 µ g/ml for A. viscosus. MTT results showed that after 24 hours the concentrations of ≥ 0.5 µ g/ml of nanosilver solution affected cell viability when compared with control group. After 48 and 72 hours only the concentration of ≥ 5 µ g/ml showed significant effect on cultured cell viability. LDH release test demonstrated toxic effect only after 48, 72 hours by 20 and 50 µ g/ml of nanosilver.Conclusion: The results demonstrated that beside its antibacterial activityagainst S. sanguis and A. viscosus, nanosilver mediated a concentration and time dependent cytotoxicity on HGF.
Directory of Open Access Journals (Sweden)
Xuelian Bai
2018-06-01
Full Text Available Mango peel, the main by-product of juice processing, possesses appreciable quantities of bioactive phenolic compounds and is worthy of further utilization. The present work reports for the first time the HPLC analysis and in vitro antioxidant evaluation of mango peel phenols (MPPs and their cytotoxic effect on the A549 lung cancer cell line. These results indicated that mango peel has the total phenolic content of 723.2 ± 0.93 mg·kg−1 dry mango peel (DMP, which consisted mainly of vanillic aldehyde, caffeic acid, chlorogenic acid, gallic acid, procyanidin B2 and oleanolic acid. Antioxidant assays showed that MPPs had strong antioxidant activities, with 92 ± 4.2% of DPPH radical scavenging rate, 79 ± 2.5% of ABTS radical inhibition rate and 4.7 ± 0.5 μM Trolox equivalents per kg−1 DMP of ferric reducing power. Gallic acid possess a stronger antioxidant capacity than other phenols. In vitro cytotoxic tests suggested that mango peel extract (MPE had an IC50 value of 15 mg·mL−1 and MPPs had a stronger inhibitory effect on the A549 cell line. Oleanolic acid exhibited the strongest cytotoxicity, with an IC50 value of 4.7 μM, which was similar with that of the positive control 5-fluorouracil.
Grecco, Simone dos S; Martins, Euder Glendes A; Girola, Natália; de Figueiredo, Carlos R; Matsuo, Alisson L; Soares, Marisi G; Bertoldo, Bruno de C; Sartorelli, Patricia; Lago, João Henrique G
2015-01-01
Nectandra (Lauraceae) species have been used in folk medicine as an antidiarrheal, analgesic, antifungal, etc., and have many pharmacological proprieties. Investigation of the chemical composition and cytotoxicity of essential oil from Nectandra leucantha Nees & Mart. leaves. This is the first study involving N. leucantha reported in the literature. The essential oil of N. leucantha leaves was obtained by hydrodistillation. Its chemical composition was determined using a combination of GC/FID, GC/MS, and determination of Kovats index (KI). In vitro cytotoxic activity was evaluated against six cancer cell lines - murine melanoma (B16F10-Nex2), human glioblastome (U-87), human cervical carcinoma (HeLa), human colon carcinoma (HCT), human breast adenocarcinoma (MCF7), and human cervical tumor (Siha) as well as against one non-tumorigenic cell line - human foreskin fibroblast (HFF). Thirty-three compounds were identified primarily sesquiterpenes (81.41%), the main compounds being bicyclogermacrene (28.44%), germacrene A (7.34%), spathulenol (5.82%), and globulol (5.25%). Furthermore, monoterpenes were also found in the analyzed oil (12.84%), predominantly α- and β-pinenes (6.59 and 4.57%, respectively). The crude essential oil displayed significant cytotoxic activity against B16F10-Nex2 (IC50 33 ± 1 μg/mL) and U87 (IC50 75.95 ± 0.03 μg/mL) and HeLa (IC50 60 ± 12 μg/mL) cell lines. The main identified compound, bicyclogermacrene, displayed IC50 ranging from 3.1 ± 0.2 to 21 ± 6 μg/mL. The results indicate that the crude oils from leaves of N. leucantha displayed cytotoxic activity being bicyclogermacrene, the main compound identified in the crude oil responsible, at least in part, for this potential.
Csoka, K; Larsson, R; Tholander, B; Gerdin, E; de la Torre, M; Nygren, P
1994-08-01
The automated fluorometric microculture cytotoxicity assay (FMCA) is based on the measurement of fluorescence generated from cellular hydrolysis of fluorescein diacetate (FDA) to fluorescein by viable cells after a 72-hr culture period in microtiter plates. The FMCA was adopted for chemosensitivity testing of tumor cells from patients with ovarian carcinoma. Thirty-seven samples of solid tumors and malignant effusions were obtained from 35 patients at diagnosis or relapse. Tumor cells from solid samples and effusions were prepared by enzymatic digestion and centrifugation, respectively, followed by Percoll or Ficoll purification. The fluorescence was proportional to the number of cells/well and considerably higher in tumor cells than in contaminating normal cells. The effect of up to 19 cytotoxic drugs was successfully assessed in 70% of the samples and there was a good correlation between drug sensitivity data reported by the FMCA and the DiSC assay performed in parallel. The overall drug sensitivity pattern in vitro corresponded well to the clinical experience. The effect of cisplatin varied considerably between patients and resistance was found also in cases not previously exposed to cytotoxic drugs. The FMCA is a rapid and simple method that seems to report clinically relevant cytotoxic drug sensitivity data in ovarian carcinomas. In the future, this method may contribute to optimizing chemotherapy by assisting in individualized drug selection and new drug development.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
In vitro screening of organotin compounds and sediment extracts for cytotoxicity to fish cells.
Giltrap, Michelle; Macken, Ailbhe; McHugh, Brendan; McGovern, Evin; Foley, Barry; Davoren, Maria
2011-01-01
The present study reports an in vitro screening method for contaminants in sediment samples utilizing an RTG-2 cell line. This technique integrates cytotoxicity testing with analytical chemistry with the aim of achieving a toxicity evaluation of the sediment sample. The toxic effect of individual organotin (OT) compounds and their presence in the sediment sample is the focus of the present study; however, other contaminants are also discussed. The following OT compounds: tributyltin (TBT), dibutyltin (DBT), monobutyltin (MBT), triphenyltin (TPT), diphenyltin (DPT), and a sediment solvent extract are exposed to the RTG-2 fish cell line. Both the alamar blue (AB) and neutral red (NR) assays are used to assess cytotoxicity after 24-h and 96-h exposure. Methodology for preparation of a sediment solvent extract suitable for biological testing and analytical determination is also described. With the RTG-2 cells, the AB and NR assays had comparable sensitivity for each individual OT compound exposure after 24 h, with TPT being the most toxic compound tested. The individual OT compound concentrations required to induce a 50% toxic effect on the cells (369 ng ml⁻¹ TBT, 1,905 ng ml⁻¹ DBT) did not equate to the concentrations of these contaminants present in the sediment extract that induced a 50% effect on the cells (294 ng ml⁻¹ TBT, 109 ng ml⁻¹ DBT). The solvent extract therefore exhibited a greater toxicity, and this suggests that the toxic effects observed were not due to OT compounds alone. The presence of other contaminants in the solvent extract is confirmed with chemical analysis, warranting further toxicity testing of contaminant mixtures and exposure to the cell line to further elucidate a complete toxicity evaluation. © 2010 SETAC.
Cytotoxicity of Light-Cured Dental Materials according to Different Sample Preparation Methods
Directory of Open Access Journals (Sweden)
Myung-Jin Lee
2017-03-01
Full Text Available Dental light-cured resins can undergo different degrees of polymerization when applied in vivo. When polymerization is incomplete, toxic monomers may be released into the oral cavity. The present study assessed the cytotoxicity of different materials, using sample preparation methods that mirror clinical conditions. Composite and bonding resins were used and divided into four groups according to sample preparation method: uncured; directly cured samples, which were cured after being placed on solidified agar; post-cured samples were polymerized before being placed on agar; and “removed unreacted layer” samples had their oxygen-inhibition layer removed after polymerization. Cytotoxicity was evaluated using an agar diffusion test, MTT assay, and confocal microscopy. Uncured samples were the most cytotoxic, while removed unreacted layer samples were the least cytotoxic (p < 0.05. In the MTT assay, cell viability increased significantly in every group as the concentration of the extracts decreased (p < 0.05. Extracts from post-cured and removed unreacted layer samples of bonding resin were less toxic than post-cured and removed unreacted layer samples of composite resin. Removal of the oxygen-inhibition layer resulted in the lowest cytotoxicity. Clinicians should remove unreacted monomers on the resin surface immediately after restoring teeth with light-curing resin to improve the restoration biocompatibility.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
International Nuclear Information System (INIS)
Lin, Ming-Chung; Chen, Chia-Ling; Yang, Tsan-Tzu; Choi, Pui-Ching; Hsing, Chung-Hsi; Lin, Chiou-Feng
2012-01-01
An overdose and a prolonged treatment of propofol may cause cellular cytotoxicity in multiple organs and tissues such as brain, heart, kidney, skeletal muscle, and immune cells; however, the underlying mechanism remains undocumented, particularly in vascular endothelial cells. Our previous studies showed that the activation of glycogen synthase kinase (GSK)-3 is pro-apoptotic in phagocytes during overdose of propofol treatment. Regarding the intravascular administration of propofol, we therefore hypothesized that propofol overdose also induces endothelial cytotoxicity via GSK-3. Propofol overdose (100 μg/ml) inhibited growth in human arterial and microvascular endothelial cells. After treatment, most of the endothelial cells experienced caspase-independent necrosis-like cell death. The activation of cathepsin D following lysosomal membrane permeabilization (LMP) determined necrosis-like cell death. Furthermore, propofol overdose also induced caspase-dependent apoptosis, at least in part. Caspase-3 was activated and acted downstream of mitochondrial transmembrane potential (MTP) loss; however, lysosomal cathepsins were not required for endothelial cell apoptosis. Notably, activation of GSK-3 was essential for propofol overdose-induced mitochondrial damage and apoptosis, but not necrosis-like cell death. Intraperitoneal administration of a propofol overdose in BALB/c mice caused an increase in peritoneal vascular permeability. These results demonstrate the cytotoxic effects of propofol overdose, including cathepsin D-regulated necrosis-like cell death and GSK-3-regulated mitochondrial apoptosis, on endothelial cells in vitro and the endothelial barrier dysfunction by propofol in vivo. Highlights: ► Propofol overdose causes apoptosis and necrosis in endothelial cells. ► Propofol overdose triggers lysosomal dysfunction independent of autophagy. ► Glycogen synthase kinase-3 facilitates propofol overdose-induced apoptosis. ► Propofol overdose causes an increase
Energy Technology Data Exchange (ETDEWEB)
Lin, Ming-Chung [Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Department of Anesthesiology, Chi Mei Medical Center, Liouying, Tainan, Taiwan (China); Chen, Chia-Ling [Center of Infectious Disease and Signaling Research, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Yang, Tsan-Tzu; Choi, Pui-Ching [Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Hsing, Chung-Hsi [Department of Anesthesiology, Chi Mei Medical Center, Tainan, Taiwan (China); Department of Anesthesiology, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Chiou-Feng, E-mail: cflin@mail.ncku.edu.tw [Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Center of Infectious Disease and Signaling Research, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China)
2012-12-01
An overdose and a prolonged treatment of propofol may cause cellular cytotoxicity in multiple organs and tissues such as brain, heart, kidney, skeletal muscle, and immune cells; however, the underlying mechanism remains undocumented, particularly in vascular endothelial cells. Our previous studies showed that the activation of glycogen synthase kinase (GSK)-3 is pro-apoptotic in phagocytes during overdose of propofol treatment. Regarding the intravascular administration of propofol, we therefore hypothesized that propofol overdose also induces endothelial cytotoxicity via GSK-3. Propofol overdose (100 μg/ml) inhibited growth in human arterial and microvascular endothelial cells. After treatment, most of the endothelial cells experienced caspase-independent necrosis-like cell death. The activation of cathepsin D following lysosomal membrane permeabilization (LMP) determined necrosis-like cell death. Furthermore, propofol overdose also induced caspase-dependent apoptosis, at least in part. Caspase-3 was activated and acted downstream of mitochondrial transmembrane potential (MTP) loss; however, lysosomal cathepsins were not required for endothelial cell apoptosis. Notably, activation of GSK-3 was essential for propofol overdose-induced mitochondrial damage and apoptosis, but not necrosis-like cell death. Intraperitoneal administration of a propofol overdose in BALB/c mice caused an increase in peritoneal vascular permeability. These results demonstrate the cytotoxic effects of propofol overdose, including cathepsin D-regulated necrosis-like cell death and GSK-3-regulated mitochondrial apoptosis, on endothelial cells in vitro and the endothelial barrier dysfunction by propofol in vivo. Highlights: ► Propofol overdose causes apoptosis and necrosis in endothelial cells. ► Propofol overdose triggers lysosomal dysfunction independent of autophagy. ► Glycogen synthase kinase-3 facilitates propofol overdose-induced apoptosis. ► Propofol overdose causes an increase
Antimicrobial and cytotoxic potentials of Buddleja polystachya extracts
Directory of Open Access Journals (Sweden)
Ghada Ahmed Fawzy
2013-06-01
Full Text Available Most of the species of Buddleja have found applications in folk medicine. This study aimed to evaluate the in vitro antimicrobial and cytotoxic potentials of B. polystachya extracts. Four extracts were prepared A-D (dichloromethane, ethyl acetate, n-butanol, and aqueous extracts, respectively. The antimicrobial activity was evaluated using the broth micro-dilution assay for minimum inhibitory concentrations (MIC. The crystal violet staining method (CVS was used for the evaluation of the cytotoxic activity on HepG-2, MCF-7 and HCT-116 human cell lines. Results showed that the highest antimicrobial activity was given by the ethyl acetate extract followed by the dichloromethane extract, while the n-butanol revealed moderate activity against gram positive bacteria only with no activity against the rest of tested microorganisms. The aqueous extract was totally ineffective against all tested microorganisms at 20 mg/ml. Among the four extracts tested, dichloromethane and ethyl acetate extracts showed the highest cytotoxic activity on all three human cell lines.
Datta, Aparna; Dasgupta, Sayantan; Mukherjee, Siddhartha
2017-04-01
In the past decade, a variety of drug carriers based on mesoporous silica nanoparticles has been extensively reported. However, their biocompatibility still remains debatable, which motivated us to explore the porous nanostructures of other metal oxides, for example titanium dioxide (TiO2), as potential drug delivery vehicles. Herein, we report the in vitro hemolysis, cytotoxicity, and protein binding of TiO2 nanoparticles, synthesized by a sol-gel method. The surface of the TiO2 nanoparticles was modified with hydroxyl, amine, or thiol containing moieties to examine the influence of surface functional groups on the toxicity and protein binding aspects of the nanoparticles. Our study revealed the superior hemocompatibility of pristine, as well as functionalized TiO2 nanoparticles, compared to that of mesoporous silica, the present gold standard. Among the functional groups studied, aminosilane moieties on the TiO2 surface substantially reduced the degree of hemolysis (down to 5%). Further, cytotoxicity studies by MTT assay suggested that surface functional moieties play a crucial role in determining the biocompatibility of the nanoparticles. The presence of NH2- functional groups on the TiO2 nanoparticle surface enhanced the cell viability by almost 28% as compared to its native counterpart (at 100 μg/ml), which was in agreement with the hemolysis assay. Finally, nonspecific protein adsorption on functionalized TiO2 surfaces was examined using human serum albumin and it was found that negatively charged surface moieties, like -OH and -SH, could mitigate protein adsorption to a significant extent.
Begnini, Karine Rech; Rizzi, Caroline; Campos, Vinicius Farias; Borsuk, Sibele; Schultze, Eduarda; Yurgel, Virginia Campello; Nedel, Fernanda; Dellagostin, Odir Antônio; Collares, Tiago; Seixas, Fabiana Kömmling
2013-02-01
BCG therapy remains at the forefront of immunotherapy for treating patients with superficial bladder cancer. The high incidence of local side effects and the presence of non-responder diseases have led to efforts to improve the therapy. Hence, we proposed that an auxotrophic recombinant BCG strain overexpressing Ag85B (BCG ∆leuD/Ag85B), could enhance the cytotoxicity to the human bladder carcinoma cell line 5637. The rBCG was generated using an expression plasmid encoding the mycobacterial antigen Ag85B to transform a BCG ∆leuD strain. The inhibitory effect of BCG ∆leuD/Ag85B on 5637 cells was determined by the MTT method, morphology observation and a LIVE/DEAD assay. Gene expression profiles for apoptotic, cell cycle-related and oxidative stress-related genes were investigated by qRT-PCR. Bax, bcl-2 and p53 induction by BCG ∆leuD/Ag85B treatment was evaluated by Western blotting. BCG ∆leuD/Ag85B revealed a superior cytotoxicity effect compared to the control strains used in this study. The results showed that the expression level of pro-apoptotic and cell cycle-related genes increased after BCG ∆leuD/Ag85B treatment, whereas the mRNA levels of anti-apoptotic genes decreased. Interestingly, BCG ∆leuD/Ag85B also increased the mRNA level of antioxidant enzymes in the bladder cancer cell line. Bax and p53 proteins levels increased following treatment. In conclusion, these results suggest that treatment with BCG ∆leuD/Ag85B enhances cytotoxicity for superficial bladder cancer cells in vitro. Therefore, rBCG therapy may have potential benefits in the treatment of bladder cancer.
Chadda, Harshita; Naveen, Sangeetha Vasudevaraj; Mohan, Saktiswaren; Satapathy, Bhabani K; Ray, Alok R; Kamarul, Tunku
2016-07-01
Although the physical and mechanical properties of hydroxyapatite-filled dental restorative composite resins have been examined, the biocompatibility of these materials has not been studied in detail. The purpose of this in vitro study was to analyze the toxicity of acrylate-based restorative composite resins filled with hydroxyapatite and a silica/hydroxyapatite combination. Five different restorative materials based on bisphenol A-glycidyl methacrylate (bis-GMA) and tri-ethylene glycol dimethacrylate (TEGDMA) were developed: unfilled (H0), hydroxyapatite-filled (H30, H50), and silica/hydroxyapatite-filled (SH30, SH50) composite resins. These were tested for in vitro cytotoxicity by using human bone marrow mesenchymal stromal cells. Surface morphology, elemental composition, and functional groups were determined by scanning electron microscopy (SEM), energy-dispersive x-ray spectroscopy (EDX), and Fourier-transformed infrared spectroscopy (FTIR). The spectra normalization, baseline corrections, and peak integration were carried out by OPUS v4.0 software. Both in vitro cytotoxicity results and SEM analysis indicated that the composite resins developed were nontoxic and supported cell adherence. Elemental analysis with EDX revealed the presence of carbon, oxygen, calcium, silicon, and gold, while the presence of methacrylate, hydroxyl, and methylene functional groups was confirmed through FTIR analysis. The characterization and compatibility studies showed that these hydroxyapatite-filled and silica/hydroxyapatite-filled bis-GMA/TEGDMA-based restorative composite resins are nontoxic to human bone marrow mesenchymal stromal cells and show a favorable biologic response, making them potential biomaterials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
Cytotoxic activity of Agave lechuguilla Torr | Casillas | African ...
African Journals Online (AJOL)
The cytotoxic activity of extract and isolated saponin from leaves of Agave lechuguilla was investigated. Ethanol extract from leaves of A. lechuguilla exhibited cytotoxic activity against HeLa cells in vitro (50% inhibitory concentration (IC50) = 89 μg/ml). Bioassay-guided fractionation of this extract had led to the isolation of 5-β ...
Energy Technology Data Exchange (ETDEWEB)
Li Jianan [State Key Laboratory of Metal Matrix Composites, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Han Pei, E-mail: hanpei_cn@163.com [Orthopaedic Department of the 6th People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Ji Weiping [Orthopaedic Department of the 6th People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Song, Yang; Zhang, Shaoxiang; Chen Ying; Zhao Changli; Zhang Fan [State Key Laboratory of Metal Matrix Composites, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Zhang Xiaonong, E-mail: xnzhang@sjtu.edu.cn [State Key Laboratory of Metal Matrix Composites, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Key Laboratory of Inorganic Coating Materials, Chinese Academy of Sciences, Shanghai 200051 (China); Jiang Yao [Orthopaedic Department of the 6th People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China)
2011-12-15
A kind of biodegradable fluoridated hydroxyapatite (FHA) coating was prepared on Mg-Zn alloy to improve the interface bioactivity in bone healing via electrodeposition method. The in vitro cytotoxicity evaluation of the ions released during degradation was taken. No toxicity was shown and even higher cells' viability appeared on the 7th day compared with the normal culture case (negative control). In vivo implantation was carried out in the femoral condyle of adult New Zealand rabbits. The cross section showed by Micro-CT scan confirmed that the better interface contacts happened in the coated group after one month implantation. Also the coating left can still be normally observed by scanning electron microscope (SEM) with a little degradation. As a result, the FHA coating may be a promising candidate to enhance interface bioactivity for biodegradable Mg alloys in orthopaedics.
Electronic cigarette aerosol induces significantly less cytotoxicity than tobacco smoke
Azzopardi, David; Patel, Kharishma; Jaunky, Tomasz; Santopietro, Simone; Camacho, Oscar M.; McAughey, John; Gaça, Marianna
2016-01-01
Abstract Electronic cigarettes (E-cigarettes) are a potential means of addressing the harm to public health caused by tobacco smoking by offering smokers a less harmful means of receiving nicotine. As e-cigarettes are a relatively new phenomenon, there are limited scientific data on the longer-term health effects of their use. This study describes a robust in vitro method for assessing the cytotoxic response of e-cigarette aerosols that can be effectively compared with conventional cigarette smoke. This was measured using the regulatory accepted Neutral Red Uptake assay modified for air–liquid interface (ALI) exposures. An exposure system, comprising a smoking machine, traditionally used for in vitro tobacco smoke exposure assessments, was adapted for use with e-cigarettes to expose human lung epithelial cells at the ALI. Dosimetric analysis methods using real-time quartz crystal microbalances for mass, and post-exposure chemical analysis for nicotine, were employed to detect/distinguish aerosol dilutions from a reference Kentucky 3R4F cigarette and two commercially available e-cigarettes (Vype eStick and ePen). ePen aerosol induced 97%, 94% and 70% less cytotoxicity than 3R4F cigarette smoke based on matched EC50 values at different dilutions (1:5 vs. 1:153 vol:vol), mass (52.1 vs. 3.1 μg/cm2) and nicotine (0.89 vs. 0.27 μg/cm2), respectively. Test doses where cigarette smoke and e-cigarette aerosol cytotoxicity were observed are comparable with calculated daily doses in consumers. Such experiments could form the basis of a larger package of work including chemical analyses, in vitro toxicology tests and clinical studies, to help assess the safety of current and next generation nicotine and tobacco products. PMID:27690199
Kwon, Jae-Sung; Kim, Kwang-Mahn; Kim, Kyoung-Nam
2014-10-01
The biocompatibility evaluation of nanomaterials is essential for their medical diagnostic and therapeutic usage, where a cytotoxicity test is the simplest form of biocompatibility evaluation. Three methods have been commonly used in previous studies for the cytotoxicity testing of nanomaterials: trypan blue exclusion, colorimetric assay using water soluble tetrazolium (WST), and imaging under a microscope following calcein AM/ethidium homodimer-1 staining. However, there has yet to be a study to compare each method. Therefore, in this study three methods were compared using the standard reference material of sodium lauryl sulfate (SLS). Each method of the cytotoxicity test was carried out using mouse fibroblasts of L-929 exposed to different concentrations of SLS. Compared to the gold standard trypan blue exclusion test, both colorimetric assay using water soluble tetrazolium (WST) and imaging under microscope with calcein AM/ethidium homodimer-1 staining showed results that were not statistically different. Also, each method exhibited various advantages and disadvantages, which included the need of equipment, time taken for the experiment, and provision of additional information such as cell morphology. Therefore, this study concludes that all three methods of cytotoxicity testing may be valid, though careful consideration will be needed when selecting tests with regard to time, finances, and the amount of information required by the researcher(s).
Kim, Young Sup; Kim, Jeoung Seob; Park, Sung-Hee; Choi, Sang-Un; Lee, Chong Ock; Kim, Seong-Kie; Kim, Young-Kyoon; Kim, Sung Hoon; Ryu, Shi Yong
2003-04-01
Two xanthanolide sesquiterpene lactones, 8- epi-xanthatin (1) and 8- epi-xanthatin epoxide (2), isolated from the leaves of Xanthium strumarium (Compositae), demonstrated a significant inhibition on the proliferation of cultured human tumor cells, i. e., A549 (non-small cell lung), SK-OV-3 (ovary), SK-MEL-2 (melanoma), XF498 (central nervous system) and HCT-15 (colon) in vitro. They were also found to inhibit the farnesylation process of human lamin-B by farnesyltransferase (FTase), in a dose-dependent manner in vitro (IC 50 value was calculated as 64 and 58 microM, respectively). Due to the relatively high concentrations of 1 and 2 required to obtain an FTase inhibition as compared with those necessary for a cytotoxic effect on tumor cells, it remains unclear whether a relationship between these two activities exists.
Directory of Open Access Journals (Sweden)
Soek Sin Teh
2013-01-01
Full Text Available The in vitro cytotoxicity tests on the extracts of Mesua beccariana, M. ferrea, and M. congestiflora against Raji, SNU-1, HeLa, LS-174T, NCI-H23, SK-MEL-28, Hep-G2, IMR-32, and K562 were achieved using MTT assay. The methanol extracts of Mesua beccariana showed its potency towards the proliferation of B-lymphoma cell (Raji. In addition, only the nonpolar to semipolar extracts (hexane to ethyl acetate of the three Mesua species indicated cytotoxic effects on the tested panel of human cancer cell lines. Antioxidant assays were evaluated using DPPH scavenging radical assay and Folin-Ciocalteu method. The methanol extracts of M. beccariana and M. ferrea showed high antioxidant activities with low EC50 values of 12.70 and 9.77 μg/mL, respectively, which are comparable to that of ascorbic acid (EC50 = 5.62 μg/mL. Antibacterial tests were carried out using four Gram positive and four Gram negative bacteria on Mesua beccariana extracts. All the extracts showed negative results in the inhibition of Gram negative bacteria. Nevertheless, methanol extracts showed some activities against Gram positive bacteria which are Bacillus cereus, methicillin-sensitive Staphylococcus aureus (MSSA, and methicillin-resistant Staphylococcus aureus (MRSA, while the hexane extract also contributed some activities towards Bacillus cereus.
Fan, Jun; Qiu, Xin; Niu, Xiaodong; Tian, Zheng; Sun, Wei; Liu, Xiaojuan; Li, Yangde; Li, Weirong; Meng, Jian
2013-05-01
Mg-1.5Y-1.2Zn-0.44Zr alloys were newly developed as degradable metallic biomaterials. A comprehensive investigation of the microstructure, mechanical properties, in vitro degradation assessments and in vitro cytotoxicity evaluations of the as-cast state, as-heat treated state and as-extruded state alloys was done. The microstructure observations show that the Mg-1.5Y-1.2Zn-0.44Zr alloys are mainly composed of the matrix α-Mg phases and the Mg12ZnY secondary phases (LPS structure). The hot extrusion method significantly refined the grains and eliminated the defects of both as-cast and heat treated alloys and thereby contributed to the better mechanical properties and biodegradation resistance. The values of tensile strength and tensile yield strength of the alloy in the as-extruded condition are about 236 and 178 MPa respectively, with an excellent elongation of 28%. Meanwhile, the value of compressive strength is about 471 MPa and the value of bending strength is about 501 MPa. The superior bending strength further demonstrates the excellent ductility of the hot extruded alloys. The results of immersion tests and electrochemical measurements in the SBF indicate that a protective film precipitated on the alloy's surface with the extension of degradation. The protective film contains Mg(OH)2 and hydroxyapatite (HA) which can reinforce osteoblast activity and promote good biocompatibility. No significant cytotoxicity towards L-929 cells was detected and the immersion extracts of alloy samples could enhance the cell proliferation with time in the cytotoxicity evaluations, implying that the Mg-1.5Y-1.2Zn-0.44Zr alloys have the potential to be used for biomedical applications. Copyright © 2013 Elsevier B.V. All rights reserved.
A cell-microelectronic sensing technique for profiling cytotoxicity of chemicals
International Nuclear Information System (INIS)
Boyd, Jessica M.; Huang, Li; Xie Li; Moe, Birget; Gabos, Stephan; Li Xingfang
2008-01-01
A cell-microelectronic sensing technique is developed for profiling chemical cytotoxicity and is used to study different cytotoxic effects of the same class chemicals using nitrosamines as examples. This technique uses three human cell lines (T24 bladder, HepG2 liver, and A549 lung carcinoma cells) and Chinese hamster ovary (CHO-K1) cells in parallel as the living components of the sensors of a real-time cell electronic sensing (RT-CES) method for dynamic monitoring of chemical toxicity. The RT-CES technique measures changes in the impedance of individual microelectronic wells that is correlated linearly with changes in cell numbers during t log phase of cell growth, thus allowing determination of cytotoxicity. Four nitrosamines, N-nitrosodimethylamine (NDMA), N-nitrosodiphenylamine (NDPhA), N-nitrosopiperidine (NPip), and N-nitrosopyrrolidine (NPyr), were examined and unique cytotoxicity profiles were detected for each nitrosamine. In vitro cytotoxicity values (IC 50 ) for NDPhA (ranging from 0.6 to 1.9 mM) were significantly lower than the IC 50 values for the well-known carcinogen NDMA (15-95 mM) in all four cell lines. T24 cells were the most sensitive to nitrosamine exposure among the four cell lines tested (T24 > CHO > A549 > HepG2), suggesting that T24 may serve as a new sensitive model for cytotoxicity screening. Cell staining results confirmed that administration of the IC 50 concentration from the RT-CES experiments inhibited cell growth by 50% compared to the controls, indicating that the RT-CES method provides reliable measures of IC 50 . Staining and cell-cycle analysis confirmed that NDPhA caused cell-cycle arrest at the G0/G1 phase, whereas NDMA did not disrupt the cell cycle but induced cell death, thus explaining the different cytotoxicity profiles detected by the RT-CES method. The parallel cytotoxicity profiling of nitrosamines on the four cell lines by the RT-CES method led to the discovery of the unique cytotoxicity of NDPhA causing cell
A cell-microelectronic sensing technique for profiling cytotoxicity of chemicals
Energy Technology Data Exchange (ETDEWEB)
Boyd, Jessica M [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Huang, Li [Environmental Health Sciences, Department of Public Health Sciences, School of Public Health, University of Alberta, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Li, Xie; Moe, Birget [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Gabos, Stephan [Public Health Surveillance and Environmental Health, Alberta Health and Wellness, 10025 Jasper Avenue, Box 1360, Edmonton, Alberta, T5J 2N3 (Canada); Xingfang, Li [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Environmental Health Sciences, Department of Public Health Sciences, School of Public Health, University of Alberta, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada)], E-mail: xingfang.li@ualberta.ca
2008-05-12
A cell-microelectronic sensing technique is developed for profiling chemical cytotoxicity and is used to study different cytotoxic effects of the same class chemicals using nitrosamines as examples. This technique uses three human cell lines (T24 bladder, HepG2 liver, and A549 lung carcinoma cells) and Chinese hamster ovary (CHO-K1) cells in parallel as the living components of the sensors of a real-time cell electronic sensing (RT-CES) method for dynamic monitoring of chemical toxicity. The RT-CES technique measures changes in the impedance of individual microelectronic wells that is correlated linearly with changes in cell numbers during t log phase of cell growth, thus allowing determination of cytotoxicity. Four nitrosamines, N-nitrosodimethylamine (NDMA), N-nitrosodiphenylamine (NDPhA), N-nitrosopiperidine (NPip), and N-nitrosopyrrolidine (NPyr), were examined and unique cytotoxicity profiles were detected for each nitrosamine. In vitro cytotoxicity values (IC{sub 50}) for NDPhA (ranging from 0.6 to 1.9 mM) were significantly lower than the IC{sub 50} values for the well-known carcinogen NDMA (15-95 mM) in all four cell lines. T24 cells were the most sensitive to nitrosamine exposure among the four cell lines tested (T24 > CHO > A549 > HepG2), suggesting that T24 may serve as a new sensitive model for cytotoxicity screening. Cell staining results confirmed that administration of the IC{sub 50} concentration from the RT-CES experiments inhibited cell growth by 50% compared to the controls, indicating that the RT-CES method provides reliable measures of IC{sub 50}. Staining and cell-cycle analysis confirmed that NDPhA caused cell-cycle arrest at the G0/G1 phase, whereas NDMA did not disrupt the cell cycle but induced cell death, thus explaining the different cytotoxicity profiles detected by the RT-CES method. The parallel cytotoxicity profiling of nitrosamines on the four cell lines by the RT-CES method led to the discovery of the unique cytotoxicity of NDPh
Energy Technology Data Exchange (ETDEWEB)
Datta, Aparna, E-mail: adatta.research@gmail.com [Jadavpur University, School of Materials Science and Nanotechnology (India); Dasgupta, Sayantan [NRS Medical College and Hospital, Department of Biochemistry (India); Mukherjee, Siddhartha [Jadavpur University, Department of Metallurgical and Material Engineering (India)
2017-04-15
In the past decade, a variety of drug carriers based on mesoporous silica nanoparticles has been extensively reported. However, their biocompatibility still remains debatable, which motivated us to explore the porous nanostructures of other metal oxides, for example titanium dioxide (TiO{sub 2}), as potential drug delivery vehicles. Herein, we report the in vitro hemolysis, cytotoxicity, and protein binding of TiO{sub 2} nanoparticles, synthesized by a sol–gel method. The surface of the TiO{sub 2} nanoparticles was modified with hydroxyl, amine, or thiol containing moieties to examine the influence of surface functional groups on the toxicity and protein binding aspects of the nanoparticles. Our study revealed the superior hemocompatibility of pristine, as well as functionalized TiO{sub 2} nanoparticles, compared to that of mesoporous silica, the present gold standard. Among the functional groups studied, aminosilane moieties on the TiO{sub 2} surface substantially reduced the degree of hemolysis (down to 5%). Further, cytotoxicity studies by MTT assay suggested that surface functional moieties play a crucial role in determining the biocompatibility of the nanoparticles. The presence of NH{sub 2}– functional groups on the TiO{sub 2} nanoparticle surface enhanced the cell viability by almost 28% as compared to its native counterpart (at 100 μg/ml), which was in agreement with the hemolysis assay. Finally, nonspecific protein adsorption on functionalized TiO{sub 2} surfaces was examined using human serum albumin and it was found that negatively charged surface moieties, like –OH and –SH, could mitigate protein adsorption to a significant extent.
Ishak, Rania A H; Osman, Rihab
2015-05-15
The aim of the present work was to develop a new solid self-microemulsifying drug delivery system (SMEDDS) for the pulmonary delivery of the poorly water-soluble anti-cancer drug atorvastatin (AVT). Microemulsion (ME) was first developed using isopropyl myristate (IPM), a combination of 2 biocompatible surfactants: lecithin/d-α-tocopheryl polyethylene glycol succinate (TPGS) and ethanol as co-surfactant. Two types of lecithin with different phosphatidylcholine (PC) contents were compared. Phase diagram, physico-chemical characterization and stability studies were used to investigate ME region. Solid SMEDDS were then prepared by spray-drying the selected ME using a combination of carriers composed of sugars, leucine as dispersibility enhancer with or without polyethylene glycol (PEG) 6000. Yield, flow properties, particle size and in vitro pulmonary deposition were used to characterize the spray-dried powders. Reconstituted MEs were characterized in terms of morphology, particle size and size distribution. In vitro cytotoxicity study was undertaken on lung cancer cell line for the selected MEs and SD-SMEDDS formulae. Results showed that the most satisfactory MEs properties were obtained with 1:3 lecithin/TPGS, 1:1 lecithin/oil and 1:1 surfactant/co-surfactant ratios. A larger ME area was obtained with lecithin containing 100% PC compared to the less expensive lecithin containing 20% PC. By manipulating spray drying parameters, carrier composition and ratio of ME lipids to carrier, microparticles with more than 70% of respirable fraction could be prepared. The ME was efficiently recovered in simulated lung fluid even after removal of alcohol. The concurrent delivery of AVT with TPGS in solid SMEDDS greatly enhanced the cytotoxic activity on lung cancer cells. Copyright © 2015 Elsevier B.V. All rights reserved.
Worawattananutai, Patsorn; Itharat, Arunporn; Ruangnoo, Srisopa
2014-08-01
Hibiscus sabdariffa (HS) leaves are a vegetable, which is used as a healthy sour soup for protection against chronic diseases in Thai traditional medicine. To investigate antioxidant, anti-inflammatory and cytotoxic activities of Hibiscus sabdariffa leave extracts from diferent extraction methods. Fresh and dry Hibiscus sabdariffa leaves were extracted by various methods such as maceration with 95% and 50% ethanol, squeeze, and boiling with water or decoction. All extracts were testedfor antioxidant activity by using DPPH radical scavenging assay, anti-inflammatory activity by determination on inhibitory effect of nitric oxide production on RAW264. 7 cell. Cytotoxic activity also tested against human prostate cancer cell line (PC-3) by using sulforhodamine B (SRB) assay. Total phenolic content determined by the Folin-Ciocalteu colorimetric method. The results found that the 95% ethanolic extract of Hibiscus sabdariffa dried leaves (HSDE95) showed the highest antioxidant activity with an EC50 of 34.51±2.62 μg/ml and had the highest phenolic content (57.00±3.73 mg GAE/g). HSDE95 also showed potent cytotoxicity against prostate cancer cell line with an IC50 of 8.58±0.68 μg/ml whereas HSDE95 and all of extracts ofHibiscus sabdariffa leaves had no anti-inflammatory activity. The obtained results revealed that HSDE95 extract showedpotent cytotoxic activity against prostate cancer cells but low antioxidant and anti-inflammatory activities. This extract should be further isolated as active compounds against prostate cancer.
Energy Technology Data Exchange (ETDEWEB)
Domingues, Vanessa O.; Hoerner, Rosmari; Reetz, Luiz G.B.; Kuhn, Fabio, E-mail: rosmari.ufsm@gmail.co [Universidade Federal de Santa Maria (UFSM), RS (Brazil). Dept. de Analises Clinicas e Toxicologicas; Coser, Virginia M.; Rodrigues, Jacqueline N.; Bauchspiess, Rita; Pereira, Waldir V. [Hospital Universitario de Santa Maria, RS (Brazil). Dept. de Hematologia-Oncologia; Paraginski, Gustavo L.; Locatelli, Aline; Fank, Juliana de O.; Giglio, Vinicius F.; Hoerner, Manfredo, E-mail: hoerner.manfredo@gmail.co [Universidade Federal de Santa Maria (UFSM), RS (Brazil). Dept. de Quimica
2010-07-01
The asymmetric diazoamines 1-(2-chlorophenyl)-3-(4-carboxyphenyl)triazene (1), 1-(2-fluorophenyl)-3-(4-carboxyphenyl)triazene (2) and 1-(2-fluorophenyl)-3-(4-amidophenyl) triazene (3) were evaluated for their ability to cleave pUC18 and pBSKII plasmid DNA, antibacterial activity and in vitro cytotoxicity against acute myeloid leukemia cells and normal leukocytes using the bioassay of reduction of 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT). The triazenes showed ability to cleave the two types of plasmid DNA: triazene 1 at pH 8.0 and 50 deg C; triazene 2 at pH 6.5 and 37 and 50 deg C; triazene 3 at pH 6.5 and 37 deg C. The compounds presented cytotoxic activity against myeloid leukemia cells. Compound 1 showed high activity against B. cereus (MIC = 32 {mu}g mL{sup -1}). The observation of intermolecular hydrogen bonding in the solid state of compound 3, based on the structural analysis by X-ray crystallography, as well as the results of IR and UV-Vis spectroscopic analyses of compounds 1, 2 and 3 are discussed in the present work. (author)
Wang, Liang; Chan, Judy Y W; Rêgo, Juciane V; Chong, Cheong-Meng; Ai, Nana; Falcão, Cláudio B; Rádis-Baptista, Gandhi; Lee, Simon M Y
2015-06-01
Animal venoms contain a diverse array of proteins and enzymes that are toxic toward various physiological systems. However, there are also some practical medicinal uses for these toxins including use as anti-bacterial and anti-tumor agents. In this study, we identified a nine-residue cryptic oligopeptide, KRFKKFFKK (EVP50) that is repeatedly encoded in tandem within vipericidin sequences. EVP50 displayed in vivo potent lethal toxicity to zebrafish larvae (LD50=6 μM) when the peptide's N-terminus was chemically conjugated to rhodamine B (RhoB). In vitro, RhoB-conjugated EVP50 (RhoB-EVP50) exhibited a concentration-dependent cytotoxic effect toward MCF-7 and MDA-MB-231 breast cancer cells. In MCF-7 cells, the RhoB-EVP50 nonapeptide accumulated inside the cells within minutes. In the cytoplasm, the RhoB-EVP50 induced extracellular calcium influx and intracellular calcium release. Membrane budding was also observed after incubation with micromolar concentrations of the fluorescent EVP50 conjugate. The conjugate's interference with calcium homeostasis, its intracellular accumulation and its induced membrane dysfunction (budding and vacuolization) seem to act in concert to disrupt the cell circuitry. Contrastively, unconjugated EVP50 peptide did not display neither toxic nor cytotoxic activities in our in vivo and in vitro models. The synergic mechanism of toxicity was restricted to the structurally modified encrypted vipericidin nonapeptide. Copyright © 2015 Elsevier B.V. All rights reserved.
Cytotoxic compounds from the leaves of Combretum paniculatum Vent
African Journals Online (AJOL)
It is used locally in the treatment of carcinomous tumors. The cytotoxic activity of pheophorbide a and pheophorbide a-methyl ester isolated from the leaves of C. paniculatum were investigated. In vitro cytotoxicity of the compounds were evaluated against HT-29, MCF-7 and HeLa cancer cell lines using the methyl thiazolyl ...
Directory of Open Access Journals (Sweden)
Canan Bural
2011-08-01
Full Text Available OBJECTIVES: Residual methyl methacrylate (MMA may leach from the acrylic resin denture bases and have adverse effects on the oral mucosa. This in vitro study evaluated and correlated the effect of the leaching residual MMA concentrations ([MMA]r on in vitro cytotoxicity of L-929 fibroblasts. MATERIAL AND METHODS: A total of 144 heat-polymerized acrylic resin specimens were fabricated using 4 different polymerization cycles: (1 at 74ºC for 9 h, (2 at 74ºC for 9 h and terminal boiling (at 100ºC for 30 min, (3 at 74ºC for 9 h and terminal boiling for 3 h, (4 at 74ºC for 30 min and terminal boiling for 30 min. Specimens were eluted in a complete cell culture medium at 37ºC for 1, 2, 5 and 7 days. [MMA]r in eluates was measured using high-performance liquid chromatography. In vitro cytotoxicity of eluates on L-929 fibroblasts was evaluated by means of cell proliferation using a tetrazolium salt XTT (sodium 3´-[1-phenyl-aminocarbonyl-3,4-tetrazolium]bis(4-methoxy-6-nitrobenzenesulphonic acid assay. Differences in [MMA]r of eluates and cell proliferation values between polymerization cycles were statistically analyzed by Kruskal-Wallis, Friedman and Dunn's multiple comparison tests. The correlation between [MMA]r of eluates and cell proliferation was analyzed by Pearson's correlation test (p<0.05. RESULTS: [MMA]r was significantly (p<0.001 higher in eluates of specimens polymerized with cycle without terminal boiling after elution of 1 and 2 days. Cell proliferation values for all cycles were significantly (p<0.01 lower in eluates of 1 day than those of 2 days. The correlation between [MMA]r and cell proliferation values was negative after all elution periods, showing significance (p<0.05 for elution of 1 and 2 days. MMA continued to leach from acrylic resin throughout 7 days and leaching concentrations markedly reduced after elution of 1 and 2 days. CONCLUSION: Due to reduction of leaching residual MMA concentrations, use of terminal boiling in
International Nuclear Information System (INIS)
Byeon, Jeong Hoon; Park, Jae Hong; Peters, Thomas M.; Roberts, Jeffrey T.
2015-01-01
Highlights: • The cytotoxicity of model welding particles was modulated through in situ passivation. • Model welding particles were incorporated with chitosan nanoparticles for passivation. • In vitro assay revealed that the passivated particles had a lower cytotoxicity. • Passivation with chitosan adhesive or graphite paste could also reduce cytotoxicity. • This method would be suitable for efficient reduction of inhalable toxic components. - Abstract: The cytotoxicity of model welding nanoparticles was modulated through in situ passivation with soluble biocompatible materials. A passivation process consisting of a spark discharge particle generator coupled to a collison atomizer as a co-flow or counter-flow configuration was used to incorporate the model nanoparticles with chitosan. The tested model welding nanoparticles are inhaled and that A549 cells are a human lung epithelial cell line. Measurements of in vitro cytotoxicity in A549 cells revealed that the passivated nanoparticles had a lower cytotoxicity (>65% in average cell viability, counter-flow) than the untreated model nanoparticles. Moreover, the co-flow incorporation between the nanoparticles and chitosan induced passivation of the nanoparticles, and the average cell viability increased by >80% compared to the model welding nanoparticles. As a more convenient way (additional chitosan generation and incorporation devices may not be required), other passivation strategies through a modification of the welding rod with chitosan adhesive and graphite paste did also enhance average cell viability (>58%). The approach outlined in this work is potentially generalizable as a new platform, using only biocompatible materials in situ, to treat nanoparticles before they are inhaled
Energy Technology Data Exchange (ETDEWEB)
Byeon, Jeong Hoon, E-mail: postjb@yu.ac.kr [School of Mechanical Engineering, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Park, Jae Hong; Peters, Thomas M. [Department of Occupational and Environmental Health, University of Iowa, IA 52242 (United States); Roberts, Jeffrey T., E-mail: jtrob@purdue.edu [Department of Chemistry, Purdue University, IN 47907 (United States)
2015-07-15
Highlights: • The cytotoxicity of model welding particles was modulated through in situ passivation. • Model welding particles were incorporated with chitosan nanoparticles for passivation. • In vitro assay revealed that the passivated particles had a lower cytotoxicity. • Passivation with chitosan adhesive or graphite paste could also reduce cytotoxicity. • This method would be suitable for efficient reduction of inhalable toxic components. - Abstract: The cytotoxicity of model welding nanoparticles was modulated through in situ passivation with soluble biocompatible materials. A passivation process consisting of a spark discharge particle generator coupled to a collison atomizer as a co-flow or counter-flow configuration was used to incorporate the model nanoparticles with chitosan. The tested model welding nanoparticles are inhaled and that A549 cells are a human lung epithelial cell line. Measurements of in vitro cytotoxicity in A549 cells revealed that the passivated nanoparticles had a lower cytotoxicity (>65% in average cell viability, counter-flow) than the untreated model nanoparticles. Moreover, the co-flow incorporation between the nanoparticles and chitosan induced passivation of the nanoparticles, and the average cell viability increased by >80% compared to the model welding nanoparticles. As a more convenient way (additional chitosan generation and incorporation devices may not be required), other passivation strategies through a modification of the welding rod with chitosan adhesive and graphite paste did also enhance average cell viability (>58%). The approach outlined in this work is potentially generalizable as a new platform, using only biocompatible materials in situ, to treat nanoparticles before they are inhaled.
iNKT cell cytotoxic responses control T-lymphoma growth in vitro and in vivo
Bassiri, Hamid; Das, Rupali; Guan, Peng; Barrett, David M.; Brennan, Patrick J.; Banerjee, Pinaki P.; Wiener, Susan J.; Orange, Jordan S.; Brenner, Michael B.; Grupp, Stephan A.; Nichols, Kim E.
2013-01-01
Invariant natural killer T (iNKT) cells comprise a lineage of CD1d-restricted glycolipid-reactive T lymphocytes with important roles in host immunity to cancer. iNKT cells indirectly participate in antitumor responses by inducing dendritic cell maturation and producing cytokines that promote tumor clearance by CD8+ T and NK cells. Although iNKT cells thereby act as potent cellular adjuvants, it is less clear whether they directly control the growth of tumors. To gain insights into the direct contribution of iNKT cells to tumor immune surveillance, we developed in vitro and in vivo systems to selectively examine the antitumor activity of iNKT cells in the absence of other cytolytic effectors. Using the EL4 T-lymphoma cell line as a model, we find that iNKT cells exert robust and specific lysis of tumor cells in vitro in a manner that is differentially-induced by iNKT cell agonists of varying TCR affinities, such as OCH, α-galactosyl ceramide and PBS44. In vitro blockade of CD1d-mediated lipid antigen presentation, disruption of T cell receptor (TCR) signaling, or loss of perforin expression significantly reduce iNKT cell killing. Consistent with these findings, iNKT cell reconstitution of T, B, and NK cell-deficient mice slows EL4 growth in vivo via TCR-CD1d and perforin-dependent mechanisms. Together, these observations establish that iNKT cells are sufficient to control the growth of T-lymphoma in vitro and in vivo. They also suggest that the induction of iNKT cell cytotoxic responses in situ might serve as a more effective strategy to prevent and/or treat CD1d+ cancers, such as T-lymphoma. PMID:24563871
iNKT cell cytotoxic responses control T-lymphoma growth in vitro and in vivo .
Bassiri, Hamid; Das, Rupali; Guan, Peng; Barrett, David M; Brennan, Patrick J; Banerjee, Pinaki P; Wiener, Susan J; Orange, Jordan S; Brenner, Michael B; Grupp, Stephan A; Nichols, Kim E
2014-01-01
Invariant natural killer T (iNKT) cells comprise a lineage of CD1d-restricted glycolipid-reactive T lymphocytes with important roles in host immunity to cancer. iNKT cells indirectly participate in antitumor responses by inducing dendritic cell maturation and producing cytokines that promote tumor clearance by CD8+ T and NK cells. Although iNKT cells thereby act as potent cellular adjuvants, it is less clear whether they directly control the growth of tumors. To gain insights into the direct contribution of iNKT cells to tumor immune surveillance, we developed in vitro and in vivo systems to selectively examine the antitumor activity of iNKT cells in the absence of other cytolytic effectors. Using the EL4 T-lymphoma cell line as a model, we found that iNKT cells exert robust and specific lysis of tumor cells in vitro in a manner that is differentially induced by iNKT cell agonists of varying T-cell receptor (TCR) affinities, such as OCH, α-galactosyl ceramide, and PBS44. In vitro blockade of CD1d-mediated lipid antigen presentation, disruption of TCR signaling, or loss of perforin expression significantly reduce iNKT cell killing. Consistent with these findings, iNKT cell reconstitution of T, B, and NK cell–deficient mice slows EL4 growth in vivo via TCR-CD1d and perforin-dependent mechanisms. Together, these observations establish that iNKT cells are sufficient to control the growth of T lymphoma in vitro and in vivo. They also suggest that the induction of iNKT cell cytotoxic responses in situ might serve as a more effective strategy to prevent and/or treat CD1d+ cancers, such as T lymphoma. ©2013 AACR.
Martinez, Emily M; Klebanoff, Samuel D; Secrest, Stephanie; Romain, Gabrielle; Haile, Samuel T; Emtage, Peter C R; Gilbert, Amy E
2018-04-01
High-throughput flow cytometry is an attractive platform for the analysis of adoptive cellular therapies such as chimeric antigen receptor T cell therapy (CAR-T) because it allows for the concurrent measurement of T cell-dependent cellular cytotoxicity (TDCC) and the functional characterization of engineered T cells with respect to percentage of CAR transduction, T cell phenotype, and measurement of T cell function such as activation in a single assay. The use of adherent tumor cell lines can be challenging in these flow-based assays. Here, we present the development of a high-throughput flow-based assay to measure TDCC for a CAR-T construct co-cultured with multiple adherent tumor cell lines. We describe optimal assay conditions (such as adherent cell dissociation techniques to minimize impact on cell viability) that result in robust cytotoxicity assays. In addition, we report on the concurrent use of T cell transduction and activation antibody panels (CD25) that provide further dissection of engineered T cell function. In conclusion, we present the development of a high-throughput flow cytometry method allowing for in vitro interrogation of solid tumor, targeting CAR-T cell-mediated cytotoxicity, CAR transduction, and engineered T cell characterization in a single assay.
Cytotoxicity of extracts of spices to cultured cells.
Unnikrishnan, M C; Kuttan, R
1988-01-01
The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.
Walter, Robert J; Attar, Bashar M; Rafiq, Asad; Delimata, Megan; Tejaswi, Sooraj
2012-09-10
Pancreatic cancer is the fourth leading cause of cancer death in the U.S. Highly infectious Newcastle disease virus (NDV) strains are known to be very cytotoxic for an array of human tumor cell types in vitro and in vivo but the effects of these and avirulent NDV strains on pancreatic neoplasms are little known. Here, the direct cytolytic effects of the avirulent Hitchner-B1 (B1) and Ulster (U) NDV strains on 7 human pancreatic tumor cell lines and 4 normal human cell lines were studied. Cytotoxicity assays used serially diluted NDV to determine minimum cytotoxic plaque forming unit (PFU) doses. For NDV-B1, normal human cells were killed only by relatively high doses (range: 471-3,724 PFU) whereas NDV-U killed these cells at low PFU (range: 0.32-1.60 PFU). Most pancreatic cancer cell types were killed by much lower NDV-B1 doses (range: 0.40-2.60 PFU) while NDV-U killed Capan-1 and SU.86.86 cultures at very low doses (0.00041 PFU and 0.0034 PFU, respectively). On average, 1,555 times more NDV-B1 was needed to kill normal cells than most pancreatic tumor cells and 558 times more NDV-U to kill the two most sensitive pancreatic cancer lines. These innately-targeted lentogenic viruses may have meaningful potential in treating pancreatic cancer.
Saito, Kayo; Hayakawa, Tohru; Kawabata, Rihito; Meguro, Daijiro; Kasai, Kazutaka
2009-03-01
To assess the antibacterial activity and cytotoxicity of an orthodontic bonding material containing an antibacterial agent. Superbond C&B (4-methacryloxyethyl trimellitate anhydride/methyl methacrylate-tri-n-butyl borane [4-META/MMA-TBB]) resin was mixed with benzalkonium chloride (BAC) to obtain final BAC concentrations of 0.25%, 0.75%, 1.25%, 1.75%, 2.5%, and 5.0% (wt/ wt). Antibacterial activity against Streptococcus mutans and Streptococcus sobrinus was evaluated by soaking the BAC-resin in distilled water at 37 degrees C for periods of 30, 90, and 180 days. Antibacterial activity of the BAC-resin was measured by the disk diffusion method, and the inhibition zone around each sample was measured and recorded. For evaluation of cytotoxicity, BAC-resin samples were put into cell culture inserts placed above human gingival cells and were incubated at 37 degrees C for 1, 3, and 6 days. Cytotoxicity was assessed with a tetrazolium bromide reduction assay. The antibacterial activity of BAC-incorporated resin samples decreased significantly after immersion in water for 180 days, regardless of BAC concentration. The antibacterial activity of nonimmersed resin containing 0.25% or 1.75% BAC was comparable with that of 5.0% BAC-resin immersed for 180 days. In cytotoxicity tests, most cells died when exposed to resins containing 1.75%, 2.5%, and 5% BAC. No difference was observed between resins containing 0.25% and 0.75% BAC at 1, 3, and 6 days of culture. The addition of BAC to 4-META/MMA-TBB resin confers an antibacterial effect even after immersion in water, and 4-META/MMA-TBB resin containing 0.25% to 0.75% BAC has no significant cytotoxic effect.
Directory of Open Access Journals (Sweden)
Amanda De Castro Juraski
2017-04-01
Full Text Available Ca-Mg silicates are receiving a growing interest in the field of bioceramics. In a previous study, wollastonite-diopside (WD glass-ceramics were successfully prepared by a new processing route, consisting of the heat treatment of a silicone resin embedding reactive oxide particles and a Ca/Mg-rich glass. The in vitro degradation, bioactivity, and cell response of these new WD glass-ceramics, fired at 900–1100 °C for 1 h, as a function of the Ca/Mg-rich glass content, are the aim of this investigation The results showed that WD glass-ceramics from formulations comprising different glass contents (70–100% at 900 °C, 30% at 1100 °C exhibit the formation of an apatite-like layer on their surface after immersion in SBF for seven days, thus confirming their surface bioactivity. The XRD results showed that these samples crystallized, mainly forming wollastonite (CaSiO3 and diopside (CaMgSi2O6, but combeite (Na2Ca2Si3O9 crystalline phase was also detected. Besides in vitro bioactivity, cytotoxicity and osteoblast adhesion and proliferation tests were applied after all characterizations, and the formulation comprising 70% glass was demonstrated to be promising for further in vivo studies.
Juraski, Amanda De Castro; Dorion Rodas, Andrea Cecilia; Elsayed, Hamada; Bernardo, Enrico; Oliveira Soares, Viviane; Daguano, Juliana
2017-01-01
Ca-Mg silicates are receiving a growing interest in the field of bioceramics. In a previous study, wollastonite-diopside (WD) glass-ceramics were successfully prepared by a new processing route, consisting of the heat treatment of a silicone resin embedding reactive oxide particles and a Ca/Mg-rich glass. The in vitro degradation, bioactivity, and cell response of these new WD glass-ceramics, fired at 900–1100 °C for 1 h, as a function of the Ca/Mg-rich glass content, are the aim of this investigation The results showed that WD glass-ceramics from formulations comprising different glass contents (70–100% at 900 °C, 30% at 1100 °C) exhibit the formation of an apatite-like layer on their surface after immersion in SBF for seven days, thus confirming their surface bioactivity. The XRD results showed that these samples crystallized, mainly forming wollastonite (CaSiO3) and diopside (CaMgSi2O6), but combeite (Na2Ca2Si3O9) crystalline phase was also detected. Besides in vitro bioactivity, cytotoxicity and osteoblast adhesion and proliferation tests were applied after all characterizations, and the formulation comprising 70% glass was demonstrated to be promising for further in vivo studies. PMID:28772783
Wawszczyk, Joanna; Kapral, Małgorzata; Hollek, Andrzej; Węglarz, Ludmiła
2014-01-01
Colon cancer has been remaining the second leading cause of cancer mortality in Poland in the last years. Epidemiological, preclinical and clinical studies reveal that dietary phytochemicals may exert chemopreventive and therapeutic effect against colorectal cancer. There is a growing interest in identifying new biologically active agents from dietary sources in this respect. Pterostilbene (trans-3,5-dimethoxy-4-hydroxystilbene) is a naturally occurring stilbene, that has been found to have antioxidative, anti-inflammatory and antipro- liferative properties. Compared to other stilbenes, pterostilbene has greater bioavailability, and so, a greater potential for clinical applications. Recent studies showed that pterostilbene exhibits the hallmark characteristics of an anticancer agent. The aim of this study was to analyze antiproliferative and cytotoxic effects of pterostilbene on human colon cancer Caco-2 cells. They were cultured using standard techniques and exposed to increasing doses of pterostilbene (5-100 μM) for 48 and 72 h. Cell proliferation was determined by sulforhodamine B assay. The growth of treated cells was expressed as a percentage of that of untreated control cells. Pterostilbene decreased proliferation rate of Caco-2 cells in a dose- and time-dependent manner. Its concentrations = 25 μM did not affect cell growth after 48 h treatment period. Significant growth inhibition was observed in cultures incubated with higher concentrations of pterostilbene (40-100 μM). Pterostilbene at all concentrations used (5-100 μM) caused significant inhibition of cell proliferation when the experimental time period was elongated to 72 h. The maximum growth reduction was observed at 100 mM pterostilbene. The cytotoxicity of pterostilbene was evaluated in 48 h cultures based on lactate dehydrogenase (LDH) leakage into the culture medium and showed dose-related pattern. The findings of this study showed significant dose-dependent antiproliferative and cytotoxic
Directory of Open Access Journals (Sweden)
Jones Lucy A
2009-09-01
Full Text Available Abstract Background Long Dan Xie Gan Wan (LD, a Chinese herbal remedy formulation, is traditionally used to treat a range of conditions, including gall bladder diseases, hepatitis, hyperthyroidism, migraines but it is not used for the management or treatment of cancer. However some of its herbal constituents, specifically Radix bupleuri, Radix scutellariae and Rhizoma alismatis have been shown to inhibit the growth of cancer cells. Thus, the aim of the study was to investigate the impact of LD on cancer cells in vitro. Methods HL60 and HT29 cancer cell lines were exposed to water extracts of LD (1:10, 1:50, 1:100 and/or 1:1000 prepared from a 3 mg/30 ml stock and for both cell lines growth, apoptotic induction, alterations in cell cycle characteristics and genotoxicity were investigated. The specificity of the action of LD on these cancer cell lines was also investigated by determining its effect on human peripheral blood lymphocytes. Preliminary chemical analysis was carried out to identify cytotoxic constituents of LD using HPLC and LCMS. Results LD was significantly cytotoxic to, and induced apoptosis in, both cell lines. Apoptotic induction appeared to be cell cycle independent at all concentrations of LD used (1:10, 1:50 and 1:100 for the HL60 cell lines and at 1:10 for the HT29 cell line. At 1:50 and 1:100 apoptotic induction by LD appeared to be cell cycle dependent. LD caused significant genotoxic damage to both cell lines compared to their respective controls. The specificity study showed that LD exerted a moderate cytotoxic action against non-proliferating and proliferating blood lymphocytes but not apoptosis. Chemical analysis showed that a number of fractions were found to exert a significant growth inhibitory effect. However, the molecular weights of compounds within these fractions did not correspond to those from the herbal constituents of LD. Conclusion It is possible that LD may have some chemotherapeutic potential. However
Tran, Phong A.; Nguyen, Hiep T.; Fox, Kate; Tran, Nhiem
2018-03-01
Iron oxide magnetic nanoparticles have significant potential in biomedical applications such as in diagnosis, imaging and therapeutic agent delivery. The choice of stabilizers and surface functionalization is important as it is known to strongly influence the cytotoxicity of the nanoparticles. The present study aimed at investigating the effects of surface charges on the cytotoxicity of iron oxide nanoparticles. We used a co-precipitation method to synthesize iron oxide nanoparticles which were then stabilized with either chitosan (CS) or polyvinyl alcohol (PVA) which have net positive charge and zero charge at physiological pH, respectively. The nanoparticles were characterized in terms of size, charges and chemical oxidation state. Cytotoxicity of the nanoparticles was assessed using mouse fibroblast cells and was correlated with surface charges of the nanoparticles and their aggregation.
In vitro cytotoxicity of fungi spoiling maize silage
DEFF Research Database (Denmark)
Rasmussen, Rie Romme; Rasmussen, Peter Have; Larsen, Thomas Ostenfeld
2011-01-01
Penicillium roqueforti, Penicillium paneum, Monascus ruber, Alternaria tenuissima, Fusarium graminearum, Fusarium avenaceum, Byssochlamys nivea and Aspergillus fumigatus have previously been identified as major fungal contaminants of Danish maize silage. In the present study their metabolite....... roqueforti metabolites roquefortine C (48μg/mL), andrastin A (>50μg/mL), mycophenolic acid (>100μg/mL) and 1-hydroxyeremophil-7(11),9(10)-dien-8-one (>280μg/mL) were high. Fractionating of agar extracts identified PR-toxin as an important cytotoxic P. roqueforti metabolite, also detectable in maize silage....... The strongly cytotoxic B. nivea and P. paneum agar extracts contained patulin above the IC50 of 0.6μg/mL, however inoculated onto maize silage B. nivea and P. paneum did not produce patulin (>371μg/kg). Still B. nivea infected maize silage containing mycophenolic acid (∼50mg/kg), byssochlamic acid and other...
Directory of Open Access Journals (Sweden)
S. Gulyuz
2018-02-01
Full Text Available Synthesis and characterization of well-defined amphiphilic block copolymers containing poly(2-ethyl-2-oxazoline as hydrophilic block and poly(ε-caprolactone or poly(L-lactide as hydrophobic block is achieved by copper-catalyzed azide-alkyne cycloaddition (CuAAC click chemistry. The clickable precursors, α-alkyne-functionalized poly(ε-caprolactone and poly(L-lactide and ω-azido-functionalized poly(2-ethyl-2-oxazoline are simply prepared and joined using copper sulfate/ascorbic acid catalyst system at room temperature. The structures of precursors and amphiphilic block copolymers are characterized by spectroscopic, chromatographic and thermal analyses. The cytotoxic activities of resulting amphiphilic block copolymers and their precursors are investigated in the prostate epithelial and cancer cells under in-vitro conditions. The treatment of the healthy prostate epithelial cell line PNT1A reveals that no significant cytotoxicity, whereas some significant toxic effects on the prostate cancer cell lines are observed.
Development and cytotoxicity evaluation of SiAlONs ceramics
International Nuclear Information System (INIS)
Santos, C.; Ribeiro, S.; Daguano, J.K.M.F.; Rogero, S.O.; Strecker, K.; Silva, C.R.M.
2007-01-01
SiAlONs are ceramics with high potential as biomaterials due to their chemical stability, associated with suitable mechanical properties, such as high fracture toughness and fracture resistance. The objective of this work was to investigate the mechanical properties and the cytotoxicity of these ceramic materials. Three different compositions were prepared, using silicon nitride, aluminum nitride and a rare earth oxide mixture as starting powders, yielding Si 3 N 4 -SiAlON composites or pure SiAlON ceramics, after hot-pressing at 1750 deg. C, for 30 min. The sintered samples were characterized by X-ray diffraction analysis (XRD) and scanning electron microscopy (SEM). Furthermore, hardness and fracture toughness were determined using the Vicker's indentation method. The biological compatibility was evaluated by in vitro cytotoxicity tests. Ceramic with elevated hardness, ranging between 17 and 21 GPa, and high fracture toughness of 5 to 6 MPa m 1/2 were obtained. Since a nontoxic behavior was observed in the cytotoxicity tests, it may be assumed that SiAlON-based ceramics are viable materials for clinical applications
Methods for Assessing Basic Particle Properties and Cytotoxicity of Engineered Nanoparticles
Directory of Open Access Journals (Sweden)
Olga-Ioanna Kalantzi
2014-03-01
Full Text Available The increasing penetration of materials and products containing engineered nanoparticles (ENPs to the market is posing many concerns regarding their environmental impacts. To assess these impacts, there is an urgent need of techniques for determining the health-related properties of ENPs and standards for assessing their toxicity. Although a wide number of systems for characterizing nanoparticles in different media (i.e., gases and liquids is already commercially available, the development of protocols for determining the cytotoxicity of ENPs is still at an infant stage, drawing upon existing knowledge from general toxicology. In this regard, differences in the preparation of ENP-containing solutions for cytotoxicity testing, as well as in the steps involved in the tests can result in significant deviations and inconsistencies between studies. In an attempt to highlight the urgent need for assessing the environmental impacts of nanotechnology, this article provides a brief overview of the existing methods for determining health-related properties of ENPs and their cytotoxicity.
In-vitro cytotoxicity of biosynthesized gold nanoparticles against ...
African Journals Online (AJOL)
The AuNPs were evaluated by x-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), ultraviolet-visible (UV–Vis) spectroscopy and transmission electron microscopy (TEM). They were also assessed for cytotoxicity against SW579 cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ...
Human mesenchymal stem cells are resistant to cytotoxic and genotoxic effects of cisplatin in vitro
Directory of Open Access Journals (Sweden)
Bruno Corrêa Bellagamba
2016-03-01
Full Text Available Abstract Mesenchymal stem cells (MSCs are known for their important properties involving multilineage differentiation potential., trophic factor secretion and localization along various organs and tissues. On the dark side, MSCs play a distinguished role in tumor microenvironments by differentiating into tumor-associated fibroblasts or supporting tumor growth via distinct mechanisms. Cisplatin (CIS is a drug widely applied in the treatment of a large number of cancers and is known for its cytotoxic and genotoxic effects, both in vitro and in vivo. Here we assessed the effects of CIS on MSCs and the ovarian cancer cell line OVCAR-3, by MTT and comet assays. Our results demonstrated the resistance of MSCs to cell death and DNA damage induction by CIS, which was not observed when OVCAR-3 cells were exposed to this drug.
International Nuclear Information System (INIS)
Thorn, R.M.
1978-01-01
Cytotoxic responses of uv-irradiated mice against syngeneic uv-induced tumors were measured by using a 51 Cr-release assay to determine if uv treatment induced a specific reduction of cytotoxic activity. The in vivo and in vitro primary responses against syngeneic tumors and allogeneic cells were unaffected, as was the ''memory'' response (in vivo stimulation, in vitro restimulation) against alloantigens. In contrast, the memory response of uv-treated mice against syngeneic, uv-induced tumors was consistently and significantly depressed. The cytotoxicity generated by tumor cell stimulation in vivo or in vitro was tumor-specific and T cell-dependent. Since the primary response against syngeneic uv-induced tumors produces apparently normal amounts of tumor-specific cytotoxic activity, uv-treated mice may not reject transplanted syngeneic tumors because of too few T effector memory cells. These results imply that, at least in this system, tumor rejection depends mostly on the secondary responses against tumor antigens and that at least one carcinogen can, indirectly, specifically regulate immune responses
Directory of Open Access Journals (Sweden)
Juba Jean
2011-04-01
Full Text Available Abstract Background Escherichia coli O157:H7 is the most common serovar of enterohemorrhagic E. coli associated with serious human disease outbreaks. Cattle are the main reservoir with E. coli O157:H7 inducing hemorrhagic enteritis in persistent shedding beef cattle, however little is known about how this pathogen affects cattle health. Jejunal Hemorrhage Syndrome (JHS has unclear etiology but the pathology is similar to that described for E. coli O157:H7 challenged beef cattle suggestive that E. coli O157:H7 could be involved. There are no effective treatments for JHS however new approaches to managing pathogen issues in livestock using prebiotics and probiotics are gaining support. The first objective of the current study was to characterize pathogen colonization in hemorrhaged jejunum of dairy cattle during natural JHS outbreaks. The second objective was to confirm the association of mycotoxigenic fungi in feeds with the development of JHS and also to identify the presence of potential mycotoxins. The third objective was to determine the impact of a prebiotic, Celmanax™, or probiotic, Dairyman's Choice™ paste, on the cytotoxicity associated with feed extracts in vitro. The fourth objective was to determine the impact of a prebiotic or a probiotic on E. coli O157:H7 colonization of mucosal explants and a bovine colonic cell line in vitro. The final objective was to determine if prebiotic and probiotic feed additives could modify the symptoms that preceded JHS losses and the development of new JHS cases. Findings Dairy cattle developed JHS after consuming feed containing several types of mycotoxigenic fungi including Fusarium culmorum, F. poae, F. verticillioides, F. sporotrichioides, Aspergillusflavus, Penicillium roqueforti, P. crustosum, P. paneum and P. citrinum. Mixtures of Shiga toxin - producing Escherichia coli (STEC colonized the mucosa in the hemorrhaged tissues of the cattle and no other pathogen was identified. The STECs
New method of synthesis and in vitro studies of a porous biomaterial
International Nuclear Information System (INIS)
Wers, E.; Lefeuvre, B.; Pellen-Mussi, P.; Novella, A.; Oudadesse, H.
2016-01-01
Biomaterials for bone reconstruction represent a widely studied area. In this paper, a new method of synthesis of a porous glass–ceramic obtained by thermal treatment is presented. The prepared biomaterial was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), and induced couple plasma-optical emission spectroscopy (ICP-OES), mercury porosimetry and by the Archimedes method. In vitro evaluations in a simulated body fluid (SBF) and in contact with SaOS_2 human osteoblasts were also carried out. The porous glass–ceramic is composed of a total porous network of 60% suitable for body fluid and cell infiltration, with pore sizes varying from 60 nm to 143 μm. The presence of two crystalline phases decreases the kinetic of bioactivity compared to an amorphous biomaterial (bioactive glass). A hydroxyapatite layer appears from 15 days of immersion on the surface and inside the pores, showing a biodegradation and a bioactivity in four steps. Cytotoxicity assessments present an increase of the cellular viability after 72 h proving the non-cytotoxic effect of the glass–ceramic. Thus, the results of these different studies indicate that the porous biomaterial may have a potential application for the bone regeneration. This paper also presents the novelty of this method. It is a rapid synthesis which combines simplicity and low cost. This represents an advantage for an eventual industrialization. - Highlights: • The new method of synthesis of a porous glass–ceramic is reproducible. • The porous glass–ceramic possesses a total porosity of 60%. • The biomaterial shows a bioactivity in four steps with hydroxyapatite formation. • 82% of cellular viability is observed on the surface of the biomaterial.
New method of synthesis and in vitro studies of a porous biomaterial
Energy Technology Data Exchange (ETDEWEB)
Wers, E., E-mail: wers.eric@hotmail.com [Equipe Chimie du Solide et Matériaux, UMR CNRS 6226, Sciences Chimiques de Rennes, Université de Rennes 1, Université Européenne de Bretagne, 263 avenue du Général Leclerc, 35042 Rennes Cedex (France); Lefeuvre, B. [Equipe Chimie du Solide et Matériaux, UMR CNRS 6226, Sciences Chimiques de Rennes, Université de Rennes 1, Université Européenne de Bretagne, 263 avenue du Général Leclerc, 35042 Rennes Cedex (France); Pellen-Mussi, P.; Novella, A. [Equipe Chimie du Solide et Matériaux, UMR CNRS 6226, Sciences Chimiques de Rennes, Université de Rennes 1, Université Européenne de Bretagne, 2 avenue du Professeur Léon Bernard, 35042 Rennes Cedex (France); Oudadesse, H. [Equipe Chimie du Solide et Matériaux, UMR CNRS 6226, Sciences Chimiques de Rennes, Université de Rennes 1, Université Européenne de Bretagne, 263 avenue du Général Leclerc, 35042 Rennes Cedex (France)
2016-04-01
Biomaterials for bone reconstruction represent a widely studied area. In this paper, a new method of synthesis of a porous glass–ceramic obtained by thermal treatment is presented. The prepared biomaterial was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), and induced couple plasma-optical emission spectroscopy (ICP-OES), mercury porosimetry and by the Archimedes method. In vitro evaluations in a simulated body fluid (SBF) and in contact with SaOS{sub 2} human osteoblasts were also carried out. The porous glass–ceramic is composed of a total porous network of 60% suitable for body fluid and cell infiltration, with pore sizes varying from 60 nm to 143 μm. The presence of two crystalline phases decreases the kinetic of bioactivity compared to an amorphous biomaterial (bioactive glass). A hydroxyapatite layer appears from 15 days of immersion on the surface and inside the pores, showing a biodegradation and a bioactivity in four steps. Cytotoxicity assessments present an increase of the cellular viability after 72 h proving the non-cytotoxic effect of the glass–ceramic. Thus, the results of these different studies indicate that the porous biomaterial may have a potential application for the bone regeneration. This paper also presents the novelty of this method. It is a rapid synthesis which combines simplicity and low cost. This represents an advantage for an eventual industrialization. - Highlights: • The new method of synthesis of a porous glass–ceramic is reproducible. • The porous glass–ceramic possesses a total porosity of 60%. • The biomaterial shows a bioactivity in four steps with hydroxyapatite formation. • 82% of cellular viability is observed on the surface of the biomaterial.
Directory of Open Access Journals (Sweden)
Arifullah Mohammed
Full Text Available Andrographis lineata is an herbal medicinal plant used in traditional medicine as a substitute for Andrographis paniculata. Here, using mature leaf explants of A. lineata we demonstrate for the first time the callus induction established on MS medium containing 1.0 mg l-1 IAA. Dried callus was subjected to solvent extraction with acetone. Further the acetone residue was separated by silica gel column chromatography, crystallized and characterized on the basis of nuclear magnetic resonance (proton and c13 and liquid chromatographic mass spectroscopy. This analysis revealed the occurrence of two known flavones namely, 7-O-methylwogonin (MW and Echioidinin (ED. Furthermore, these compounds were tested for their cytotoxicity against leukemic cell line, CEM. We identify that ED and MW induced cytotoxicity in a time- and concentration-dependent manner. Further increase in the LDH release upon treatment with ED and MW further confirmed our cytotoxicity results against leukemic cell line. Strikingly, MW was more potent than ED when compared by trypan blue and MTT assays. Our results recapitulate the utility of callus cultures for the production of plant specific bioactive secondary metabolites instead of using wild plants. Together, our in vitro studies provide new insights of A. lineata callus cultures serving as a source for cancer chemotherapeutic agents.
Mohammed, Arifullah; Chiruvella, Kishore K.; Rao, Yerra Koteswara; Geethangili, Madamanchi; Raghavan, Sathees C.; Ghanta, Rama Gopal
2015-01-01
Andrographis lineata is an herbal medicinal plant used in traditional medicine as a substitute for Andrographis paniculata. Here, using mature leaf explants of A. lineata we demonstrate for the first time the callus induction established on MS medium containing 1.0 mg l–1 IAA. Dried callus was subjected to solvent extraction with acetone. Further the acetone residue was separated by silica gel column chromatography, crystallized and characterized on the basis of nuclear magnetic resonance (proton and c13) and liquid chromatographic mass spectroscopy. This analysis revealed the occurrence of two known flavones namely, 7-O-methylwogonin (MW) and Echioidinin (ED). Furthermore, these compounds were tested for their cytotoxicity against leukemic cell line, CEM. We identify that ED and MW induced cytotoxicity in a time- and concentration-dependent manner. Further increase in the LDH release upon treatment with ED and MW further confirmed our cytotoxicity results against leukemic cell line. Strikingly, MW was more potent than ED when compared by trypan blue and MTT assays. Our results recapitulate the utility of callus cultures for the production of plant specific bioactive secondary metabolites instead of using wild plants. Together, our in vitro studies provide new insights of A. lineata callus cultures serving as a source for cancer chemotherapeutic agents. PMID:26488879
Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.
Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H
2015-07-01
The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Efeoglu, Esen; Casey, Alan; Byrne, Hugh J
2017-10-09
Although consumer exposure to nanomaterials is ever increasing, with potential increased applications in areas such as drug and/or gene delivery, contrast agents and diagnosis, the determination of the cyto- and geno-toxic effects of nanomaterials on human health and the environment still remains challenging. Although many techniques have been established and adapted to determine the cytotoxicity and genotoxicity of nano-sized materials, these techniques remain limited by the number of assays required, total cost, and use of labels and they struggle to explain the underlying interaction mechanisms. In this study, Raman microspectroscopy is employed as an in vitro label-free, high content screening technique to observe toxicological changes within the cell in a multi-parametric fashion. The evolution of spectral markers as a function of time and applied dose has been used to elucidate the mechanism of action of polyamidoamine (PAMAM) dendrimers associated with cytotoxicity and their impact on nuclear biochemistry. PAMAM dendrimers are chosen as a model nanomaterial due to their widely studied cytotoxic and genotoxic properties and commercial availability. Point spectra were acquired from the cytoplasm to monitor the cascade of toxic events occurring in the cytoplasm upon nanoparticle exposure, whereas the spectra acquired from the nucleus and the nucleolus were used to explore PAMAM-nuclear material interaction as well as genotoxic responses.
Interference of magnesium corrosion with tetrazolium-based cytotoxicity assays.
Fischer, Janine; Prosenc, Marc H; Wolff, Martin; Hort, Norbert; Willumeit, Regine; Feyerabend, Frank
2010-05-01
Magnesium (Mg) alloys are promising materials for the development of biodegradable implants. However, the current in vitro test procedures for cytotoxicity, cell viability and proliferation are not always suitable for this class of materials. In this paper we show that tetrazolium-salt-based assays, which are widely used in practice, are influenced by the corrosion products of Mg-based alloys. Corroded Mg converts tetrazolium salts to formazan, leading to a higher background and falsifying the results of cell viability. Tetrazolium-based assays are therefore not a useful tool for testing the cytotoxicity of Mg in static in vitro assays. Copyright (c) 2009 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
In vitro cytotoxicity of biosynthesized titanium dioxide nanoparticles ...
African Journals Online (AJOL)
The FT-IR spectrum of C. tamala leaf extract showed that the biomolecules were potentially involved in reduction processes. The negative zeta potential of -14 mV indicated that the NPs were stable and discrete while their crystalline nature was confirmed by XRD. Cytotoxicity analysis showed that the TiO2 NPs exhibit a ...
Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.
2012-01-01
Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699
International Nuclear Information System (INIS)
Kabbash, A.; El-Soud, K.A.; Zalat, E.; Shoeib, N.; Yagi, A.
2008-01-01
Aloe emodin and barbaloin, isolated as the active principles of the medicinal plant Aloe vera L., were extracted by supercritical fluid extraction (SFE) and analyzed by high performance liquid chromatography (HPLC). With optimized operating conditions for SFE, aloe emodin and barbaloin were quantitatively extracted from A. Vera leaves within 20 minutes at a flow rate of 0.3 ml/min, temperature and pressure at 40C and 3200 Psi respectively with the addition of 1 ml of methanol as a modifier. Separation of aloe emodin and barbaloin, in a pure form, from the SFE extract was achieved using a semi-preparative column. The cytotoxic activity of both aloe emodin and barbaloin were evaluated using the in-vitro MTT colorimetric assay. Aloe emodin showed a cytotoxic activity on two human colon cancer cells lines (DLD-1 and HD-29) with IC 8.94 and 10.78 M respectively, while barbaloin had no effect. (author)
International Nuclear Information System (INIS)
Rodrigues, Marcilene M.A.; Simioni, Andreza R.; Primo, Fernando L.; Siqueira-Moura, Marigilson P.; Morais, Paulo C.; Tedesco, Antonio C.
2009-01-01
This study reports on the preparation, characterization and in vitro toxicity test of a new nano-drug delivery system (NDDS) based on bovine serum albumin (BSA) nanospheres which incorporates surface-functionalized magnetic nanoparticles (MNP) and/or the silicon(IV) phthalocyanine (NzPc). The new NDDS was engineered for use in photodynamic therapy (PDT) combined with hyperthermia (HPT) to address cancer treatment. The BSA-based nanospheres, hosting NzPc, MNP or both (NzPc and MNP), present spherical shape with hydrodynamic average diameter values ranging from 170 to 450 nm and zeta potential of around -23 mV. No difference on the fluorescence spectrum of the encapsulated NzPc was found regardless of the presence of MNP. Time-dependent fluorescence measurements of the encapsulated NzPc revealed a bi-exponential decay for samples incorporating only NzPc and NzPc plus MNP, in the time window ranging from 1.70 to 5.20 ns. The in vitro assay, using human fibroblasts, revealed no cytotoxic effect in all samples investigated, demonstrating the potential of the tested system as a synergistic NDDS.
Phenolic Composition, Antioxidant Capacity and in vitro Cytotoxicity Assessment of Fruit Wines
Directory of Open Access Journals (Sweden)
Ana Ljevar
2016-01-01
Full Text Available Fruit wines contain a wide range of phenolic compounds with biological effects, but their composition and potential benefits to human health have been studied to the much lesser extent compared to grape wines. The aim of this research is to study the phenolic profile of different types of fruit wines and to evaluate their antioxidant and biological potential. Commercially available fruit wines from blackberry, cherry, raspberry, blackcurrant, strawberry and apple produced in Croatia were analyzed. To the best of our knowledge, this study represents the first comprehensive screening of Croatian fruit wines. The phenolic characterization was performed by spectrophotometry and HPLC-PDA/MS analysis. The antioxidant capacity was determined using ABTS and FRAP assays, while in vitro biological activity was analyzed by the cytotoxicity assay on human breast (MCF-7, colon (CaCo-2 and cervical (HeLa cancer cell lines. Among the studied fruit wines, blackberry, cherry and blackcurrant wines contained the highest amount of total phenolics, while the last two also contained the highest amount of total anthocyanins. The analysis of individual phenolic compounds showed distinctive phenolic composition of each type of fruit wine, notably as regards anthocyanins. Blackberry, followed by cherry, raspberry and blackcurrant wines also had a significantly higher antioxidant capacity than strawberry and apple wines. Fruit wines inhibited the growth of human cancer cells in vitro in a dose-dependent manner with differing susceptibility among tested cancer cells. Blackberry, cherry, raspberry and blackcurrant wines in the volume ratio of 10 and 20 % showed to be the most effective anti-proliferative agents, with higher susceptibility in HeLa and MCF-7 cells than CaCo-2 cells.
Mishra, Tripti; Pal, Mahesh; Meena, Sanjeev; Datta, Dipak; Dixit, Prateek; Kumar, Anil; Meena, Baleshwar; Rana, T S; Upreti, D K
2016-01-01
The rhizome of Hedychium spicatum has been widely used in traditional medicines. The present study deals with the evaluation of the cytotoxic potential of rhizome essential oils from four different regions of the Western Himalaya (India) along with comparative correlation analysis to characterise the bioactive cytotoxic component. The essential oils were coded as MHS-1, MHS-2, MHS-3 and MHS-4, and characterised using GC-FID and GC-MS. The main volatile compounds identified were 1,8-cineol, eudesmol, cubenol, spathulenol and α-cadinol. In vitro cytotoxic activities were assessed against human cancer cell lines such as, the lung (A549), colon (DLD-1, SW 620), breast (MCF-7, MDA-MB-231), head and neck (FaDu), and cervix (HeLa). MHS-4 is significantly active in comparison to other samples against all cancer cell lines. Sample MHS-4 has major proportion of monoterpene alcohol mainly 1,8-cineol. Principal components analysis was performed for the experimental results and all four samples were clustered according to their percentage inhibition at different doses.
Generation of specific antitumor cytotoxic T-lymphocytes in the monoculture
International Nuclear Information System (INIS)
Lupatov, A.Yu.; Brondz, B.D.
1992-01-01
A new model for the generation of specific antitumor cytotoxic T-lymphocytes (CTL) was proposed. In contrast to other models, it allows to generate effector CTL without immunization in vitro. For estimation of cytotoxic activity, chromium-51 release assay was used. It has been shown that effector CTL were absent in the lymph nodes in 1-fold as well as 2-fold immunization. Specific CTL were detected only after secondary immunization and subsequent cultivation in vitro. Effector cells had Thy1.2 + , Lyt2 + , L3T4 - phenotypes. Presence in vitro of exogenous IL-2 was needed for the generation of CTL against MX-11 sarcoma but not against EL4 lymphoma. The release of IL-2 from lymphomas cells could stimulate generation of the effector cells through activation of the endogenous production of IL-2, or due to some other factors
A Novel Preparation Method of Two Polymer Dyes with Low Cytotoxicity
Directory of Open Access Journals (Sweden)
Dongjun Lv
2017-02-01
Full Text Available A new preparation method of polymer dyes was developed to improve both the grafting degree of the azo dyes onto O-carboxymethyl chitosan (OMCS and the water solubility of prepared polymer dyes. Firstly, the coupling compound of two azo edible colorants, sunset yellow (SY and allura red (AR, was grafted onto OMCS, and then coupled with their diazonium salt. The chemical structure of prepared polymer dyes was determined by Fourier transform-infrared spectroscopy and 1H-NMR, and the results showed that the two azo dyes were successfully grafted onto OMCS. The grafting degree onto OMCS and the water solubility of polymer dyes were tested, and the results showed that they were both improved as expected. The UV-vis spectra analysis results showed that the prepared polymer dyes showed similar color performance with the original azo dyes. Eventually, the cytotoxicity of prepared polymer dyes was tested and compared with the original azo dyes by a cytotoxicity test on human liver cell lines LO2, and the results showed that their grafting onto OMCS significantly reduced the cytotoxicity.
International Nuclear Information System (INIS)
Zighelboim, J.; Bonavida, B.; Fahey, J.L.
1974-01-01
Adherent cells, presumably macrophages, obtained from the peritoneal cavity shortly after rejection of the allogeneic leukemia EL4, produced effective cell-mediated cytotoxicity (CMC) in vitro. These cytotoxic cells were sensitive to anti-macrophage serum and resistant to anti-thymocyte serum and 10,000 roentgen irradiation. In contrast, a second population of specifically cytotoxic cells were nonadherent, sensitive to x-rays and anti-thymocyte serum, but not to anti-macrophage serum. The two cell populations had a cooperative cytotoxic effect in vitro against allogeneic tumor cells
Directory of Open Access Journals (Sweden)
Louis Maes
2012-12-01
Full Text Available Malaria, leishmaniasis and human African trypanosomiasis continue to be major public health problems in need of new and more effective drugs. The aim of this study was to evaluate in vitro antiprotozoal activity of twenty endemic medicinal plants collected from the island of Soqotra in the Indian Ocean. The plant materials were extracted with methanol and tested for antiplasmodial activity against erythrocytic schizonts of Plasmodium falciparum, for antileishmanial activity against intracellular amastigotes of Leishmania infantum and for antitrypanosomal activity against intracellular amastigotes of Trypanosoma cruzi and free trypomastigotes of T. brucei. To assess selectivity, cytotoxicity was determined against MRC-5 fibroblasts. Selective activity was obtained for Punica protopunica against Plasmodium (IC50 2.2 µg/mL while Eureiandra balfourii and Hypoestes pubescens displayed activity against the three kinetoplastid parasites (IC50 < 10 µg/mL. Acridocarpus socotranus showed activity against T. brucei and T. cruzi (IC50 3.5 and 8.4 µg/mL. Ballochia atrovirgata, Dendrosicycos socotrana, Dracaena cinnabari and Euphorbia socotrana displayed non-specific inhibition of the parasites related to high cytotoxicity.
Ahmed, Farrukh Rafiq; Shoaib, Muhammad Harris; Azhar, Mudassar; Um, Soong Ho; Yousuf, Rabia Ismail; Hashmi, Shahkamal; Dar, Ahsana
2015-11-01
Halloysite is a clay mineral with chemical similarity to kaolin, a pharmaceutical ingredient. It consists of mainly aluminosilicate nanotubular particles in the size range of ∼ 200-1000 nm. Many studies have tried to empirically explore this novel clay for its potential in drug delivery systems but no work has yet studied its cytotoxicity from the perspective of oral drug delivery system. In this study, the halloysite nanotubes (HNTs) were subjected to size distribution analyses, which reveal more than 50% of nanotubes in the size range of 500 nm and rest mainly in the sub micrometer range. HNTs were then evaluated for in-vitro cytotoxicity against HCT116 (colorectal carcinoma) and HepG2 (hepatocellular carcinoma) cells which represent the earliest entry point and the first accumulating organ, respectively, for nanoparticles en-route to systemic circulation after oral delivery. Moreover, HNTs were tested for their cytogenetic toxicity against human peripheral blood lymphocytes. Both these results collectively indicated that HNTs are generally safe at practical concentrations of excipients for oral dosage forms. Copyright © 2015 Elsevier B.V. All rights reserved.
Gül, Süleyman; Demirci, Betül; Başer, Kemal Hüsnü Can; Akpulat, H Aşkin; Aksu, Pinar
2012-05-01
The aim of this study was to determine the chemical composition of Urtica dioica essential oil, and to evaluate its cytotoxic and genotoxic effects, using cytogenetic tests such as the cytokinesis-block micronucleus assay and chromosomal aberration analysis in human lymphocyte cultures in vitro. GC-MS analysis of U. dioica essential oil identified 43 compounds, representing 95.8% of the oil. GC and GC-MS analysis of the essential oil of U. dioica revealed that carvacrol (38.2%), carvone (9.0%), naphthalene (8.9%), (E)-anethol (4.7%), hexahydrofarnesyl acetone (3.0%), (E)-geranyl acetone (2.9%), (E)-β-ionone (2.8%) and phytol (2.7%) are the main components, comprising 72.2% of the oil. A significant correlation was found between the concentration of essential oil and the following: chromosomal aberrations, micronuclei frequency, apoptotic cells, necrotic cells, and binucleated cells.
International Nuclear Information System (INIS)
Wilke, Diego Veras; Jimenez, Paula Christine; Pessoa, Claudia; Moraes, Manoel Odorico de; Costa-Lotufo, Leticia Veras; Araujo, Renata Mendonca; Silva, Wildson Max Barbosa da; Silveira, Edilberto Rocha; Pessoa, Otilia Deusdenia Loiola; Braz-Filho, Raimundo; Lopes, Norberto Peporine
2009-01-01
Two lipidic α-amino acids 1a and 1b were isolated from the zoanthid Protopalythoa variabilis using a bioguided fractionation for cytotoxic activity. The structures of the metabolites were determined by spectroscopic methods, including NMR (nuclear magnetic resonance) 1 H and 13 C, IR infrared) and high resolution mass spectrometry (positive mode). The cytotoxic activity of the crude extract, as well as of the mixture of 1a and 1b were measured in vitro using the MTT assay for four human tumor cell lines. This finding has important biological and chemical implications for this type of compound. This is the first report of lipidic α-amino acids from natural sources, as well as of their cytotoxic activity. (author)
In vitro cytotoxicity evaluation of nano-carbon particles with different sp{sup 2}/sp{sup 3} ratios
Energy Technology Data Exchange (ETDEWEB)
Li, S.S.; Wu, B.J.; Deng, Q.Y. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Guo, Y.B. [The Third People' s Hospital of Chengdu, Sichuan 610031 (China); Leng, Y.X., E-mail: yxleng@263.net [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Huang, N. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China)
2017-06-01
Graphitization occurs during the long-term service of a diamond-like carbon (DLC) modified artificial joint. Then, DLC wear debris, which are carbon particles with different sp{sup 2}/sp{sup 3} ratios and sizes ranging from the nano- to micro-meter scale produced. In this paper, to promote the application of DLC coating for artificial joint modification, the cytotoxicity of DLC debris (nano-carbon particles, NCs) with different sp{sup 2}/sp{sup 3} ratios was studied. The microstructure and physical characteristics of NCs with different sp{sup 2}/sp{sup 3} ratios were investigated by Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), Transmission Electron Microscope (TEM) and Dynamic Light Scattering (DLS). Meanwhile, osteoblasts and macrophages were applied to characterize the cytotoxicity of the NCs. In vitro cytotoxicity assay results indicated that cells incubated with NCs of different sp{sup 2}/sp{sup 3} ratios had greater osteogenic capacity, and these particles caused a weaker immune response in comparison with CoCrMo particles. Taken together, the results indicated that NCs with different sp{sup 2}/sp{sup 3} ratios presented a good cytocompatibility than CoCrMo particles. But no significant differences were observed among NCs with different sp{sup 2}/sp{sup 3} ratios. The better cytocompatibility of NCs is mainly attributable to their surface charge. - Highlights: • NCs with different sp{sup 2}/sp{sup 3} ratios have been successfully prepared by annealing treatment. • NCs with different sp{sup 2}/sp{sup 3} ratios show good osteogenic capacity and lower immune response. • The good cytocompatibility of NCs is mainly dependent on its surface charge.
In vitro cytotoxicity of biosynthesized titanium dioxide nanoparticles ...
African Journals Online (AJOL)
ISSN: 1596-5996 (print); 1596-9827 (electronic) ... dioxide (Ti(OH)2) (80 mL) in aqueous solution with stirring for 2 h at room temperature. The TiO2 NPs ... The TiO2 NPs showed dose-dependent cytotoxicity towards D145 cells. Keywords: .... with ethanol and chloroform, and dried at room ... oxidation state of the TiO2 NPs.
Luo, Lan; Xu, Lina; Zhao, Haibo
2017-09-01
The present work proposed a simple, one pot, and green approach for the deoxygenation of graphene oxide (GO) using pyrogallol as reducing and stabilizing agent. This synthetic strategy prevents the utilization of toxic reducing reagents during synthesis. The characterization results of Ultra violet visible (UV-Vis), X-ray diffraction (XRD), X-ray photo electron spectroscopy (XPS), Transmission electron microscopy (TEM) for the synthesized GO and reduced graphene oxide (RGO) indicated the strong removal of oxygen groups after reduction which followed by stabilization with oxidized form of pyrogallol. TEM analysis showed the thin transparent silk like sheets of graphene. FTIR analysis confirmed the stabilization of graphene sheets with oxidized pyrogallol molecules. XRD and XPS analysis represented the deoxygenation of GO to RGO. The in-vitro cytotoxicity of RGO towards HeLa cells is dose dependant. The prepared RGO also exhibited the percent cell viability of about 80% even at higher concentrations indicating the less toxic nature of the RGO stabilized with pyrogallol. These results have represented that this synthetic approach is effective for the preparation of bulk scale RGO in a simple, less expensive and eco-friendly method. Since this method avoids the use of chemical reagents that are toxic in nature, the produced graphene are likely to offer several potential biomedical applications. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Bendinelli Mauro
2009-03-01
Full Text Available Abstract Background Cytotoxic T lymphocytes play a crucial role in the immunological control of microbial infections and in the design of vaccines and immunotherapies. Measurement of cytotoxic T lymphocyte activity requires that the test antigen is presented by target cells having the same or compatible class I major hystocompatibility complex antigens as the effector cells. Conventional assays use target cells labeled with 51chromium and infer cytotoxic T lymphocyte activity by measuring the isotope released by the target cells lysed following incubation with antigen-specific cytotoxic T lymphocytes. This assay is sensitive but needs manipulation and disposal of hazardous radioactive reagents and provides a bulk estimate of the reporter released, which may be influenced by spontaneous release of the label and other poorly controllable variables. Here we describe a novel method for producing target in outbred hosts and assessing cytotoxic T lymphocyte activity by flow cytometry. Results The method consists of culturing skin fibroblasts, immortalizing them with a replication defective clone of simian virus 40, and finally transducing them with a bicistronic vector encoding the target antigen and the reporter green fluorescent protein. When used in a flow cytometry-based assay, the target cells obtained with this method proved valuable for assessing the viral envelope protein specific cytotoxic T lymphocyte activity in domestic cats acutely or chronically infected with feline immunodeficiency virus, a lentivirus similar to human immunodeficiency virus and used as animal model for AIDS studies. Conclusion Given the versatility of the bicistronic vector used, its ability to deliver multiple and large transgenes in target cells, and its extremely wide cell specificity when pseudotyped with the vesicular stomatitis virus envelope protein, the method is potentially exploitable in many animal species.
International Nuclear Information System (INIS)
Langmuir, Virginia K.; Laderoute, Keith R.; Mendonca, Holly L.; Sutherland, Robert M.; Hei, Tom K.; Liu, S.-X.; Hall, Eric J.; Naylor, Matthew A.; Adams, Gerald E.
1996-01-01
Purpose: To determine what structural moieties of the fused pyrazine mono-N-oxides are determining factors in their in vitro cytotoxicity and oncogenicity. Methods and Materials: A new series of experimental bioreductive drugs, fused pyrazine mono-N-oxides, was evaluated in vitro for aerobic and hypoxic cytotoxicity in the HT29 human colon adenocarcinoma cell line by using clonogenic assays. The relative oncogenicities of these compounds were also determined in aerobic cultures of C3H 10T1/2 mouse embryo fibroblasts by using a standard transformation assay. Results: Removal of the 4-methyl piperazine side chain from the parent compound, RB 90740, reduced the potency of the hypoxic cytotoxin. Reduction of the N-oxide function increased the aerobic cytotoxicity and eliminated most of the hypoxic/aerobic cytotoxic differential. The reduced N-oxide also had significant oncogenicity, consistent with a mechanism of genotoxicity following bioreduction of RB 90740. Conclusion: This new series of bioreductive compounds may be effective in cancer therapy, particularly the lead compound RB 90740. The oncogenic potential of these compounds is similar to that for other cancer therapies. Further studies should include evaluation of these compounds in vivo and the development of analogs with reduced oncogenic potential and retention of the hypoxic/aerobic cytotoxicity differential
International Nuclear Information System (INIS)
Sun, Li; Kong, Beihua; Sheng, Xiugui; Sheu, Jim Jinn-Chyuan; Shih, Ie-Ming
2010-01-01
Recently, some studies have indicated that Rsf-1/HBXAP plays a role in chromatin remodeling and transcriptional regulation that may contribute to tumorigenesis in ovarian cancer. The present study demonstrates that using dendritic cells (DCs) from human cord blood CD34 + cells transduced with Rsf-1/HBXAP DNA plasmids by nucleofection generate specific cytotoxic T lymphocytes (CTL) against ovarian cancer in vitro. After transfection, DCs were analyzed for Rsf-1/HBXAP mRNA expression by RT-PCR and protein expression by Western blot. Then the DC phenotypes, T-cell stimulatory capacity, endocytic activity and migration capacity were explored by flow cytometry analysis, allogeneic mixed lymphocyte reaction, endocytosis and transwell chemotaxis assay, respectively. After transfection, Rsf-1/HBXAP expression was detected at mRNA and protein levels. Allogeneic T-cell proliferation induced by transfected DCs was obviously higher than non-transfected DCs, but the endocytosis capacity and migratory ability were not different. Rsf-1/HBXAP gene-transduced DCs could induce antigen-specific CTL and generate a very potent cytotoxicity to OVCAR3 cells. These data suggest that Rsf-1/HBXAP gene-transduced DCs may be a potential adjuvant immunotherapy for ovarian cancer in clinical applications.
Zhao, Lingyun; Xu, Xiaoyu; Wang, Xiaowen; Zhang, Xiaodong; Gao, Fuping; Tang, Jintian
2009-07-01
Cancer comprehensive treatment has been fully acknowledged as it can provide an effective multimodality approach for fighting cancers. In this study, various innovative technologies for cancer treatment including cancer nanotechnology, chemotherapy by sustainable release, as well as magnetic induction hyperthermia (MIH) have been integrated for the purpose of cancer comprehensive treatment. Briefly, such kind of treatment can be realized by applying of the tailored magnetic nanoparticles (MNPs) composite polymeric film. Fe3O4 MNPs acting as the agent for MIH, and anti-cancer drug docetaxel as chemotherapeutic agent were incorporated within the biodegradable polymeric film. Physiochemical characterizations on MNPs and the film have been systematically carried out by various instrumental analyses. Our results demonstrated that the film has been successfully fabricated by the solvent cast method. Hyperthermia could be induced by stimulating the nanocomposite film under an alternative magnetic field (AMF). The incorporation of MNPs, as well as hyperthermia would facilitate the drug release from the polymeric film. The in-vitro cytotoxicity results indicated the bi-modal cancer treatment approach for combined MIH and chemotherapy is more effective than the mono-modal treatment by docetaxel treatment. The magnetic nanocomposite film can realize cancer comprehensive treatment thus has great potential in clinical application.
Directory of Open Access Journals (Sweden)
Agustina Setiawati
2017-05-01
Full Text Available Many studies were designed explore chemopreventive activity of natural products on colon cancer especially addressing COX-2 as molecular target. Another promising source of natural product that potentially exhibit anticancer activity on colon cancer is Ganoderma lucidum. This study assessed selectivity of cytotoxic effect of G. lucidum extract on WiDr to Vero cells and investigated molecular mechanism on COX-2. G. lucidum ex-tract was prepared by reflux extraction method; in vitro anticancer was assayed by MTT method on WiDr and Vero cell line. This study applied apoptosis induction assay to observe cell death mechanism using double staining method; further COX-2 expression was stained by immunocytochemistry method. G. lucidum extract has cytotoxic effect on WiDr cells with IC50 135 µg/mL. However, the cytotoxic effect had low selectivity to-wards Vero cells with Selectivity Index (SI 3.66. The extract induced apoptosis and suppressed COX-2 ex-pression in WiDr cells. G. lucidum extract was potential to be developed as anticancer agent towards colon cancer.
Cytotoxic and genotoxic potential of food-borne nitriles in a liver in vitro model
Kupke, Franziska; Herz, Corinna; Hanschen, Franziska S.; Platz, Stefanie; Odongo, Grace A.; Helmig, Simone; Bartolomé Rodríguez, María M.; Schreiner, Monika; Rohn, Sascha; Lamy, Evelyn
2016-01-01
Isothiocyanates are the most intensively studied breakdown products of glucosinolates from Brassica plants and well recognized for their pleiotropic effects against cancer but also for their genotoxic potential. However, knowledge about the bioactivity of glucosinolate-borne nitriles in foods is very poor. As determined by GC-MS, broccoli glucosinolates mainly degrade to nitriles as breakdown products. The cytotoxicity of nitriles in human HepG2 cells and primary murine hepatocytes was marginal as compared to isothiocyanates. Toxicity of nitriles was not enhanced in CYP2E1-overexpressing HepG2 cells. In contrast, the genotoxic potential of nitriles was found to be comparable to isothiocyanates. DNA damage was persistent over a certain time period and CYP2E1-overexpression further increased the genotoxic potential of the nitriles. Based on actual in vitro data, no indications are given that food-borne nitriles could be relevant for cancer prevention, but could pose a certain genotoxic risk under conditions relevant for food consumption. PMID:27883018
Mendiola, Judith; Regalado, Erik L; Díaz-García, Alexis; Thomas, Olivier P; Fernández-Calienes, Aymé; Rodríguez, Hermis; Laguna, Abilio; Valdés, Olga
2014-01-01
Aqueous and organic fractions from the crude extracts of 17 sponge species collected at Boca de Calderas, Havana, Cuba were analysed. The organic fractions of Mycale laxissima, Clathria echinata and Agelas cerebrum exhibited values of concentrations causing 50% inhibition of in vitro growth of Plasmodium berghei (IC50) of 42.3 ± 5.1, 52 ± 9.7 and 60.3 ± 10.6 μg/mL, respectively, while their selectivity indexes for fibroblast cell lines were 9.45, 4.24 and 8.7, correspondingly. These fractions reduced parasitemia of infected Balb/c mice as well. Selective cytotoxicity indexes against tumour HeLa cells focused an interest on the aqueous fraction of M. laxissima (>7.12) and organic fractions of Polymastia nigra (5.95), A. cerebrum (5.48) and Niphates erecta (>4.2). Triterpenoids/steroids and alkaloids detected in the organic fractions of M. laxissima, C. echinata and A. cerebrum should be isolated for future investigation.
Piloto Ferrer, Janet; Cozzi, Renata; Cornetta, Tommaso; Stano, Pasquale; Fiore, Mario; Degrassi, Francesca; De Salvia, Rosella; Remigio, Antonia; Francisco, Marbelis; Quiñones, Olga; Valdivia, Dayana; González, Maria L; Pérez, Carlos; Sánchez-Lamar, Angel
2014-01-01
Xanthium strumarium L. is a member of the Asteraceae commonly used in Cuba, mainly as diuretic. Some toxic properties of this plant have also been reported and, to date, very little is known about its genotoxic properties. The present work aims was to evaluate the potential cytotoxic and genotoxic risk of whole extract from Xanthium strumarium L. whole extract of aerial parts. No positive response was observed in a battery of four Salmonella typhimurium strains, when exposed to concentrations up to 5 mg/plate, with and without mammalian metabolic activation (liver microsomal S9 fraction from Wistar rats). In CHO cells, high concentrations (25-100 μg/mL) revealed significant reduction in cell viability. Results from sister chromatid exchanges, chromosome aberrations, and comet assay showed that X. strumarium extract is genotoxic at the highest concentration used, when clear cytotoxic effects were also observed. On the contrary, no increase in micronuclei frequency in bone marrow cells was observed when the extract was orally administered to mice (100, 500, and 2000 mg/Kg doses). The data presented here constitute the most complete study on the genotoxic potential of X. strumarium L. and show that the extract can induce in vitro DNA damage at cytotoxic concentrations.
Directory of Open Access Journals (Sweden)
Janet Piloto Ferrer
2014-01-01
Full Text Available Xanthium strumarium L. is a member of the Asteraceae commonly used in Cuba, mainly as diuretic. Some toxic properties of this plant have also been reported and, to date, very little is known about its genotoxic properties. The present work aims was to evaluate the potential cytotoxic and genotoxic risk of whole extract from Xanthium strumarium L. whole extract of aerial parts. No positive response was observed in a battery of four Salmonella typhimurium strains, when exposed to concentrations up to 5 mg/plate, with and without mammalian metabolic activation (liver microsomal S9 fraction from Wistar rats. In CHO cells, high concentrations (25–100 μg/mL revealed significant reduction in cell viability. Results from sister chromatid exchanges, chromosome aberrations, and comet assay showed that X. strumarium extract is genotoxic at the highest concentration used, when clear cytotoxic effects were also observed. On the contrary, no increase in micronuclei frequency in bone marrow cells was observed when the extract was orally administered to mice (100, 500, and 2000 mg/Kg doses. The data presented here constitute the most complete study on the genotoxic potential of X. strumarium L. and show that the extract can induce in vitro DNA damage at cytotoxic concentrations.
Martín-Cameán, Ana; Jos, Ángeles; Mellado-García, Pilar; Iglesias-Linares, Alejandro; Solano, Enrique; Cameán, Ana M
2015-07-01
Intraoral fixed orthodontic appliances are frequently used in the clinical practice of dentistry. They are made from alloys containing different metals at various percentages. The use of these appliances leads to the long-term exposure of patients to these materials, and the potential toxic effects of this exposure raises concerns about patient safety. Thus, the biocompatibility (corrosion behaviour and toxicity) of these materials has to be evaluated prior to clinical use. In the present report, the most recent studies in the scientific literature examining metal ion release from orthodontic appliances and the toxic effects of these ions have been reviewed with a special focus on cytotoxicity and genotoxicity. Previous studies suggest that a case-by-case safety evaluation is required to take into account the increasing variability of materials, their composition and the manufacturing processes. Moreover, in vivo toxicity studies in regard to metal release, cytotoxicity and genotoxicity are still scarce. Therefore, in vitro and in vivo monitoring studies are needed to establish cause-effect relationships between metal ion release and biomarkers of cytotoxicity and genotoxicity. Further investigations could be performed to elucidate the toxic mechanisms involved in the observed effects with a special emphasis on oxidative damage. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wang, Jiali, E-mail: wangjialicsu@yahoo.cn [Center for Translational Medicine Research and Development, Institute of Biomedical and Health Engineering, Chinese Academy of Sciences, Shenzhen 518055 (China); Musculoskeletal Research Laboratory, Department of Orthopaedics and Traumatology, The Chinese University of Hong Kong, Hong Kong SAR (China); Qin, Ling [Center for Translational Medicine Research and Development, Institute of Biomedical and Health Engineering, Chinese Academy of Sciences, Shenzhen 518055 (China); Musculoskeletal Research Laboratory, Department of Orthopaedics and Traumatology, The Chinese University of Hong Kong, Hong Kong SAR (China); Wang, Kai [School of Humanities and Social Sciences, Hunan University of Chinese Medicine, Changsha 410208 (China); Wang, Jue; Yue, Ye [Center for Translational Medicine Research and Development, Institute of Biomedical and Health Engineering, Chinese Academy of Sciences, Shenzhen 518055 (China); Li, Yangde [Guangdong Innovation Team for Biodegradable Magnesium and Medical Implants, E-ande, Dongguan 523660 (China); Tang, Jian [Center for Translational Medicine Research and Development, Institute of Biomedical and Health Engineering, Chinese Academy of Sciences, Shenzhen 518055 (China); Li, Weirong [Guangdong Innovation Team for Biodegradable Magnesium and Medical Implants, E-ande, Dongguan 523660 (China)
2013-10-01
Magnesium alloys have been advocated as potential artificial bone materials due to their biocompatibility and biodegradability. The understanding of their corrosive mechanism in physiological environments is therefore essential for making application-orientated designs. Thus, this in vitro study was designed to assess the effects of CO{sub 2} on corrosive behavior of AZ31D to mimic in vivo special ingredient. Electrochemical technologies accompanied with Scanning electron microscope, Fourier transform infrared, X-ray diffraction, Energy dispersive spectroscopy and hydrogen evolution measurement were employed to analyze corrosive rates and mechanisms of AZ31D. Moreover, the biocompatibility of AZ31D was assessed with a direct cell attachment assay and an indirect cytotoxicity test in different diluted extracts. The ion concentrations in extracts were measured using inductively coupled plasma mass spectrometry to offer explanations on the differences of cell viability in the indirect test. The results of the direct cytotoxicity assay showed that the corrosive rate of AZ31D was too rapid to allow for cell adhesion. Extracts diluted less than 20 times would cause adverse effects on cell proliferation, likely due to excessive ions and gas release. Moreover, the presence of CO{sub 2} did not cause significant differences on corrosive behavior of AZ31D according to the results of electrochemical testing and hydrogen evolution measurement. This might be caused by the simultaneous process of precipitation and dissolution of MgCO{sub 3} due to the penetration role of CO{sub 2}. This analysis of corrosive atmospheres on the degradation behavior of magnesium alloys would contribute to the design of more scientific in vitro testing systems in the future. - Highlights: • We evaluate the effects of CO{sub 2} on corrosion behavior of magnesium alloys. • We assess the feasibility of commercial AZ31D alloy as potential implants. • CO{sub 2} is not the key factor to minimize
International Nuclear Information System (INIS)
Rasool, M.H.; Afzal, A.M.
2014-01-01
Newcastle disease (ND), one of the most important disease of poultry throughout the World is caused by Newcastle Disease Virus (NDV). It is causing huge economic losses in poultry industry of Pakistan. Regardless of vaccination, other prevention and control measures are necessary to prevent ND outbreaks. Natural resources have been exploited to obtain antiviral compounds in several latest studies. In this study, the antiviral activity of Viro Care GZ-081 was checked up in-vitro, in-ovo and in-vivo. The cytotoxicity assay of the product was performed using Vero cell line. All the trials revealed that the stock solution and 1:2 dilution of GZ-08 had some antiviral activity as well as were cytotoxic. As the concentration decreased, cytotoxicity as well as antiviral activities were lost. Based on these findings, it was concluded that GZ-08 sanitizer or spray can be used as antiviral agent to clean or disinfect some non-living surfaces against different viruses in general and NDV in particular. However, in-vivo use of GZ-08 in poultry against NDV is recommended only as pre-treatment with ND vaccines as it significantly reduced morbidity and mortality as compared to the use of vaccines alone. However, further work is recommended in future on GZ-08 for its use as post-treatment of ND as well as on other antiviral compounds of natural origin to develop a novel antiviral drug against NDV in poultry. (author)
Directory of Open Access Journals (Sweden)
Dina Fatmawati
2011-12-01
Design and Method: The method was quasi experimental with post test only non equivalent control group design. HeLa cell was divided into two groups. The first group as positive control with doxorubicin, second group as treatment with ethanolic extract of sarang semut at various concentrations. Ethanolic extract of sarang semut concentrations used were 3,91 μg/ml; 7,81 μg/ml; 15,63 μg/ml; 31,25 μg/ml; 62,50 μg/ml; 125 μg/ml; 250 μg/ml; 500 μg/ml; 1000 μg/ml. Cytotoxic effect was evaluated by direct counting method with tryphan blue dye then using probit regression analysis to find IC50 value. Result: Inhibitory concentration 50 (IC50 value ethanol extract of sarang semut was 33,28 μg/ml. Ethanol extract of sarang semut had a cytotoxicity effect categorized as the moderately active (20 ìg/ml< IC50< 100ìg/ ml. Inhibitory concentration 50 (IC50 value doxorubicin was 5,56 μg/ml. Cytotoxicity effect of doxorubisin higher than cytotoxicity effect of ethanolic extract of sarang semut. Conclusion: Ethanolic extract of sarang semut (Myrmecodia pendens had a cytotoxic effect categorized as the moderately active on HeLa cell (Sains Medika, 3(2:112-120.
Directory of Open Access Journals (Sweden)
Veronique Mégalizzi
2007-05-01
Full Text Available Although the molecular function of cr receptors has not been fully defined and the natural ligand(s is still not known, there is increasing evidence that these receptors and their ligands might play a significant role in cancer biology. 4-(N-tibenzylpiperidin-4-yl-4iodobenzamide (4-IBP, a selective σ1, agonist, has been used to investigate whether this compound is able to modify: 1 in vitro the migration and proliferation of human cancer cells; 2 in vitro the sensitivity of human glioblastoma cells to cytotoxic drugs; and 3 in vivo in orthotopic glioblastoma and non-small cell lung carcinoma (NSCLC models the survival of mice coadministered cytotoxic agents. 4-IBP has revealed weak anti proliferative effects on human U373-MG glioblastoma and C32 melanoma cells but induced marked concentration-dependent decreases in the growth of human A549 NSCLC and PC3 prostate cancer cells. The compound was also significantly antimigratory in all four cancer cell lines. This may result, at least in U373-MG cells, from modifications to the actin cytoskeleton. 4-IBP modified the sensitivity of U373-MG cells in vitro to proapoptotic lomustin and proautophagic temozolomide, and markedly decreased the expression of two proteins involved in drug resistance: glucosylceramide synthase and Rho guanine nucleotide dissociation inhibitor. In vivo, 4-IBP increased the antitumor effects of temozolomide and irinotecan in immunodeficient mice that were orthotopically grafted with invasive cancer cells.
Directory of Open Access Journals (Sweden)
Hanan Abd Al-Hay Saied Al-Ashaal
2017-11-01
Full Text Available Objective: To investigate the biological activities of polar and non-polar extracts of Balanites aegyptiaca fruits. Methods: Antihyperglycemic activity using alloxan induced diabetic rats was evaluated. In vitro cytotoxicity against human carcinoma cell lines activity in addition to antioxidant and antitrematodal effects were investigated. Phytochemicals were determined using chromatographic and spectral analyses including TLC, GC and LC/MS/MS methods. Results: The reduction in blood glucose level reached 64.13%, 69.07% and 77.01% for hexane, chloroform and methanol extract, respectively. Isolated organs and histopathological examination illustrated improvement in treated animal's pancreas which is the master gland in controlling glucose level. The highest in vitro free radical scavenging capacity was achieved by chloroform extract (75.72%. Meanwhile, hexane and methanol extracts exhibited 44.01% and 41.77% scavenging capacity, respectively. Cytotoxic activity against human carcinoma cell lines illustrated efficacious influence against brain, liver, lung, breast and lymphoblastic leukemia cell lines. Brain cell line was the most susceptible cell line by both chloroform and methanol extracts. In vitro antitrematodal effectiveness showed that 100% mortality of Schistosoma worms was induced at the 3rd and 5th days for methanol and chloroform extracts. Meanwhile, both extracts exhibited antifasciolosis activity with LC50 of 63.19 and 55.15 mg/L, respectively. Conclusions: The current results illustrated that Balanites aegyptiaca phytochemicals induced potent hypoglycemic activity and potent to moderate antioxidant and cytotoxic effects. Chloroform and methanol extracts were found to have antitrematodal efficacy against Schistosoma mansoni and Fasciola gigantica hepatic worms.
Directory of Open Access Journals (Sweden)
Vida Elsyana
2016-01-01
Full Text Available Clove mistletoe (Dendrophthoe pentandra (L. Miq. is a semiparasitic plant that belongs to Loranthaceae family. Clove mistletoe was traditionally used for cancer treatment in Indonesia. In the present study, we examined cytotoxicity of clove mistletoe leaves extracts against brine shrimps and conducted their antiproliferative activity on K562 (human chronic myelogenous leukemia and MCM-B2 (canine benign mixed mammary cancer cell lines in vitro. The tested samples were water extract, ethanol extract, ethanol fraction, ethyl acetate fraction, and n-hexane fraction. Cytotoxicity was screened using Brine Shrimp Lethality Test (BSLT. Antiproliferative activity was conducted using Trypan Blue Dye Method and cells were counted using haemocytometer. The results showed that n-hexane fraction exhibited significant cytotoxicity with LC50 value of 55.31 μg/mL. The n-hexane fraction was then considered for further examination. The n-hexane fraction of clove mistletoe could inhibit growth of K562 and MCM-B2 cancer cell lines in vitro. The inhibition activity of clove mistletoe n-hexane fraction at concentration of 125 μg/mL on K562 cancer cell lines was 38.69%, while on MCM-B2 it was 41.5%. Therefore, it was suggested that clove mistletoe had potential natural anticancer activity.
Energy Technology Data Exchange (ETDEWEB)
Ziemann, C; Creutzenberg, O [Fraunhofer Institute of Toxicology and Experimental Medicine, Hannover (Germany); Jackson, P [CERAM Research Ltd., Stoke-on-Trent (United Kingdom); Brown, R [TOXSERVICES, Stretton (United Kingdom); Attik, G; Rihn, B H, E-mail: christina.ziemann@item.fraunhofer.d [Nancy-University, Faculte de Pharmacie, Nancy (France)
2009-02-01
Inhalation of some respirable crystalline silica (MMAD < approx. 4 mum) leads to inflammatory and malignant diseases. Comprehensive physicochemical/biological data and suitable in vitro/in vivo methods may distinguish between more or less harmful quartz-varieties. Within the European Collective Research Project SILICERAM an in vitro screening battery was established to evaluate cytotoxicity (LDH-release, MTT-assay), genotoxicity (Comet-assay) and pro-inflammatory potential (PGE{sub 2}-liberation, TNF-a mRNA expression) of 5 respirable quartz-containing dusts from ceramic plants: brickwork (BR: 7.8% quartz), tableware granulate/cast (TG/TC: 5.8%/3.1%), tiles (TI: 8.1%), refractory (RF: 3.7%). DQ12 (87% a-quartz) and Al{sub 2}O{sub 3} were used as particulate positive and negative controls, respectively. Primary rat alveolar macrophages and the macrophage cell line NR8383 served as model systems. Aluminium lactate was used as inhibitor of biologically active silica, enabling differentiation of silica- and non-specific toxicity. At 200mug/cm{sup 2} (2h) the dusts did not alter significantly LDH-release (except TC), whereas the MTT-assay demonstrated the mainly quartz-independent rank order: DQ12>RF>TG>Ti>BR>TC>Al{sub 2}O{sub 3}. DNA-damage was maximal for BR and TI followed by DQ12>TG>TC>RF>Al{sub 2}O{sub 3}. All dusts induced PGE{sub 2}-liberation (DQ12>BR>TC>TG>Ti>RF>Al{sub 2}O{sub 3}) at 50mug/cm{sup 2} (4h), but TNF-a mRNA (10mug/cm{sup 2}, 24h) was only increased by DQ12, TG (quartz-dependently), and TC. In conclusion, these in vitro tests were an adequate approach to screen the toxic potential of quartz-containing ceramic dusts, but the quartz-content was too low to differentiate the various quartz-varieties.
Hossain, Mohammad Shahadat; Reza, A S M Ali; Rahaman, Md Masudur; Nasrin, Mst Samima; Rahat, Mohammed Rasib Uddin; Islam, Md Rabiul; Uddin, Md Josim; Rahman, Md Atiar
2018-01-05
The present study was planned to investigate the phytochemical, antioxidant, antinociceptive, anticoagulant and cytotoxic activities of the Jacquemontia tamnifolia (L.) Griseb leaf methanol extract (MExJT) in the laboratory using both in vitro and in vivo methods. Phytochemical values, namely, total phenolic and flavonoid contents, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging effect and FeCl3 reducing power effects, were studied by established methods. In vivo antinociceptive activity was performed by acidic acid-induced writhing test and formalin-induced pain test on Swiss albino mice at doses of 125, 250 and 500 mg/kg body weight. The clot lysis and brine shrimp lethality bioassay in vitro were used to evaluate the thrombolytic and cytotoxic activities of the plant extract, respectively. Phytochemical screening illustrates the presence of tannins, saponins, flavonoids, gums and carbohydrates, steroids, alkaloids and reducing sugars in the extract. The results showed the total phenolic content (146.33 g gallic acid equivalents/100 g extract) and total flavonoid content (133.33 g quercetin/100 g). Significant (pacetic acid-induced writhing test and formalin-induced pain models in Swiss albino mice with doses of 125, 250 and 500 mg/kg body weight. Significant (panalgesic activity. The results also demonstrate that MExJT has moderate thrombolytic and lower cytotoxic properties that may warrant further exploration.
Gundala, Naveen K V; Naidu, Vegi G M; Das, Undurti N
2017-03-01
The aim of this study was to observe whether polyunsaturated fatty acids (PUFAs) can protect rat insulinoma (RIN5 F) cells against streptozotocin (STZ)-induced apoptosis in vitro and type 1 diabetes mellitus (T1DM) and type 2 DM (T2DM) in vivo and if so, what would be the mechanism of this action. RIN5 F cells were used for the in vitro study, whereas the in vivo study was performed in Wistar rats. STZ was used to induce apoptosis of RIN5 F cells in vitro and T1- and T2DM in vivo. The effect of PUFAs: γ-linolenic acid (GLA), arachidonic acid (AA) of ω-6 series, and eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) of ω-3 series; cyclooxygenase (COX) and lipoxygenase (LOX) inhibitors and antiinflammatory metabolite of AA and DHA, lipoxin A4 (LXA4), and resolvin D2 and protectin, respectively against STZ-induced cytotoxicity to RIN5 F cells in vitro and LXA4 against T1- and T2DM in vivo was studied. Changes in the antioxidant content, lipid peroxides, nitric oxide, and expression of PDX1, P65, nuclear factor-κb (NF-κb), and IKB genes in STZ-treated RIN5 F cells in vitro and Nrf2, GLUT2, COX2, iNOS protein levels in the pancreatic tissue of T1- and T2DM and LPCLN2 (lipocalin 2), NF-κb, IKB I in adipose tissue of T2DM after LXA4 treatment were studied. Plasma glucose, insulin, and tumor necrosis factor (TNF)-α levels also were measured in STZ-induced T1- and T2DM Wistar rats. Among all PUFAs tested, AA and EPA are the most effective against STZ-induced cytotoxicity to RIN5 F cells in vitro. Neither COX nor LOX inhibitors blocked the cytoprotective action of AA in vitro and T1- and T2DM by STZ. LXA4 production by RIN5 F cells in vitro and plasma LXA4 levels in STZ-induced T1- and T2DM animals were decreased by STZ that reverted to normal after AA treatment. AA prevented both T1- and T2DM induced by STZ. Antiinflammatory metabolite of AA and LXA4 prevented both T1- and T2DM induced by STZ. The expression of Pdx1, NF-κb, IKB genes in the
Cytotoxic Effect and Antioxidant Activity of Bioassay- guided ...
African Journals Online (AJOL)
... were investigated for their in vitro cytotoxic effect against various cancer cell lines using 3-(4, 5-dimethyl-2-thiazolyl)-2, 5- ... In MTT assay, fractions 1, 2 and 4 from methanol extract showed the ... plant is used as antitumourigenic, antioxidant,.
Phytochemical and Cytotoxic Investigations of Alpinia mutica Rhizomes
Directory of Open Access Journals (Sweden)
Kae Shin Sim
2011-01-01
Full Text Available The methanol and fractionated extracts (hexane, ethyl acetate and water of Alpinia mutica (Zingiberaceae rhizomes were investigated for their cytotoxic effect against six human carcinoma cell lines, namely KB, MCF7, A549, Caski, HCT116, HT29 and non-human fibroblast cell line (MRC 5 using an in vitro cytotoxicity assay. The ethyl acetate extract possessed high inhibitory effect against KB, MCF7 and Caski cells (IC50 values of 9.4, 19.7 and 19.8 µg/mL, respectively. Flavokawin B (1, 5,6-dehydrokawain (2, pinostrobin chalcone (3 and alpinetin (4, isolated from the active ethyl acetate extract were also evaluated for their cytotoxic activity. Of these, pinostrobin chalcone (3 and alpinetin (4 were isolated from this plant for the first time. Pinostrobin chalcone (3 displayed very remarkable cytotoxic activity against the tested human cancer cells, such as KB, MCF7 and Caski cells (IC50 values of 6.2, 7.3 and 7.7 µg/mL, respectively. This is the first report of the cytotoxic activity of Alpinia mutica.
Farzin Heravi; Mohammad Ramezani; Maryam Poosti; Mohsen Hosseini; Arezoo Shajiei; Farzaneh Ahrari
2013-01-01
Background and aims. Incorporation of nano-particles to orthodontic bonding systems has been considered to prevent enamel demineralization around appliances. This study investigated cytotoxicity of Transbond XT adhesive containing 1 wt% titanium dioxide (TiO2) nano-particles. Materials and methods. Ten composite disks were prepared from each of the conventional and TiO2-containg composites and aged for 1, 3, 5, 7 and 14 days in Dulbecco’s Modified Eagle’s Medium (DMEM). The extrac...
Influence of HLA-D/DR antigen disparity in CTL generation in vitro
International Nuclear Information System (INIS)
Johnsen, H.E.; Madsen, M.; Mossin, J.; Kristensen, T.
1983-01-01
This report describes the influence of HLA-D/-DR antigen disparity upon the level of cytotoxicity in allogeneic in vitro cultures. Allogeneic cultures, between unrelated HLA-D/-DR full house donors, tested in CML gave three different levels of cytotoxicity, termed weak, intermediate and strong cytotoxicity. HLA-D/-DR compatibility predicts weak cytotoxicity and two HLA-B antigen incompatibility predicts strong cytotoxicity. On the contrary, HLA-A antigens have no major influence upon the strength of cytotoxicity. Accepting that the MLC/CML reaction is an in vitro parallel to the in vivo transplantation of allogeneic tissue, the observations are in accordance with the results of HLA-D/-DR matching for graft survival in human renal transplantation. (author)
International Nuclear Information System (INIS)
Fitch, F.W.; Engers, H.D.; Cerottini, J.C.; Bruner, K.T.
1976-01-01
Irradiated cells obtained from MLC at the peak of the CTL response caused profound suppression of generation of CTL when added in small numbers at the initiation of primary MLC prepared with normal spleen cells. The inhibitory activity of the MLC cells was not affected by irradiation (1000 rads) but was abolished by treatment with anti-theta serum and complement. The suppression was immunologically specific. The response of A (H-2/sup a/) spleen cells toward C3H (H-2/sup k/) alloantigens was suppressed by irradiated MLC cells obtained from MLC prepared with A spleen cells and irradiated C3H-stimulating cells, whereas the response of A spleen cells toward DBA/2 (H-2/sup d/) alloantigens was affected relatively little. However, if irradiated C3H x DBA/2F1 hybrid spleen cells were used to stimulate A spleen cells in MLC, addition of irradiated MLC cells having cytotoxic activity toward C3H antigens abolished the response to both C3H and DBA/2 antigens. The response to DBA/2 antigens was much less affected when a mixture of irradiated C3H and DBA/2 spleen cells was used as stimulating cells. Thus, the presence of MLC cells having cytotoxic activity toward one alloantigen abolished the response to another non-cross-reacting antigen only when both antigens were present on the same F1 hybrid-stimulating cells. This suppression of generation of CTL by irradiated MLC cells apparently involves inactivation of alloantigen-bearing stimulating cells as a result of residual cytotoxic activity of the irradiated MLC cells. This mechanism may be active during the decline in CTL activity noted in the normal immune response in vivo and in vitro
Huy, Tran Quang; Hien Thanh, Nguyen Thi; Thuy, Nguyen Thanh; Chung, Pham Van; Hung, Pham Ngoc; Le, Anh-Tuan; Hong Hanh, Nguyen Thi
2017-03-01
Silver nanoparticles (AgNPs) have been proven to have noticeable cytotoxicity in vitro and antiviral activity against some types of enveloped viruses. This paper presents the cytotoxicity and antiviral activity of pure AgNPs synthesized by the electrochemical method, towards cell culture and poliovirus (a non-enveloped virus). Prepared AgNPs were characterized by ultraviolet-visible spectroscopy, energy-dispersive X-ray spectroscopy and transmission electron microscopy. Before incubation with poliovirus, different concentrations of AgNPs were added to human rhabdomyosarcoma (RD) cell monolayers seeded in 96 well plates for testing their cytotoxicity. The in vitro cytotoxicity and anti-poliovirus activity of AgNPs were daily assessed for cytopathic effect (CPE) through inverted light microscopy. CPE in the tested wells was determined in comparison with those in wells of negative and positive control. Structure analysis showed that AgNPs were formed with a quasi-spherical shape with mean size about 7.1nm and high purity. No CPE of RD cells was seen in wells at the time point of 48h post-incubation with AgNPs at concentration up to 100ppm. The anti-poliovirus activity of AgNPs was determined at 3.13ppm corresponding to the viral concentration of 1TCID 50 (Tissue Culture Infective Dose) after 30min, and 10TCID 50 after 60min, the cell viability was found up to 98% at 48h post-infection, with no CPE found. Whereas, a strong CPE of RD cells was found at 48h post-infection with the mixture of AgNPs and poliovirus at concentration of 100TCID 50 , and in wells of positive controls. With mentioned advantages, electrochemical-synthesized AgNPs are promising candidate for advanced biomedical and disinfection applications. Copyright © 2016 Elsevier B.V. All rights reserved.
In vitro Cytotoxic and Antioxidant Activity of Leaf Extracts of ...
African Journals Online (AJOL)
plant were tested for cytotoxicity against four cancer cells, viz, MCF-7 (oestrogen ... Results: The methanol extract showed the highest antioxidant activity (DPPH, half maximal inhibitory .... Total flavonoid content was determined using the.
Directory of Open Access Journals (Sweden)
Ana Paula Lorenzen Voytena
2018-03-01
Full Text Available Green Coffea arabica L. seed oil (GCO has been used as an active cosmetic ingredient in many skin care products, due to its composition and balance of fatty acids. On the other hand, while roasted coffee oil (RCO is mainly used for imparting aroma in the food industry, there is no data available to suggest its safety in cell-based model systems. In this context, the present study aims to evaluate the chemical composition of GCO, RCO, and their correspondent polar fractions (PFs; and assess their cytotoxicity and antioxidant potential in vitro. RCO and RCO PF exhibited significantly higher amounts of phenolic compounds, when compared to both GCO and GCO PF. In the DPPH assay, after 5 min of incubation, RCO inhibited about 80% of radicals, while GCO only achieved half of this activity. Similar results were also obtained for their PFs. Upon exposure to GCO, no cytotoxic effects were observed, in fact, there were slight increments in cell proliferation. Nevertheless, cell exposure to RCO led to significant decreases in cell viability. Increases in the concentration of coffee oil PFs were associated with correspondent relevant increased cytotoxicity. Upon hydrogen peroxide-induced oxidative stress, neither GCO nor RCO treatment were effective in protecting cells.
Yamamoto, Naoki; Kato, Yoshinao; Sato, Atsushi; Hiramatsu, Noriko; Yamashita, Hiromi; Ohkuma, Mahito; Miyachi, Ei-Ichi; Horiguchi, Masayuki; Hirano, Koji; Kojima, Hajime
2016-08-01
In vitro test methods that use human corneal epithelial cells to evaluate the eye irritation potency of chemical substances do not use human corneal epithelium because it has been difficult to maintain more than four passages. In this study, we make a new cell line comprising immortalized human corneal epithelial cells (iHCE-NY1). The IC50 of iHCE-NY1 cells is slightly higher than that of Statens Seruminstitut Rabbit Cornea (SIRC) cells, which are currently used in some in vitro test methods. CDKN1A in iHCE-NY1 cells was used as a marker of gene expression to indicate cell cycle activity. This enabled us to evaluate cell recovery characteristics at concentrations lower than the IC50 of cytotoxic tests.
Energy Technology Data Exchange (ETDEWEB)
Yang, Liu, E-mail: yqliu@lzu.edu.c [Lanzhou Jiaotong University (China). Environmental and Municipal Engineering School; Chun-Yan Zhaob; Ying-Qian Liu [Lanzhou University (China). School of Pharmacy
2011-07-01
A series of novel conjugates of camptothecin and 5-fluorouracil were first synthesized and their cytotoxic activities against two human tumor cell lines (SGC-7901 and A-549) as well as in vitro pharmacokinetic determination of lactone stability were studied. Among these compounds, most tested conjugates showed comparable or superior cytotoxic activities to 2, but less potent compared with 1. Particularly, conjugates 10b and 10d were highly active against A-549 with IC{sub 50} values of 0.45 and 0.38 {mu}mol L{sup -1}, respectively. Also, the in vitro pharmacokinetic determination of lactone levels of representative compound 10b showed that the biological life span of their lactone forms in human and mouse plasma significantly increased compared with their mother compound 1. Quantitative structure-activity relationship (QSAR) method was then applied for developing linear models to predict the cytotoxic activities of these derivatives that have not yet been synthesized or experimentally tested. In addition, molecular docking was used to clarify the binding mode of these derivatives to human DNA topoisomerase I. The important hydrogen-bonding interactions were observed between these derivatives and their receptor. The results from molecular modeling and QSAR study can guide the design of novel conjugates with higher antitumor activity. (author)
Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants
Alves, Celha Borges Costa; Segurado, Márcio Nunes; Dorta, Miriam Cristina Leandro; Dias, Fátima Ribeiro; Lenza, Maurício Guilherme; Lenza, Marcos Augusto
2016-01-01
ABSTRACT Objective: To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Methods: Six mini-implants (Conexão(tm), Neodent(tm) and SIN(tm)) were separately immersed in artificial saliva (pH 6.76) for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM). The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Conclusion: Orthodontic mini-implants manufactured by Conexão(tm), Neodent(tm) and SIN(tm) present high corrosion resistance and are not cytotoxic. PMID:27901227
Directory of Open Access Journals (Sweden)
Mejdoub Hafedh
2011-09-01
Full Text Available Abstract Background In order to validate its antiseptic and anticancer properties with respect to traditional uses, we have screened for the first time the antimicrobial activity of aerial parts of M. vulgare L. essential oil against different pathogenic microorganisms and the cytotoxic activity against HeLa cell lines. Methods The agar disk diffusion method was used to study the antibacterial activity of M. vulgare essential oil against 12 bacterial and 4 fungi strains. The disc diameters of zone of inhibition (DD, the minimum inhibitory concentrations (MIC and the concentration inhibiting 50% (IC50 were investigated to characterize the antimicrobial activities of this essential oil. The in vitro cytotoxicity of M. vulgare essential oil was examined using a modified MTT assay; the viability and the IC50 were used to evaluate this test. Results The antimicrobial activity of the essential oil was investigated in order to evaluate its efficacy against the different tested microorganisms. The present results results showed a significant activity against microorganisms especially Gram (+ bacteria with inhibition zones and minimal inhibitory concentration values in the range of 6.6-25.2 mm and 1120-2600 μg/ml, respectively, whereas Gram (- bacteria exhibited a higher resistance. As far as the antifungal activity, among four strains tested, Botrytis cinerea exhibited the strongest activity with inhibition zones of 12.6 mm. However, Fusarium solani, Penicillium digitatum and Aspergillus niger were less sensitive to M. vulgare essential oil. About the citotoxicity assay, this finding indicate the capability of this essential oil to inhibited the proliferation of HeLa cell lines under some conditions with IC50 value of 0.258 μg/ml. Conclusion This investigation showed that the M. vulgare essential oil has a potent antimicrobial activity against some Gram (+ pathogenic bacteria and Botrytis cinerea fungi. The present studies confirm the use of this
DEFF Research Database (Denmark)
Marker, O; Thomsen, Allan Randrup; Andersen, G T
1977-01-01
When spleen cells, which have been primed to Lymphocytic Choriomeningitis (LCM) virus during a primary infection several months previously, are stimulated in vitro with Con A. highly specific secondary cytotoxic effector cells are generated. The degree of cytotoxicity revealed by such Con A...
In vivo and in vitro Antimalarial Activity of Vernonia amygdalina ...
African Journals Online (AJOL)
omoregie
ABSTRACT. The in vitro antiplasmodial activity and cytotoxicity of extracts from Jatropha tanjorensis leaves ... an important role in the traditional methods of malaria treatment ... system consisted of TLC plates 10 × 10 cm silica gel. 60F254 .... Based on this classification, the three ... cost intervention during malaria infection.
Cytotoxic properties of a 4-nitroimidazole (NSC 38087): a radiosensitizer of hypoxic cells in vitro
International Nuclear Information System (INIS)
Stratford, I.J.; Williamson, C.; Hardy, C.
1981-01-01
5-Phenoxysulphonyl-1-methyl-4-nitroimidazole (NSC 38087) can act as a sensitizer of hypoxic mammalian cells to radiation in vitro. The degree of sensitization achieved is greater than would be predicted from the drug's electron affinity. Cytotoxicity studies have shown that 5sub(μM) NSC 38087 can reduce the surviving fraction of log-phase V79 cells in air at 37 0 C to 10 -2 after 2 h exposure. This toxicity is considerably increased by small rises in temperature. In contrast to other nitroheterocyclic radiosensitizers, NSC 38087 and related 5-substituted 4-nitroimidazoles show greater toxicity towards aerobic than to hypoxic cells. Log-phase cells show the highest sensitivity to the toxic action of NSC 38087, with plateau-phase cells, cells with a history of chronic hypoxia, and thermotolerant cells showing greater resistance. These toxicity data are compared to those for the 2-nitroimidazole hypoxic-cell sensitizer misonidazole. (author)
An in vitro cytotoxicity assessment of graphene nanosheets on alveolar cells
Dervin, Saoirse; Murphy, James; Aviles, Ruth; Pillai, Suresh C.; Garvey, Mary
2018-03-01
The collection of intrinsic properties possessed by graphene family nanomaterials (GFNs) results in their continuous exploitation for biomedical applications. The materials biomedical potential has motivated an upsurge in green preparation routes for the production of graphene like materials with limited toxicity. A number of bio-friendly reducing agents have been utilized for the preparation of chemically reduced graphene oxide (GO), and their resulting cytotoxic effects examined. However, the toxicology effects of one of the first biomolecules implemented for the reduction of GO, ascorbic acid (AA) has yet to be investigated. Herein, the toxicity of three distinct GFNs; GO, hydrazine reduced GO (H.rGO) and AA.rGO, prepared through diverse chemical routes are studied, to demonstrate the cytotoxic activity of a green reducer, in comparison to an established reduction method using hydrazine hydrate. The variation in atomic structure of GO, H.rGO and AA.rGO resulting from different synthesis techniques demonstrates the dependence of toxicity on particle shape and size. All GFNs induced high levels of alveolar cell toxicity. Interaction of AA.rGO with the A549 human lung epithelial carcinoma cell line resulted in increased leakage of lactate dehydrogenase, indicative of diminished cell membrane integrity. The uncharacteristic shape of the AA.rGO may be responsible for this proliferated release of the essential protein. The presented data therefore demonstrates that modification of synthetic processes significantly alter the biological activities of GFNs.
Directory of Open Access Journals (Sweden)
Hülya Karaca Gençer
2017-03-01
Full Text Available Owing to the growing need for antifungal agents, we synthesized a new series 2-((5-(4-(5-substituted-1H-benzimidazol-2-ylphenyl-4-substituted-4H-1,2,4-triazol-3-ylthio-1-(substitutedphenylethan-1-one derivatives, which were tested against Candida species. The synthesized compounds were characterized and elucidated by FT-IR, 1H-NMR, 13C-NMR and HR-MS spectroscopies. The synthesized compounds were screened in vitro anticandidal activity against Candida species by broth microdiluation methods. In vitro cytotoxic effects of the final compounds were determined by MTT assay. Microbiological studies revealed that compounds 5m, 5o, 5r, 5t, 5y, 5ab, and 5ad possess a good antifungal profile. Compounds 5w was the most active derivative and showed comparable antifungal activity to those of reference drugs ketoconazole and fluconazole. Cytotoxicity evaluation of compounds 5m, 5o, 5r, 5w, 5y, 5ab and 5ad showed that compounds 5w and 5ad were the least cytotoxic agents. Effects of these two compounds against ergosterol biosynthesis were observed by LC-MS-MS method, which is based on quantification of ergosterol level in C. albicans. Compounds 5w and 5d inhibited ergosterol biosynthesis concentration dependently. A fluorescence microscopy study was performed to visualize effect of compound 5w against C. albicans at cellular level. It was determined that compound 5w has a membrane damaging effect, which may be related with inhibition of biosynthesis of ergosterol.
Comparison of mammalian and fish cell line cytotoxicity: impact of endpoint and exposure duration
International Nuclear Information System (INIS)
Guelden, Michael; Moerchel, Sabine; Seibert, Hasso
2005-01-01
Comparisons of acute toxic concentrations of chemicals to fish in vivo and cytotoxic concentrations to fish cell lines in vitro reveal rather good correlations of the toxic potencies in vitro and in vivo, but a clearly lower sensitivity of the fish cells. To examine whether the low sensitivity is specific for fish cells, cytotoxic potencies of reference chemicals from the Multicenter Evaluation of In Vitro Cytotoxicity program (MEIC) reported for the fish cell lines R1 and RTG-2 were compared with those obtained with the mouse Balb/c 3T3 cell line. Cytotoxic potencies (EC 50 values) for MEIC reference chemicals were determined with exponentially growing Balb/c 3T3 cells using three different test protocols. To assess both endpoints, cell proliferation and cell survival, EC 50 values were measured for the decrease in final cell protein after 24 and 72 h of exposure and for the reduction of cell protein increase during 24 h of exposure. EC 50 values obtained with the fish cell lines R1 and RTG-2 using cell survival as endpoint were taken from the MEIC data base. The comparison of cytotoxic potencies shows that, in general, the fish cell lines and the mammalian cell line are almost equally sensitive towards the cytotoxic action of chemicals. The mammalian cell line assay, however, becomes considerably more sensitive, by factors of 3.4-8.5, than the fish cell line assays, if cell growth instead of cell survival is used as endpoint. It is concluded, that cell proliferation might be a better endpoint than cell survival and that mammalian cell lines might be suited to assess fish acute toxicity
Directory of Open Access Journals (Sweden)
Aurea Silveira Cruz
1998-04-01
Full Text Available OBJETIVO: Comparar a sensibilidade do método de difusão em ágar e do método de extração utilizando as linhagens celulares RC-IAL (células fibroblásticas de rim de coelho e HeLa (células epiteliais de carcinoma do colo do útero humano, na avaliação da citotoxicidade "in vitro" de materiais de uso médico-hospitalar. MATERIAL E MÉTODO: Foram testadas 50 amostras escolhidas por sorteio, entre as já conhecidamente positivas e negativas e identificadas como: algodão, espuma, borracha, látex, celulose e acrílico. Além, das amostras citadas foram testadas experimentalmente várias concentrações de SDS (duodecil sulfato de sódio nas culturas celulares RC-IAL e HeLa. RESULTADOS: Das 50 amostras testadas , 44 (88% foram positivas para os dois métodos. Mas quando comparado o SDS nos dois métodos foram observados resultados positivos nas concentrações de 0,5 a 0,05 µg/ml no método de difusão em ágar e no método de extração somente foi observado efeito citotóxico até a concentração de 0,25 µg/ml. CONCLUSÃO: Os resultados encontrados são similares aos observados por outros autores que testaram materiais como, por exemplo, ligas metálicas. Quando foi usado o SDS observou-se, nas duas linhagens celulares, diferenças favoráveis ao método de difusão em ágar em duas concentrações, isto é, a sensibilidade deste método foi significantemente maior, por inspecção, em relação ao método de extração, além de se constituir em método mais simples de ser realizado.OBJECTIVE: A comparison of the sensitivity of the agar diffusion method with that of extraction using cell-lines RC-IAL (fibroblastic of rabbit kidney and HeLa (epithelial carcionoma cells from the cervix uteri of the humam uterus, in the in vitro evaluation of materials of medical and hospital. MATERIAL AND METHODS: Fifteen samples chosen at random, from among the already known positives and negatives in our stock, were tested and identified as cotton
Chlorpromazine inhibits tumour necrosis factor synthesis and cytotoxicity in vitro.
Zinetti, M; Galli, G; Demitri, M T; Fantuzzi, G; Minto, M; Ghezzi, P; Alzani, R; Cozzi, E; Fratelli, M
1995-11-01
Chlorpromazine (CPZ) has been previously shown to protect against endotoxin [lipopolysaccharide (LPS)] lethality and inhibit the release of tumour necrosis factor in vivo. We investigated at the cellular level whether this was due to direct inhibition of tumour necrosis factor-alpha (TNF-alpha) synthesis, using LPS-stimulated THP-1 human monocytic leukemia cells. We also studied the effect of CPZ on human TNF-alpha action by assessing TNF-alpha cytotoxicity on mouse fibrosarcoma L929 cells. CPZ (1-100 microM) inhibited TNF-alpha production in THP-1 cells in a dose dependent manner by a maximum of 80%. This effect was comparable to that of two well-known inhibitory drugs, dexamethasone and cyclicAMP. Inhibition was also evident at the mRNA level. On the other hand CPZ (10-25 microM) also inhibited TNF-alpha activity: in fact it reduced the cytotoxicity of TNF-alpha on L929 cells (EC50 was increased four times) and could provide protection even as a post-treatment. CPZ inhibited TNF-induced apoptosis in L929 cells, as detected by analysis of nuclear morphology. However, since we showed that apoptosis was very limited, and was not the main mode of cell death in our conditions, this could not explain the overall protection. Since CPZ did not interfere with either the oligomerization state of TNF-alpha or its receptor binding, our data suggest that it reduced cytotoxicity by inhibiting some steps in the TNF-alpha signalling pathways.
Directory of Open Access Journals (Sweden)
Mohagheghi MA
2009-09-01
Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: 4-Aryl-4H-chromenes are novel anticancer agents which induce apoptosis in cancer cells. These compounds were found to induce apoptosis by targeting the tubulin/microtubule system in cell proliferation process. The aim of this study was to report cyototoxic and apoptosis inducing activities of a new series of synthesized 4-aryl-4H-chromenes compounds."n"n Methods: The in vitro cytotoxic activity of the synthesized 4-aryl-4H-chromenes was investigated against a paned of human cancer cell lines including MCF-7 (breast carcinoma, A549 (lung carcinoma, HEPG-2 (liver carcinoma, SW-480 (colon adenocarcinoma, U87-MG (glioblastoma, 1321N1 (astrocytoma, and DAOY (medulloblastoma. The percentage of growth inhibitory activity was evaluated using MTT colorimetric assay versus controls not treated with test derivatives. The data for etoposide, a well known anticancer drug, was included for comparison. For each compound, the 50% inhibitory concentration (IC50 were determined. Apoptosis inducing activity were assessed by DAPI staining."n"n Results: Preliminary screening showed that those chromenes analogs bearing phenyl-isoxazole-3-yl substitution or the derivatives containing methoxyphenyl in chromene ring exhibited
IN VITRO CYTOTOXICITY OF BTEX METABOLITES IN HELA CELL LINES
Fuel leakage from underground storage tanks is a major source of groundwater contamination. Although the toxicity of regulated compounds such as benzene, toluene, ethylbenzene, and xylene (BTEX) are well recognized, the cytotoxicity of their metabolites has not been studied exte...
Directory of Open Access Journals (Sweden)
Yan Zhao
Full Text Available Mitochondrial functions are crucial for pancreatic β-cell survival and glucose-induced insulin secretion. Hexarelin (Hex is a synthetic small peptide ghrelin analogue, which has been shown to protect cardiomyocytes from the ischemia-reperfusion process. In this study, we used in vitro and in vivo models of streptozotocin (STZ-induced β-cell damage to study the protective effect of Hex and the associated mechanisms. We found that STZ produced a cytotoxic effect in a dose- and time-dependent manner in MIN6 cells (a mouse β-cell line. Hex (1.0 μM decreased the STZ-induced damage in β-cells. Rhodamine 123 assay and superoxide DHE production assay revealed that Hex ameliorated STZ-induced mitochondrial damage and excessive superoxide activity in β-cells. In addition, Hex significantly reduced STZ-induced expression of cleaved Caspases-3, Caspases-9 and the ratio of pro-apoptotic protein Bax to anti-apoptotic protein Bcl-2 in MIN6 cells. We further examined the in vivo effect of Hex in a rat model of type 1 diabetes induced by STZ injection. Hex ameliorated STZ-induced decrease in plasma insulin and protected the structure of islets from STZ-induced disruption. Hex also ameliorated STZ-induced expression of cleaved Caspase-9 and the Bax in β-cells. In conclusion, our data indicate that Hex is able to protects β-cell mass from STZ-caused cytotoxic effects involving mitochondrial pathways in vitro and in vivo. Hex may serve as a potential protective agent for the management of diabetes.
CYTOTOXICITY AND MUTAGENESIS METHODS FOR EVALUATING TOXICITY REMOVAL FROM WASTEWATERS
This project was a feasibility study of the effectiveness of a mammalian cell cytotoxicity assay and a mammalian cell mutagenesis assay for monitoring the toxicity and mutagenicity of influent and effluent wastewater at treatment plants. In the cytotoxicity assay, ambient samples...
Bioassay-guided studies on the cytotoxic and in vitro trypanocidal ...
African Journals Online (AJOL)
This paper reports a bioassay-guided study to search for possible biological activity (cytotoxic and trypanocidal) in two Ugandan medicinal plants. The methodology adopted was the so-called ping-pong approach, involving phytochemical purification (column chromatography and preparative thin layer chromatography), ...
Antitumor effect of Ganoderma lucidum : Cytotoxicity and Tumor Growth Delay(1)
Energy Technology Data Exchange (ETDEWEB)
Kwon, Hyoung Cheol; Kim, Jung Soo [Chonbuk National University College of Medicine, Chonju (Korea, Republic of); Choi, Dong Seong [Chonju Woosuck Univ., Chonju (Korea, Republic of); Song, Chang Won [Univ. of Minnesota Medical School, Minneapolis (United States)
1994-10-15
Purpose: To investigate the effect of aqueous extract of Ganoderma lucidum(G.I.) on the survival of tumor cells in vitro and on the growth of tumors in vivo. Materials and Methods: Dried G.I. was made into powder, extracted with distilled water, filtered and diluted from a maximum concentration of 100 mg/ml in sequence. The cytotoxicity of G.O. in vitro was evaluated from its ability to reduce the clonogenicity of SCK tumor cells. For the tumor growth delay study, about 2x10{sup 5} of SCK tumor cells were subcutaneously inoculated in the legs of A/J mice. The first experimental group of mice were injected i.p. with 0.2ml of 250 mg/kg of G/I. From the first day after tumor inoculation for 10 days. The second experimental group of mice were injected i.p. with 0.2ml of 250 mg/kg of G.I. either once a day for 10 days or twice a day for 5 days beginning from the 7th day after tumor inoculation. Results: 1. Cytotoxicity in vitro; survival fraction, as judged from the curve, at G.I. concentration of 0.5, 1,5,10,25,50 and 100 mg/ml were 1.0, 0.74{+-}0.03, 0.18{+-}0.03, 0.15{+-}0.02, 0.006{+-}0.002, 0.015 and 0.0015, respectively. 2. Tumor growth delay in vivo; a) the time required for the mean tumor volume to grow to 1,000mm{sup 3} was 11 days in the control group and 14 days in the experimental group. b) the time required for tumor volume to increase 4 times was 11 days in the control group while it was 10.5 and 12 days in the groups injected with G.I. once a day and twice a day from the 7th day after tumor inoculation respectively. Conclusion: Aqueous extracts of G.I. showed a marked cytotoxicity on the SCK mammary cells in vitro. Tumor growth delay was statistically significant when G.I. injection was started soon after tumor inoculation, but it was not significant when injection was started after the tumors were firmly established.
Antitumor effect of Ganoderma lucidum : Cytotoxicity and Tumor Growth Delay(1)
International Nuclear Information System (INIS)
Kwon, Hyoung Cheol; Kim, Jung Soo; Choi, Dong Seong; Song, Chang Won
1994-01-01
Purpose: To investigate the effect of aqueous extract of Ganoderma lucidum(G.I.) on the survival of tumor cells in vitro and on the growth of tumors in vivo. Materials and Methods: Dried G.I. was made into powder, extracted with distilled water, filtered and diluted from a maximum concentration of 100 mg/ml in sequence. The cytotoxicity of G.O. in vitro was evaluated from its ability to reduce the clonogenicity of SCK tumor cells. For the tumor growth delay study, about 2x10 5 of SCK tumor cells were subcutaneously inoculated in the legs of A/J mice. The first experimental group of mice were injected i.p. with 0.2ml of 250 mg/kg of G/I. From the first day after tumor inoculation for 10 days. The second experimental group of mice were injected i.p. with 0.2ml of 250 mg/kg of G.I. either once a day for 10 days or twice a day for 5 days beginning from the 7th day after tumor inoculation. Results: 1. Cytotoxicity in vitro; survival fraction, as judged from the curve, at G.I. concentration of 0.5, 1,5,10,25,50 and 100 mg/ml were 1.0, 0.74±0.03, 0.18±0.03, 0.15±0.02, 0.006±0.002, 0.015 and 0.0015, respectively. 2. Tumor growth delay in vivo; a) the time required for the mean tumor volume to grow to 1,000mm 3 was 11 days in the control group and 14 days in the experimental group. b) the time required for tumor volume to increase 4 times was 11 days in the control group while it was 10.5 and 12 days in the groups injected with G.I. once a day and twice a day from the 7th day after tumor inoculation respectively. Conclusion: Aqueous extracts of G.I. showed a marked cytotoxicity on the SCK mammary cells in vitro. Tumor growth delay was statistically significant when G.I. injection was started soon after tumor inoculation, but it was not significant when injection was started after the tumors were firmly established
Directory of Open Access Journals (Sweden)
Ali Niaz
2011-11-01
Full Text Available Abstract Background Saponins isolated from plant sources have a number of traditional and industrial applications. Saponins have pharmacological effects like anti-inflammatory, molluscicidal, antimicrobial, antispasmodic, antidiabetic, anticancer, anticonvulsant, anthelmintic, antitussive and cytotoxic activities. The current work describes the anthelmintic and cytotoxic activities of crude saponins of Achillea Wilhelmsii and Teucrium Stocksianum as these plants are rich with saponins. Methods Brine shrimp cytotoxic activity of crude saponins was determined by Meyer et al. (1982 at test concentrations of 1000 μg/ml, 100 μg/ml, 10 μg/ml, 7.5 μg/ml, 5.0 μg/ml, 2.5 μg/ml and 1.25 μg/ml. Percentage mortality of test concentrations was determined. Similarly, in vitro anthelmintic activity was determined against roundworms, tapeworms and earthworms. Albendazole and piperazine citrate at concentration 10 mg/ml were used as standard anthelmintic drugs. Results Crude saponins of Achillea wilhelmsii (CSA and Teucrium stocksianum (CST had, respectively, cytotoxic activity with LC50 values 2.3 ± 0.16 and 5.23 ± 0. 34 μg/ml. For in vitro anthelmintic activity, time for paralysis and death of parasites (parasiticidal activity was noted. At concentration 40 mg/ml, crude saponins of Achillea wilhelmsii are 1.96 and 2.12 times more potent than albendazole against Pheretima posthuma and Raillietina spiralis, respectively. Similarly, at concentration 40 mg/ml, crude saponins of Teucrium stocksianum (CST has 1.89, 1.96 and 1.37 times more parasiticidal activity than albendazole against Pheretima posthuma, Raillietina spiralis and Ascardia galli, respectively. Conclusion Crude saponins of Achillea wilhelmsii and Teucrium stocksianum have cytotoxic and anthelmintic activity. The crude saponins may be excellent sources of cytotoxic and anthelmintic constituents that warrant its isolation and purification for new drug development.
International Nuclear Information System (INIS)
Song, Yijuan; Guan, Rongfa; Lyu, Fei; Kang, Tianshu; Wu, Yihang; Chen, Xiaoqiang
2014-01-01
Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD 50 of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials than
Energy Technology Data Exchange (ETDEWEB)
Song, Yijuan [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Guan, Rongfa, E-mail: rongfaguan@163.com [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Lyu, Fei [Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310014 (China); Kang, Tianshu; Wu, Yihang [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Chen, Xiaoqiang [Hubei University of Technology, Wuhan 430068 (China)
2014-11-15
Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD{sub 50} of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials
The fluorometric microculture cytotoxicity assay.
Lindhagen, Elin; Nygren, Peter; Larsson, Rolf
2008-01-01
The fluorometric microculture cytotoxicity assay (FMCA) is a nonclonogenic microplate-based cell viability assay used for measurement of the cytotoxic and/or cytostatic effect of different compounds in vitro. The assay is based on hydrolysis of the probe, fluorescein diacetate (FDA) by esterases in cells with intact plasma membranes. The assay is available as both a semiautomated 96-well plate setup and a 384-well plate version fully adaptable to robotics. Experimental plates are prepared with a small amount of drug solution and can be stored frozen. Cells are seeded on the plates and cell viability is evaluated after 72 h. The protocol described here is applicable both for cell lines and freshly prepared tumor cells from patients and is suitable both for screening in drug development and as a basis for a predictive test for individualization of anticancer drug therapy.
Enhanced cytotoxicity of anticancer drug delivered by novel nanoscale polymeric carrier
Stoika, R.; Boiko, N.; Senkiv, Y.; Shlyakhtina, Y.; Panchuk, R.; Finiuk, N.; Filyak, Y.; Bilyy, R.; Kit, Y.; Skorohyd, N.; Klyuchivska, O.; Zaichenko, A.; Mitina, N.; Ryabceva, A.
2013-04-01
We compared in vitro action of highly toxic anticancer drug doxorubicin under its delivery to the mammalian tumor cells in free form and after encapsulation in novel bio-functionalized nanoscale polymeric carrier. Such encapsulation was found to enhance significantly drug uptake by the targeted cells, as well as its cytotoxic action. 10 times higher cytotoxicity of the carrier-immobilized doxorubicin comparing to its free form was demonstrated by direct cell counting, and 5 times higher cytotoxicity of encapsulated doxorubicin was shown by FACS analysis. The polymeric carrier itself did not possess significant toxicity in vitro or in vivo (laboratory mice). The carrier protected against negative side effects of doxorubicin in mice with experimental NK/Ly lymphoma. The life duration of tumor-bearing animals treated with doxorubicin-carrier complex was significantly longer than life duration in animals treated with free doxorubicin. Besides, the effective treatment dose of the carrier-delivered doxorubicin in tumor-bearing mice was 10 times lower than such dose of free doxorubicin. Thus, novel nanoscale polymers possess high potential as drug carrier.
Enhanced cytotoxicity of anticancer drug delivered by novel nanoscale polymeric carrier
International Nuclear Information System (INIS)
Stoika, R; Boiko, N; Panchuk, R; Filyak, Y; Senkiv, Y; Finiuk, N; Shlyakhtina, Y; Bilyy, R; Kit, Y; Skorohyd, N; Klyuchivska, O; Zaichenko, A; Mitina, N; Ryabceva, A
2013-01-01
We compared in vitro action of highly toxic anticancer drug doxorubicin under its delivery to the mammalian tumor cells in free form and after encapsulation in novel bio-functionalized nanoscale polymeric carrier. Such encapsulation was found to enhance significantly drug uptake by the targeted cells, as well as its cytotoxic action. 10 times higher cytotoxicity of the carrier-immobilized doxorubicin comparing to its free form was demonstrated by direct cell counting, and 5 times higher cytotoxicity of encapsulated doxorubicin was shown by FACS analysis. The polymeric carrier itself did not possess significant toxicity in vitro or in vivo (laboratory mice). The carrier protected against negative side effects of doxorubicin in mice with experimental NK/Ly lymphoma. The life duration of tumor-bearing animals treated with doxorubicin-carrier complex was significantly longer than life duration in animals treated with free doxorubicin. Besides, the effective treatment dose of the carrier-delivered doxorubicin in tumor-bearing mice was 10 times lower than such dose of free doxorubicin. Thus, novel nanoscale polymers possess high potential as drug carrier.
The harmonized INFOGEST in vitro digestion method
Egger, Lotti; Ménard, Olivia; Delgado-Andrade, Cristina; Alvito, Paula; Assunção, Ricardo; Balance, Simon; Barberá, Reyes; Brodkorb, Andre; Cattenoz, Thomas; Clemente, Alfonso; Comi, Irene; Dupont, Didier; Garcia-Llatas, Guadalupe; Lagarda, María Jesús; Feunteun, Le Steven; Janssen Duijghuijsen, Lonneke; Karakaya, Sibel; Lesmes, Uri; Mackie, Alan R.; Martins, Carla; Meynier, Anne; Miralles, Beatriz; Murray, B.S.; Pihlanto, Anne; Picariello, Gianluca; Santos, C.N.; Simsek, Sebnem; Recio, Isidra; Rigby, Neil; Rioux, Laurie Eve; Stoffers, Helena; Tavares, Ana; Tavares, Lucelia; Turgeon, Sylvie; Ulleberg, E.K.; Vegarud, G.E.; Vergères, Guy; Portmann, Reto
2016-01-01
Within the active field of in vitro digestion in food research, the COST Action INFOGEST aimed to harmonize in vitro protocols simulating human digestion on the basis of physiologically inferred conditions. A harmonized static in vitro digestion (IVD) method was recently published as a primary
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Mulcahy, R. T.; Dembs, N. L.; Ublacker, G. A.
1984-01-01
We have investigated the relationships between nitrosourea structure and physicochemical properties and the ability of misonidazole (MISO) to potentiate nitrosourea cytotoxicity in an in vitro model system. EMT-6/Ro tumour cells were exposed in suspension to each of 9 different nitrosourea anti-tumour drugs under hypoxic and aerobic culture conditions. Additional cultures were similarly treated with nitrosoureas in the presence of 1.0 mM MISO. Seven of the 9 nitrosoureas did not demonstrate any selective toxicity toward aerobic or hypoxic cells. In contrast, chlorozotocin (CHLZ) was slightly more toxic toward hypoxic cells while Bis-OH CyNU more effectively killed aerobic cells. The addition of MISO to the drug treatment enhanced the effectiveness of all the nitrosoureas under hypoxic conditions, with the exception of CHLZ which was uninfluenced by MISO. The magnitude of the MISO dose enhancement factor (DEF, defined as the ratio of drug doses required to reduce cell survival to S = 10(-3) in 4 hours in the absence and presence of 1.0 mM MISO) for each combination was examined as a function of the relative carbamoylating or alkylating activity of the nitrosourea included in that combination. Such an analysis revealed a significant (P less than 0.05) positive correlation between relative carbamoylating potency and DEF. No significant (P greater than 0.20) relationship could be established for DEF and alkylating activity. PMID:6704305
Tripathi, Garima; Gough, Julie E; Dinda, Amit; Basu, Bikramjit
2013-06-01
The aim of this study was to investigate the in vivo biocompatibility in terms of healing of long segmental bone defect in rabbit model as well as in vitro cytotoxicity of eluates of compression-molded High density polyethylene (HDPE)-hydroxyapatite (HA)-aluminum oxide (Al2O3) composite-based implant material. Based on the physical property in terms of modulus and strength properties, as reported in our recent publication, HDPE-40 wt % HA and HDPE-20 wt % HA-20 wt % Al2O3 hybrid composites were used for biocompatibility assessment. Osteoblasts cells were cultured in conditioned media, which contains varying amount of composite eluate (0.01, 0.1, and 1.0 wt %). In vitro, the eluates did not exhibit any significant negative impact on proliferation, mineralization or on morphology of human osteoblast cells. In vivo, the histological assessment revealed neobone formation at the bone/implant interface, characterized by the presence of osteoid and osteoblasts. The observation of osteoclastic activity indicates the process of bone remodeling. No inflammation to any noticeable extent was observed at the implantation site. Overall, the combination of in vitro and in vivo results are suggestive of potential biomedical application of compression-molded HDPE- 20 wt % HA- 20 wt % Al2O3 composites to heal long segmental bone defects without causing any toxicity of bone cells. Copyright © 2012 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Shakir, Mohammad; Faraz, Mohd; Sherwani, Mohd Asif; Al-Resayes, Saud I.
2016-01-01
The doping of semiconductor by rare earth metals nanoparticles is an effective way for increasing photocatalytic activity. Zinc oxide and Lanthanum doped Zinc oxide nanoparticles were synthesized by modifying the gel-combustion method. It was found that La can greatly enhance the cytotoxicity and photocatalytic activity of ZnO nanoparticles towards various cell lines and Paracetamol drug. These nanoparticles were characterized by various spectroscopic and other techniques which clearly revealed the presence of lanthanum ions. The absorption edge shifts towards the visible region after doping with La ions. This shift shows that the doping of La ions is favorable for absorbing the visible light. The comparative photocatalytic and cytotoxicity activity revealed that La doped ZnO nanoparticles remarkably enhanced activities as compared to the ZnO nanoparticles. The outcome of these studies offers valuable for planning La doped ZnO nanoparticles having cytotoxicity and photocatalytic activities helpful for the formulation of anticancer product and waste water remediation.
Energy Technology Data Exchange (ETDEWEB)
Shakir, Mohammad, E-mail: shakir078@yahoo.com [Department of Chemistry, Aligarh Muslim University, Aligarh 202002 (India); Faraz, Mohd [Department of Chemistry, Aligarh Muslim University, Aligarh 202002 (India); Sherwani, Mohd Asif [Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh 202002 (India); Al-Resayes, Saud I. [Department of Chemistry, College of Science, King Saud University, Riyadh 11451 (Saudi Arabia)
2016-08-15
The doping of semiconductor by rare earth metals nanoparticles is an effective way for increasing photocatalytic activity. Zinc oxide and Lanthanum doped Zinc oxide nanoparticles were synthesized by modifying the gel-combustion method. It was found that La can greatly enhance the cytotoxicity and photocatalytic activity of ZnO nanoparticles towards various cell lines and Paracetamol drug. These nanoparticles were characterized by various spectroscopic and other techniques which clearly revealed the presence of lanthanum ions. The absorption edge shifts towards the visible region after doping with La ions. This shift shows that the doping of La ions is favorable for absorbing the visible light. The comparative photocatalytic and cytotoxicity activity revealed that La doped ZnO nanoparticles remarkably enhanced activities as compared to the ZnO nanoparticles. The outcome of these studies offers valuable for planning La doped ZnO nanoparticles having cytotoxicity and photocatalytic activities helpful for the formulation of anticancer product and waste water remediation.
Suppression of cytotoxic T lymphocytes by carrageenan-activated macrophage-like cells
International Nuclear Information System (INIS)
Yung, Y.P.; Cudkowicz, G.
1978-01-01
In the presence of 100 μg/ml of carrageenans (CAR), B6D2F 1 responder spleen cells failed to generate antiparent or anti-allogeneic cytotoxic T lymphocytes in vitro, but instead generated suppressor cells. Cultured CAR-treated cells added to mixtures of B6D2F 1 anti-B6 or B6D2F 1 anti-C3H cytotoxic effectors (induced in vitro) and the appropriate 51 Cr-labeled lymphoma targets reduced or abolished cytolysis (measured as 51 Cr release) depending on the ratio of suppressor to effector cells. Cultured spleen cells not exposed to CAR failed to inhibit both types of cytotoxicity. Presuppressor cells were associated with a splenic subpopulation independent of the thymus (i.e., present in spleens of athymic nude mice), were moderately adherent to Sephadex G-10 columns, but were not phagocytic or ''sticky'' to carbonyl iron particles. Activation of such cells by CAR was not prevented by in vitro exposure to 2000 rads of γ-rays before culture, nor facilitated by antigenic stimulation. The matured suppressor cells remained radioresistant and became strongly adherent to Sephadex G-10. The suppressors lacked surface Thy-1 alloantigen detectable by antibody and rabbit complement. Suppressor cell activity was not restricted by the immunologic specificity and major histocompatibility type of effectors
Cytotoxicity of Pd nanostructures supported on PEN: Influence of sterilization on Pd/PEN interface
Energy Technology Data Exchange (ETDEWEB)
Polívková, M., E-mail: polivkoa@vscht.cz [Department of Solid State Engineering, University of Chemistry and Technology Prague, 166 28 Prague (Czech Republic); Siegel, J. [Department of Solid State Engineering, University of Chemistry and Technology Prague, 166 28 Prague (Czech Republic); Rimpelová, S. [Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, 166 28 Prague (Czech Republic); Hubáček, T. [Institute of Hydrobiology, Biology Centre of the AS CR, 370 05 Ceske Budejovice (Czech Republic); Kolská, Z. [Materials Centre of Usti n. L., J.E. Purkyne University, 400 96 Usti nad Labem (Czech Republic); Švorčík, V. [Department of Solid State Engineering, University of Chemistry and Technology Prague, 166 28 Prague (Czech Republic)
2017-01-01
Non-conventional antimicrobial agents, such as palladium nanostructures, have been increasingly used in the medicinal technology. However, experiences uncovering their harmful and damaging effects to human health have begun to appear. In this study, we have focused on in vitro cytotoxicity assessment of Pd nanostructures supported on a biocompatible polymer. Pd nanolayers of variable thicknesses (ranging from 1.1 to 22.4 nm) were sputtered on polyethylene naphthalate (PEN). These nanolayers were transformed by low-temperature post-deposition annealing into discrete nanoislands. Samples were characterized by AFM, XPS, ICP-MS and electrokinetic analysis before and after annealing. Sterilization of samples prior to cytotoxicity testing was done by UV irradiation, autoclave and/or ethanol. Among the listed sterilization techniques, we have chosen the gentlest one which had minimal impact on sample morphology, Pd dissolution and overall Pd/PEN interface quality. Cytotoxic response of Pd nanostructures was determined by WST-1 cell viability assay in vitro using three model cell lines: mouse macrophages (RAW 264.7) and two types of mouse embryonic fibroblasts (L929 and NIH 3T3). Finally, cell morphology in response to Pd/PEN was evaluated by means of fluorescence microscopy. - Highlights: • Annealing of Pd nanolayers on PEN resulted to Pd aggregation and formation of discrete nanoislands. • UV treatment was found as the gentlest sterilization method in term of physicochemical properties of Pd/PEN interface. • Autoclaving and chemical sterilization by ethanol resulted into remarkable changes of Pd/PEN interface. • Cytotoxicity of Pd samples was insignificant. • Pd nanostructures are potentially applicable as health-unobjectionable antibacterial coatings of medical devices.
Directory of Open Access Journals (Sweden)
L.C. Silva-Pereira
2005-06-01
Full Text Available Mercury is a xenobiotic metal that is a highly deleterious environmental pollutant. The biotransformation of mercury chloride (HgCl2 into methylmercury chloride (CH3HgCl in aquatic environments is well-known and humans are exposed by consumption of contaminated fish, shellfish and algae. The objective of the present study was to determine the changes induced in vitro by two mercury compounds (HgCl2 and CH3HgCl in cultured human lymphocytes. Short-term human leukocyte cultures from 10 healthy donors (5 females and 5 males were set-up by adding drops of whole blood in complete medium. Cultures were separately and simultaneously treated with low doses (0.1 to 1000 µg/l of HgCl2 and CH3HgCl and incubated at 37ºC for 48 h. Genotoxicity was assessed by chromosome aberrations and polyploid cells. Mitotic index was used as a measure of cytotoxicity. A significant increase (P < 0.05 in the relative frequency of chromosome aberrations was observed for all concentrations of CH3HgCl when compared to control, whether alone or in an evident sinergistic combination with HgCl2. The frequency of polyploid cells was also significantly increased (P < 0.05 when compared to control after exposure to all concentrations of CH3HgCl alone or in combination with HgCl2. CH3HgCl significantly decreased (P < 0.05 the mitotic index at 100 and 1000 µg/l alone, and at 1, 10, 100, and 1000 µg/l when combined with HgCl2, showing a synergistic cytotoxic effect. Our data showed that low concentrations of CH3HgCl might be cytotoxic/genotoxic. Such effects may indicate early cellular changes with possible biological consequences and should be considered in the preliminary evaluation of the risks of populations exposed in vivo to low doses of mercury.
Large-scale validation of methods for cytotoxic T-lymphocyte epitope prediction
DEFF Research Database (Denmark)
Larsen, Mette Voldby; Lundegaard, Claus; Lamberth, K.
2007-01-01
BACKGROUND: Reliable predictions of Cytotoxic T lymphocyte (CTL) epitopes are essential for rational vaccine design. Most importantly, they can minimize the experimental effort needed to identify epitopes. NetCTL is a web-based tool designed for predicting human CTL epitopes in any given protein....... of the other methods achieved a sensitivity of 0.64. The NetCTL-1.2 method is available at http://www.cbs.dtu.dk/services/NetCTL.All used datasets are available at http://www.cbs.dtu.dk/suppl/immunology/CTL-1.2.php....
Bortezomib interactions with chemotherapy agents in acute leukemia in vitro.
Horton, Terzah M; Gannavarapu, Anurhadha; Blaney, Susan M; D'Argenio, David Z; Plon, Sharon E; Berg, Stacey L
2006-07-01
Although there is effective chemotherapy for many patients with leukemia, 20% of children and up to 65% of adults relapse. Novel therapies are needed to treat these patients. Leukemia cells are very sensitive to the proteasome inhibitor bortezomib (VELCADE(R), PS-341), which enhances the in vitro cytotoxic effects of dexamethasone and doxorubicin in multiple myeloma. To determine if bortezomib enhances the cytotoxicity of agents used in leukemia, we employed an in vitro tetrazolium-based colorimetric assay (MTT) to evaluate the cytotoxic effects of bortezomib alone and in combination with dexamethasone, vincristine, doxorubicin, cytarabine, asparaginase, geldanamycin, trichostatin A, and the bcl-2 inhibitor HA14.1. We demonstrated that primary leukemia lymphoblasts and leukemia cell lines are sensitive to bortezomib, with an average IC(50) of 12 nM. Qualitative and quantitative bortezomib-drug interactions were evaluated using the universal response surface approach (URSA). Bortezomib was synergistic with dexamethasone in dexamethasone-sensitive leukemia cells, and additive with vincristine, asparaginase, cytarabine, and doxorubicin. The anti-leukemic activity of bortezomib was also additive with geldanamycin and HA14.1, and additive or synergistic with trichostatin A. These results were compared to analysis using the median-dose effect method, which generated complex drug interactions due to differences in dose-response curve sigmoidicities. These data suggest bortezomib could potentiate the cytotoxic effects of combination chemotherapy in patients with leukemia.
Directory of Open Access Journals (Sweden)
Anees A. Ansari
2017-09-01
Full Text Available Monodispersed luminescent functionalized core-shell nanospheres (LFCSNs were successfully synthesized and investigated for their cyto-toxic effect on human liver hepatocellular carcinoma cell line (HepG2 cells by adopting MTT, DNA Ladder, TUNEL assay and qPCR based gene expressions through mRNA quantifications. The TUNEL and DNA ladder assays suggested an insignificant apoptosis in HepG2 cells due to the LFCSNs treatment. Further, the qPCR results also show that the mRNA expressions of cell cycle checkpoint gene p53 and apoptosis related gene (caspase-9 was up-regulated, while the antiapoptotic gene BCl-2 and apoptosis related genes FADD and CAS-3 (apoptosis effecter gene were down-regulated in the LFCSNs treated cells. The nanospheres that were loaded into the cells confirm their intracellular uptake by light and fluorescent spectro-photometry and microscopy imaging analysis. The loaded nanospheres demonstrate an absolute resistance to photo-bleaching, which were applied for dynamic imaging to real-time tracking in-vitro cell migratory activity for continuous 24 and 48 h durations using a time-lapsed fluorescent microscope. These properties of LFCSNs could therefore promote applications in the area of fluorescent protein biolabeling and drug-delivery.
Directory of Open Access Journals (Sweden)
Ahmed M. Al-Shammari
2016-01-01
Full Text Available Background: Chemotherapy is one of the antitumor therapies used worldwide in spite of its serious side effects and unsatisfactory results. Many attempts have been made to increase its activity and reduce its toxicity. 5-Fluorouracil (5-FU is still a widely-used chemotherapeutic agent, especially in combination with other chemotherapies. Combination therapy seems to be the best option for targeting tumor cells by different mechanisms. Virotherapy is a promising agent for fighting cancer because of its safety and selectivity. Newcastle disease virus is safe, and it selectively targets tumor cells. We previously demonstrated that Newcastle disease virus (NDV could be used to augment other chemotherapeutic agents and reduce their toxicity by halving the administered dose and replacing the eliminated chemotherapeutic agents with the Newcastle disease virus; the same antitumor activity was maintained. Methods: In the current work, we tested this hypothesis on different tumor cell lines. We used the non-virulent LaSota strain of NDV in combination with 5-FU, and we measured the cytotoxicity effect. We evaluated this combination using Chou–Talalay analysis. Results: NDV was synergistic with 5-FU at low doses when used as a combination therapy on different cancer cells, and there were very mild effects on non-cancer cells. Conclusion: The combination of a virulent, non-pathogenic NDV–LaSota strain with a standard chemotherapeutic agent, 5-FU, has a synergistic effect on different tumor cells in vitro, suggesting this combination could be an important new adjuvant therapy for treating cancer.
Carboxylesterase-dependent cytotoxicity of dibasic esters (DBE) in rat nasal explants.
Trela, B A; Bogdanffy, M S
1991-02-01
Dibasic esters (DBE) are a solvent mixture of dimethyl adipate (DMA), dimethyl glutarate (DMG), and dimethyl succinate (DMS) used in the paint and coating industry. Subchronic inhalation toxicity studies have demonstrated that DBE induce a mild degeneration of the olfactory, but not the respiratory, epithelium of the rat nasal cavity. Carboxylesterase-mediated hydrolysis of the individual dibasic esters is more efficient in olfactory than in respiratory mucosal homogenates. In the present study, an in vitro system of cultured rat nasal explants was utilized to determine if DBE toxicity is dependent on a metabolic activation by nonspecific carboxylesterase. Explants from both the olfactory and the respiratory regions of the female rat nasal cavity were incubated for 2 hr in Williams' medium E containing 10-100 mM DMA, DMG, or DMS. DBE caused a dose-related increase in nasal explant acid phosphatase release, a biochemical index of cytotoxicity. HPLC analysis demonstrated parallel increases in the carboxylesterase-mediated formation of monomethyl ester metabolites. Diacid metabolite production in the nasal explant system was not entirely concentration-dependent. Metabolite concentrations and acid phosphatase release were generally greater in olfactory than respiratory tissues. DBE-induced cytotoxicity and acid metabolite production were markedly attenuated in nasal tissue excised from rats which were pretreated with bis(p-nitrophenyl)phosphate, a carboxylesterase inhibitor. This study presents a viable in vitro method for assessing organic ester cytotoxicity in the rat nasal cavity. It was shown that DBE are weak nasal toxicants under the conditions of this system. It was further demonstrated that DBE toxicity is dependent on a carboxylesterase-mediated activation. A similar mechanism was proposed for the nasal toxicity induced by other organic esters following inhalation exposure.
Improved cytotoxicity testing of magnesium materials
Energy Technology Data Exchange (ETDEWEB)
Fischer, Janine [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Structural Research on Macromolecules, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Proefrock, Daniel [Helmholtz-Zentrum Geesthacht, Institute for Coastal Research, Department for Marine Bioanalytical Chemistry, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Hort, Norbert [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Magnesium Processing, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Willumeit, Regine; Feyerabend, Frank [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Structural Research on Macromolecules, Max-Planck Str. 1, D - 21502 Geesthacht (Germany)
2011-06-25
Metallic magnesium (Mg) and its alloys are highly suitable for medical applications as biocompatible and biodegradable implant materials. Magnesium has mechanical properties similar to bone, stimulates bone regeneration, is an essential non-toxic element for the human body and degrades completely within the body environment. In consequence, magnesium is a promising candidate as implant material for orthopaedic applications. Protocols using the guideline of current ISO standards should be carefully evaluated when applying them for the characterization of the cytotoxic potential of degradable magnesium materials. For as-cast material we recommend using 10 times more extraction medium than recommended by the ISO standards to obtain reasonable results for reliable cytotoxicity rankings of degradable materials in vitro. In addition primary isolated human osteoblasts or mesenchymal stem cells should be used to test magnesium materials.
Improved cytotoxicity testing of magnesium materials
International Nuclear Information System (INIS)
Fischer, Janine; Proefrock, Daniel; Hort, Norbert; Willumeit, Regine; Feyerabend, Frank
2011-01-01
Metallic magnesium (Mg) and its alloys are highly suitable for medical applications as biocompatible and biodegradable implant materials. Magnesium has mechanical properties similar to bone, stimulates bone regeneration, is an essential non-toxic element for the human body and degrades completely within the body environment. In consequence, magnesium is a promising candidate as implant material for orthopaedic applications. Protocols using the guideline of current ISO standards should be carefully evaluated when applying them for the characterization of the cytotoxic potential of degradable magnesium materials. For as-cast material we recommend using 10 times more extraction medium than recommended by the ISO standards to obtain reasonable results for reliable cytotoxicity rankings of degradable materials in vitro. In addition primary isolated human osteoblasts or mesenchymal stem cells should be used to test magnesium materials.
Stimulatory and cytotoxic effects of beryllium on proliferation of mouse spleen lymphocytes in vitro
Energy Technology Data Exchange (ETDEWEB)
Price, R.J.; Skilleter, D.N.
1985-01-01
Low concentrations (1-5 ..mu..M) of beryllium (Be) salts were weakly mitogenic to mouse spleen cells in vitro as measured by an hydroxyurea-sensitive 2-3fold increase in pulse labelled (/sup 3/H)-thymidine incorporation into lymphocyte DNA. It is proposed the activation may be induced by a direct interaction of Be/sup 2 +/ with the lymphocyte membranes. Higher concentrations of Be/sup 2 +/ (5-20 ..mu..M) produced a gradual loss of the stimulatory response, possibly as the result of either a limited cytotoxic effect or by the established property of intracellularly-accumulated Be/sup 2 +/ to inhibit cell division. In contrast, Concanavalin A-stimulated lymphocyte mitogenesis was markedly decreased by a 20-h-preincubation of splenocytes with micromolar concentrations of Be/sup 2 +/, whereas similar pretreatment with lower concentrations (0.1 ..mu..M) actually enchanced the subsequent proliferative response. In both cases, supplementary addition of 0.1-1% peritoneal macrophages increased the level of Concanavalin A stimulation. It is concluded, therefore, that inhibition of the proliferative response to accessory cell-dependent mitogens may result from a dose-dependent destruction by Be/sup 2 +/ of the macrophage/adherent cell population.
Directory of Open Access Journals (Sweden)
Karthikeyan Elumalai
2014-03-01
Full Text Available A new series of some novel acetazolamide cyclocondensed 1,2,3,4-tetrahydropyrimidines was prepared by reacting of N-{[5-(acetylamino-1,3,4-thiadiazol-2-yl]sulfonyl}-3-oxobutanamide with urea/thiourea and appropriate aldehyde in the presence of catalytic amount of laboratory made p-toluenesulfonic acid as an efficient catalyst. Confirmation of the chemical structure of the synthesized compounds (12a–n was substantiated by TLC, different spectral data IR, 1H NMR, Mass spectra and elemental analysis were done. The synthesized compounds were evaluated for in-vitro antimicrobial and cytotoxicity against Bacillus subtilis, Escherichia coli and Vero cells. The titled compounds exhibited weak, moderate, or high in-vitro antimicrobial and cytotoxicity. Compounds 12c, 12d, 12g and 12h, exhibited potential antimicrobial and in-vitro cytotoxicity.
Cytotoxicity of Cerastes cerastes snake venom: Involvement of imbalanced redox status.
Kebir-Chelghoum, Hayet; Laraba-Djebari, Fatima
2017-09-01
Envenomation caused by Cerastes cerastes snake venom is characterized by a local and a systemic tissue damage due to myonecrosis, hemorrhage, edema and acute muscle damage. The present study aimed to evaluate the relationship between the pro/anti-oxidants status and the cytotoxicity of C. cerastes snake venom. The in vivo cytotoxicity analysis was undertaken by the injection of C. cerastes venom (48μg/20g body weight) by i.p. route, mice were then sacrificed at 3, 24 and 48h post injection, organs were collected for further analysis. In vitro cytotoxicity analysis was investigated on cultured PBMC, hepatocytes and isolated liver. The obtained results showed a significant cell infiltration characterized by a significant increase of myeloperoxidase (MPO) and eosinoperoxidase (EPO) activities. These results showed also a potent oxidative activity of C. cerastes venom characterized by increased levels of residual nitrites and lipid peroxidation associated with a significant decrease of glutathione and catalase activity in sera and tissues (heart, lungs, liver and kidneys). The in vitro cytotoxicity of C. cerastes venom on PBMC seems to be dose-dependent (IC50 of 21μg/ml/10 6 cells) and correlated with an imbalanced redox status at high doses of venom. However, in the case of cultured hepatocytes, the LDH release and oxidative stress were observed only at high doses of the venom. The obtained results of in vivo study were confirmed by the culture of isolated liver. Therefore, these results suggest that the venom induces a direct cytotoxic effect which alters the membrane integrity causing a leakage of the cellular contents. This cytotoxic effect can lead indirectly to inflammatory response and oxidative stress. These data suggest that an early anti-inflammatory and antioxidant treatment could be useful in the management of envenomed victims. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Isa, N.M.; Abdelwahab, S.I.; Mohan, S.; Abdul, A.B.; Sukari, M.A.; Taha, M.M.E.; Syam, S.; Narrima, P.; Cheah, S.Ch.; Ahmad, S.; Mustafa, M.R.
2012-01-01
The current in vitro study was designed to investigate the anti-inflammatory, cytotoxic and antioxidant activities of boesenbergin A (BA), a chalcone derivative of known structure isolated from Boesenbergia rotunda. Human hepatocellular carcinoma (HepG2), colon adenocarcinoma (HT-29), non-small cell lung cancer (A549), prostate adenocarcinoma (PC3), and normal hepatic cells (WRL-68) were used to evaluate the cytotoxicity of BA using the MTT assay. The antioxidant activity of BA was assessed by the ORAC assay and compared to quercetin as a standard reference antioxidant. ORAC results are reported as the equivalent concentration of Trolox that produces the same level of antioxidant activity as the sample tested at 20 µg/mL. The toxic effect of BA on different cell types, reported as IC 50 , yielded 20.22 ± 3.15, 10.69 ± 2.64, 20.31 ± 1.34, 94.10 ± 1.19, and 9.324 ± 0.24 µg/mL for A549, PC3, HepG2, HT-29, and WRL-68, respectively. BA displayed considerable antioxidant activity, when the results of ORAC assay were reported as Trolox equivalents. BA (20 µg/mL) and quercetin (5 µg/mL) were equivalent to a Trolox concentration of 11.91 ± 0.23 and 160.32 ± 2.75 µM, respectively. Moreover, the anti-inflammatory activity of BA was significant at 12.5 to 50 µg/mL and without any significant cytotoxicity for the murine macrophage cell line RAW 264.7 at 50 µg/mL. The significant biological activities observed in this study indicated that BA may be one of the agents responsible for the reported biological activities of B. rotunda crude extract
Hamdi, Assia; Bero, Joanne; Beaufay, Claire; Flamini, Guido; Marzouk, Zohra; Vander Heyden, Yvan; Quetin-Leclercq, Joelle
2018-02-14
Plants used for traditional medicine produce diverse and complex secondary metabolites exhibiting various medicinal properties. The medicinal plant Haplophyllum tuberculatum is used by native people against malaria and parasitic infections. In this study and in order to contribute for the search of new natural drugs for leishmaniasis, the essential oils of H. tuberculatum leaves, stems and aerial parts (leaves+stems) collected in two different periods, 2013 and 2015, and their components by GC/FID and GC/MS analyses were investigated. Those collected in 2013 were also re-analyzed two years later. The extracted oils were screened in vitro for anti-leishmanial activity on Leishmania mexicana mexicana (L.m.m.) promastigotes and cytotoxicity on the Chinese Hamster Ovary (CHO) cell line. Limonene (1.5 - 8%), its isomers (R- (+)-limonene and S-(-)-limonene), linalool and octanol were also tested. Results showed that the chemical composition varied according to the year of collection. Though major compounds remain almost the same, qualitative and quantitative variations in the composition of the EOs can be observed between the two years of collection, with some minor compounds identified only in one type of samples. Variation in the composition were also observed in the re-analyzed volatile oils, showing stability concerns. The essential oils and R-(+)-limonene showed moderate anti-leishmanial activity. Their IC 50 range from 6.48 to 50.28 μg/ml. Cytotoxicity assays for theses volatile extracts, R- (+)-limonene and S- (-)-limonene on CHO cells showed relatively potent cytotoxicity with a selectivity index <10. Their CC 50 range from 27.79 to 82.56 μg/ml. The findings of the present study demonstrated that H. tuberculatum might not be considered as a natural source for production of new anti-leishmanial agents without further analyzing its eventual in vivo toxicity as well as that of major pure compounds.
Singh, Bharat; Sahu, Pooran M; Sharma, Ram A
2017-02-01
The flavonoids are the largest group of phenolic compounds isolated from a wide range of higher plants. These compounds work as antimicrobials, anti-insect agents and protect plants from other types of biotic and abiotic stresses. Various researchers have suggested that flavonoids possessed antioxidant, antineoplastic and cytotoxic activities. The main objective of this study was to test dichloromethane fraction of resinous exudate of Heliotropium subulatum for their antioxidant, antineoplastic and cytotoxic activities, as well as to search new antioxidant and antineoplastic agents for pharmaceutical formulations. Five flavonoids were isolated from resinous exudate of this plant species and screened for their in vitro and in vivo antioxidant models (DPPH radical scavenging, reducing power, superoxide anion scavenging, metal chelating scavenging systems, catalase and lipid peroxidation), antineoplastic (Sarcoma 180), and cytotoxic (Chinese hamster V79 cells) activities. Tricetin demonstrated maximum antioxidant activity against both in vitro and in vivo experimental systems while galangin exhibited maximum inhibition (78.35%) at a dose of 10 µg/kg/day against Sarcoma 180. Similarly, it was found that galangin also showed highest activity (21.1 ± 0.15%) at a concentration of 70 µg/ml to Chinese hamster V79 cells. The observed results suggest that tricetin has a potential to scavenge free radicals in both in vitro and in vivo models while the galangin could be considered as antitumor and cytotoxic agent.
Persson, Andrea; Tykesson, Emil; Westergren-Thorsson, Gunilla; Malmström, Anders; Ellervik, Ulf; Mani, Katrin
2016-07-08
We previously reported that the xyloside 2-(6-hydroxynaphthyl) β-d-xylopyranoside (XylNapOH), in contrast to 2-naphthyl β-d-xylopyranoside (XylNap), specifically reduces tumor growth both in vitro and in vivo Although there are indications that this could be mediated by the xyloside-primed glycosaminoglycans (GAGs) and that these differ in composition depending on xyloside and cell type, detailed knowledge regarding a structure-function relationship is lacking. In this study we isolated XylNapOH- and XylNap-primed GAGs from a breast carcinoma cell line, HCC70, and a breast fibroblast cell line, CCD-1095Sk, and demonstrated that both XylNapOH- and XylNap-primed chondroitin sulfate/dermatan sulfate GAGs derived from HCC70 cells had a cytotoxic effect on HCC70 cells and CCD-1095Sk cells. The cytotoxic effect appeared to be mediated by induction of apoptosis and was inhibited in a concentration-dependent manner by the XylNap-primed heparan sulfate GAGs. In contrast, neither the chondroitin sulfate/dermatan sulfate nor the heparan sulfate derived from CCD-1095Sk cells primed on XylNapOH or XylNap had any effect on the growth of HCC70 cells or CCD-105Sk cells. These observations were related to the disaccharide composition of the XylNapOH- and XylNap-primed GAGs, which differed between the two cell lines but was similar when the GAGs were derived from the same cell line. To our knowledge this is the first report on cytotoxic effects mediated by chondroitin sulfate/dermatan sulfate. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Tradtrantip, Lukmanee; Felix, Christian M; Spirig, Rolf; Morelli, Adriana Baz; Verkman, A S
2018-05-01
Intravenous human immunoglobulin G (IVIG) may have therapeutic benefit in neuromyelitis optica spectrum disorders (herein called NMO), in part because of the anti-inflammatory properties of the IgG Fc region. Here, we evaluated recombinant Fc hexamers consisting of the IgM μ-tailpiece fused with the Fc region of human IgG1. In vitro, the Fc hexamers prevented cytotoxicity in aquaporin-4 (AQP4) expressing cells and in rat spinal cord slice cultures exposed to NMO anti-AQP4 autoantibody (AQP4-IgG) and complement, with >500-fold greater potency than IVIG or monomeric Fc fragments. Fc hexamers at low concentration also prevented antibody-dependent cellular cytotoxicity produced by AQP4-IgG and natural killer cells. Serum from rats administered a single intravenous dose of Fc hexamers at 50 mg/kg taken at 8 h did not produce complement-dependent cytotoxicity when added to AQP4-IgG-treated AQP4-expressing cell cultures. In an experimental rat model of NMO produced by intracerebral injection of AQP4-IgG, Fc hexamers at 50 mg/kg administered before and at 12 h after AQP4-IgG fully prevented astrocyte injury, complement activation, inflammation and demyelination. These results support the potential therapeutic utility of recombinant IgG1 Fc hexamers in AQP4-IgG seropositive NMO. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wong, Yu Hua; Tan, Wai Yan; Tan, Chin Ping; Long, Kamariah; Nyam, Kar Lin
2014-01-01
Objective To examine the cytotoxic properties of both the kenaf (Hibiscus cannabinus L.) seed extract and kenaf seed oil on human cervical cancer, human breast cancer, human colon cancer and human lung cancer cell lines. Methods The in vitro cytotoxic activity of the kenaf (Hibiscus cannabinus L.) seed extract and kenaf seed oil on human cancer cell lines was evaluated by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and sulforhodamine B assays. Cell morphological changes were observed by using an inverted light microscope. Results The kenaf seed extract (KSE) exhibited a lower IC50 than kenaf seed oil (KSO) in all of the cancer cell lines. Morphological alterations in the cell lines after KSE and KSO treatment were observed. KSE and KSO possessed effective cytotoxic activities against all the cell lines been selected. Conclusions KSE and KSO could be potential sources of natural anti-cancer agents. Further investigations on using kenaf seeds for anti-proliferative properties are warranted. PMID:25183141
Anaplasma phagocytophilum-Related Defects in CD8, NKT, and NK Lymphocyte Cytotoxicity
Directory of Open Access Journals (Sweden)
Diana G. Scorpio
2018-04-01
Full Text Available Human granulocytic anaplasmosis, caused by the tick-transmitted Anaplasma phagocytophilum, is not controlled by innate immunity, and induces a proinflammatory disease state with innate immune cell activation. In A. phagocytophilum murine infection models, hepatic injury occurs with production of IFNγ thought to be derived from NK, NKT cells, and CD8 T lymphocytes. Specific A. phagocytophilum ligands that drive inflammation and disease are not known, but suggest a clinical and pathophysiologic basis strikingly like macrophage activation syndrome (MAS and hemophagocytic syndrome (HPS. We studied in vivo responses of NK, NKT, and CD8 T lymphocytes from infected animals for correlates of lymphocyte-mediated cytotoxicity and examined in vitro interactions with A. phagocytophilum-loaded antigen-presenting cells (APCs. Murine splenocytes were examined and found deficient in cytotoxicity as determined by CD107a expression in vitro for specific CTL effector subsets as determined by flow cytometry. Moreover, A. phagocytophilum-loaded APCs did not lead to IFNγ production among CTLs in vitro. These findings support the concept of impaired cytotoxicity with A. phagocytophilum presentation by APCs that express MHC class I and that interact with innate and adaptive immune cells with or after infection. The findings strengthen the concept of an enhanced proinflammatory phenotype, such as MAS and HPS disease states as the basis of disease and severity with A. phagocytophilum infection, and perhaps by other obligate intracellular bacteria.
Enhancement of human natural cytotoxicity by Plasmodium falciparum antigen activated lymphocytes
DEFF Research Database (Denmark)
Theander, T G; Pedersen, B K; Bygbjerg, I C
1987-01-01
Mononuclear cells (MNC) isolated from malaria immune donors and from donors never exposed to malaria were stimulated in vitro with soluble purified Plasmodium falciparum antigens (SPag) or PPD. After 7 days of culture the proliferative response and the cytotoxic activity against the natural killer...... were preincubated with interleukin 2 (IL-2) for one hour before the start of the cytotoxic assay. SPag activation did not enhance the cytotoxic activity of MNC which did not respond to the antigen in the proliferation assay, and preincubation of these cells with IL-2 did not increase the activity. PPD...
Antibody-dependent cellular cytotoxicity and skin disease
International Nuclear Information System (INIS)
Norris, D.A.; Lee, L.A.
1985-01-01
Antibody dependent cellular cytotoxicity (ADCC) is a recently described mechanism of immunologic lysis in which cellular targets sensitized by specific antibodies are efficiently and selectively lysed by Fc receptor (FcR) bearing nonspecific effectors. Immunoglobulins of various classes (IgG, IgM, IgA, IgE) and various cellular effectors (large granular lymphocytes, monocyte/macrophages, T lymphocytes, neutrophils, and eosinophils) can induce ADCC in vitro, and the importance of ADCC in vivo is being tested experimentally in resistance to viral, bacterial, and parasitic infection, in tumor surveillance, in allograft rejection, and in inflammatory diseases. There is much indirect evidence that ADCC may be the mechanism of damage of different cellular targets in skin diseases, but the best direct evidence concerns immunologic keratinocyte damage, especially in cutaneous lupus erythematosus (LE). The authors have shown that keratinocytes of several species are highly susceptible to lymphocyte and monocyte-mediated ADCC, but not to neutrophil or eosinophil ADCC in vitro using two different cytotoxicity assays. In contrast, complement was a relatively ineffective mediator of lysis of metabolically intact keratinocyte targets. Patients with certain cutaneous lupus syndromes have serum antibodies capable of inducing monocyte and lymphocyte ADCC of targets coated with extractable nuclear antigens. The authors have shown that these antigens apparently move to the cell membrane of keratinocytes in vitro following ultraviolet irradiation. In an animal model, they have shown that antibodies to SSA/Ro bind to human keratinocytes in vivo, especially after ultraviolet irradiation
Directory of Open Access Journals (Sweden)
Manisha Pandey 1,2 * , Hira Choudhury 1, Mohd Cairul Iqbal Mohd Amin 2
2016-12-01
Full Text Available Background: Preliminary safety evaluation of polymer intended to use as drug delivery carrier is essential. Methods: In this study polyacrylamide grafted bacterial cellulose (BC/AM hydrogel was prepared by microwave irradiation initiated free radical polymerization. The synthesized hydrogel was subjected to in vitro cytotoxicity and acute gastrointestinal toxicity studies to evaluate its biological safety as potential oral drug delivery carrier. Results: The results indicate that hydrogel was non cytotoxic and did not show any histopathological changes in GI tract after a high dose of oral administration. Conclusion: The results revealed that hydrogel composed of bacterial cellulose and polyacrylamide is safe as oral drug delivery carrier.
International Nuclear Information System (INIS)
Smith, G.; Nicklin, S.
1979-01-01
A terminal labelling method is described for measuring cell-mediated cytotoxicity based on the ability of surviving target cells to incorporate [ 3 H]uridine into their RNA precursor pools. Parameters of the system were examined using whole and damaged embryonic mouse fibroblast monolayers. This assay is less laborious than direct cell counting and gives increased sensitivity at low target to effector cell ratios. The labelling time is short and, unlike similar techniques, it allows target cell monolayers to remain intact after completion of the radioassay and available for histological examination. This is important where heterogeneous target populations are employed since it allows assessment of differential cell killing and eliminates the need for duplicate cultures. The assay was used in conjunction with a well defined mouse popliteal lymph node assay to investigate the appearance of cytotoxic cells during a localised graft versus host response. Results showed a direct correlation between proliferative index and the development of highly specific cell-mediated cytotoxicity. (Auth.)
International Nuclear Information System (INIS)
Benavides, T.; Mitjans, M.; Martinez, V.; Clapes, P.; Infante, M.R.; Clothier, R.H.; Vinardell, M.P.
2004-01-01
Extensive efforts have been made, recently, to find surfactants with lower irritation potential than those presently commercially available, for use in pharmaceutical and cosmetic preparations. Cytotoxic and phototoxic effects of a novel family of dicationic arginine-diglyceride surfactant compounds, 1,2-diacyl,3-O-(L-arginyl)-rac-glycerol with alkyl chain lengths in the range from 8 to 14 carbon atoms, were compared to three commercial surfactants. The end-points used to assess toxicity were the red blood cell lysis assay and uptake of the vital dye neutral red 24 h after dosing (NRU), respectively. Two immortalized cell lines, murine fibroblast cell line, 3T3, and one human keratinocyte cell line, HaCaT, were used as in vitro models to predict the potential phototoxicity which could result in irritation, determined by resazurin reduction to resorufin and neutral red uptake (NRU). All tested surfactants had cytotoxicity effects as demonstrated by and decrease of NR uptake, which showed a clear concentration-response relationship. Concentrations resulting in 50% inhibition of NR uptake (IC 50 ) range from 1 μmol l -1 (hexadecyl trimethyl ammonium bromide) to 565 μmol l -1 (12,12-L-arginine). Erythrocyte haemolysis also showed a clear concentration-response relationship, the 50% of haemolysis ranged from 37 μmol l -1 (10,10-L-arginine) to 151 μmol l -1 (sodium lauryl sulphate). Phototoxicity was performed with 12,12-L-acetyl-arginine, the most stable chemical structure. The validated 3T3 NRU photoxicity assay was used and revealed a phototoxic potential
Capello, Tabata M; Martins, Euder G A; de Farias, Camyla F; Figueiredo, Carlos R; Matsuo, Alisson L; Passero, Luiz Felipe D; Oliveira-Silva, Diogo; Sartorelli, Patricia; Lago, João Henrique G
2015-02-01
Fractionation of the MeOH extract from leaves of Piper cernuum Vell. (Piperaceae) afforded six phenylpropanoid derivatives: 3',4'-dimethoxydihydrocinnamic acid (1), piplaroxide (2), methyl 4'-hydroxy-3',5'-dimethoxy cinnamate (3), 3',4',5'-trimethoxydihydrocinnamic acid (3), dihydropiplartine (5), and piplartine (6). The structures of isolated metabolites were characterized by NMR and MS spectral data analysis. The chemical composition of essential oil from the leaves was determined using GC/LREIMS followed by the determination of Kovats indexes. This procedure allowed the identification of nineteen terpenoids, with β-elemene (7), bicyclogermacrene (8), germacrene D (9), and (E)-caryophyllene (10) as the main compounds. Compounds 1 and 3-6 displayed no in vitro cytotoxicity against cancer cell lineages B16F10-Nex2, U87, HeLa, HL-60, HCT, and A2058 while 2 showed moderate activity against B16F10-Nex2 and HL-60 lines. Otherwise, compounds 7-10 displayed high cytotoxic activity. Evaluation against non-tumorigenic HFF cells indicated a reduced selectivity of compounds 7-10 to tumoral cells. No antileishmanial activity on macrophages infected with L. (L.) amnazonensis was found for the crude MeOH extract and compounds 1-6. The crude essential oil and compounds 7-10 reduced parasitism and eliminated the majority of infected and non-infected cells at 50 μg/mL.
Toxin content and cytotoxicity of algal dietary supplements
Energy Technology Data Exchange (ETDEWEB)
Heussner, A.H.; Mazija, L. [Human and Environmental Toxicology, University of Konstanz, 78457 Konstanz (Germany); Fastner, J. [Federal Environmental Agency, Section II 3.3—Drinking-water resources and treatment, Berlin (Germany); Dietrich, D.R., E-mail: daniel.dietrich@uni-konstanz.de [Human and Environmental Toxicology, University of Konstanz, 78457 Konstanz (Germany)
2012-12-01
Blue-green algae (Spirulina sp., Aphanizomenon flos-aquae) and Chlorella sp. are commercially distributed as organic algae dietary supplements. Cyanobacterial dietary products in particular have raised serious concerns, as they appeared to be contaminated with toxins e.g. microcystins (MCs) and consumers repeatedly reported adverse health effects following consumption of these products. The aim of this study was to determine the toxin contamination and the in vitro cytotoxicity of algae dietary supplement products marketed in Germany. In thirteen products consisting of Aph. flos-aquae, Spirulina and Chlorella or mixtures thereof, MCs, nodularins, saxitoxins, anatoxin-a and cylindrospermopsin were analyzed. Five products tested in an earlier market study were re-analyzed for comparison. Product samples were extracted and analyzed for cytotoxicity in A549 cells as well as for toxin levels by (1) phosphatase inhibition assay (PPIA), (2) Adda-ELISA and (3) LC–MS/MS. In addition, all samples were analyzed by PCR for the presence of the mcyE gene, a part of the microcystin and nodularin synthetase gene cluster. Only Aph. flos-aquae products were tested positive for MCs as well as the presence of mcyE. The contamination levels of the MC-positive samples were ≤ 1 μg MC-LR equivalents g{sup −1} dw. None of the other toxins were found in any of the products. However, extracts from all products were cytotoxic. In light of the findings, the distribution and commercial sale of Aph. flos-aquae products, whether pure or mixed formulations, for human consumption appear highly questionable. -- Highlights: ► Marketed algae dietary supplements were analyzed for toxins. ► Methods: Phosphatase inhibition assay (PPIA), Adda-ELISA, LC-MS/MS. ► Aph. flos-aquae products all tested positive for microcystins. ► Products tested negative for nodularins, saxitoxins, anatoxin-a, cylindrospermopsin. ► Extracts from all products were cytotoxic.
Directory of Open Access Journals (Sweden)
Susana Suely Rodrigues Milhomem-Paixão
2017-01-01
Full Text Available Andiroba oil (AO is obtained from an Amazonian plant and is used in traditional medicine. We carried out a comparative study to test the cytotoxicity, genotoxicity, and hematotoxicity of the oil and its nanoemulsion (AN in vitro (fibroblasts, lineage NIH/3T3 and in vivo (Swiss mice. The AN was characterized by DLS/Zeta, and its stability was investigated for 120 days. The biological activity of AN was assessed in vitro by MTT test and cell morphology analyses and in vivo by micronucleus, comet, and hematotoxicity tests. The AN presented a hydrodynamic diameter (Hd of 142.5±3.0 and PDI of 0.272±0.007 and good stability at room temperature. The MTT test evidenced the cytotoxicity of AO and of AN only at their highest concentrations, but AN showed lower cytotoxicity than AO. A lower cytotoxicity of AN, when compared to AO, is in fact an interesting data suggesting that during therapeutic application there will be a lower impact in the cell viability of healthy cells. Cytotoxicity, genotoxicity, and hematotoxicity were not observed in vivo. These tests on the biological and toxicological effects of andiroba oil and nanostructured oil are still initial ones but will give a direction to future application in cosmetics and/or the development of new phytotherapics.
Cytotoxic bibenzyl dimers from the stems of Dendrobium fimbriatum Hook.
Xu, Feng-Qing; Xu, Fang-Cheng; Hou, Bo; Fan, Wei-Wei; Zi, Cheng-Ting; Li, Yan; Dong, Fa-Wu; Liu, Yu-Qing; Sheng, Jun; Zuo, Zhi-Li; Hu, Jiang-Miao
2014-11-15
The bioassay-guided chemical investigation of the stems of Dendrobium fimbriatum Hook led to the isolation of seven first reported bibenzyl dimers with a linkage of a methylene moiety, fimbriadimerbibenzyls A-G (1-7), together with a new dihydrophenanthrene derivative (S)-2,4,5,9-tetrahydroxy-9,10-dihydrophenanthrene (8) and thirteen known compounds (9-21). The structure of the new compound was established by spectroscopic analysis. Biological evaluation of bibenzyl derivatives against five human cell lines indicated that seven of those compounds exhibited broad-spectrum and cytotoxic activities with IC50 values ranging from 2.2 to 21.2 μM. Those rare bibenzyl dimers exhibited cytotoxic activities in vitro and the cytotoxicity decreased as the number of oxygen-containing groups in the structure decreases. Copyright © 2014 Elsevier Ltd. All rights reserved.
In vitro screening methods for assessing plant disease resistance
International Nuclear Information System (INIS)
Lebeda, A.; Svabova, L.
2010-01-01
A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)
Cetuximab Enhanced the Cytotoxic Activity of Immune Cells during Treatment of Colorectal Cancer
Directory of Open Access Journals (Sweden)
Lin Wang
2017-11-01
Full Text Available Background/Aims: Cetuximab is a chimeric IgG1 monoclonal antibody which targets the extracellular domain of epidermal growth factor receptor. This antibody is widely used for colorectal cancer (CRC treatment but its influence on the immune system is incompletely understood. Methods: The immune influence of cetuximab therapy in CRC patients was investigated by analyzing peripheral blood mononuclear cells using flow cytometry. We undertook in vitro cytotoxicity and cytokine-profile assays to ascertain the immunomodulatory effect of cetuximab treatment. Results: The number of CD3+ T, CD8+ T, and natural killer (NK cells was increased significantly and T-regulatory cells reduced gradually after cetuximab treatment. Percentage of CD4+ T, natural killer T (NKT-like, invariant NKT, and dendritic cells was similar between baseline patients and cetuximab patients. Expression of CD137 on NK and CD8+ T cells was increased significantly after 4 weeks of cetuximab therapy. In vitro cetuximab treatment markedly increased expression of CD137 and CD107a on NK and CD8+ T cells. Cetuximab treatment promoted the cytotoxic activity of NK and CD8+ T cells against tumor cells. Conclusion: Cetuximab treatment promotes activation of the immune response but alleviates immunosuppression: this might be the underlying anti-CRC effect of cetuximab.
Cytotoxic effects of cyanoacrylates used as retrograde filling materials: an in vitro analysis
Directory of Open Access Journals (Sweden)
Azevedo Cledson Lima de
2003-01-01
Full Text Available Cyanoacrylate has been used in medicine and dentistry for many years. It has been used as a postextraction dressing and retrograde filling material in endodontic surgery. The aim of this study was to evaluate the cytotoxic effects of Histoacryl and other two homologue ethyl cyanoacrylates, Super Bonder and Ultrabond, on cultured fibroblasts, using the Trypan blue dye exclusion assay. The cyanoacrylates were applied to round glass coverslips, which were placed in contact with NIH 3T3 cells. After 0, 6, 12 and 24 h (short-term assay; viability and 1, 3, 5 and 7 days (long-term assay; survival, the cells were examined under phase light microscopy and counted. The data were compared by the Kruskal-Wallis test. In the short-term experiments, only the cultures of the Ultrabond group (GIV presented significant smaller percentages of cell viability than the cultures of the other groups (GI: control; GII: Super Bonder; GIII: Histoacryl. Although the cultures of the Super Bonder group (GII presented smaller percentages of cell viability than cultures of the other groups (GI, GIII, GIV at the long-term assay, this group was the only experimental group presenting a continuous and progressive cell growth. Our results have shown an in vitro biocompatibility of Histoacryl and ethyl cyanoacrylate homologues. These cyanoacrylates could therefore be of importance for endodontic purposes.
Cytotoxic CD4 T Cells—Friend or Foe during Viral Infection?
Juno, Jennifer A.; van Bockel, David; Kent, Stephen J.; Kelleher, Anthony D.; Zaunders, John J.; Munier, C. Mee Ling
2017-01-01
CD4 T cells with cytotoxic function were once thought to be an artifact due to long-term in vitro cultures but have in more recent years become accepted and reported in the literature in response to a number of viral infections. In this review, we focus on cytotoxic CD4 T cells in the context of human viral infections and in some infections that affect mice and non-human primates. We examine the effector mechanisms used by cytotoxic CD4 cells, the phenotypes that describe this population, and the transcription factors and pathways that lead to their induction following infection. We further consider the cells that are the predominant targets of this effector subset and describe the viral infections in which CD4 cytotoxic T lymphocytes have been shown to play a protective or pathologic role. Cytotoxic CD4 T cells are detected in the circulation at much higher levels than previously realized and are now recognized to have an important role in the immune response to viral infections. PMID:28167943
Roemer, E; Stabbert, R; Veltel, D; Müller, B P; Meisgen, T J; Schramke, H; Anskeit, E; Elves, R G; Fournier, J A
2008-04-01
The effects of the addition of ammonium magnesium phosphate (AMP) to the paper of an electrically heated cigarette (EHC) prototype on smoke composition and toxicity were quantified and the underlying mechanisms investigated. Smoke from EHC prototypes with and without AMP and from conventional cigarettes, i.e. the University of Kentucky Standard Reference Cigarette 1R4F and eight American-blend market cigarettes, was compared. Endpoints for comparison were smoke chemistry, where toxic constituents were measured, cytotoxic activity, as measured in murine fibroblasts embryo cells by the Neutral Red Uptake Assay, and genotoxic activity, as measured in bacteria by the Salmonella Reverse Mutation Assay and in murine lymphoma cells by the TK Assay. The addition of AMP to the EHC led to a reduction of toxic substances and toxicological activity of approximately 30% compared to the EHC without AMP. Compared to the conventional cigarettes, the EHC with AMP showed reductions of 75-90%. Smoke from the EHCs generated in nitrogen atmospheres supplemented with different concentrations of ammonia and oxygen was assayed for its in vitro cytotoxicity and genotoxicity. The results indicate that the ammonia released by AMP at the heating site of the EHC is responsible for the reductions in cytotoxicity and mutagenicity for the EHC with AMP compared with the EHC without AMP. Thus, while the EHC approach distinctly reduces toxic smoke constituents compared to conventional cigarettes, the use of AMP in the paper of an EHC leads to further distinct reductions. In the study presented here, in vitro assays were used as quantitative tools to investigate toxicity-related mechanisms.
Takii, T; Abe, C; Tamura, A; Ramayah, S; Belisle, J T; Brennan, P J; Onozaki, K
2001-03-01
Mycobacteria-induced in vitro events reflecting human tuberculosis can contribute to the evaluation of the pathogenesis of Mycobacterium tuberculosis (MTB). In this study, we propose such an in vitro method based on live mycobacteria-induced cytotoxicity to human cell lines. When human lung-derived normal fibroblast cell line MRC-5 was infected with various strains of mycobacteria (M. tuberculosis H(37)Rv and H(37) Ra, Mycobacterium avium 427S and 2151SmO, and Mycobacterium bovis BCG Pasteur and Tokyo), the fibroblasts were killed by mycobacteria according to the degree of virulence. Other human originated macrophage (U-937, THP-1), myeloid (HL-60), and epithelial carcinoma (A549) cell lines exhibited a similar cytotoxic response to virulent mycobacteria. MRC-5 was most susceptible to virulent mycobacteria among various human cell lines examined. The cytotoxicity was enhanced by the proinflammatory cytokines, interleukin-1 (IL-1) and tumor necrosis factor-a (TNF-alpha), which in the absence of mycobacteria stimulate the growth of normal human fibroblasts. This in vitro evaluation system was applied to clinical isolates of drug-sensitive MTB (DS-MTB), drug-resistant MTB (DR-MTB) including multidrug-resistant (MDR-MTB), and M. avium complex (MAC). MTB strains (n = 24) exhibited strong cytotoxic activity, but MAC strains (n = 5) had only weak activity. Furthermore, there was no significant difference in cytotoxicity between DS-MTB (n = 11) and DR-MTB (n = 13). Collectively, these results suggest that this new in vitro system is useful for evaluating the pathogenesis of mycobacteria and that there was no difference in the pathogenesis between drug-susceptible and drug-resistant clinical isolates.
A Cytotoxic Hydroperoxy Sterol from the Brown Alga, Nizamuddinia Zanardinii
Directory of Open Access Journals (Sweden)
Abdolhossein Rustaiyan
2013-03-01
Full Text Available Background:The marine environment is a unique source of bioactive natural products, of which Nizamuddinia zanardinii is an important brown algae distributed in Oman Sea. Literature revealed that there is no report on phytochemistry and pharmacology of this valuable algae.Methods:Bioguided fractionation of the methanolic extract of Nizamuddinia zanardinii, collected from Oman Sea, led to the isolation of a hydroperoxy sterol. Its structure was determined by analysis of the spectroscopic data as 24-hydroperoxy-24-vinyl cholesterol (HVC. In vitro cytotoxic activity of this compound was evaluated against HT29, MCF7, A549, HepG2 and MDBK cell lines.Results:Although 24(R-hydroproxy-24-vinylcholesterol has been previously reported from Sargassum and Padina species, it is the first report on the presence of this compound from N. zanardinii. This compound exhibited cytotoxicity in all cell lines (IC50, 3.62, 9.09, 17.96, 32.31 and 37.31 μg/mL respectively. HVC was also evaluated for apoptotic activity and demonstrated positive results in terminal deoxynucleotidyl transferase dUTP Nick End labeling (TUNEL assay suggesting it a candidate for further apoptotic studies.Conclusions:Nizamuddinia zanardinii, a remarkable brown algae of Oman Sea, is a good source of hydroproxy sterols with promising cytotoxic on various cell lines particularly human colon adenocarcinoma.
Fowsiya, J.; Madhumitha, G.
2017-11-01
Plants are the main source of medicine which is used in traditional as well as modern medicine in recent years for curing many diseases. Carissa edulis Vahl is one of the traditional plants which have healing property on diarrhea, toothache and chest pain. The present work aims on phytochemical, antioxidant and in vitro cytotoxicity test of C. edulis dried fruits. The different solvent extracts obtained from petroleum ether, ethyl acetate, chloroform, ethanol and water have been evaluated the presence of phytochemicals. Several assays were carried out like total antioxidant, DPPH, reducing power and thiobarbituric acid to investigate the free radical scavenging property. In addition, the cytotoxicity study also carried out on human lung cancer cells (A549). Among different solvent extract, ethanol exhibited strong antioxidant activity. Additionally, the in vitro cytotoxicity test of C. edulis on human lung cancer cell (A549) showed IC50 value 405.704 ± 2.42 μg/mL. Therefore, C. edulis could be useful as a potential preventive intervention for free radicals mediated diseases as well as an antioxidant drug in the pharmaceutical industry.
Cytotoxic Effects of Alcoholic Extract of Dorema Glabrum Seed on Cancerous Cells Viability
Directory of Open Access Journals (Sweden)
Maryam Bannazadeh Amirkhiz
2013-08-01
Full Text Available Purpose: In the present study cytotoxic effects of the alcoholic extract of Dorema Glabrum seed on viability of WEHI-164 cells, mouse Fibrosarcoma cell line and L929 normal cells were compared with the cytotoxic effects of Taxol (anticancer and apoptosis inducer drug. Methods: To find out the plant extract cytotoxic effects, MTT test and DNA fragmentation assay, the biochemical hallmark of apoptosis were performed on cultured and treated cells. Results: According to the findings the alcoholic extract of Dorema Glabrum seed can alter cells morphology and because of chromatin condensation and other changes they shrink and take a spherical shape, and lose their attachment too. So the plant extract inhibits cell growth albeit in a time and dose dependent manner and results in degradation of chromosomal DNA. Conclusion: Our data well established the anti-proliferative effect of methanolic extract of Dorema Glabrum seed and clearly showed that the plant extract can induce apoptosis and not necrosis in vitro, but the mechanism of its activities remained unknown. These results demonstrated that Dorema Glabrum seed might be a novel and attractive therapeutic candidate for tumor treatment in clinical practices.
Tuomi, Jukka T; Björkstrand, Roy V; Pernu, Mikael L; Salmi, Mika V J; Huotilainen, Eero I; Wolff, Jan E H; Vallittu, Pekka K; Mäkitie, Antti A
2017-03-01
Custom-designed patient-specific implants and reconstruction plates are to date commonly manufactured using two different additive manufacturing (AM) technologies: direct metal laser sintering (DMLS) and electron beam melting (EBM). The purpose of this investigation was to characterize the surface structure and to assess the cytotoxicity of titanium alloys processed using DMLS and EBM technologies as the existing information on these issues is scarce. "Processed" and "polished" DMLS and EBM disks were assessed. Microscopic examination revealed titanium alloy particles and surface flaws on the processed materials. These surface flaws were subsequently removed by polishing. Surface roughness of EBM processed titanium was higher than that of DMLS processed. The cytotoxicity results of the DMLS and EBM discs were compared with a "gold standard" commercially available titanium mandible reconstruction plate. The mean cell viability for all discs was 82.6% (range, 77.4 to 89.7) and 83.3% for the control reconstruction plate. The DMLS and EBM manufactured titanium plates were non-cytotoxic both in "processed" and in "polished" forms.
Kathirvel, Poonkodi; Ravi, Subban
2012-01-01
This study examines the chemical composition and in vitro anticancer activity of the essential oil from Ocimum basilicum Linn. (Lamiaceae), cultivated in the Western Ghats of South India. The chemical compositions of basil fresh leaves were identified by GC-MS: 11 components were identified. The major constituents were found to be methyl cinnamate (70.1%), linalool (17.5%), β-elemene (2.6%) and camphor (1.52%). The results revealed that this plant may belong to the methyl cinnamate and linalool chemotype. A methyl thiazol tetrazolium assay was used for in vitro cytotoxicity screening against the human cervical cancer cell line (HeLa), human laryngeal epithelial carcinoma cell line (HEp-2) and NIH 3T3 mouse embryonic fibroblasts. The IC(50) values obtained were 90.5 and 96.3 µg mL(-1), respectively, and the results revealed that basil oil has potent cytotoxicity.
Jhoo, Jin-Woo; Freeman, James P; Heinze, Thomas M; Moody, Joanna D; Schnackenberg, Laura K; Beger, Richard D; Dragull, Klaus; Tang, Chung-Shih; Ang, Catharina Y W
2006-04-19
Kava (Piper methysticum), a perennial shrub native to the South Pacific islands, has been used to relieve anxiety. Recently, several cases of severe hepatotoxicity have been reported from the consumption of dietary supplements containing kava. It is unclear whether the kava constituents, kavalactones, are responsible for the associated hepatotoxicity. To investigate the key components responsible for the liver toxicity, bioassay-guided fractionation was carried out in this study. Kava roots, leaves, and stem peelings were extracted with methanol, and the resulting residues were subjected to partition with a different polarity of solvents (hexane, ethyl acetate, n-butanol, and water) for evaluation of their cytotoxicity on HepG2 cells based on the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and lactate dehydrogenase and aspartate aminotransferase enzyme leakage assays. Organic solvent fractions displayed a much stronger cytotoxicity than water fractions for all parts of kava. The hexane fraction of the root exhibited stronger cytotoxic effects than fractions of root extracted with other solvents or extracts from the other parts of kava. Further investigations using bioassay-directed isolation and analysis of the hexane fraction indicated that the compound responsible for the cytotoxicity was flavokavain B. The identity of the compound was confirmed by (1)H and (13) C NMR and MS techniques.
Directory of Open Access Journals (Sweden)
Thao T. Nguyen
2015-12-01
Full Text Available In traditional medicine, Carica papaya leaf has been used for a wide range of therapeutic applications including skin diseases and cancer. In this study, we investigated the in vitro cytotoxicity of aqueous and ethanolic extracts of Carica papaya leaves on the human oral squamous cell carcinoma SCC25 cell line in parallel with non-cancerous human keratinocyte HaCaT cells. Two out of four extracts showed a significantly selective effect towards the cancer cells and were found to contain high levels of phenolic and flavonoid compounds. The chromatographic and mass spectrometric profiles of the extracts obtained with Ultra High Performance Liquid Chromatography-Quadrupole Time of Flight-Mass Spectrometry were used to tentatively identify the bioactive compounds using comparative analysis. The principal compounds identified were flavonoids or flavonoid glycosides, particularly compounds from the kaempferol and quercetin families, of which several have previously been reported to possess anticancer activities. These results confirm that papaya leaf is a potential source of anticancer compounds and warrant further scientific investigation to validate the traditional use of papaya leaf to treat cancer.
Isometachromin, a new cytotoxic sesquiterpenoid from a deep water sponge of the family Spongiidae.
McConnell, O J; Longley, R; Gunasekera, M
1992-09-15
Isometachromin (1), a new sesquiterpene-quinone that is related structurally to metachromin C (2), and the known compounds ilimaquinone (3) and 5-epi-ilimaquinone (4), were isolated from a deep water sponge in the family Spongiidae; the structure of isometachromin was elucidated by spectral methods. Isometachromin exhibits in vitro cytotoxicity against the human lung cancer cell line A549 (IC50 = 2.6 micrograms/ml), but not against P388 murine leukemia (IC 50 > or equal to 10 micrograms/ml) and also exhibits antimicrobial activity.
International Nuclear Information System (INIS)
Sun, Jian; Zhou, Wei; Hu, Weixiao; Shan, Shang; Zhang, Shijie; Li, Haibo
2013-01-01
Twenty two new 5-fluorouracil (5-FU) derivatives, 2-butoxy-4-substituted 5-fluoropyrimidines, were synthesized and characterized by IR, 1 H NMR, MS, HRMS. All compounds were preliminarily evaluated by MTT assay on human liver BEL-7402 cancer cell line in vitro. Ten compounds were selected to test their cytotoxic activity against A549, HL-60 and MCF-7 cancer cell lines in vitro. These compounds were more sensitive to BEL-7402 than other cell lines, particularly, cytotoxic activity of compounds 6b, 6d-f, 6p, 6s-u were in sub-micromolar scale. The highest cytotoxic potency against A549, HL-60 and MCF-7 was shown by 2-butoxy-4-chloro-5-fluoropyrimidine (5) with IC 50 values of 0.10, 1.66 and 0.59 μM, respectively. Compounds 6d and 6e were effective against MCF-7 with IC 50 9.73 μM and HL-60 with IC 50 8.83 μM, respectively
Gaikwad, Dinanath; Shewale, Rajnita; Patil, Vinit; Mali, Dipak; Gaikwad, Uday; Jadhav, Namdeo
2017-11-01
The aim of this work was to prepare pectin-poly (vinyl pyrrolidone) [PVP] based curcumin particulates to enhance the anticancer potential of curcumin, solubility and allow its localized controlled release. Pectin-PVP based curcumin particulates (PECTIN-PVP CUR) were prepared by spray drying technique in different ratios and were evaluated for surface morphology, micromeritics, flowability, particle size, drug content, in vitro dissolution, inhalable fraction, anti-angiogenesis/angiolysis and cytotoxicity. Results of micromeritic properties, Carr's index, Hausner's ratio and angle of repose were satisfactory. The batch CP3 was considered as optimum, due to excellent flowability, acceptable aggregation and enhanced solubility. The particle size and size distribution data of selected batch CP3 showed 90% of curcumin particulates having size less than 2.74μm, which may deposit to lungs. Twin Impinger studies showed that 29% of respirable fraction was generated, which could be directly delivered to lungs. The in vitro dissolution data showed many fold increase in dissolution rate. Angiolytic activity and MTT assay of PECTIN-PVP CUR have demonstrated enhancement in the anti-tumor potential, compared to curcumin alone. Altogether, PECTIN-PVP CUR were found suitable for local delivery and enhance its anticancer potential of curcumin. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Anajwala Chetan C.
2010-06-01
Full Text Available Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nux-vomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC50 value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 µg/ml by SRB assay and 775.1 & 1461µg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic.
Directory of Open Access Journals (Sweden)
Farzin Heravi
2013-12-01
Full Text Available Background and aims. Incorporation of nano-particles to orthodontic bonding systems has been considered to prevent enamel demineralization around appliances. This study investigated cytotoxicity of Transbond XT adhesive containing 1 wt% titanium dioxide (TiO2 nano-particles. Materials and methods. Ten composite disks were prepared from each of the conventional and TiO2-containg composites and aged for 1, 3, 5, 7 and 14 days in Dulbecco’s Modified Eagle’s Medium (DMEM. The extracts were obtained and exposed to culture media of human gingival fibroblasts (HGF and mouse L929 fibroblasts. Cell viability was measured using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Results. Both adhesives were moderately toxic for HGF cells on the first day of the experiment, but the TiO2-containing adhesive produced significantly lower toxicity than the pure adhesive (P0.05. There was a significant reduction in cell toxicity with increasing pre-incubation time (P<0.001. L929 cells showed similar toxicity trends, but lower sensitivity to detect cytotoxicity of dental composites. Conclusion. The orthodontic adhesive containing TiO2 nano-particles indicated comparable or even lower toxicity than its nano-particle-free counterpart, indicating that incorporation of 1 wt% TiO2 nano-particles to the composite structure does not result in additional health hazards compared to that occurring with the pure adhesive.
International Nuclear Information System (INIS)
Huget, R.P.; Flad, H.D.; Opitz, H.G.
1977-01-01
L1210 cells and their culture supernatants were found to inhibit the generation of PFC in the in vitro primary immune response of spleen cells to SRBC. As few as 1 percent of L1210 cells and 1 percent of culture fluid were inhibitory. Inhibition of DNA or protein synthesis of L1210 cells did not abolish their immunosuppressive activity, excluding exhaustion of culture medium as a possible mechanism of inhibition of PFC. Heating of the supernatant completely abrogated the suppressive effect and resulted in a marked increase of PFC. Daily evaluation of cell viability in the cultures revealed that, in the presence of L1210 and supernatants, the fraction of surviving cells is markedly reduced. We conclude that a direct cytotoxic effect on splenic lymphocytes and macrophages is the predominant immunosuppressive mechanism of L1210 cells and their culture supernatants
Analysis of the Effects of Cell Stress and Cytotoxicity on In ...
Chemical toxicity can arise from disruption of specific biomolecular functions or through more generalized cell stress and cytotoxicity-mediated processes. Here, concentration-dependent responses of 1063 chemicals including pharmaceuticals, natural products, pesticidals, consumer, and industrial chemicals across a diverse battery of 821 in vitro assay endpoints from 7 high-throughput assay technology platforms were analyzed in order to better distinguish between these types of activities. Both cell-based and cell-free assays showed a rapid increase in the frequency of responses at concentrations where cell stress / cytotoxicity responses were observed in cell-based assays. Chemicals that were positive on at least two viability/cytotoxicity assays within the concentration range tested (typically up to 100 M) activated a median of 12% of assay endpoints while those that were not cytotoxic in this concentration range activated 1.3% of the assays endpoints. The results suggest that activity can be broadly divided into: (1) specific biomolecular interactions against one or more targets (e.g., receptors or enzymes) at concentrations below which overt cytotoxicity-associated activity is observed; and (2) activity associated with cell stress or cytotoxicity, which may result from triggering of specific cell stress pathways, chemical reactivity, physico-chemical disruption of proteins or membranes, or broad low-affinity non-covalent interactions. Chemicals showing a g
Riedl, Sabrina; Rinner, Beate; Schaider, Helmut; Liegl-Atzwanger, Bernadette; Meditz, Katharina; Preishuber-Pflügl, Julia; Grissenberger, Sarah; Lohner, Karl; Zweytick, Dagmar
2017-09-22
Di-peptides derived from the human host defense peptide lactoferricin were previously described to specifically interact with the negatively charged lipid phosphatidylserine exposed by cancer cells. In this study one further derivative, namely R-DIM-P-LF11-334 is shown to exhibit even increased cancer toxicity in vitro and in vivo while non-neoplastic cells are not harmed. In liposomal model systems composed of phosphatidylserine mimicking cancerous and phosphatidylcholine mimicking non-cancerous membranes the specific interaction with the cancer marker PS was confirmed by specific induction of membrane perturbation and permeabilization in presence of the peptide. In vitro studies with cell lines of human malignant melanoma, such as A375, or primary cells of human melanoma metastases to the brain, as MUG Mel1, and non-neoplastic human dermal fibroblasts NHDF revealed high cytotoxic effect of R-DIM-P-LF11-334 on melanoma cells of A375 and MUG Mel1, whereas only minor effect on the dermal fibroblasts NHDF was observed, yielding an about 20-fold killing-specificity for A375 and MUG-Mel1. The LC 50 values for melanoma A375 and MUG Mel1 were about 10 μM. Analysis of secondary structure of the peptide revealed an increase in the proportion of β-sheets exclusively in presence of the cancer mimic. Stability studies further indicated a potential adequate stability in blood or under stringent conditions. Importantly the cytotoxic effect on cancer cells was also proven in vivo in mouse xenografts of human melanoma, where peptide treatment induced strong tumor regression and in average a tumor area reduction of 85% compared to tumors of control mice without peptide treatment.
In vitro cytotoxic, genotoxic and antioxidant/oxidant effects of guaiazulene on human lymphocytes
Directory of Open Access Journals (Sweden)
Başak Toğar
2015-02-01
Full Text Available The aim of this study was to evaluate for the cytotoxicity, genotoxicity and antioxidant/oxidant activity of GYZ on human peripheral blood lymphocytes (PBLs. Guaiazulene (GYZ was added into culture tubes at various concentrations (0-400 µg/mL-1. Cytotoxicity against the human lymphocytes cultures was examined by lactate dehydrogenase (LDH release assay. The proliferative response was estimated by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay. Antioxidant/oxidant activity was evaluated by measuring the total oxidant status (TOS and total antioxidant capacity (TAC levels. Micronucleus (MN and chromosomal aberration (CA tests were used in genotoxicity studies. The results showed that GYZ caused cytotoxicity in the PBLs at high concentrations, but TOS level were not affected, while the level of TAC was significantly increased. GYZ also did not induce chromosomal aberrations when compared to that of the control group. Results this study clearly revealed that GYZ was not genotoxic and also increased the capacity of the antioxidant in the culture of human PBL cells. This report is first report on the impact of GYZ on human PBL cells.
Directory of Open Access Journals (Sweden)
Tripti Mishra
Full Text Available Betula utilis, also known as Himalayan silver birch has been used as a traditional medicine for many health ailments like inflammatation, HIV, renal and bladder disorders as well as many cancers from ages. Here, we performed bio-guided fractionation of Betula utilis Bark (BUB, in which it was extracted in methanol and fractionated with hexane, ethyl acetate, chloroform, n-butanol and water. All six fractions were evaluated for their in-vitro anticancer activity in nine different cancer cell lines and ethyl acetate fraction was found to be one of the most potent fractions in terms of inducing cytotoxic activity against various cancer cell lines. By utilizing column chromatography, six triterpenes namely betulin, betulinic acid, lupeol, ursolic acid (UA, oleanolic acid and β-amyrin have been isolated from the ethyl acetate extract of BUB and structures of these compounds were unraveled by spectroscopic methods. β-amyrin and UA were isolated for the first time from Betula utilis. Isolated triterpenes were tested for in-vitro cytotoxic activity against six different cancer cell lines where UA was found to be selective for breast cancer cells over non-tumorigenic breast epithelial cells (MCF 10A. Tumor cell selective apoptotic action of UA was mainly attributed due to the activation of extrinsic apoptosis pathway via up regulation of DR4, DR5 and PARP cleavage in MCF-7 cells over non-tumorigenic MCF-10A cells. Moreover, UA mediated intracellular ROS generation and mitochondrial membrane potential disruption also play a key role for its anti cancer effect. UA also inhibits breast cancer migration. Altogether, we discovered novel source of UA having potent tumor cell specific cytotoxic property, indicating its therapeutic potential against breast cancer.
Directory of Open Access Journals (Sweden)
JF Sanchez-Suarez
2013-03-01
Full Text Available Background: The leishmanicidal and cytotoxic activity of ten essential oils obtained from ten plant specimens were evaluated.Methods: Essential oils were obtained by the steam distillation of plant leaves without any prior processing. Cytotoxicity was tested on J774 macrophages and leishmanicidal activity was assessed against four species of Leishmania associated with cutaneous leishmaniasis. Results: Seven essential oils exhibited activity against Leishmania parasites, five of which were toxic against J774 macrophages. Selectivity indices of >6 and 13 were calculated for the essential oils of Ocimum basilicum and Origanum vulgare, respectively.Conclusion: The essential oil of Ocimum basilicum was active against promastigotes of Leishmania and innocuous to J774 macrophages at concentrations up to 1600 µg/mL and should be further investigated for leishmanicidal activity in others in vitro and in vivo experimental models.
Directory of Open Access Journals (Sweden)
Geethashri Anand
2015-01-01
Full Text Available Background: Oral health is an integral and important component of general health. Infectious diseases such as caries, periodontal, and gingivitis indicate the onset of imbalance in homeostasis between oral micro biota and host. The present day medicaments used in oral health care have numerous side effects. The uses of herbal plants as an alternative have gained popularity due to side effects of antibiotics and emergence of multidrug resistant strains. Anacardium occidentale (cashew and Mangifera indica (mango have been used as traditional oral health care measures in India since time immemorial. Materials and Methods: The ethanol extracts of cashew and mango leaves were obtained by maceration method. The antimicrobial activity was evaluated by clear zone produced by these plant extracts against Enterococcus faecalis, Staphylococcus aureus, Streptococcus mutans, Escherichia coli, and Candida albicans in agar plate method, determination of minimum inhibitory concentration (MIC, minimum bactericidal/fungicidal concentration (MBC/MFC, and suppression of biofilm. The cytotoxic effects of plants extract was determined by microculture tetrazolium assay on human gingival fibroblast and Chinese hamster lung fibroblast (V79 cell lines. Results: Cashew and mango leaf extract significantly (P < 0.05 produced larger zone of inhibition against test pathogens when compared to povidone---iodine-based mouth rinses. Although the MIC and MBC/MFC values of mouth rinses were effective in lower concentrations; plant extracts significantly (P < 0.001 suppressed the biofilms of oral pathogens. The leaf extracts were less cytotoxic (P < 0.001 compared to mouth rinses. Conclusions: Plant extracts are superior to the mouth rinses and have a promising role in future oral health care.
A rapid in vitro screening system for the identification and evaluation of anticancer drugs
International Nuclear Information System (INIS)
Kao, J.W.; Collins, J.L.
1989-01-01
We report the development of an in vitro screening system that can be used to identify new anticancer drugs that are specifically cytotoxic for dividing cells. The screening system takes advantage of the potential of many cell lines, including tumor cells, to stop dividing when they are plated at high cell density. The cytotoxic effects of anticancer drugs on dividing (i.e., cells plated at low cell density) and nondividing cells (i.e., cells plated at high cell density) is measured by the incorporation of 51Cr. This in vitro system was evaluated by measuring the cytotoxic effects of the anticancer drugs cisplatin, thiotepa, doxorubicin, methotrexate, and vinblastine on the cell lines B/C-N, ME-180, and MCF-7. In this in vitro system the concentrations of the anticancer drugs that produced significant cytotoxicity on only dividing cells are similar to the concentrations that are used clinically. The fact that this in vitro system is rapid, simple, applicable to many cell types, and able to predict effective concentrations of anticancer drugs should make it useful for the screening of new anticancer drugs and for the design of preclinical studies
François, G; Passreiter, C M; Woerdenbag, H J; Van Looveren, M
1996-04-01
Aqueous and lipophilic extracts of Neurolaena lobata (Asteraceae), obtained from Guatemala, were tested against Plasmodium falciparum in vitro. Moreover, sesquiterpene lactones, of the germacranolide and furanoheliangolide type, isolated from N. lobata, were shown to be active against P. falciparum in vitro. In addition to their antiplasmodial activity, their cytotoxic effects on human carcinoma cell lines were evaluated. Structure-activity relationships are discussed.
Cytotoxicity, DNA binding and localisation of novel bis-naphthalimidopropyl polyamine derivatives.
Pavlov, V; Kong Thoo Lin, P; Rodilla, V
2001-07-31
Bis-naphthalimidopropyl spermidine (BNIPSpd), spermine (BNIPSpm) and oxa-spermine (BNIPOSpm) showed high in vitro cytotoxicity against human breast cancer MCF-7 cells with IC(50) values of 1.38, 2.91 and 8.45 microM, respectively. These compounds were found to effectively displace the intercalating agent ethidium bromide bound to the calf thymus DNA using fluorimetric methods (C(50) 0.08-0.12 microM) and their apparent equilibrium binding constants (K(app)) were calculated to be in the range of 10.5-18 x 10(7) M(-1). Furthermore, strong stabilisation of calf thymus DNA duplex in the presence of bis-naphthalimidopropyl polyamine derivatives (BNIPSpd, BNIPSpm and BNIPOSpm) was observed by UV spectrophotometric analysis (T(m)=93.3-97 degrees C compared with 75 degrees C for calf thymus DNA without drug). Because of their inherent fluorescence, these compounds were localised preferentially inside the nucleus as evidenced by their direct observation under the fluorescence microscope. The results obtained suggest that the cytotoxic activity of the bis-naphthalimidopropyl polyamines may be in part, caused by their effects on DNA.
Sánchez-Fernández, Antonio; Peña-Parás, Laura; Vidaltamayo, Román; Cué-Sampedro, Rodrigo; Mendoza-Martínez, Ana; Zomosa-Signoret, Viviana C; Rivas-Estilla, Ana M; Riojas, Paulina
2014-12-04
Halloysite is an aluminosilicate clay that has been widely used for controlled drug delivery, immobilization of enzymes, and for the capture of circulating tumor cells (CTCs). Surface modification of halloysite by organosilanes has been explored to improve their properties. In this study halloysite clay nanotubes (HNTs) were functionalized by two different organosilanes: Trimethoxy(propyl)silane (TMPS), and Triethoxy(octyl)silane (EOS). Untreated and modified samples were characterized by scanning electron microscopy (SEM), X-ray diffractometry (XRD), thermogravimetrical analysis (TGA), and Fourier transform infrared spectroscopy (FTIR). Results showed a strong interaction of organosilanes with the chemical groups present in HNTs. Biocompatibility and cytotoxicity of these nanomaterials were determined using C6 rat glioblastoma cells. Our results indicate that prior to functionalization, HNTs show a high biocompatibility and low cytotoxicity. However, HNTs functionalized with EOS and TMPS showed high cytotoxicity by inducing apoptosis. These results allow the identification of potential applications in biomedical areas for HNTs.
Directory of Open Access Journals (Sweden)
Antonio Sánchez-Fernández
2014-12-01
Full Text Available Halloysite is an aluminosilicate clay that has been widely used for controlled drug delivery, immobilization of enzymes, and for the capture of circulating tumor cells (CTCs. Surface modification of halloysite by organosilanes has been explored to improve their properties. In this study halloysite clay nanotubes (HNTs were functionalized by two different organosilanes: Trimethoxy(propylsilane (TMPS, and Triethoxy(octylsilane (EOS. Untreated and modified samples were characterized by scanning electron microscopy (SEM, X-ray diffractometry (XRD, thermogravimetrical analysis (TGA, and Fourier transform infrared spectroscopy (FTIR. Results showed a strong interaction of organosilanes with the chemical groups present in HNTs. Biocompatibility and cytotoxicity of these nanomaterials were determined using C6 rat glioblastoma cells. Our results indicate that prior to functionalization, HNTs show a high biocompatibility and low cytotoxicity. However, HNTs functionalized with EOS and TMPS showed high cytotoxicity by inducing apoptosis. These results allow the identification of potential applications in biomedical areas for HNTs.
Two new alkaloids from Portulaca oleracea and their cytotoxic activities.
Tian, Jin-Long; Liang, Xiao; Gao, Pin-Yi; Li, Dan-Qi; Sun, Qian; Li, Ling-Zhi; Song, Shao-Jiang
2014-01-01
Two new alkaloids named (3R)-3,5-bis(3-methoxy-4-hydroxyphenyl)-2,3-dihydro-2(1H)-pyridinone (1) and 1,5-dimethyl-6-phenyl-1,2-dihydro-1,2,4-triazin-3(2H)-one (2), together with two known compounds (7'R)-N-feruloyl normetanephrine (3) and N-trans-feruloyl tyramine (4) were isolated from the air-dried aerial parts of Portulaca oleracea L. Their structures and configurations were elucidated by spectroscopic methods including 1D NMR, 2D NMR, and HR-MS techniques. In addition, compounds 1-4 were tested for in vitro cytotoxic activities against human lung (K562 and A549) and breast (MCF-7 and MDA-MB-435) cancer cell lines.
Quantitative structure-cytotoxicity relationship of phenylpropanoid amides.
Shimada, Chiyako; Uesawa, Yoshihiro; Ishihara, Mariko; Kagaya, Hajime; Kanamoto, Taisei; Terakubo, Shigemi; Nakashima, Hideki; Takao, Koichi; Saito, Takayuki; Sugita, Yoshiaki; Sakagami, Hiroshi
2014-07-01
A total of 12 phenylpropanoid amides were subjected to quantitative structure-activity relationship (QSAR) analysis, based on their cytotoxicity, tumor selectivity and anti-HIV activity, in order to investigate on their biological activities. Cytotoxicity against four human oral squamous cell carcinoma (OSCC) cell lines and three human oral normal cells was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. Tumor selectivity was evaluated by the ratio of the mean CC50 (50% cytotoxic concentration) against normal oral cells to that against OSCC cell lines. Anti-HIV activity was evaluated by the ratio of CC50 to EC50 (50% cytoprotective concentration from HIV infection). Physicochemical, structural, and quantum-chemical parameters were calculated based on the conformations optimized by the LowModeMD method followed by density functional theory (DFT) method. Twelve phenylpropanoid amides showed moderate cytotoxicity against both normal and OSCC cell lines. N-Caffeoyl derivatives coupled with vanillylamine and tyramine exhibited relatively higher tumor selectivity. Cytotoxicity against normal cells was correlated with descriptors related to electrostatic interaction such as polar surface area and chemical hardness, whereas cytotoxicity against tumor cells correlated with free energy, surface area and ellipticity. The tumor-selective cytotoxicity correlated with molecular size (surface area) and electrostatic interaction (the maximum electrostatic potential). The molecular size, shape and ability for electrostatic interaction are useful parameters for estimating the tumor selectivity of phenylpropanoid amides. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Düsman, E; Almeida, I V; Pinto, E P; Lucchetta, L; Vicentini, V E P
2017-05-31
Integral grape juice is extracted from the grape through processes that allow the retention of their natural composition. However, due to the severity of some processes, fruit juices can undergo changes in their quality. The present study evaluated the cytotoxic and mutagenic effects of integral grape juice by a cytokinesis-blocked micronucleus assay in Rattus norvegicus hepatoma cells (HTC) in vitro. Vitis labrusca L. (variety Concord) were produced organically and by a conventional system, and their juice was extracted by a hot extraction process. The organic grapes were subjected to ultraviolet-type C radiation (UV-C). Experiments were performed after production and after 6 months in storage. Physicochemical analyses revealed that UV-C irradiation of organic grapes, the juice production process, and storage resulted in nutraceutical alterations. However, none of the juice concentrations were cytotoxic to HTC cells by the cytokinesis-blocked proliferation index results or were mutagenic, because the formation of micronucleated cells was not induced. In general, juice induced cell proliferation, possibly due to the presence of vitamins and sugar content (total soluble solid). The data increased the understanding of food technology and confirmed the quality and safety consumption of these juices.
Directory of Open Access Journals (Sweden)
GITTITH SÁNCHEZ
2002-01-01
Full Text Available The aim of the present study was to study the trypanocidal activity of nanoparticles loaded with nifurtimox in comparison with the free drug against Trypanosoma cruzi, responsible for Chagas' disease. Ethylcyanoacrylate nanoparticles acted as the delivery system into cells. As the obligate replicative intracellular form is amastigote, in vitro studies were performed on this form of parasite as well as on cell culture derived trypomastigotes. The fluorescence method used here was very useful as it allowed for the simultaneous study of trypanocide activity and cytotoxicity by determining living or dead parasites within living or dead host cells. According to these results, the greatest trypanocide activity on cell culture-derived trypomastigotes was recorded for nifurtimox-loaded nanoparticles with a 50% inhibitory concentration (IC50 twenty times less than that of the free drug. The cytotoxycity of unloaded nanoparticles at low concentrations was similar to that obtained by free drug when evaluated on Vero cells. Furthermore, nifurtimox-loaded nanoparticles showed increased trypanocide activity on intracellular amastigotes with an IC50 thirteen times less than that of nifurtimox. We also observed that the unloaded nanoparticles possess the previously-described trypanocide activity, similar to the standard solution of nifurtimox, although the mechanism for this has not yet been elucidated. In conclusion, it was possible to establish in vitro conditions using nifurtimox encapsulated nanoparticles in order to decrease the doses of the drug and thus to obtain high trypanocidal activity on both free trypomastigotes and intracellular amastigotes with low cytotoxicity for the host cell.
Sleijfer, S; Le, T. K. P.; de Jong, S.; Timmer-Bosscha, H; Withoff, S; Mulder, NH
Several studies suggest that tumor necrosis factor-alpha (TNF) is able to overcome drug resistance in tumors. Whether TNF is able to do so in tumor cell lines that are drug resistant due to a mutation in the tumor suppressor gene p53 is unclear. Therefore, we studied the in vitro cytotoxic effects
DEFF Research Database (Denmark)
Bengtson, Stefan; Kling, Kirsten; Madsen, Anne Mette
2016-01-01
Graphene and graphene oxide receive much attention these years, because they add attractive properties to a wide range of applications and products. Several studies have shown toxicological effects of other carbon‐based nanomaterials such as carbon black nanoparticles and carbon nanotubes in vitro...... and in vivo. Here, we report in‐depth physicochemical characterization of three commercial graphene materials, one graphene oxide (GO) and two reduced graphene oxides (rGO) and assess cytotoxicity and genotoxicity in the murine lung epithelial cell line FE1. The studied GO and rGO mainly consisted of 2......–3 graphene layers with lateral sizes of 1–2 µm. GO had almost equimolar content of C, O, and H while the two rGO materials had lower contents of oxygen with C/O and C/H ratios of 8 and 12.8, respectively. All materials had low levels of endotoxin and low levels of inorganic impurities, which were mainly...
Galuska, Sebastian P; Galuska, Christina E; Tharmalingam, Tharmala; Zlatina, Kristina; Prem, Gerlinde; Husejnov, Farzali C O; Rudd, Pauline M; Vann, Willie F; Reid, Colm; Vionnet, Justine; Gallagher, Mary E; Carrington, Faye A; Hassett, Sarah-Louise; Carrington, Stephen D
2017-06-01
Neutrophil extracellular traps (NET) are formed against pathogens. However, various diseases are directly linked to this meshwork of DNA. The cytotoxic properties of extracellular histones especially seem to be an important trigger during these diseases. Furthermore, NET accumulation on implants is discussed to result in an impaired efficiency or failure, depending on the category of implant. Interestingly, mucins have been investigated as surface coatings potentially capable of reducing neutrophil adhesion. Similarly, polysialic acid was shown to inactivate the cytotoxic properties of extracellular histones. We wanted to combine the probability to decrease the adhesion of neutrophils using mucins with the capability of sialic acid polymers to counteract histone-mediated cytotoxicity. To this end, we elongate cervical mucins using bacterial polysialyltransferases. Subsequent cell-based experiments demonstrated the activity of elongated mucins against histone-mediated cytotoxicity. Thus, polysialylated mucins may represent a novel component to coat implants or to combat diseases with exaggerated NET formation. © 2017 Federation of European Biochemical Societies.
In vitro screening for population variability in toxicity of pesticide-containing mixtures
Abdo, Nour; Wetmore, Barbara A.; Chappell, Grace A.; Shea, Damian; Wright, Fred A.; Rusyna, Ivan
2016-01-01
Population-based human in vitro models offer exceptional opportunities for evaluating the potential hazard and mode of action of chemicals, as well as variability in responses to toxic insults among individuals. This study was designed to test the hypothesis that comparative population genomics with efficient in vitro experimental design can be used for evaluation of the potential for hazard, mode of action, and the extent of population variability in responses to chemical mixtures. We selected 146 lymphoblast cell lines from 4 ancestrally and geographically diverse human populations based on the availability of genome sequence and basal RNA-seq data. Cells were exposed to two pesticide mixtures – an environmental surface water sample comprised primarily of organochlorine pesticides and a laboratory-prepared mixture of 36 currently used pesticides – in concentration response and evaluated for cytotoxicity. On average, the two mixtures exhibited a similar range of in vitro cytotoxicity and showed considerable inter-individual variability across screened cell lines. However, when in vitroto-in vivo extrapolation (IVIVE) coupled with reverse dosimetry was employed to convert the in vitro cytotoxic concentrations to oral equivalent doses and compared to the upper bound of predicted human exposure, we found that a nominally more cytotoxic chlorinated pesticide mixture is expected to have greater margin of safety (more than 5 orders of magnitude) as compared to the current use pesticide mixture (less than 2 orders of magnitude) due primarily to differences in exposure predictions. Multivariate genome-wide association mapping revealed an association between the toxicity of current use pesticide mixture and a polymorphism in rs1947825 in C17orf54. We conclude that a combination of in vitro human population-based cytotoxicity screening followed by dosimetric adjustment and comparative population genomics analyses enables quantitative evaluation of human health hazard
Niemiec, Tomasz; Dudek, Mariusz; Dziekan, Natalia; Jaworski, Sławomir; Przewozik, Aleksandra; Soszka, Emilia; Koperkiewicz, Anna; Koczoń, Piotr
2017-07-01
The coating of nanoparticles on materials for medical application [e.g., the coating of Fe3O4 nanopowder (IONP) with a carbon nanolayer] serves to protect and modify the selected biological, physical, and chemical properties of the coated material. Increases in chemical stability, changes in biocompatibility, and a modified surface structure are examples of the effects caused by the formation of carbon coatings. In the current study, Fe3O4 nanoparticles were coated with a carbon nanolayer (IONP@C) in a plasmochemical reactor (using radio-frequency plasma-enhanced chemical vapor deposition methods) under various experimental conditions. Based on data from X-ray diffraction, Raman, and IR spectroscopy, the best processing parameters were determined in order to produce a carbon coating that would not change the structure of the IONP. The materials with the best cover, i.e., a uniform carbon nanolayer, were used in cytotoxic tests to investigate their biological properties using the human HepG2 hepatocarcinoma cell line and chicken embryo red blood cells as an in vitro model. The obtained results proved the low cytotoxicity of Fe3O4 micropowder and IONP in contrast to IONP@C, which reduced cell viability, increased hemolysis, and generally was more toxic than bare Fe3O4.
International Nuclear Information System (INIS)
Cordes, N.; Beinke, C.; Beuningen, D. van; Plasswilm, L.
2004-01-01
Background and purpose: interactions of cells with a substratum, especially extracellular matrix proteins, initiate clustering of integrin receptors in the cell membrane. This process represents the initial step for the activation of signaling pathways regulating survival, proliferation, differentiation, adhesion, and migration, and could, furthermore, be important for cellular resistance-mediating mechanisms against radiation or cytotoxic drugs. The lack of data elucidating the impact of irradiation or cytotoxic drugs on this important phenomenon led to this study on human A549 lung cancer cells in vitro. Material and methods: the human lung carcinoma cell line A549 grown on polystyrene or fibronectin (FN) was irradiated with 0-8 Gy or treated with cisplatin (0.1-50 μM), paclitaxel (0.1-50 nM), or mitomycin (0.1-50 μM). Colony formation assays, immunofluorescence staining in combination with activation of integrin clustering using anti-β 1 -integrin antibodies (K20), and Western blotting for tyrosine phosphorylation under treatment of cells with the IC 50 for irradiation (2 Gy; IC 50 = 2.2 Gy), cisplatin (2 μM), paclitaxel (5 nM), or mitomycin (7 μM) were performed. Results: attachment of cells to FN resulted in a significantly reduced radio- and chemosensitivity compared to polystyrene. The clustering of β 1 -integrins examined by immunofluorescence staining was only stimulated by irradiation, cisplatin, paclitaxel, or mitomycin in case of cell attachment to FN. By contrast, tyrosine phosphorylation, as one of the major events following β 1 -integrin clustering, showed a 3.7-fold, FN-related enhancement, and treatment of cells with the IC 50 of radiation, cisplatin, paclitaxel, or mitomycin showed a substratum-dependent induction. Conclusion: for the first time, a strong influence of irradiation and a variety of cytotoxic drugs on the clustering of β 1 -integrins could be shown. This event is a prerequisite for tyrosine phosphorylation and, thus, the
Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants
Directory of Open Access Journals (Sweden)
Celha Borges Costa Alves
Full Text Available ABSTRACT Objective: To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Methods: Six mini-implants (Conexão(tm, Neodent(tm and SIN(tm were separately immersed in artificial saliva (pH 6.76 for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM. The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p < 0.05 considered significant. Statistical analysis was carried out with Graph Pad PRISM software Version 4.0. Results: No changes in cell viability or morphology were observed. Mini-implants SEM images revealed smooth surfaces with no obvious traces of corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Conclusion: Orthodontic mini-implants manufactured by Conexão(tm, Neodent(tm and SIN(tm present high corrosion resistance and are not cytotoxic.
Reprint of: Improved cytotoxicity testing of magnesium materials
International Nuclear Information System (INIS)
Fischer, Janine; Pröfrock, Daniel; Hort, Norbert; Willumeit, Regine; Feyerabend, Frank
2011-01-01
Metallic magnesium (Mg) and its alloys are highly suitable for medical applications as biocompatible and biodegradable implant materials. Magnesium has mechanical properties similar to bone, stimulates bone regeneration, is an essential non-toxic element for the human body and degrades completely within the body environment. In consequence, magnesium is a promising candidate as implant material for orthopaedic applications. Protocols using the guideline of current ISO standards should be carefully evaluated when applying them for the characterization of the cytotoxic potential of degradable magnesium materials. For as-cast material we recommend using 10 times more extraction medium than recommended by the ISO standards to obtain reasonable results for reliable cytotoxicity rankings of degradable materials in vitro. In addition primary isolated human osteoblasts or mesenchymal stem cells should be used to test magnesium materials.
Reprint of: Improved cytotoxicity testing of magnesium materials
Energy Technology Data Exchange (ETDEWEB)
Fischer, Janine [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Structural Research on Macromolecules, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Proefrock, Daniel [Helmholtz-Zentrum Geesthacht, Institute for Coastal Research, Department for Marine Bioanalytical Chemistry, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Hort, Norbert [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Magnesium Processing, Max-Planck Str. 1, D - 21502 Geesthacht (Germany); Willumeit, Regine; Feyerabend, Frank [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Department for Structural Research on Macromolecules, Max-Planck Str. 1, D - 21502 Geesthacht (Germany)
2011-12-15
Metallic magnesium (Mg) and its alloys are highly suitable for medical applications as biocompatible and biodegradable implant materials. Magnesium has mechanical properties similar to bone, stimulates bone regeneration, is an essential non-toxic element for the human body and degrades completely within the body environment. In consequence, magnesium is a promising candidate as implant material for orthopaedic applications. Protocols using the guideline of current ISO standards should be carefully evaluated when applying them for the characterization of the cytotoxic potential of degradable magnesium materials. For as-cast material we recommend using 10 times more extraction medium than recommended by the ISO standards to obtain reasonable results for reliable cytotoxicity rankings of degradable materials in vitro. In addition primary isolated human osteoblasts or mesenchymal stem cells should be used to test magnesium materials.
Singh, Ranjana; Mishra, Vijay K.; Singh, Hemant K.; Sharma, Gunjan; Koch, Biplob; Singh, Bachcha; Singh, Ranjan K.
2018-03-01
Acrylamide (acr) is a potential toxic molecule produced in thermally processed food stuff. Acr-Mg complex has been synthesized chemically and characterized by spectroscopic techniques. The binding sites of acr with Mg were identified by experimental and computational methods. Both experimental and theoretical results suggest that Mg coordinated with the oxygen atom of Cdbnd O group of acr. In-vitro cytotoxicity studies revealed significant decrease in the toxic level of acr-Mg complex as compared to pure acr. The decrease in toxicity on complexation with Mg may be a useful step for future research to reduce the toxicity of acr.
van Luyn, M.J.A.; van Wachem, P.B.; Olde damink, L.H.H.; Olde Damink, L.H.H.; Dijkstra, Pieter J.; Feijen, Jan; Nieuwenhuis, P.
1992-01-01
We investigated commercially available dermal sheep collagen either cross-linked with hexamethylenediisocyanate, or cross-linked with glutaraldehyde. In previous in vitro studies we could discriminate primary, i.e. extractable, and secondary cytotoxicity, due to cell-biomaterial interactions, i.e.
Biological evaluation of dental materials, in vitro and in vivo
International Nuclear Information System (INIS)
Kawahara, H.
1982-01-01
In this paper, the correlation between the user of tissue culture for in vitro tests and the tissue irritability and pupal response observed in in vitro tests, will be discussed. It would produce confusion if dental materials were standardised with the unreliable parameter of the living system in dynamic balance. Biological tests, both in vitro and in vivo, should be used for pre-standards testing, without any political control to establish physicochemical standards. As a first step, corrosion tests and the dissolution dosje of toxic components from the material in the tissue culture medium and/or artificial salvia should be standardised under conditions simulating the oral environment. The CNC method and photo-pattern analysis are used for the interpretation of cytotoxicity. The need for biological testing, both in vitro and in vivo, definitely exists in order to obtain physicochemical standards, with a biological simulation depending upon the feedback obtained from the results of in vitro and in vivo tests
Anand, Geethashri; Ravinanthan, Manikandan; Basaviah, Ravishankar; Shetty, A Veena
2015-01-01
Oral health is an integral and important component of general health. Infectious diseases such as caries, periodontal, and gingivitis indicate the onset of imbalance in homeostasis between oral micro biota and host. The present day medicaments used in oral health care have numerous side effects. The uses of herbal plants as an alternative have gained popularity due to side effects of antibiotics and emergence of multidrug resistant strains. Anacardium occidentale (cashew) and Mangifera indica (mango) have been used as traditional oral health care measures in India since time immemorial. The ethanol extracts of cashew and mango leaves were obtained by maceration method. The antimicrobial activity was evaluated by clear zone produced by these plant extracts against Enterococcus faecalis, Staphylococcus aureus, Streptococcus mutans, Escherichia coli, and Candida albicans in agar plate method, determination of minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration (MBC/MFC), and suppression of biofilm. The cytotoxic effects of plants extract was determined by microculture tetrazolium assay on human gingival fibroblast and Chinese hamster lung fibroblast (V79) cell lines. Cashew and mango leaf extract significantly (P < 0.05) produced larger zone of inhibition against test pathogens when compared to povidone-iodine-based mouth rinses. Although the MIC and MBC/MFC values of mouth rinses were effective in lower concentrations; plant extracts significantly (P < 0.001) suppressed the biofilms of oral pathogens. The leaf extracts were less cytotoxic (P < 0.001) compared to mouth rinses. Plant extracts are superior to the mouth rinses and have a promising role in future oral health care.
Synthesis and in vitro cytotoxicity of mPEG-SH modified gold nanorods
Didychuk, Candice L.; Ephrat, Pinhas; Belton, Michelle; Carson, Jeffrey J. L.
2008-02-01
Plasmon-resonant gold nanorods show great potential as an agent for contrast-enhanced biomedical imaging or for phototherapeutics. This is primarily due to the high molar extinction coefficient at the absorption maximum and the dependence of the wavelength of the absorption maximum on the aspect ratio, which is tunable in the near-infrared (NIR) during synthesis. Although gold nanorods can be produced in high-yield through the seed-mediated growth technique, the presence of residual cetyltrimethylammonium bromide (CTAB), a stabilizing surfactant required for nanorod growth, interferes with cell function and causes cytotoxicity. To overcome this potential obstacle to in vivo use, we synthesized gold nanorods and conjugated them to a methoxy (polyethylene glycol)-thiol (mPEG (5000)-SH). This approach yielded mPEG-SH modified gold nanorods with optical and morphometric properties that were similar to raw (CTAB) nanorods. Both the CTAB and mPEG-SH nanorods were tested for cytotoxicity against the HL-60 human leukemia cell line by trypan blue exclusion, and the mPEG-SH modified gold nanorods were also tested against a rat insulinoma (RIN-38) and squamous cell carcinoma (SCCVII) cell line. Cells incubated for 24 h with the mPEG-SH modified nanorods had little change in cell viability compared to cells incubated with vehicle alone. This was in contrast to cytotoxicity of CTAB nanorods on HL-60 cells. These results suggest that mPEG-SH modified gold nanorods are better suited for cell loading protocols and injection into animals and facilitate their use for imaging and phototherapeutic purposes.
In vitro assessment of cytotoxic activities of Lachesis muta muta snake venom.
Directory of Open Access Journals (Sweden)
Stephanie Stransky
2018-04-01
Full Text Available Envenomation by the bushmaster snake Lachesis muta muta is considered severe, characterized by local effects including necrosis, the main cause of permanent disability. However, cellular mechanisms related to cell death and tissue destruction, triggered by snake venoms, are poorly explored. The purpose of this study was to investigate the cytotoxic effect caused by L. m. muta venom in normal human keratinocytes and to identify the cellular processes involved in in cellulo envenomation. In order to investigate venom effect on different cell types, Alamar Blue assay was performed to quantify levels of cellular metabolism as a readout of cell viability. Apoptosis, necrosis and changes in mitochondrial membrane potential were evaluated by flow cytometry, while induction of autophagy was assessed by expression of GFP-LC3 and analyzed using fluorescence microscopy. The cytotoxic potential of the venom is shown by reduced cell viability in a concentration-dependent manner. It was also observed the sequential appearance of cells undergoing autophagy (by 6 hours, apoptosis and necrosis (12 and 24 hours. Morphologically, incubation with L. m. muta venom led to a significant cellular retraction and formation of cellular aggregates. These results indicate that L. m. muta venom is cytotoxic to normal human keratinocytes and other cell lines, and this toxicity involves the integration of distinct modes of cell death. Autophagy as a cell death mechanism, in addition to apoptosis and necrosis, can help to unravel cellular pathways and mechanisms triggered by the venom. Understanding the mechanisms that underlie cellular damage and tissue destruction will be useful in the development of alternative therapies against snakebites.
Directory of Open Access Journals (Sweden)
Josefa Antón
2007-07-01
Full Text Available Many cytotoxic compounds of therapeutic interest have been isolated from marine invertebrates, and some of them have been reported to be of microbial origin. Pyridoacridine alkaloids are the main compounds extracted from the ascidian Cystodytes dellechiajei. Here we describe the in vitro antiproliferative activity against different tumor cell lines of the ascidian extracts and provide some insights on the role of the microbial community associated with the tunicate in the production of these compounds. C. dellechiajei extracts showed remarkably high antiproliferative activity (IC50 ≤5 μg/mL in human lung carcinoma A-549, colon adenocarcinoma H-116, pancreatic adenocarcinoma PSN-1 and breast carcinoma SKBR3 cell lines. Moreover, we found that the maximum activity was located in the tunic tissue of the colony, which harbours a microbial community. In order to ascertain the involvement of this community in the synthesis of the bioactive compounds different approachs that included culture and culture independent methods were carried out. We undertook a screening for antiproliferative activities of the bacterial isolates from the ascidian, as well as a comprative analysis of the cytotoxic activities and the microbial communities from two color morphs of the ascidian, green and blue. In addition, the changes of the antiproliferative activities and the composition of the microbial communities were studied from ascidians kept in aquaria and treated with antibiotics for one month. Our data obtained from the different experiments did not point out to bacteria as the source of the cytotoxic compounds, suggesting thus an ascidian origin.
Schuch, Rodrigo Andrade; Oliveira, Thaís Larré; Collares, Thaís Farias; Monte, Leonardo Garcia; Inda, Guilherme Roig; Dellagostin, Odir Antonio; Vendruscolo, Claire Tondo; Moreira, Angelita da Silveira; Hartwig, Daiane Drawanz
2017-01-01
The successful production of new, safe, and effective vaccines that generate immunological memory is directly related to adjuvant feature, which is responsible for increasing and/or modulating the immune response. Several compounds display adjuvant activity, including carbohydrates. These compounds play important roles in the immune response, as well as having biocompatible properties in vaccine formulations. One such carbohydrate is xanthan gum, a polysaccharide that is produced by the plant-pathogenic bacterium Xanthomonas spp., which has adjuvant attributes. This study evaluated the immune response induced by xanthan gum associated with ovalbumin in BALB/c mice, which were subcutaneously immunized, in terms of antibody production (IgG1, IgG2a, IgG2b, and IgG3), and assessed the levels of IFN- γ in the splenocyte culture using indirect ELISA. Furthermore, we investigated in vitro cytotoxicity of xanthan in the embryo fibroblasts cell line of the NIH/3T3 mouse by MTT assay and propidium iodide uptake assay. The mice immunized with ovalbumin plus xanthan gum exhibited higher antibody IgG1 responses than control groups. Furthermore, the xanthan polysaccharide was capable of increasing the immunogenicity of antigens by producing IFN- γ and did not exhibit cytotoxicity effects in NIH/3T3 mouse fibroblast cells, considered a promising candidate for vaccine adjuvant.
Directory of Open Access Journals (Sweden)
Rodrigo Andrade Schuch
2017-01-01
Full Text Available The successful production of new, safe, and effective vaccines that generate immunological memory is directly related to adjuvant feature, which is responsible for increasing and/or modulating the immune response. Several compounds display adjuvant activity, including carbohydrates. These compounds play important roles in the immune response, as well as having biocompatible properties in vaccine formulations. One such carbohydrate is xanthan gum, a polysaccharide that is produced by the plant-pathogenic bacterium Xanthomonas spp., which has adjuvant attributes. This study evaluated the immune response induced by xanthan gum associated with ovalbumin in BALB/c mice, which were subcutaneously immunized, in terms of antibody production (IgG1, IgG2a, IgG2b, and IgG3, and assessed the levels of IFN-γ in the splenocyte culture using indirect ELISA. Furthermore, we investigated in vitro cytotoxicity of xanthan in the embryo fibroblasts cell line of the NIH/3T3 mouse by MTT assay and propidium iodide uptake assay. The mice immunized with ovalbumin plus xanthan gum exhibited higher antibody IgG1 responses than control groups. Furthermore, the xanthan polysaccharide was capable of increasing the immunogenicity of antigens by producing IFN-γ and did not exhibit cytotoxicity effects in NIH/3T3 mouse fibroblast cells, considered a promising candidate for vaccine adjuvant.
Leishmanicidal, antiplasmodial and cytotoxic activity of indole alkaloids from Corynanthe pachyceras
DEFF Research Database (Denmark)
Staerk, D; Lemmich, E; Christensen, J
2000-01-01
-NMR resonances by COSY and NOESY experiments. These and related alkaloids showed pronounced activity against Leishmania major promastigotes (IC50 at the micromolar level) but no significant in vitro antiplasmodial activity (against chloroquine-sensitive Plasmodium falciparum). Cytotoxicity assessed with drug...
Liu, Dun; Wang, Lijun; Wang, Zhigang; Cuschieri, Alfred
2012-07-01
To date, there has not been an agreement on the best methods for the characterisation of multi-walled carbon nanotube (MWCNT) toxicity. The length of MWCNTs has been identified as a factor in in vitro and in vivo studies, in addition to their purity and biocompatible coating. Another unresolved issue relates to the variable toxicity of MWCNTs on different cell types. The present study addressed the effects of MWCNTs' length on mammalian immune and epithelial cancer cells RAW264.7 and MCF-7, respectively. Our data confirm that MWCNTs induce cytotoxicity in a length- and cell type-dependent manner. Whereas, longer (3 to 14 μm) MWCNTs exert high toxicity, especially to RAW264.7 cells, shorter (1.5 μm) MWCNTs are significantly less cytotoxic. These findings confirm that the degree of biocompatibility of MWCNTs is closely related to their length and that immune cells appear to be more susceptible to damage by MWCNTs. Our study also indicates that MWCNT nanotoxicity should be analysed for various components of cellular response, and cytotoxicity data should be validated by the use of more than one assay system. Results from chromogenic-based assays should be confirmed by trypan blue exclusion.
Karanam, Vamshikrishna; Marslin, Gregory; Krishnamoorthy, Balakumar; Chellan, Vijayaraghavan; Siram, Karthik; Natarajan, Tamilselvan; Bhaskar, Balaji; Franklin, Gregory
2015-06-01
Carboplatin is a platinum based drug used in the treatment of several malignancies. Due to poor cellular uptake, generally, a larger dose of drug is administered to achieve therapeutic levels, causing harmful side-effects such as hematologic toxicity. In order to enhance the cellular uptake of carboplatin, we have developed carboplatin loaded nanoparticles using the biodegradable polymer poly (ɛ-caprolactone) (PCL). Nanoparticles ranging from the size of 23.77±1.37 to 96.73±2.79 nm with positive zeta potential and moderate entrapment efficiency (54.21±0.98%) were obtained. Transmission electron microscopy (TEM) and atomic force microscopy (AFM) confirmed the spherical morphology and smooth surface of all nanoformulations. The concentrations of PCL and the stabilizer (DMAB) are found to play a role in determining the size and the entrapment efficiency of the nanoparticles. Drug release from nanoparticles followed a biphasic pattern with an initial burst release followed by a sustained release for 10h. Results of in vitro cellular uptake and cytotoxicity studies revealed that carboplatin in the form of PCL-nanoparticles were efficiently up taken and displayed profound cytotoxicity to U-87 MG (human glioma) cells than the free drug. Importantly, unlike the free carboplatin, carboplatin in the form of PCL nanoparticles did not present any haemolytic activity in rat erythrocytes, a major side effect of this chemotherapeutic drug. This suggests that poly (ɛ-caprolactone) nanoencapsulation of carboplatin might be an efficient approach to treat cancer, while reducing carboplatin induced haemolysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Comparative study of cytotoxicity of direct metal laser sintered and cast Co-Cr-Mo dental alloy
Directory of Open Access Journals (Sweden)
T. Puskar
2015-07-01
Full Text Available The presented work investigated the cytotoxicity of direct metal laser sintered (DMLS and cast Co-Cr-Mo (CCM dental alloy. In vitro tests were done on human fibroblast cell line MRC-5. There was no statistically significant difference in the cytotoxic effects of DMLS and CCM alloy specimens. The results of this investigation show good potential of DMLS Co-Cr-Mo alloy for application in dentistry.
Nanoencapsulation of gallic acid and evaluation of its cytotoxicity and antioxidant activity.
de Cristo Soares Alves, Aline; Mainardes, Rubiana Mara; Khalil, Najeh Maissar
2016-03-01
Gallic acid is an important polyphenol compound presenting various biological activities. The objective of this study was to prepare, characterize and evaluate poly(lactic-co-glycolic acid) (PLGA) nanoparticles coated or not with polysorbate 80 (PS80) containing gallic acid. Nanoparticles coated or not with PS80 were produced by emulsion solvent evaporation method and presented a mean size of around 225 nm, gallic acid encapsulation efficiency of around 26% and zeta potential of -22 mV. Nanoparticle formulations were stable during storage, except nanoparticles coated with PS80 stored at room temperature. In vitro release profile demonstrated a quite sustained gallic acid release from nanoparticles and PS80-coating decreased drug release. Cytotoxicity over red blood cells was assessed and gallic acid-loaded PLGA nanoparticles at all analyzed concentrations demonstrated lack of hemolysis, while PS80-nanoparticles containing gallic acid were cytotoxic only in higher concentrations. Antioxidant potential of nanoparticles containing gallic acid was assessed and PLGA uncoated nanoparticles presented greater efficacy than PS80-coated PLGA nanoparticles. Copyright © 2015 Elsevier B.V. All rights reserved.
Maiyo, Fiona C; Moodley, Roshila; Singh, Moganavelli
2016-01-01
Moringa oleifera, from the family Moringaceae, is used as a source of vegetable and herbal medicine and in the treatment of various cancers in many African countries, including Kenya. The present study involved the phytochemical analyses of the crude extracts of M.oleifera and biological activities (antioxidant, cytotoxicity and induction of apoptosis in-vitro) of selected isolated compounds. The compounds isolated from the leaves and seeds of the plant were quercetin-3-O-glucoside (1), 4-(β-D-glucopyranosyl-1→4-α-L-rhamnopyranosyloxy)-benzyl isothiocyanate (2), lutein (3), and sitosterol (4). Antioxidant activity of compound 1 was significant when compared to that of the control, while compound 2 showed moderate activity. The cytotoxicity of compounds 1 and 2 were tested in three cell lines, viz. liver hepatocellular carcinoma (HepG2), colon carcinoma (Caco-2) and a non-cancer cell line Human Embryonic Kidney (HEK293), using the MTT cell viability assay and compared against a standard anticancer drug, 5-fluorouracil. Apoptosis studies were carried out using the acridine orange/ethidium bromide dual staining method. The isolated compounds showed selective in vitro cytotoxic and apoptotic activity against human cancer and non-cancer cell lines, respectively. Compound 1 showed significant cytotoxicity against the Caco-2 cell line with an IC50 of 79 μg mL(-1) and moderate cytotoxicity against the HepG2 cell line with an IC50 of 150 μg mL(-1), while compound 2 showed significant cytotoxicity against the Caco- 2 and HepG2 cell lines with an IC50 of 45 μg mL(-1) and 60 μg mL(-1), respectively. Comparatively both compounds showed much lower cytotoxicity against the HEK293 cell line with IC50 values of 186 μg mL(-1) and 224 μg mL(-1), respectively.
Antiplasmodial activity and cytotoxicity of ethanol extract of Zea mays root
Directory of Open Access Journals (Sweden)
Jude Efiom Okokon
2017-04-01
Full Text Available Objective:Zea mays root decoction that has been traditionally used for the treatment of malaria by various tribes in Nigeria, was evaluated for antimalarial potential against malaria parasites using in vivo and in vitro models. Materials and Methods: The root extract of Zea mays was investigated for antimalarial activity against Plasmodium berghei in mice using rodent malaria models; suppressive, prophylactic and curative tests and in vitro antiplasmodial activity against chloroquine-sensitive (Pf 3D7 and resistant (Pf INDO strains of Plasmodium falciparum using SYBR green assay method. Median lethal dose and cytotoxic activity against HeLa and HEKS cells were assessed and phytochemical screening was also carried out using standard procedures. Results: The LD50 value of root extract was found to be 474.34 mg/kg. The crude extract (45-135 mg/kg, p.o showed significant (p100 μg/ml against both HeLa and HEKS cell lines. Conclusion: These results suggest that the root extract of Zea mays possesses antimalarial activity against both chloroquine-sensitive and resistant malaria and these data justify its use in ethnomedicine to treat malaria infections.
Directory of Open Access Journals (Sweden)
Moulay Ali Oukerrou
2017-01-01
Full Text Available The aim of this work is to investigate the in vitro cytotoxic and antibacterial effects of the essential oils of Aloysia citriodora Palau, harvested in different regions of Morocco. The chemical profile was established using gas chromatography-mass spectrometry analysis. The cytotoxic activity against P815, MCF7, and VERO cell lines as well as the normal human peripheral blood mononuclear cells (PBMCs was evaluated using the MTT assay. Standard, ATCC, strains of bacteria (Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa were cultivated in Muller Hinton media. Then, agar disc diffusion, minimum inhibitory concentrations (MICs, and minimal bactericidal concentrations (MBCs were determined using microdilution method. The essential oils obtained were predominantly composed of β-spathulenol (15.61%, Ar-curcumene (14.15%, trans-caryophyllene oxide (14.14%, and neral (10.02%. The results of the assays showed that the cytotoxic effect of the essential oil of A. citriodora was high on P815 and moderate on MCF7 and on VERO cell lines. However, no cytotoxic effect was observed on PBMCs. On the other hand, essential oils showed a significant antimicrobial activity against both Gram-negative and Gram-positive bacteria. MICs ranged between 2.84 and 8.37 mg/ml. Essential oil of A. citriodora leaves possesses significant antibacterial effect and cytotoxic activity against tumor cell lines.
Synthesis and cytotoxicity study of magnesium ferrite-gold core-shell nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Nonkumwong, Jeeranan [Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Pakawanit, Phakkhananan [Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Wipatanawin, Angkana [Division of Biochemistry and Biochemical Technology, Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Jantaratana, Pongsakorn [Department of Physics, Faculty of Science, Kasetsart University, Bangkok 11900 (Thailand); Ananta, Supon [Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Srisombat, Laongnuan, E-mail: slaongnuan@yahoo.com [Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2016-04-01
In this work, the core-magnesium ferrite (MgFe{sub 2}O{sub 4}) nanoparticles were prepared by hydrothermal technique. Completed gold (Au) shell coating on the surfaces of MgFe{sub 2}O{sub 4} nanoparticles was obtained by varying core/shell ratios via a reduction method. Phase identification, morphological evolution, optical properties, magnetic properties and cytotoxicity to mammalian cells of these MgFe{sub 2}O{sub 4} core coated with Au nanoparticles were examined by using a combination of X-ray diffraction, scanning electron microscopy, transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy, UV–visible spectroscopy (UV–vis), vibrating sample magnetometry and resazurin microplate assay techniques. In general, TEM images revealed different sizes of the core-shell nanoparticles generated from various core/shell ratios and confirmed the completed Au shell coating on MgFe{sub 2}O{sub 4} core nanoparticles via suitable core/shell ratio with particle size less than 100 nm. The core-shell nanoparticle size and the quality of coating influence the optical properties of the products. The UV–vis spectra of complete coated MgFe{sub 2}O{sub 4}-Au core-shell nanoparticles exhibit the absorption bands in the near-Infrared (NIR) region indicating high potential for therapeutic applications. Based on the magnetic property measurement, it was found that the obtained MgFe{sub 2}O{sub 4}-Au core-shell nanoparticles still exhibit superparamagnetism with lower saturation magnetization value, compared with MgFe{sub 2}O{sub 4} core. Both of MgFe{sub 2}O{sub 4} and MgFe{sub 2}O{sub 4}-Au core-shell also showed in vitro non-cytotoxicity to mouse areola fibroblast (L-929) cell line. - Highlights: • Synthesis of MgFe{sub 2}O{sub 4}-Au core-shell nanoparticles with particle size < 100 nm • Complete Au shell coating on the surfaces of MgFe{sub 2}O{sub 4} nanoparticles • In vitro cytotoxicity study of complete coated MgFe{sub 2}O{sub 4}-Au core
Synthesis and cytotoxicity study of magnesium ferrite-gold core-shell nanoparticles
International Nuclear Information System (INIS)
Nonkumwong, Jeeranan; Pakawanit, Phakkhananan; Wipatanawin, Angkana; Jantaratana, Pongsakorn; Ananta, Supon; Srisombat, Laongnuan
2016-01-01
In this work, the core-magnesium ferrite (MgFe_2O_4) nanoparticles were prepared by hydrothermal technique. Completed gold (Au) shell coating on the surfaces of MgFe_2O_4 nanoparticles was obtained by varying core/shell ratios via a reduction method. Phase identification, morphological evolution, optical properties, magnetic properties and cytotoxicity to mammalian cells of these MgFe_2O_4 core coated with Au nanoparticles were examined by using a combination of X-ray diffraction, scanning electron microscopy, transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy, UV–visible spectroscopy (UV–vis), vibrating sample magnetometry and resazurin microplate assay techniques. In general, TEM images revealed different sizes of the core-shell nanoparticles generated from various core/shell ratios and confirmed the completed Au shell coating on MgFe_2O_4 core nanoparticles via suitable core/shell ratio with particle size less than 100 nm. The core-shell nanoparticle size and the quality of coating influence the optical properties of the products. The UV–vis spectra of complete coated MgFe_2O_4-Au core-shell nanoparticles exhibit the absorption bands in the near-Infrared (NIR) region indicating high potential for therapeutic applications. Based on the magnetic property measurement, it was found that the obtained MgFe_2O_4-Au core-shell nanoparticles still exhibit superparamagnetism with lower saturation magnetization value, compared with MgFe_2O_4 core. Both of MgFe_2O_4 and MgFe_2O_4-Au core-shell also showed in vitro non-cytotoxicity to mouse areola fibroblast (L-929) cell line. - Highlights: • Synthesis of MgFe_2O_4-Au core-shell nanoparticles with particle size < 100 nm • Complete Au shell coating on the surfaces of MgFe_2O_4 nanoparticles • In vitro cytotoxicity study of complete coated MgFe_2O_4-Au core-shell nanoparticles
Nocchi, Samara Requena; de Moura-Costa, Gislaine Franco; Novello, Claudio Roberto; Rodrigues, Juliana; Longhini, Renata; de Mello, João Carlos Palazzo; Filho, Benedito Prado Dias; Nakamura, Celso Vataru; Ueda-Nakamura, Tânia
2016-01-01
Background: Herpes simplex virus type 1 (HSV-1) is associated with orofacial infections and is transmitted by direct contact with infected secretions. Several efforts have been expended in the search for drugs to the treatment for herpes. Schinus terebinthifolius is used in several illnesses and among them, for the topical treatment of skin wounds, especially wounds of mucous membranes, whether infected or not. Objective: To evaluate the cytotoxicity and anti-HSV-1 activity of the crude hydroethanolic extract (CHE) from the stem bark of S. terebinthifolius, as well as its fractions and isolated compounds. Materials and Methods: The CHE was subjected to bioguided fractionation. The anti-HSV-1 activity and the cytotoxicity of the CHE, its fractions, and isolated compounds were evaluated in vitro by SRB method. A preliminar investigation of the action of CHE in the virus–host interaction was conducted by the same assay. Results: CHE presented flavan-3-ols and showed anti-HSV-1 activity, better than its fractions and isolated compounds. The class of substances found in CHE can bind to proteins to form unstable complexes and enveloped viruses, as HSV-1 may be vulnerable to this action. Our results suggest that the CHE interfered with virion envelope structures, masking viral receptors that are necessary for adsorption or entry into host cells. Conclusion: The plant investigated exhibited potential for future development treatment against HSV-1, but further tests are necessary, especially to elucidate the mechanism of action of CHE, as well as preclinical and clinical studies to confirm its safety and efficacy. SUMMARY Crude hydroethanolic extract (CHE) presents promising activity against herpes simplex virus type 1 (HSV 1), with selectivity index (SI) = 22.50CHE has flavan-3-ols in its composition, such as catechin and gallocatechinThe fractions and isolated compounds obtained from CHE by bioguided fractionation are less active than the CHE against HSV-1CHE interferes
Synthesis and cytotoxic evaluation of novel C-10 nitrate derivatives of colchicine
International Nuclear Information System (INIS)
Shen, L.H.; Wang, B.; Liu, S.M.
2016-01-01
In our continuing search for more potent anticancer agent, eight novel nitrates couple with C-10 colchicine nitric oxide-releasing derivatives (5a-f and 7a-b) were prepared. These target compounds were assayed for their anti-tumor activity in vitro against four cancer cell lines, including human hepatocellular carcinoma cells (BEL7402), human ovary carcinoma cells (A2780), human lung adenocarcinoma cells (A549) and human breast carcinoma cells (MCF7). Preliminary results indicated that most of them exhibited significant cytotoxic effect toward cancer cells. Compound 7a was investigated further for its more potent cytotoxicity than colchicine. (author)
VANLUYN, MJA; VANWACHEM, PB; DAMINK, LHHO; DIJKSTRA, PJ; FEIJEN, J; NIEUWENHUIS, P
1992-01-01
We investigated commercially available dermal sheep collagen either cross-linked with hexamethylenedlisocyanate, or cross-linked with glutaraldehyde. In previous in vitro studies we could discriminate primary, i.e. extractable, and secondary cytotoxicity, due to cell-biomaterial interactions, i.e.
Antioxidant and cytotoxic activity of new di- and polyamine caffeine analogues.
Jasiewicz, Beata; Sierakowska, Arleta; Jankowski, Wojciech; Hoffmann, Marcin; Piorońska, Weronika; Górnicka, Agnieszka; Bielawska, Anna; Bielawski, Krzysztof; Mrówczyńska, Lucyna
2018-04-18
A series of new di- and polyamine-caffeine analogues were synthesized and characterized by NMR, FT-IR and MS spectroscopic methods. To access stability of the investigated caffeine analogues Molecular Dynamic simulations were performed in NAMD 2.9 assuming CHARMM36 force field. To evaluate the antioxidant capacity of new compounds, three different antioxidant assays were used, namely 1,1-diphenyl-2-picryl-hydrazyl free radical (DPPH • ) scavenging activity, ferrous ions (Fe 2+ ) chelating activity and Fe 3+ →Fe 2+ reducing ability. In vitro, the ability of new derivatives to protect human erythrocytes against oxidative haemolysis induced by free radical from 2,2'-azobis(2-methylpropionamidine) dihydrochloride (AAPH) was estimated. The cytotoxic activity was tested using MCF-7 breast cancer cells and human erythrocytes. All compounds showed the antioxidant capacity depending mostly on their ferrous ions chelating activity. In the presence of AAPH, some derivatives were able to effectively inhibit the oxidative haemolysis. Two derivatives, namely 8-(methyl(2-(methylamino)ethyl)-amino)caffeine and 8-(methyl(3-(methylamino)propyl)amino)caffeine, showed cytotoxic activity against MCF-7 breast cancer cells but not against human erythrocytes. Therefore, it is concluded that the selected di- and polyamine caffeine analogues, depending on their chemical structure, were able to minimize the oxidative stress and to inhibit the tumour cell grow. The confirmed antioxidant and cytotoxic properties of some caffeine derivatives make them attractive for potential applications in food or pharmaceutical industries.
Directory of Open Access Journals (Sweden)
Showkat Ahmad Ganie
2014-01-01
Full Text Available Arnebia benthamii is a major ingredient of the commercial drug available under the name Gaozaban, which has antibacterial, antifungal, anti-inflammatory, and wound-healing properties. In the present study, in vitro antioxidant and anticancer activity of different extracts of Arnebia benthamii were investigated. Antioxidant potential of plant extracts was evaluated by means of total phenolics, DPPH, reducing power, microsomal lipid peroxidation, and hydroxyl radical scavenging activity. The highest phenolic content (TPC of 780 mg GAE/g was observed in ethyl acetate, while the lowest TPC of 462 mg GAE/g was achieved in aqueous extract. At concentration of 700 µg/mL, DPPH radical scavenging activity was found to be highest in ethyl acetate extract (87.99% and lowest in aqueous extract (73%. The reducing power of extracts increased in a concentration dependent manner. We also observed its inhibition on Fe2+/ascorbic acid-induced lipid peroxidation (LPO on rat liver microsomes in vitro. In addition, Arnebia benthamii extracts exhibited antioxidant effects on Calf thymus DNA damage induced by Fenton reaction. Cytotoxicity of the extracts (10–100 µg/mL was tested on five human cancer cell lines (lung, prostate, leukemia, colon, and pancreatic cell lines using the Sulphorhodamine B assay.
Energy Technology Data Exchange (ETDEWEB)
Akabani, Gamal [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Carlin, Sean [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Welsh, Phil [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States)]. E-mail: zalut001@mc.duke.edu
2006-04-15
Introduction: Radioimmunotherapy with anti-HER2 monoclonal antibodies (mAbs) such as trastuzumab is a promising strategy for treating HER2-positive breast and ovarian carcinoma patients. The objective of this study was to determine the cytotoxic effectiveness of trastuzumab labeled with the 7.2-h half-life {alpha}-particle emitter {sup 211}At. Methods: Experiments were performed on SKBr-3, BT-474 and the transfected MCF7/HER2-18 human breast carcinoma cell lines. Intrinsic radiosensitivity was determined after exposure to external beam irradiation. The cytotoxicity of {sup 211}At-labeled trastuzumab was measured by clonogenic assays. The distribution of HER2 receptor expression on the cell lines was measured using fluorescence-activated cell sorting. A pharmacokinetic (PK)/microdosimetric model was established to assess the effects of specific activity (SA), HER2 receptor expression and absorbed dose on survival fraction (SF). Results: With external beam irradiation, the 2-Gy SF for BT-474, SKBr-3 and MCF7/HER2-18 cells was 0.78, 0.53 and 0.64 Gy, respectively. Heterogeneous HER2 expression was observed, with a subpopulation of cells lacking measurable receptor (14.5%, SKBr-3; 0.34%, MCF-7/HER2; 1.73%, BT-474). When plotted as a function of activity concentration, SF curves were biphasic and inversely proportional to SA; however, when the model was applied and absorbed doses calculated, the SF curve was monoexponential independent of SA. Thus, the PK model was able to demonstrate the effects of competition between cold and labeled mAb. These studies showed that the relative biological effectiveness of {sup 211}At-labeled trastuzaumab was about 10 times higher than that of external beam therapy. Conclusion: These in vitro studies showed that {sup 211}At-labeled trastuzumab mAb is an effective cytotoxic agent for the treatment of HER2-positive tumor cells. The SA of the labeled mAb and the homogeneity of HER2 receptor expression are important variables influencing
Accelerated in-vitro release testing methods for extended-release parenteral dosage forms.
Shen, Jie; Burgess, Diane J
2012-07-01
This review highlights current methods and strategies for accelerated in-vitro drug release testing of extended-release parenteral dosage forms such as polymeric microparticulate systems, lipid microparticulate systems, in-situ depot-forming systems and implants. Extended-release parenteral dosage forms are typically designed to maintain the effective drug concentration over periods of weeks, months or even years. Consequently, 'real-time' in-vitro release tests for these dosage forms are often run over a long time period. Accelerated in-vitro release methods can provide rapid evaluation and therefore are desirable for quality control purposes. To this end, different accelerated in-vitro release methods using United States Pharmacopeia (USP) apparatus have been developed. Different mechanisms of accelerating drug release from extended-release parenteral dosage forms, along with the accelerated in-vitro release testing methods currently employed are discussed. Accelerated in-vitro release testing methods with good discriminatory ability are critical for quality control of extended-release parenteral products. Methods that can be used in the development of in-vitro-in-vivo correlation (IVIVC) are desirable; however, for complex parenteral products this may not always be achievable. © 2012 The Authors. JPP © 2012 Royal Pharmaceutical Society.
Accelerated in vitro release testing methods for extended release parenteral dosage forms
Shen, Jie; Burgess, Diane J.
2012-01-01
Objectives This review highlights current methods and strategies for accelerated in vitro drug release testing of extended release parenteral dosage forms such as polymeric microparticulate systems, lipid microparticulate systems, in situ depot-forming systems, and implants. Key findings Extended release parenteral dosage forms are typically designed to maintain the effective drug concentration over periods of weeks, months or even years. Consequently, “real-time” in vitro release tests for these dosage forms are often run over a long time period. Accelerated in vitro release methods can provide rapid evaluation and therefore are desirable for quality control purposes. To this end, different accelerated in vitro release methods using United States Pharmacopoeia (USP) apparatus have been developed. Different mechanisms of accelerating drug release from extended release parenteral dosage forms, along with the accelerated in vitro release testing methods currently employed are discussed. Conclusions Accelerated in vitro release testing methods with good discriminatory ability are critical for quality control of extended release parenteral products. Methods that can be used in the development of in vitro-in vivo correlation (IVIVC) are desirable, however for complex parenteral products this may not always be achievable. PMID:22686344
Directory of Open Access Journals (Sweden)
Khosrou Abdi
2012-07-01
Full Text Available Background and the purpose of the study: Dual functional agents in which nitroaromatic or nitroheterocyclic compounds are attached through a linker unit to mustards and aziridines have shown higher cytotoxicities than the corresponding counterparts to both aerobic and hypoxic cells and enhanced radiosensitizing activity. In thepresent investigation cytotoxicity and radiosensitizing activity of 2,4-dinitrobenzyl, 2,4-dinitrobenzoyl, and 2,4-dinitrophenacetyl derivatives of 5-fluorouracil which was assumed to release cytotoxic active quinone methidide,and 5-fluorouracil under hypoxic conditions on HT-29 cell line under both aerobic and hypoxic conditions wasinvestigated.Methods: 5-fluorouracil derivative X-XIII were prepared by the reaction of the corresponding di-nitro substitutedbenzyl, benzoyl and phenacetyl halides with 5-fluorouracil protected at N-1 with di-t-butoxydicarbonate (BOC in dimethyl formamide (DMF in the presence of the potassium carbonate followed by hydrolysis of the blocking,group by potassium carbonate in methanol. Cytotoxicity of fluorouracil VIII and tested compounds X-XIII against HT-29cell line under both aerobic and hypoxic conditions after 48 hrs incubation were measured by determination of the percent of the survival cells using 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and percent of the dead cells using propidium iodide(PI-digitonine assay and results were used to calculate the corresponding IC50 values. Radiosensitization experiments were carried out by irradiation of the incubations with a 60Co source and clonogenic assay was performed to determine the cell viabilities following treatment with the tested compounds and/or radiation. Sensitization Enhancement Ratio (SER of each tested compound was obtained from the radiation survival curves in the absence and presence of each sensitizer for 37% survival respectively.Results and major conclusion: Findings of the present study showed that
Kwok, Amy Ho Yan; Wang, Yan; Ho, Wing Shing
2016-05-15
Colorectal cancer (CRC) is the third most common cancer. Its global incidence and mortality have been on the rise. Recent strategy of therapies has involved the use of non-steroid anti-inflammatory drugs and cyclooxygenase-selective inhibitors. Aerial parts of Imperata cylindrical L. Raeusch (IMP) have been used as an anti-inflammatory agent in traditional Chinese medicine. Asarachidonate acid cascadeis often involved in inflammation-related malignancy and IMP is an anti-inflammatory agent, hence it is hypothesized that IMP aerial part ethyl acetate extract exerts cytotoxic effects on colorectal cancer cells in vitro. The HT-29 adenocarcinoma cell line was used to elucidate its pro-apoptotic activities. Flow cytometry and fluorescent microscopy were performed to assess cell cycle arrest and the accumulation of reactive oxygen species (ROS). The mRNA and hormone levels of arachidonate acid pathways were studied via quantitative reverse transcription PCR (qRT-PCR) and ELISA. The 50% growth inhibitory effect (GI50) of the IMP extract on HT-29 was measured with a value of 14.5 µg/ml. Immuno-blot and caspase-3/7 activity assay showed the pro-apoptotic effect of IMP on the activation of caspase cascade. G2/M arrest was observed via flow cytometry. The ROS activity was modulated by the IMP extraction a concentration-dependent manner in HT-29 cells. The IMP extract increased PGE2 and PGF2α levels qRT-PCR revealed that transcripts of rate-limiting PGE2- and PGF2α-biosynthetic enzymes - COX-1, mPGES1 and AKR1C3 were notably up-regulated. Among the prostanoid receptors, EP1 and FP transcripts were up-regulated while EP4 transcripts decreased. The findings suggest that the proliferative effect of PGE2, which is generally believed to associate with heightened DNA synthesis and cross-talk with MAPK pathways, is likely triggered by the pro-apoptotic or -oxidative effects exerted by IMP extract in HT-29 cells. Concurring with this notion, indomethacin (COX-1/2-inhibitor) was
A strategy for in vitro safety testing of nanotitania-modified textile products
International Nuclear Information System (INIS)
Roszak, Joanna; Stępnik, Maciej; Nocuń, Marek; Ferlińska, Magdalena; Smok-Pieniążek, Anna; Grobelny, Jarosław; Tomaszewska, Emilia; Wąsowicz, Wojciech; Cieślak, Małgorzata
2013-01-01
Highlights: • Commercially available TiO 2 /Ag nanomaterials (NMs) showed higher cytotoxic effect than TiO 2 NMs. • Both titania NMs in pristine form induced a weak genotoxic effect in in vitro studies. • Cytotoxic effect of textile materials modified with TiO 2 /Ag NMs depended on the mode of the fiber manufacturing. • The strategy of in vitro testing of textile materials modified with NMs was proposed. -- Abstract: Titanium dioxide nanomaterials are extensively used in many applications, also for modification of textile materials. Toxicological assessment of such textile materials is currently seldom performed, mainly because of lack of appropriate guidelines. The aim of the study was to assess cytotoxic and genotoxic potential of commercially available TiO 2 and TiO 2 /Ag NMs in pristine form as well as polypropylene fibers modified with the NMs. Both titania NMs showed a cytotoxic effect on BALB/3T3 clone A31 and V79 fibroblasts after 72-h exposure. Both NMs induced a weak genotoxic effect in comet assay, with TiO 2 /Ag being more active. In vitro micronucleus test on human lymphocytes revealed a weak mutagenic effect of both materials after 24 h of exposure. In contrast, no significant increase in micronuclei frequency was observed in the in vitro micronucleus test on V79 fibroblasts. The 24-h extracts prepared from polypropylene fibers modified with TiO 2 /Ag induced a cytotoxic effect on BALB/3T3 cells which strongly depended on the mode of the fibers manufacturing. The study presents a comprehensive approach to toxicity assessment of textile fibers modified with NMs. Proposed approach may form a good “starting point” for improved future testing strategies
A strategy for in vitro safety testing of nanotitania-modified textile products
Energy Technology Data Exchange (ETDEWEB)
Roszak, Joanna; Stępnik, Maciej; Nocuń, Marek; Ferlińska, Magdalena; Smok-Pieniążek, Anna [Nofer Institute of Occupational Medicine, 8 St Teresy St., 91-348 Łódź (Poland); Grobelny, Jarosław; Tomaszewska, Emilia [University of Lodz, Faculty of Chemistry, 163 Pomorska St, 90-236 Łódź (Poland); Wąsowicz, Wojciech [Nofer Institute of Occupational Medicine, 8 St Teresy St., 91-348 Łódź (Poland); Cieślak, Małgorzata, E-mail: cieslakm@iw.lodz.pl [Textile Research Institute, 118 Gdańska St., 90-520, Łódź (Poland)
2013-07-15
Highlights: • Commercially available TiO{sub 2}/Ag nanomaterials (NMs) showed higher cytotoxic effect than TiO{sub 2} NMs. • Both titania NMs in pristine form induced a weak genotoxic effect in in vitro studies. • Cytotoxic effect of textile materials modified with TiO{sub 2}/Ag NMs depended on the mode of the fiber manufacturing. • The strategy of in vitro testing of textile materials modified with NMs was proposed. -- Abstract: Titanium dioxide nanomaterials are extensively used in many applications, also for modification of textile materials. Toxicological assessment of such textile materials is currently seldom performed, mainly because of lack of appropriate guidelines. The aim of the study was to assess cytotoxic and genotoxic potential of commercially available TiO{sub 2} and TiO{sub 2}/Ag NMs in pristine form as well as polypropylene fibers modified with the NMs. Both titania NMs showed a cytotoxic effect on BALB/3T3 clone A31 and V79 fibroblasts after 72-h exposure. Both NMs induced a weak genotoxic effect in comet assay, with TiO{sub 2}/Ag being more active. In vitro micronucleus test on human lymphocytes revealed a weak mutagenic effect of both materials after 24 h of exposure. In contrast, no significant increase in micronuclei frequency was observed in the in vitro micronucleus test on V79 fibroblasts. The 24-h extracts prepared from polypropylene fibers modified with TiO{sub 2}/Ag induced a cytotoxic effect on BALB/3T3 cells which strongly depended on the mode of the fibers manufacturing. The study presents a comprehensive approach to toxicity assessment of textile fibers modified with NMs. Proposed approach may form a good “starting point” for improved future testing strategies.
Liu, Hongwei; Liu, Zhixiong; Jiang, Bing; Huo, Lei; Liu, Jinfang; Lu, Jingchen
2015-06-01
Although aggressive therapeutic regimen has been applied in the treatment of Glioblastoma (GBM), the prognosis of patients with GBM remains poor. Preclinical studies have demonstrated the efficacy of Suntinib in GBM both in vitro and in vivo. In this study, we showed that the cytotoxicity was enhanced by transfection with miR-145 mimic. In addition, we suggested that the enhanced cytotoxicity of Sunitinib by miR-145 mimic was mediated by inhibition of both P-gp and Bcrp.
Directory of Open Access Journals (Sweden)
Jia Zhang
2018-05-01
Full Text Available Four complexes, [Cu2(glyha(bpy2(H2O]·2ClO4·H2O (1, [Cu2(glyha(phen2]·2ClO4 (2, [Cu2(alaha(bpy2Cl]·Cl·4H2O (3, and [{Cu2(alaha(phen2}{Cu2(alaha(phen2(NO3}]·3NO3 (4 (glyha2− = dianion glycinehydroxamic acid, alaha2− = dianion alaninehydroxamic acid, bpy = 2,2′-bipyridine, phen = 1,10-phenanthroline have been successfully synthesized and characterized by X-ray single crystal diffraction. The interactions of these complexes with calf thymus DNA (CT-DNA were studied through UV spectroscopy, fluorescence spectroscopy, and circular dichroism. The results revealed that complexes 1–4 could interact with CT-DNA through intercalation. Interactions of all complexes with bovine serum albumin (BSA were confirmed by the docking study to quench the intrinsic fluorescence of BSA in a static quenching process. Furthermore, the in vitro cytotoxic effect of the complexes was also examined on four tumor cell lines, including human lung carcinoma cell line (A549, human colon carcinoma cell line (HCT-116, human promyelocytic leukemia cell (HL-60 and cervical cancer cell line (HeLa. All complexes exhibited different antitumor activities.
Synergistic cytotoxic effects of antibodies directed against different cell surface determinants
Energy Technology Data Exchange (ETDEWEB)
Elliott, E V; Pindar, A; Stevenson, F K; Stevenson, G T [Southampton General Hospital (UK). Tenovus Research Lab.
1978-03-01
Three antibody populations were raised in rabbits against surface antigens on guinea-pig L/sub 2/C leukaemic lymphocytes: against idiotypic determinants on the lambda chain of the surface immunoglobulin, against C region determinants on the lambda chain, and against the surface antigens recognised by conventional anti-lymphocyte sera. Complement and K-cell cytotoxicities effected by the antibodies on L/sub 2/C cells were studied in vitro. In both cytotoxic systems mixtures of the antibodies revealed synergy, in that the titres of the mixtures exceeded predicted additive titres of their components. The synergy was greater when the mixed antibodies were directed to determinants on the same molecule rather than to determinants on different molecules.
Antiplasmodial activity and cytotoxicity of ethanol extract of Zea mays root.
Okokon, Jude Efiom; Antia, Bassey Sunday; Azare, Bala Adamu; Okokon, Patience Jude
2017-01-01
Zea mays root decoction that has been traditionally used for the treatment of malaria by various tribes in Nigeria, was evaluated for antimalarial potential against malaria parasites using in vivo and in vitro models. The root extract of Zea mays was investigated for antimalarial activity against Plasmodium berghei in mice using rodent malaria models; suppressive, prophylactic and curative tests and in vitro antiplasmodial activity against chloroquine-sensitive (Pf 3D7) and resistant (Pf INDO) strains of Plasmodium falciparum using SYBR green assay method. Median lethal dose and cytotoxic activity against HeLa and HEKS cells were assessed and phytochemical screening was also carried out using standard procedures. The LD 50 value of root extract was found to be 474.34 mg/kg. The crude extract (45-135 mg/kg, p.o) showed significant (p100 μg/ml against both HeLa and HEKS cell lines. These results suggest that the root extract of Zea mays possesses antimalarial activity against both chloroquine-sensitive and resistant malaria and these data justify its use in ethnomedicine to treat malaria infections.
DEFF Research Database (Denmark)
Skov Madsen, P; Hokland, P; Hokland, M
1987-01-01
We have investigated the interaction between human platelets and the NK-system, with special emphasis on the action of secretory products from platelets in an NK assay with 51Cr-labelled K562 as target cells. Supernatants from thrombin-stimulated platelets added to the NK assay consistently...... decreased the NK-cytotoxicity by 40% +/- 4.3%, indicating the existence of secreted products from platelets as a source of NK-inhibiting substances. In contrast, no direct cytotoxic effect of these secretory products on the target cells (K562) was seen. Thus, normal human platelets, when stimulated...... with thrombin, are capable of secreting different, yet undefined factors, which significantly inhibit NK activity in vitro. The results also suggest that the role of products from contaminating in vitro activated platelets should be borne in mind when performing conventional NK assays. Udgivelsesdato: 1986-Oct...
Gu, Qing-Yang; Qiu, Xiao; Liu, Jing-Jing; Fu, Min; Chao, Jian-Ping; Ju, Rui-Jun; Li, Xue-Tao
2018-08-01
Diclofenac sodium (abrr. DS) and indomethacin (abrr. IMC) have been intercalated into the layered terbium hydroxide (LTbH) by anion exchange method. Chemical compositions, thermostability, morphology, luminescence property, release behaviors and cytotoxic effects have been investigated. The DS molecules may embed between layers with a bilayered arrangement and the IMC may correspond to a monolayered arrangement. The Tb3+ luminescence in DS-LTbH and IMC-LTbH composites were enhanced compared with LTbH precusor and the luminescence intensity increases with the deprotonation degree. Drug release was measured with HPLC, and LTbH showed sustained release behavior on both drugs. Further In Vitro evaluation were carried out on cancer cells. Cytotoxic effect of LTbH was observed with a sulforhodamine B colorimetric assay on a variety of cancer cell lines, which revealed that the LTbH showed little cytotoxic effect. Results indicate LTbH may offer a potential vehicle as an effective drug delivery system along with diagnostic integration.
Method for in vitro recombination
Gibson, Daniel Glenn; Smith, Hamilton O
2013-05-07
The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.
Scavone, Paola; Villar, Silvia; Umpiérrez, Ana; Zunino, Pablo
2015-06-01
Proteus mirabilis is frequently associated with complicated urinary tract infections (UTI). It is proposed that several virulence factors are associated with P. mirabilis uropathogenicity. The aim of this work was to elucidate genotoxic and cytotoxic effects mediated by MR/P fimbriae and flagella in eukaryotic cells in vitro. Two cell lines (kidney- and bladder-derived) were infected with a clinical wild-type P. mirabilis strain and an MR/P and a flagellar mutant. We evaluated adhesion, genotoxicity and cytotoxicity by microscopy, comet assay and triple staining technique, respectively. Mutant strains displayed lower adhesion rates than the P. mirabilis wild-type strain and were significantly less effective to induce genotoxic and cytotoxic effects compared to the wild type. We report for the first time that P. mirabilis MR/P fimbriae and flagella mediate genotoxic and cytotoxic effects on eukaryotic cells, at least in in vitro conditions. These results could contribute to design new strategies for the control of UTI. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Kumar, Anil; Ahuja, Alka; Ali, Javed; Baboota, Sanjula
2016-01-01
In the present study, Curcumin (CU)-loaded nanocarrier (NC) such as nanoemulsion (NE) was developed with the objective of increasing its cytotoxicity and bioavailability through lymphatic transport by enhancing its solubility and intestinal permeability. Based on the area obtained in pseudoternary phase diagram, various % combination of Labrafac Lipophile WL 1349, Solutol HS 15, Transcutol HP and distilled water were selected. Formulations which passed physical stability studies were selected for further studies such as globule size, zeta potential, in vitro release, ex vivo permeation, in vitro lipolysis studies, bioavailability studies and cytotoxicity against glioblastoma cells (U-87). The optimized NC (NE-SB1) had small average globule diameter of 67 ± 6 nm with zeta potential of -37 ± 2.5 mv which indicated long-term dispersion stability. During in vitro lipolysis study, the digestion rate of medium chain triglycerides increased with decreased globule diameter. Statistically significant difference was found in AUC0-inf of NC formulation (p < 0.05) compared to CU suspension. The relative bioavailability of NC was found 11.88 ± 0.47 with respect to CU suspension. During cytotoxicity studies, IC50 of CU solution on U87 cells was found 24.23 µM, while for the NE- SB1 it was 16.41 µM. The optimized formulation was found to be stable during 6 months of accelerated stability. The overall results revealed that the CU-loaded NC is a very effective approach for enhancing the oral absorption of poorly water-soluble drug CU and have great potential for future clinical application.
Directory of Open Access Journals (Sweden)
Lee Gyun
2010-09-01
Full Text Available Abstract Background Serum-containing medium (SCM, which has a number of poorly defined components with varying concentrations, hampers standardization of lymphocyte cultures. In order to develop a serum-free medium (SFM for the expansion of human lymphocytes from peripheral blood mononuclear cells (PBMCs, a statistical optimization approach based on a fractional factorial method and a response surface method was adopted. A basal medium was prepared by supplementing RPMI1640 medium with insulin, albumin, ferric citrate, ethanolamine, fatty acids, glutamine, sodium pyruvate, 2-mercaptoethanol, 1-thioglycerol, nonessential amino acids, and vitamins. We identified additional positive determinants and their optimal concentrations for cell growth through a statistical analysis. Results From a statistical analysis using the fractional factorial method, cholesterol and polyamine supplement were identified as positive determinants for cell growth. Their optimal concentrations were determined by the response surface method. The maximum viable cell concentration in the developed SFM was enhanced by more than 1.5-fold when compared to that in RPMI1640 supplemented with 10% fetal bovine serum (FBS. Furthermore, a cytotoxicity assay and an enzyme-linked immunospot assay revealed that the effector function of cytotoxic T lymphocytes generated from PBMCs grown in SFM, by stimulation of peptide-presenting dendritic cells, was retained or even better than that in SCM. Conclusions The use of a developed SFM with cholesterol and polyamine supplement for human lymphocyte culture resulted in better growth without loss of cellular function when compared to SCM.
Jeon, Min Kyoung; Lim, Jong-Baeck; Lee, Gyun Min
2010-09-21
Serum-containing medium (SCM), which has a number of poorly defined components with varying concentrations, hampers standardization of lymphocyte cultures. In order to develop a serum-free medium (SFM) for the expansion of human lymphocytes from peripheral blood mononuclear cells (PBMCs), a statistical optimization approach based on a fractional factorial method and a response surface method was adopted. A basal medium was prepared by supplementing RPMI1640 medium with insulin, albumin, ferric citrate, ethanolamine, fatty acids, glutamine, sodium pyruvate, 2-mercaptoethanol, 1-thioglycerol, nonessential amino acids, and vitamins. We identified additional positive determinants and their optimal concentrations for cell growth through a statistical analysis. From a statistical analysis using the fractional factorial method, cholesterol and polyamine supplement were identified as positive determinants for cell growth. Their optimal concentrations were determined by the response surface method. The maximum viable cell concentration in the developed SFM was enhanced by more than 1.5-fold when compared to that in RPMI1640 supplemented with 10% fetal bovine serum (FBS). Furthermore, a cytotoxicity assay and an enzyme-linked immunospot assay revealed that the effector function of cytotoxic T lymphocytes generated from PBMCs grown in SFM, by stimulation of peptide-presenting dendritic cells, was retained or even better than that in SCM. The use of a developed SFM with cholesterol and polyamine supplement for human lymphocyte culture resulted in better growth without loss of cellular function when compared to SCM.
Immunomodulatory Effect of Rhaphidophora korthalsii on Natural Killer Cell Cytotoxicity
Directory of Open Access Journals (Sweden)
Swee Keong Yeap
2012-01-01
Full Text Available The in vivo immunomodulatory effect of ethanolic extracts from leaves of Rhaphidophora korthalsii was determined via immune cell proliferation, T/NK cell phenotyping, and splenocyte cytotoxicity of BALB/c mice after 5 consecutive days of i.p. administration at various concentrations. Splenocyte proliferation index, cytotoxicity, peripheral blood T/NK cell population, and plasma cytokine (IL-2 and IFN-γ in mice were assessed on day 5 and day 15. High concentration of extract (350 μg/mice/day for 5 consecutive days was able to stimulate immune cell proliferation, peripheral blood NK cell population, IL-2, and IFN- γ cytokines, as well as splenocyte cytotoxicity against Yac-1 cell line. Unlike rIL-2 which degraded rapidly, the stimulatory effect from the extract managed to last until day 15. These results suggested the potential of this extract as an alternative immunostimulator, and they encourage further study on guided fractionation and purification to identify the active ingredients that contribute to this in vitro and in vivo immunomodulatory activity.
Cytotoxic Flavones from the Stem Bark of Bougainvillea spectabilis Willd.
Do, Lien T M; Aree, Thammarat; Siripong, Pongpun; Vo, Nga T; Nguyen, Tuyet T A; Nguyen, Phung K P; Tip-Pyang, Santi
2018-01-01
Five new flavones possessing a fully substituted A-ring with C-6 and C-8 methyl groups, bougainvinones I - M (1: -5: ), along with three known congeners, 2'-hydroxydemethoxymatteucinol (6: ), 5,7,3',4'-tetrahydroxy-3-methoxy-6,8-dimethylflavone (7: ) and 5,7,4'-trihydroxy-3-methoxy-6,8-dimethylflavone (8: ), were isolated from the EtOAc extract of the stem bark of Bougainvillea spectabilis . Their structures were established by means of spectroscopic data (ultraviolet, infrared, high-resolution electrospray ionization mass spectrometry, and one-dimensional and two-dimensional nuclear magnetic resonance) and single-crystal X-ray crystallographic analysis. The in vitro cytotoxicity of all isolated compounds against five cancer cell lines (KB, HeLa S-3, MCF-7, HT-29, and HepG2) was evaluated. Compound 5: showed promising cytotoxic activity against the KB and HeLa S-3 cell lines, with IC 50 values of 7.44 and 6.68 µM. The other compounds exhibited moderate cytotoxicity against the KB cell line. Georg Thieme Verlag KG Stuttgart · New York.
Directory of Open Access Journals (Sweden)
Michael W Holliday
Full Text Available We previously reported that fenretinide (4-HPR was cytotoxic to acute lymphoblastic leukemia (ALL cell lines in vitro in association with increased levels of de novo synthesized dihydroceramides, the immediate precursors of ceramides. However, the cytotoxic potentials of native dihydroceramides have not been defined. Therefore, we determined the cytotoxic effects of increasing dihydroceramide levels via de novo synthesis in T-cell ALL cell lines and whether such cytotoxicity was dependent on an absolute increase in total dihydroceramide mass versus an increase of certain specific dihydroceramides. A novel method employing supplementation of individual fatty acids, sphinganine, and the dihydroceramide desaturase-1 (DES inhibitor, GT-11, was used to increase de novo dihydroceramide synthesis and absolute levels of specific dihydroceramides and ceramides. Sphingolipidomic analyses of four T-cell ALL cell lines revealed strong positive correlations between cytotoxicity and levels of C22:0-dihydroceramide (ρ = 0.74-0.81, P ≤ 0.04 and C24:0-dihydroceramide (ρ = 0.84-0.90, P ≤ 0.004, but not between total or other individual dihydroceramides, ceramides, or sphingoid bases or phosphorylated derivatives. Selective increase of C22:0- and C24:0-dihydroceramide increased level and flux of autophagy marker, LC3B-II, and increased DNA fragmentation (TUNEL assay in the absence of an increase of reactive oxygen species; pan-caspase inhibition blocked DNA fragmentation but not cell death. C22:0-fatty acid supplemented to 4-HPR treated cells further increased C22:0-dihydroceramide levels (P ≤ 0.001 and cytotoxicity (P ≤ 0.001. These data demonstrate that increases of specific dihydroceramides are cytotoxic to T-cell ALL cells by a caspase-independent, mixed cell death mechanism associated with increased autophagy and suggest that dihydroceramides may contribute to 4-HPR-induced cytotoxicity. The targeted increase of specific acyl chain dihydroceramides
Cytotoxic and Antimicrobial Constituents from the Essential Oil of Lippia alba (Verbenaceae).
Santos, Nara O Dos; Pascon, Renata C; Vallim, Marcelo A; Figueiredo, Carlos R; Soares, Marisi G; Lago, João Henrique G; Sartorelli, Patricia
2016-08-12
Backgroud: Lippia alba (Verbenaceae) is a plant widely used in folk medicine to treat various diseases. The present work deals with the chemical composition of the crude essential oil extracted from leaves of L. alba and evaluation of its antimicrobial and cytotoxic activities. Methods: Leaves of L. alba were extracted by hydrodistillation and analyzed by gas chromatography/mass spectrometry (GC/MS) as well as by nuclear magnetic resonance (NMR) spectroscopy. Cytotoxic and antimicrobial activities of crude essential oil were evaluated in vitro using MTT and broth microdilution assays, respectively. Results: Chemical analysis afforded the identification of 39 substances corresponding to 99.45% of the total oil composition. Concerning the main compounds, monoterpenes nerol/geraniol and citral correspond to approximately 50% of crude oil. The cytotoxic activity of obtained essential oil against several tumor cell lines showed IC 50 values ranging from 45 to 64 µg/mL for B16F10Nex2 (murine melanoma) and A549 (human lung adenocarcinoma). In the antimicrobial assay, was observed that all tested yeast strains, except C. albicans , were sensitive to crude essential oil. MIC values were two to four-folds lower than those determined to bacterial strains. Conclusion: Analysis of chemical composition of essential oils from leaves of L. alba suggested a new chemotype nerol/geraniol and citral. Based in biological evidences, a possible application for studied oil as an antifungal in medicine, as well as in agriculture, is described.
Popat, Amirali; Karmakar, Surajit; Jambhrunkar, Siddharth; Xu, Chun; Yu, Chengzhong
2014-05-01
Curcumin (CUR), a naturally derived anti-cancer cocktail is arguably the most widely studied neutraceutical. Despite a lot of promises, it is yet to reach the market as an active anti-cancer formulation. In the present study, we have prepared highly soluble (3 mg/ml) CUR-γ-hydroxypropyl cyclodextrin (CUR-CD) hollow spheres. CUR-CD hollow spheres were prepared by a novel and scalable spray drying method. CUR-CD was then encapsulated into positively charged biodegradable chitosan (CUR-CD-CS) nanoparticles. The CUR-CD-CS nanoparticles were characterised by TEM, SEM, DLS, drug loading and in vitro release. We tested the efficacy of these CUR-CD-CS nanoparticles in SCC25 cell lines using MTT assay and investigated its cellular uptake mechanism. We also studied Oligo DNA loading in CUR-CD-CS nanoparticles and its delivery via confocal imaging and FACS analysis. Our results demonstrated that CUR-CD-CS nanoparticles showed superior in vitro release performance and higher cytotoxicity in SCC25 cell line amongst all tested formulations. The cytotoxicity results were corroborated by cell cycle analysis and apoptosis test, showing nearly 100% apoptotic cell death in the case of CUR-CD-CS nanoparticles. Compared to CS nanoparticles, CS-CD nanoformulation showed higher cellular delivery of Cy3-Oligo DNA which was tested quantitatively using flowcytometry analysis, indicating that CD not only enhanced CUR solubility but also boosted the cellular uptake. Our study shows that rationally designed bio-degradable natural biomaterials have great potential as next generation nano-carriers for hydrophobic drug delivery such as CUR with potential of dual drug-gene delivery. Copyright © 2014 Elsevier B.V. All rights reserved.
Dhayalan, Manikandan; Denison, Michael Immanuel Jesse; L, Anitha Jegadeeshwari; Krishnan, Kathiravan; N, Nagendra Gandhi
2017-02-01
In recent years, the green synthesis of gold (GNPs) and silver (SNPs) nanoparticles has gained great interest among chemists and researchers. The present study reports an eco-friendly, cost-effective, rapid and easy method for the synthesis of gold and silver nanoparticles using the seed extract of Embelia ribes (SEEr) as capping and reducing agent. The synthesised GNPs and SNPs were characterised using the following techniques: UV-vis spectroscopy, DLS, HR-TEM, FT-IR and XRD. The free radical scavenging potential of GNPs and SNPs was measured by DPPH assay and Phosphomolybdenum assay. Further, the antimicrobial activity against two micro-organisms were tested using disc diffusion method and cytotoxicity of GNPs and SNPs was determined against MCF-7 cell lines at different concentrations by MTT assay. Both the GNPs and SNPs prepared from E. ribes comparatively showed promising results thereby proving their clinical importance.
Al-Qudah, Mahmoud A; Otoom, Noor K; Al-Jaber, Hala I; Saleh, Ayman M; Abu Zarga, Musa H; Afifi, Fatma U; Abu Orabi, Sultan T
2017-12-01
Phytochemical investigation of the chemical constituents of the aerial parts of Scabiosa prolifera L. led to the isolation of one new flavonol glycoside, kaempferol-3-O-(4″,6″-di-E-p-coumaroyl)-β-D-galactopyranoside (1), along with ten other known compounds including luteolin-7-O-(2″-O-ethyl-β-glucopyranoside), β-sitosterol, β-sitosterylglucoside, ursolic acid, corosolic acid, ursolic acid 3-O-β-D-arabinopyranoside, apigenin, methyl-α-D-glucopyranoside, luteolin-7-O-β-glucopyranoside and isoorientin. The structures of all isolated compounds were established using chemical methods and spectroscopic methods including IR, UV, NMR (1D and 2D) and HRESIMS. All compounds were isolated for the first time from the plant. The antioxidant and cytotoxic activities of compounds 1 and 2 were also investigated.
Analogues of luteinizing hormone-releasing hormone containing cytotoxic groups.
Janáky, T; Juhász, A; Bajusz, S; Csernus, V; Srkalovic, G; Bokser, L; Milovanovic, S; Redding, T W; Rékási, Z; Nagy, A
1992-02-01
In an attempt to produce better cytotoxic analogues, chemotherapeutic antineoplastic radicals including an alkylating nitrogen mustard derivative of D-phenylalanine (D-melphalan), reactive cyclopropane, anthraquinone derivatives [2-(hydroxymethyl)anthraquinone and the anticancer antibiotic doxorubicin], and an antimetabolite (methotrexate) were coupled to suitably modified agonists and antagonists of luteinizing hormone-releasing hormone (LH-RH). Analogues with D-lysine6 and D-ornithine6 or N epsilon-(2,3-diaminopropionyl)-D-lysine and N delta-(2,3-diaminopropionyl)-D-ornithine were used as carriers for one or two cytotoxic moieties. The enhanced biological activities produced by the incorporation of D amino acids into position 6 of the agonistic analogues were further increased by the attachment of hydrophobic cytotoxic groups, resulting in compounds with 10-50 times higher activity than LH-RH. Most of the monosubstituted agonistic analogues showed high affinities for the membrane receptors of human breast cancer cells, while the receptor binding affinities of peptides containing two cytotoxic side chains were lower. Antagonistic carriers [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,D-Lys6,D-Ala10] LH-RH [where Nal(2) is 3-(2-naphthyl)alanine], [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,N epsilon-(2,3-diaminopropionyl)-D-Lys6,D-Ala10]LH-RH, and their D-Pal(3)3 homologs [Pal(3) is 3-(3-pyridyl)alanine] as well as [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Pal(3)3,Tyr5,N epsilon-(2,3-diamino-propionyl)-D-Lys6,D-Ala10]LH-RH were linked to cytotoxic compounds. The hybrid molecules inhibited ovulation in rats at doses of 10 micrograms and suppressed LH release in vitro. The receptor binding of cytotoxic analogues was decreased compared to the precursor peptides, although analogues with 2-(hydroxymethyl)anthraquinone hemiglutarate had high affinities. All of the cytotoxic analogues tested inhibited [3H]thymidine incorporation into DNA in cultures of human breast and prostate cancer cell lines
Ganapathy-Kanniappan, Shanmugasundaram; Geschwind, Jean-Francois H; Kunjithapatham, Rani; Buijs, Manon; Syed, Labiq H; Rao, Pramod P; Ota, Shinichi; Vali, Mustafa
2010-04-01
3-Bromopyruvate (3BrPA) is a pyruvate analog known for its alkylating property. Recently, several reports have documented the antiglycolytic and anticancer effects of 3BrPA and its potential for therapeutic applications. 3BrPA-mediated cytotoxicity has been evaluated in vitro by various methods including tetrazolium salt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide)-based assays such as MTT, MTS, and so on. However, growing body of evidences has shown that tetrazolium reagent may interfere with the test compounds. In this study, we investigated whether the tetrazolium reagent interferes with the assessment of 3BrPA cytotoxicity. The results of the tetrazolium-based MTS assay were compared with 3 distinct cell viability detection methods, that is, Trypan Blue staining, ATP depletion, and Annexin V staining in 2 different cell lines, Vx-2 and HepG2. The MTS assay data showed false positive results by indicating increased cell viability at 1 mM and 2 mM 3BrPA whereas the other cell viability assays demonstrated that both Vx-2 and HepG2 cells are not viable at the same treatment conditions. In order to validate the direct interaction of 3BrPA with MTS reagent, we tested cell-free media incubated with different concentrations of 3BrPA. The results of cell-free media showed an increase in absorbance in a dose-dependent manner confirming the interaction of MTS with 3BrPA. Thus, our data clearly demonstrate that 3BrPA interferes with the accuracy of MTS-based cytotoxicity evaluation. Hence, we suggest that employing multiple methods of biochemical as well as morphological cytotoxicity assays is critical to evaluate 3BrPA-mediated cell death.
Cytotoxic and toxicological effects of phthalimide derivatives on tumor and normal murine cells
Directory of Open Access Journals (Sweden)
PAULO MICHEL PINHEIRO FERREIRA
2015-03-01
Full Text Available Eleven phthalimide derivatives were evaluated with regards to their antiproliferative activity on tumor and normal cells and possible toxic effects. Cytotoxic analyses were performed against murine tumors (Sarcoma 180 and B-16/F-10 cells and peripheral blood mononuclear cells (PBMC using MTT and Alamar Blue assays. Following, the investigation of cytotoxicity was executed by flow cytometry analysis and antitumoral and toxicological potential by in vivo techniques. The molecules 3b, 3c, 4 and 5 revealed in vitro cytotoxicity against Sarcoma 180, B-16/F-10 and PBMC. Since compound 4 was the most effective derivative, it was chosen to detail the mechanism of action after 24, 48 and 72 h exposure (22.5 and 45 µM. Sarcoma 180 cells treated with compound 4 showed membrane disruption, DNA fragmentation and mitochondrial depolarization in a time- and dose-dependent way. Compounds 3c, 4 and 5 (50 mg/kg/day did not inhibit in vivotumor growth. Compound 4-treated animals exhibited an increase in total leukocytes, lymphocytes and spleen relative weight, a decreasing in neutrophils and hyperplasia of spleen white pulp. Treated animals presented reversible histological changes. Molecule 4 had in vitro antiproliferative action possibly triggered by apoptosis, reversible toxic effects on kidneys, spleen and livers and exhibited immunostimulant properties that can be explored to attack neoplasic cells.
Cytotoxic drug sensitivity of Epstein-Barr virus transformed lymphoblastoid B-cells
Directory of Open Access Journals (Sweden)
Olah Eva
2006-11-01
Full Text Available Abstract Background Epstein-Barr virus (EBV is the causative agent of immunosuppression associated lymphoproliferations such as post-transplant lymphoproliferative disorder (PTLD, AIDS related immunoblastic lymphomas (ARL and immunoblastic lymphomas in X-linked lymphoproliferative syndrome (XLP. The reported overall mortality for PTLD often exceeds 50%. Reducing the immunosuppression in recipients of solid organ transplants (SOT or using highly active antiretroviral therapy in AIDS patients leads to complete remission in 23–50% of the PTLD/ARL cases but will not suffice for recipients of bone marrow grafts. An additional therapeutic alternative is the treatment with anti-CD20 antibodies (Rituximab or EBV-specific cytotoxic T-cells. Chemotherapy is used for the non-responding cases only as the second or third line of treatment. The most frequently used chemotherapy regimens originate from the non-Hodgkin lymphoma protocols and there are no cytotoxic drugs that have been specifically selected against EBV induced lymphoproliferative disorders. Methods As lymphoblastoid cell lines (LCLs are well established in vitro models for PTLD, we have assessed 17 LCLs for cytotoxic drug sensitivity. After three days of incubation, live and dead cells were differentially stained using fluorescent dyes. The precise numbers of live and dead cells were determined using a custom designed automated laser confocal fluorescent microscope. Results Independently of their origin, LCLs showed very similar drug sensitivity patterns against 29 frequently used cytostatic drugs. LCLs were highly sensitive for vincristine, methotrexate, epirubicin and paclitaxel. Conclusion Our data shows that the inclusion of epirubicin and paclitaxel into chemotherapy protocols against PTLD may be justified.
International Nuclear Information System (INIS)
Menon, M.; Lloyd, E.L.; Mitchen, J.L.
Lymphocytes from patients carrying a body burden greater than 0.3 μCi 226 Ra were tested for specific cytotoxicity to four different osteosarcoma cell lines, as well as normal human fibroblasts. Cytotoxicity indices (defined as the ratio of the number of target cells remaining, after treatment with the patients' lymphocytes, relative to the values obtained with normal control subjects) have been calculated. With one exception, no cytotoxicity was observed. This is in agreement with the fact that no fresh osteosarcomas were diagnosed. The patient in whom cytotoxicity was observed was suffering from inflammation of the hip joint at the time of the first test. When the test was repeated 10 months later, no cytotoxicity was observed. No significant nonspecific cytotoxicity was observed using lymphocytes taken from four normal control subjects with any of the target cell lines used. (U.S.)
A cytotoxic cyclic heptapeptide from the seeds of Annona cherimola.
Wélé, Alassane; Zhang, Yanjun; Ndoye, Idrissa; Brouard, Jean-Paul; Pousset, Jean-Louis; Bodo, Bernard
2004-09-01
From a methanol extract of the seeds of Annona cherimola, a new cyclic heptapeptide, cherimolacyclopeptide C, has been isolated. The structure was elucidated on the basis of the MS/MS fragmentation using a Q-TOF mass spectrometer equipped with an ESI source, extensive 2D NMR experiments, and chemical degradation. Cherimolacyclopeptide C exhibited significant in vitro cytotoxic activity against KB cells, with an IC(50) value of 0.072 microM.
A cytotoxicity study of silicon oxycarbide nanowires as cell scaffold for biomedical applications
Energy Technology Data Exchange (ETDEWEB)
Lagonegro, P.; Rossi, F. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Galli, C., E-mail: carlo.galli@unipr.it [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Smerieri, A. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Alinovi, R.; Pinelli, S. [Department of Clinical and Experimental Medicine, Parma University, via Gramsci 14, 43126 Parma (Italy); Rimoldi, T. [Physics and Earth Science Department, Parma University, Parco Area delle Scienze 7/A, 43124 Parma (Italy); Attolini, G. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Macaluso, G.; Macaluso, C. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Saddow, S.E. [Electrical Engineering Department, University of South Florida, 4202 East Fowler Avenue, ENB118 Tampa, Florida (United States); Salviati, G. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy)
2017-04-01
Goal: Nanowires are promising biomaterials in multiple clinical applications. The goal of this study was to investigate the cytotoxicity of carbon-doped silica nanowires (SiO{sub x}C{sub y} NWs) on a fibroblastic cell line in vitro. Materials and methods: SiO{sub x}C{sub y} NWs were grown on Si substrates by CVD process. Murine L929 fibroblasts were cultured in complete DMEM and indirect and direct cytotoxicity tests were performed in agreement with ISO 19003-5, by quantitating cell viability at MTT and chemiluminescent assay. Cell cultures were investigated at Scanning Electron Microscope (SEM) and immunocytochemistry to observe their morphology and investigate cell-NWs interactions. Furthermore, hemocompatibility with Platelet-rich Plasma was assayed at SEM and by ELISA assay. Results: SiOxCy NWs proved biocompatible and did not impair cell proliferation at contact assays. L929 were able to attach on NWs and proliferate. Most interestingly, L929 reorganised the NW scaffold by displacing the nanostructure and creating tunnels within the NW network. NWs moreover did not impair platelet activation and behaved similarly to flat SiO{sub 2}. Conclusions: Our data show that SiOxCy NWs did not release cytotoxic species and acted as a viable and adaptable scaffold for fibroblastic cells, thus representing a promising platform for implantable devices. - Highlights: • NWs did not release cytotoxic species. • Fibroblasts reorganised the NWs network, adapting it to their needs. • Blood tests with platelet-rich plasma and dynamic blood coagulation tests showed oxycarbide NWs induced platelet activation. • Carbon-doped SiO{sub x}C{sub y} NWs network are a promising biomaterial for implantable scaffolds for tissue regeneration.
International Nuclear Information System (INIS)
Cowan, D.S.M.; Rauth, A.M.; Toronto Univ., ON; Matejovic, J.F.; McClelland, R.A.; Wardman, P.
1994-01-01
2-Nitroimidazoles targeted to DNA via intercalation have previously been shown to be as much as 10-100 times more efficient on a molar basis than the untargeted nitroimidazole, misonidazole, in vitro as hypoxic cell selective radiosensitizers and cytotoxins based on extracellular concentrations. In this work the effect of varying the nitroaromatic group has been examined through the preparation of a DNA-targeted 4-nitroimidazole (4-MeNLP-3), a 5-nitroimidazole (5-NLP-3) and a 5-nitrofuran (FEP-2) linked to phenanthridinium ions. With the previously synthesized 2-nitroimidazoles, this provides a series of DNA targeted compounds of varying electron affinity as well as structure at the nitroaromatic position. The present series of compounds was tested for partition coefficient, DNA binding ability, reduction potentials and in vitro radiosensitizing and cytotoxic abilities. The results obtained indicate that targeting such compounds to DNA diminishes the dependency of radiosensitizing and cytotoxic properties on reduction potential and may allow significant uncoupling of toxicity from radiosensitizing ability. (author)
Ciprofloxacin nano-niosomes for targeting intracellular infections: an in vitro evaluation
International Nuclear Information System (INIS)
Akbari, Vajihe; Abedi, Daryoush; Pardakhty, Abbas; Sadeghi-Aliabadi, Hojjat
2013-01-01
In order to propose non-ionic surfactant vesicles (niosomes) for the treatment of intracellular infections, a remote loading method (active drug encapsulation) followed by sonication was used to prepare nano-niosome formulations containing ciprofloxacin (CPFX). Size analysis, size distribution and zeta potentials of niosomes were evaluated and then their antimicrobial activity, cellular uptake, cytotoxicity, intracellular distribution, and antibacterial activity against intracellular Staphylococcus aureus infection of murine macrophage-like, J774, cells were investigated in comparison to free drug. Our findings reveal that size and composition of the niosome formula can influence their in vitro biological properties. Vesicles in the 300–600 nm size range were phagocytosed to a greater degree by macrophages in comparison to other size vesicles. The minimum inhibitory concentrations (MICs) of CPFX-loaded niosomes were two to eightfold lower than MICs of free CPFX. In addition, niosome encapsulation of CPFX provided high intracellular antimicrobial activities while free CPFX is ineffective for eradicating intracellular forms of S. aureus. Encapsulation of CPFX in niosomes generally decreased its in vitro cytotoxicity. Our results show that niosomes are suitable drug delivery systems with good efficacy and safety properties to be proposed for drug targeting against intracellular infections.
Ciprofloxacin nano-niosomes for targeting intracellular infections: an in vitro evaluation
Energy Technology Data Exchange (ETDEWEB)
Akbari, Vajihe; Abedi, Daryoush [Isfahan University of Medical Sciences, Department of Pharmaceutical Biotechnology and Isfahan Pharmaceutical Research Center, Faculty of Pharmacy (Iran, Islamic Republic of); Pardakhty, Abbas [Kerman University of Medical Sciences, Pharmaceutics Research Center (Iran, Islamic Republic of); Sadeghi-Aliabadi, Hojjat, E-mail: sadeghi@pharm.mui.ac.ir [Isfahan University of Medical Sciences, Department of Pharmaceutical Biotechnology and Isfahan Pharmaceutical Research Center, Faculty of Pharmacy (Iran, Islamic Republic of)
2013-04-15
In order to propose non-ionic surfactant vesicles (niosomes) for the treatment of intracellular infections, a remote loading method (active drug encapsulation) followed by sonication was used to prepare nano-niosome formulations containing ciprofloxacin (CPFX). Size analysis, size distribution and zeta potentials of niosomes were evaluated and then their antimicrobial activity, cellular uptake, cytotoxicity, intracellular distribution, and antibacterial activity against intracellular Staphylococcus aureus infection of murine macrophage-like, J774, cells were investigated in comparison to free drug. Our findings reveal that size and composition of the niosome formula can influence their in vitro biological properties. Vesicles in the 300-600 nm size range were phagocytosed to a greater degree by macrophages in comparison to other size vesicles. The minimum inhibitory concentrations (MICs) of CPFX-loaded niosomes were two to eightfold lower than MICs of free CPFX. In addition, niosome encapsulation of CPFX provided high intracellular antimicrobial activities while free CPFX is ineffective for eradicating intracellular forms of S. aureus. Encapsulation of CPFX in niosomes generally decreased its in vitro cytotoxicity. Our results show that niosomes are suitable drug delivery systems with good efficacy and safety properties to be proposed for drug targeting against intracellular infections.
International Nuclear Information System (INIS)
Wehrmaker, A.; Lehmann, V.; Droege, W.
1986-01-01
The immunogenicity of a mutagenized subline (ESb-D) of the weakly immunogenic T-cell lymphoma L 5178 Y ESb has been characterized. The injection of 10(6) ESb-D cells ip did not establish lethal tumors in untreated DBA/2 mice but established tumors in sublethally irradiated mice. Injection of ESb-D cells into otherwise untreated DBA/2 mice established also a state of protective immunity against the subsequent injection of otherwise lethal doses of ESb tumor cells. Protection was only obtained after injection of intact but not UV-irradiated or mitomycin-C-treated ESb-D cells. A direct T-cell-mediated cytotoxic activity was also demonstrable in the spleen cells of DBA/2 mice after injection of ESb-D cells but not ESb cells. The cytotoxic activity was variant specific for ESb-D target cells, and it was induced only with intact but not UV-irradiated or mitomycin C-treated ESb-D cells. This suggested that the induction of protective and cytotoxic immunity may require the persistence of the antigen or unusually high antigen doses. The in vivo priming for a secondary in vitro cytotoxic response, in contrast, was achieved with intact and also with mitomycin C-treated ESb-D cells but again not with UV-irradiated ESb-D cells. This indicated that the metabolic activity was a minimal requirement for the in vivo immunogenicity of the ESb-D tumor line. The secondary cytotoxic activity was demonstrable on ESb-D and ESb target cells and could be restimulated in vitro about equally well with ESb-D and ESb cells. But the in vivo priming was again only obtained with ESb-D cells and not with ESb cells. These experiments thus demonstrated that the requirements for immunogenicity are more stringent in vivo than in vitro, and more stringent for the induction of direct cytotoxic and protective immunity in vivo than for the in vivo priming for secondary in vitro responses
Sirc-cvs cytotoxicity test: an alternative for predicting rodent acute systemic toxicity.
Kitagaki, Masato; Wakuri, Shinobu; Hirota, Morihiko; Tanaka, Noriho; Itagaki, Hiroshi
2006-10-01
An in vitro crystal violet staining method using the rabbit cornea-derived cell line (SIRC-CVS) has been developed as an alternative to predict acute systemic toxicity in rodents. Seventy-nine chemicals, the in vitro cytotoxicity of which was already reported by the Multicenter Evaluation of In vitro Toxicity (MEIC) and ICCVAM/ECVAM, were selected as test compounds. The cells were incubated with the chemicals for 72 hrs and the IC(50) and IC(35) values (microg/mL) were obtained. The results were compared to the in vivo (rat or mouse) "most toxic" oral, intraperitoneal, subcutaneous and intravenous LD(50) values (mg/kg) taken from the RTECS database for each of the chemicals by using Pearson's correlation statistics. The following parameters were calculated: accuracy, sensitivity, specificity, prevalence, positive predictability, and negative predictability. Good linear correlations (Pearson's coefficient; r>0.6) were observed between either the IC(50) or the IC(35) values and all the LD(50) values. Among them, a statistically significant high correlation (r=0.8102, p50) values and the oral LD(50) values. By using the cut-off concentrations of 2,000 mg/kg (LD(50)) and 4,225 microg/mL (IC(50)), no false negatives were observed, and the accuracy was 84.8%. From this, it is concluded that this method could be used to predict the acute systemic toxicity potential of chemicals in rodents.
Chandar, Sanchitha; Kotian, Ravindra; Madhyastha, Prashanthi; Kabekkodu, Shama Prasada; Rao, Padmalatha
2017-01-01
The aim of this study was to investigate the cytotoxicity in human gingival fibroblast by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and corrosion behavior by potentiodynamic polarization technique of commercially pure titanium (Ti 12) and its alloy Ti-6Al-4V (Ti 31). In the present in vitro study, cytotoxicity of Ti 12 and Ti 31 in human gingival fibroblast by MTT assay and the corrosion behavior by potentiodynamic polarization technique in aqueous solutions of 0.1 N NaCl, 0.1 N KCl, and artificial saliva with and without NaF were studied. The independent t -test within materials and paired t-test with time interval showed higher cell viability for Ti 12 compared to Ti 31. Over a period, cell viability found to stabilize in both Ti 12 and Ti 31. The effects of ions of Ti and alloying elements aluminum and vanadium on the cell viability were found with incubation period of cells on samples to 72 h. The electrochemical behavior of Ti 12 and Ti 31 in different experimental solutions showed a general tendency for the immersion potential to shift steadily toward nobler values indicated formation of TiO 2 and additional metal oxides. The multiphase alloy Ti-6Al-4V showed more surface pitting. The commercially pure Ti showed better cell viability compared to Ti 31. Less cell viability in Ti 31 is because of the presence of aluminum and vanadium. A significant decrease in cytotoxicity due to the formation of TiO 2 over a period of time was observed both in Ti 12 and Ti 31. The electrochemical behavior of Ti 12 and Ti 31 in different experimental solutions showed a general tendency for the immersion potential to shift steadily toward nobler values indicated formation of TiO2 and additional metal oxides. Ti 31 alloy showed surface pitting because of its multiphase structure.
Six cytotoxic annonaceous acetogenins from Annona squamosa seeds.
Chen, Yong; Chen, Jian-Wei; Wang, Yu; Xu, Sha-Sha; Li, Xiang
2012-12-01
Custard apple (Annona squamosa L.) is an edible tropical fruit, and its seeds had been used in south China as a folk medicine to treat "malignant sore" (cancer) and as an insecticide. Phytochemical investigation of the ethanol fraction of custard apple seeds led to the isolation of six new annonaceous acetogenins: annosquacins A-D (1-4), annosquatin A (5) and annosquatin B (6). Their structures were elucidated by spectroscopic analysis. Compounds 1-4 are adjacent bistetrahydrofuran annonaceous acetogenins. Compounds 5 and 6 are non-adjacent bistetrahydrofuran annonaceous acetogenins and the first examples in which the tetrahydrofuran ring system is located between C-9 and C-20. The absolute configurations of 1-6 were defined by the application of the Mosher method. Compounds 1-6 exhibited potent cytotoxic activity in vitro against five human tumour cell lines. Compounds 5 and 6 showed a high selectivity toward the MCF-7 and A-549 cell line respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
National Research Council Canada - National Science Library
Gao1, Radharaman Ray2, Yan Xiao3, Peter E. Barker3 and Prab, Xiugong
2006-01-01
.... In this study, the anti-cytotoxic and anti-inflammatory effects of a representative macrolide antibiotic, roxithromycin, were tested in vitro using SM-exposed normal human small airway epithelial (SAE...
Novel magnesium alloy Mg–2La caused no cytotoxic effects on cells in physiological conditions
Energy Technology Data Exchange (ETDEWEB)
Weizbauer, Andreas, E-mail: weizbauer.andreas@mh-hannover.de [Laboratory for Biomechanics and Biomaterials, Department of Orthopedic Surgery, Hannover Medical School, Anna-von-Borries-Straße 1-7, 30625 Hannover (Germany); CrossBIT, Center for Biocompatibility and Implant-Immunology, Department of Orthopedic Surgery, Hannover Medical School, Feodor-Lynen-Str. 31, 30625 Hannover (Germany); Seitz, Jan-Marten [Institute of Materials Science, Leibniz Universität Hannover, An der Universität 2, 30823 Garbsen (Germany); Werle, Peter [ABB AG, Trafoweg 4, 06112 Halle (Germany); Hegermann, Jan [Institute of Functional and Applied Anatomy, Hannover Medical School, Carl-Neuberg-Straße 1, 30625 Hannover (Germany); Willbold, Elmar [Laboratory for Biomechanics and Biomaterials, Department of Orthopedic Surgery, Hannover Medical School, Anna-von-Borries-Straße 1-7, 30625 Hannover (Germany); CrossBIT, Center for Biocompatibility and Implant-Immunology, Department of Orthopedic Surgery, Hannover Medical School, Feodor-Lynen-Str. 31, 30625 Hannover (Germany); Eifler, Rainer [Institute of Materials Science, Leibniz Universität Hannover, An der Universität 2, 30823 Garbsen (Germany); Windhagen, Henning [Laboratory for Biomechanics and Biomaterials, Department of Orthopedic Surgery, Hannover Medical School, Anna-von-Borries-Straße 1-7, 30625 Hannover (Germany); Reifenrath, Janin [Small Animal Clinic, University of Veterinary Medicine Hannover, Bünteweg 9, 30559 Hannover (Germany); Waizy, Hazibullah [Laboratory for Biomechanics and Biomaterials, Department of Orthopedic Surgery, Hannover Medical School, Anna-von-Borries-Straße 1-7, 30625 Hannover (Germany)
2014-08-01
Using several different in vitro assays, a new biodegradable magnesium alloy Mg–2La, composed of 98% magnesium and 2% lanthanum, was investigated as a possible implant material for biomedical applications. An in vitro cytotoxicity test, according to EN ISO 10993-5/12, with L929 and human osteoblastic cells identified no toxic effects on cell viability at physiological concentrations (at 50% dilutions and higher). The metabolic activity of human osteoblasts in the 100% extract was decreased to < 70% and was therefore rated as cytotoxic. The degradation rates of Mg–2La were evaluated in phosphate buffered saline and four different cell culture media. The degradation rates were shown to be influenced by the composition of the solution, and the addition of fetal bovine serum slightly accelerated the corrosive process. The results of these in vitro experiments suggest that Mg–2La is a promising candidate for use as an orthopedic implant material. - Highlights: • A new magnesium alloy (Mg–2La) has been developed. • Magnesium alloy Mg–2La revealed no toxic effect in physiological concentrations. • Degradation rates were influenced by the corrosion media. • The addition of fetal bovine serum increased the corrosive process slightly.
Novel magnesium alloy Mg–2La caused no cytotoxic effects on cells in physiological conditions
International Nuclear Information System (INIS)
Weizbauer, Andreas; Seitz, Jan-Marten; Werle, Peter; Hegermann, Jan; Willbold, Elmar; Eifler, Rainer; Windhagen, Henning; Reifenrath, Janin; Waizy, Hazibullah
2014-01-01
Using several different in vitro assays, a new biodegradable magnesium alloy Mg–2La, composed of 98% magnesium and 2% lanthanum, was investigated as a possible implant material for biomedical applications. An in vitro cytotoxicity test, according to EN ISO 10993-5/12, with L929 and human osteoblastic cells identified no toxic effects on cell viability at physiological concentrations (at 50% dilutions and higher). The metabolic activity of human osteoblasts in the 100% extract was decreased to < 70% and was therefore rated as cytotoxic. The degradation rates of Mg–2La were evaluated in phosphate buffered saline and four different cell culture media. The degradation rates were shown to be influenced by the composition of the solution, and the addition of fetal bovine serum slightly accelerated the corrosive process. The results of these in vitro experiments suggest that Mg–2La is a promising candidate for use as an orthopedic implant material. - Highlights: • A new magnesium alloy (Mg–2La) has been developed. • Magnesium alloy Mg–2La revealed no toxic effect in physiological concentrations. • Degradation rates were influenced by the corrosion media. • The addition of fetal bovine serum increased the corrosive process slightly
Directory of Open Access Journals (Sweden)
Saied Soflaei
2012-01-01
Full Text Available Visceral leishmaniasis is one of the most important sever diseases in tropical and subtropical countries. In the present study the effects of antimony sulfide nanoparticles on Leishmania infantum in vitro were evaluated. Antimony sulfide NPs (Sb2S5 were synthesized by biological method from Serratia marcescens bacteria. Then the cytotoxicity effects of different concentrations (5, 10, 25, 50, and 100 μg/mL of this nanoparticle were assessed on promastigote and amastigote stages of L. infantum. MTT method was used for verification results of promastigote assay. Finally, the percentages of apoptotic, necrotic, and viable cells were determined by flow cytometry. The results indicated the positive effectiveness of antimony sulfide NPs on proliferation of promastigote form. The IC50 (50% inhibitory concentration of antimony sulfide NPs on promastigotes was calculated 50 μg/mL. The cytotoxicity effect was dose-dependent means by increasing the concentration of antimony sulfide NPs, the cytotoxicity curve was raised and the viability curve of the parasite dropped simultaneously. Moreover, the IC50 of antimony sulfide NPs on amastigote stage was calculated 25 μg/mL. On the other hand, however, antimony sulfide NPs have a low cytotoxicity effect on uninfected macrophages but it can induce apoptosis in promastigote stage at 3 of 4 concentrations.
International Nuclear Information System (INIS)
Lockshin, A.; Giovanella, B.C.; Quian, C.; Mendoza, J.T.; Vardeman, D.M.; Stehlin, J.S. Jr.
1984-01-01
BRO human melanoma cells were prelabeled in vitro with [125I]5-iodo-2'-deoxyuridine ([125I]IdUrd) and inoculated into NIH-II nude mice ip, im, sc, or iv. Saline or diphtheria toxin (DT), which is selectively toxic to human cells compared to those of mice, was injected, and the loss of 125I from the animals was monitored daily with a whole-body gamma scintillation detector. For most of the inoculation sites DT accelerated the rate of 125I excretion and in all cases was cytotoxic for the inoculated cells as determined by host survival or measurement of visible tumor growth. Differences between the rates of 125I loss for DT-treated mice compared to untreated mice were most evident for cells inoculated ip or im. These results indicate that [125I]IdUrd prelabeling of human tumor cells inoculated in nude mice offers a rapid method for determination of cytotoxicity in vivo
Directory of Open Access Journals (Sweden)
Khoshayand Mohammad
2012-07-01
Full Text Available Abstract Background and the purpose of the study Dual functional agents in which nitroaromatic or nitroheterocyclic compounds are attached through a linker unit to mustards and aziridines have shown higher cytotoxicities than the corresponding counterparts to both aerobic and hypoxic cells and enhanced radiosensitizing activity. In the present investigation cytotoxicity and radiosensitizing activity of 2,4-dinitrobenzyl, 2,4-dinitrobenzoyl, and 2,4-dinitrophenacetyl derivatives of 5-fluorouracil which was assumed to release cytotoxic active quinone methidide and 5-fluorouracil under hypoxic conditions on HT-29 cell line under both aerobic and hypoxic conditions was investigated. Methods 5-fluorouracil derivative X-XIII were prepared by the reaction of the corresponding di-nitro substituted benzyl, benzoyl and phenacetyl halides with 5-fluorouracil protected at N-1 with di-t-butoxydicarbonate (BOC in dimethyl formamide (DMF in the presence of the potassium carbonate followed by hydrolysis of the blocking group by potassium carbonate in methanol. Cytotoxicity of fluorouracil VIII and tested compounds X-XIII against HT-29 cell line under both aerobic and hypoxic conditions after 48 hrs incubation were measured by determination of the percent of the survival cells using 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and percent of the dead cells using propidium iodide(PI-digitonine assay and results were used to calculate the corresponding IC50 values. Radiosensitization experiments were carried out by irradiation of the incubations with a 60Co source and clonogenic assay was performed to determine the cell viabilities following treatment with the tested compounds and/or radiation. Sensitization Enhancement Ratio (SER of each tested compound was obtained from the radiation survival curves in the absence and presence of each sensitizer for 37% survival respectively. Results and major conclusion Findings of the present study
Cacciotti, Ilaria; Chronopoulou, Laura; Palocci, Cleofe; Amalfitano, Adriana; Cantiani, Monica; Cordaro, Massimo; Lajolo, Carlo; Callà, Cinzia; Boninsegna, Alma; Lucchetti, Donatella; Gallenzi, Patrizia; Sgambato, Alessandro; Nocca, Giuseppina; Arcovito, Alessandro
2018-07-01
The topical treatment for oral mucosal diseases is often based on products optimized for dermatologic applications; consequently, a lower therapeutic effect may be present. 18-β-glycyrrhetic acid (GA) is extracted from Glycirrhiza glabra. The first aim of this study was to test the cytotoxicity of GA on PE/CA-PJ15 cells. The second aim was to propose and test two different delivery systems, i.e. nanoparticles and fibers, to guarantee a controlled release of GA in vitro. We used chitosan and poly(lactic-co-glycolic) acid based nanoparticles and polylactic acid fibers. We tested both delivery systems in vitro on PE/CA-PJ15 cells and on normal human gingival fibroblasts (HGFs). The morphology of GA-loaded nanoparticles (GA-NPs) and fibers (GA-FBs) was investigated by electron microscopy and dynamic light scattering; GA release kinetics was studied spectrophotometrically. MTT test was used to assess GA cytotoxicity on both cancer and normal cells. Cells were exposed to different concentrations of GA (20–500 μmol l‑1) administered as free GA (GA-f), and to GA-NPs or GA-FBs. ROS production was evaluated using dichlorodihydrofluorescein as a fluorescent probe. Regarding the cytotoxic effect of GA on PE/CA-PJ15 cells, the lowest TC50 value was 200 μmol l‑1 when GA was added as GA-NPs. No cytotoxic effects were observed when GA was administered to HGFs. N-acetyl Cysteine reduced mortality induced by GA-f in PE/CA-PJ15 cells. The specific effect of GA on PE/CA-PJ15 cells is mainly due to the different sensitivity of cancer cells to ROS over-production; GA-NPs and GA-FBs formulations increase, in vitro, this toxic effect on oral cancer cells.
The in vitro toxicology of Swedish snus
Coggins, Christopher R. E.; Ballantyne, Mark; Curvall, Margareta; Rutqvist, Lars-Erik
2012-01-01
Three commercial brands of Swedish snus (SWS), an experimental SWS, and the 2S3 reference moist snuff were each tested in four in vitro toxicology assays. These assays were: Salmonella reverse mutation, mouse lymphoma, in vitro micronucleus, and cytotoxicity. Water extractions of each of the 5 products were tested using several different concentrations; the experimental SWS was also extracted using dimethyl sulfoxide (DMSO). Extraction procedures were verified by nicotine determinations. Results for SWS in the mutagenicity assays were broadly negative: there were occasional positive responses, but these were effectively at the highest concentration only (concentrations well above those suggested by regulatory guidelines), and were often associated with cytotoxicity. The 2S3 reference was unequivocally positive in one of the three conditions of the micronucleus assay (MNA), at the highest concentration only. Positive controls produced the expected responses in each assay. The SWS data are contrasted with data reported for combusted tobacco in the form of cigarettes, where strongly positive responses have been routinely reported for mutagenicity and cytotoxicity. These negative findings in a laboratory setting concur with the large amount of epidemiological data from Sweden, data showing that SWS are associated with considerably lower carcinogenic potential when compared with cigarettes. PMID:22400986
Immunobiological Effects of Glucosamine In Vitro
DEFF Research Database (Denmark)
Forchhammer, L; Thorn, M; Met, O
2003-01-01
Glucosamine (GlcN) and N-acetyl-d-glucosamine (GlcNAc) were assayed in vitro for their effects on proliferation, cytotoxicity and cytokine secretion in primary and secondary mixed lymphocyte cultures (MLCs). In addition, we studied the effect of GlcN and GlcNAc on the proliferation of purified CD4...
Distribution and tumour cytotoxicity of the radiosensitizer misonidazole (Ro-07-0582) in C57 mice
International Nuclear Information System (INIS)
Pedersen, J.E.; Smith, M.R.; Bugden, R.D.; Peckham, M.J.
1979-01-01
The distribution and clearance of misonidazole (MIS=Ro-07-0582) were studied in C57 mouse tissued and in transplants of Lewis lung tumour. The half life of the drug in blood after a dose of 1mg/g i.p. was 3 h. Some tissues, such as liver, were found to have consistently low MIS levels, and this was found to be due to degradation of the drug after removal of the tissues from the host. The in vivo cytotoxicity of MIS to Lewis lung tumour cells was studied using an in-vitro colony assay. After half of the tumours had been irradiated with 10 Gy to kill most of the oxic cells, the mice received i.p. injections of MIS. To simulate the longer drug exposure of human tumour cells (due to the longer half life in man) a repeated injection regime was used in some mice. There was no significant cell kill after a single dose, but with a prolonged exposure to the drug in the multiply injected animals, cell survival was reduced to 50% of control in both the irradiated and unirradiated tumours. Since the hypoxic fraction of the unirradiated tumour is probably not more than 30%, it would appear that MIS is not selectively cytotoxic to hypoxic cells. However, MIS had a much greater cytotoxic effect upon hypoxic Lewis lung tumour cells in vitro, with very little or no effect on cells grown in air. This would support the theory that the presence of hypoxic cells is essential for the expression of MIS cytotoxicity. (author)
International Nuclear Information System (INIS)
Ades, E.W.; Hinson, A.; Butler, L.D.
1986-01-01
The ability of in vitro addition of recombinant interleukin 2 (rIL-2) to differentially enhance natural cytotoxicity was assessed using cells from mice with natural and induced cellular defects. In vivo treatment with most immunosuppressive or cytoreductive agents, anti-asialo-GM1 antibody, or gamma irradiation dramatically reduced in vitro cytotoxicity against natural killer (NK) sensitive targets by direct reduction in either percentage specific lysis or lytic units per spleen. In most cases, in vitro addition of rIL-2 (at concentrations causing augmented NK function in cells from naive Balb/C mice) enhanced cytotoxic activity of cells from treatment groups to a normal value but not within the rIL-2-enhanced range of nontreated animals. Additionally, cytotoxic activity of cells from animals treated with certain drugs or gamma irradiation could be augmented by rIL-2 when measured by percentage lysis but not lytic units per spleen. In vivo treatment with cyclosporin A did not affect natural cytotoxic activity and addition of rIL-2 augmented the NK activity in a similar fashion to the profile of naive cells. In experiments using cells from beige (C57Bl/6-bg) mice which have a natural defect in NK activity against YAC-1 targets, addition of rIL-2 (at concentrations causing augmented natural cytotoxic function in cells from C57Bl/6 mice) could not effectively enhance in vitro natural cytotoxic function
Energy Technology Data Exchange (ETDEWEB)
Ades, E.W.; Hinson, A.; Butler, L.D.
1986-08-01
The ability of in vitro addition of recombinant interleukin 2 (rIL-2) to differentially enhance natural cytotoxicity was assessed using cells from mice with natural and induced cellular defects. In vivo treatment with most immunosuppressive or cytoreductive agents, anti-asialo-GM1 antibody, or gamma irradiation dramatically reduced in vitro cytotoxicity against natural killer (NK) sensitive targets by direct reduction in either percentage specific lysis or lytic units per spleen. In most cases, in vitro addition of rIL-2 (at concentrations causing augmented NK function in cells from naive Balb/C mice) enhanced cytotoxic activity of cells from treatment groups to a normal value but not within the rIL-2-enhanced range of nontreated animals. Additionally, cytotoxic activity of cells from animals treated with certain drugs or gamma irradiation could be augmented by rIL-2 when measured by percentage lysis but not lytic units per spleen. In vivo treatment with cyclosporin A did not affect natural cytotoxic activity and addition of rIL-2 augmented the NK activity in a similar fashion to the profile of naive cells. In experiments using cells from beige (C57Bl/6-bg) mice which have a natural defect in NK activity against YAC-1 targets, addition of rIL-2 (at concentrations causing augmented natural cytotoxic function in cells from C57Bl/6 mice) could not effectively enhance in vitro natural cytotoxic function.
Directory of Open Access Journals (Sweden)
Dimitris Tsiapras
2013-10-01
Full Text Available Background: Electronic cigarettes (ECs have been marketed as an alternative-to-smoking habit. Besides chemical studies of the content of EC liquids or vapour, little research has been conducted on their in vitro effects. Smoking is an important risk factor for cardiovascular disease and cigarette smoke (CS has well-established cytotoxic effects on myocardial cells. The purpose of this study was to evaluate the cytotoxic potential of the vapour of 20 EC liquid samples and a “base” liquid sample (50% glycerol and 50% propylene glycol, with no nicotine or flavourings on cultured myocardial cells. Included were 4 samples produced by using cured tobacco leaves in order to extract the tobacco flavour. Methods: Cytotoxicity was tested according to the ISO 10993-5 standard. By activating an EC device at 3.7 volts (6.2 watts—all samples, including the “base” liquid and at 4.5 volts (9.2 watts—four randomly selected samples, 200 mg of liquid evaporated and was extracted in 20 mL of culture medium. Cigarette smoke (CS extract from three tobacco cigarettes was produced according to ISO 3308 method (2 s puffs of 35 mL volume, one puff every 60 s. The extracts, undiluted (100% and in four dilutions (50%, 25%, 12.5%, and 6.25%, were applied to myocardial cells (H9c2; percent-viability was measured after 24 h incubation. According to ISO 10993-5, viability of 6.25% (viability: 76.9 ± 2.0% at 6.25%, 38.2 ± 0.5% at 12.5%, 3.1 ± 0.2% at 25%, 5.2 ± 0.8% at 50%, and 3.9 ± 0.2% at 100% extract concentration. Three EC extracts (produced by tobacco leaves were cytotoxic at 100% and 50% extract concentrations (viability range: 2.2%–39.1% and 7.4%–66.9% respectively and one (“Cinnamon-Cookies” flavour was cytotoxic at 100% concentration only (viability: 64.8 ± 2.5%. Inhibitory concentration 50 was >3 times lower in CS extract compared to the worst-performing EC vapour extract. For EC extracts produced by high-voltage and energy, viability was
Directory of Open Access Journals (Sweden)
Nefedova L.
2017-06-01
Full Text Available is a vitamin-like substance, para-aminobenzoic acid (PABA. The aim of this work is to study antiviral activity of para-aminobenzoic acid, ε-aminocaproic acid, and their mixture against influenza virus, to evaluate their cytotoxic effect and to calculate their selectivity index by in vitro methods. Materials and Methods. For evaluation of cytotoxic concentration (CC50 of the substance tested, we used MDCK cell culture. For determination of anti-influenza activity of PABA, ε-АCA, and their mixture under conditions of in vitro experiment, we used 24-hour passaged MDCK culture cells of dog’s kidney, influenza virus strain А/FM/1/47 (H1N1, infected titer of which in MDCK culture cells of was between 3.0 and 9.0 lgID50. Results. As a result of our studies, we have determined that PABA in the concentration range studied from 10 to 1,000 ug/ml did not have any cytopahtic effect in MDCK culture cells. We calculated selectivity index (SI for PABA, that was equal SI=128205, this fact confirm high level of therapeutic safety of this substance. The result of our experiments demonstrate that anti-influenza activity of PABA solution is almost 100 times higher than that of “ACA”, furthermore in our in vitro experiment the mixture of PABA and ε-aminocaproic acid (in ratio 1:100 demonstrates a synergetic effect. In addition, for combination of PABA and εАКК (1:100 we calculated fractional inhibitory coefficient FIC=0.79, that indicates to moderate synergetic effect of these substances. Conclusions. As a result of our in vitro studies, we have determined a high-level antiviral activity of para-aminobenzoic acid against influenza virus, and in combination with ε-aminocaproic acid it demonstrated a synergetic effect. We have determined that PABA does not exhibit any cytotoxic effect on MDCK culture cells in the concentration range studied and demonstrates high level of therapeutic safety.
In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes
National Research Council Canada - National Science Library
McCormack-Brown, Stephanie
2008-01-01
.... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...
Rajavel, Krishnamoorthy; Gomathi, Rajkumar; Manian, Sellamuthu; Rajendra Kumar, Ramasamy Thangavelu
2014-01-21
Understanding the bacterial cytotoxicity of CNTs is important for a wide variety of applications in the biomedical, environmental, and health sectors. A majority of the earlier reports attributed the bactericidal cytotoxicity of CNTs to bacterial cell membrane damage by direct physical puncturing. Our results reveal that bacterial cell death via bacterial cell membrane damage is induced by reactive oxygen species (ROS) produced from CNTs and is not due to direct physical puncturing by CNTs. To understand the actual mechanism of bacterial killing, we elucidated the bacterial cytotoxicity of SWCNTs and MWCNTs against Gram-negative human pathogenic bacterial species Escherichia coli, Shigella sonnei, Klebsiella pneumoniae, and Pseudomonas aeruginosa and its amelioration upon functionalizing the CNTs with antioxidant tannic acid (TA). Interestingly, the bacterial cells treated with CNTs exhibited severe cell damage under laboratory (ambient) and sunlight irradiation conditions. However, CNTs showed no cytotoxicity to the bacterial cells when incubated in the dark. The quantitative assessments carried out by us made it explicit that CNTs are effective generators of ROS such as (1)O2, O2(•-), and (•)OH in an aqueous medium under both ambient and sunlight-irradiated conditions. Both naked and TA-functionalized CNTs showed negligible ROS production in the dark. Furthermore, strong correlations were obtained between ROS produced by CNTs and the bacterial cell mortality (with the correlation coefficient varying between 0.7618 and 0.9891) for all four tested pathogens. The absence of bactericidal cytotoxicity in both naked and functionalized CNTs in the dark reveals that the presence of ROS is the major factor responsible for the bactericidal action compared to direct physical puncturing. This understanding of the bactericidal activity of the irradiated CNTs, mediated through the generation of ROS, could be interesting for novel applications such as regulated ROS delivery
Timocin, Taygun; Ila, Hasan Basri; Dordu, Tuba; Husunet, Mehmet Tahir; Tazehkand, Mostafa Norizadeh; Valipour, Ebrahim; Topaktas, Mehmet
2016-01-01
Flurbiprofen is non-steroidal anti-inflammatory drug which is commonly used for its analgesic, antipyretic, and anti-inflammatory effects. The purpose of the study was to explore the genotoxic and cytotoxic effects of flurbiprofen in human cultured lymphocytes by sister chromatid exchange, chromosome aberration, and cytokinesis-blocked micronucleus tests. 10, 20, 30, and 40 μg/mL concentrations of flurbiprofen (solvent is DMSO) were used to treatment of human cultured lymphocytes at two different treatment periods (24 and 48 h). Flurbiprofen had no significant genotoxic effect in any of these tests. But exposing to flurbiprofen for 24 and 48 h led to significant decrease on proliferation index, mitotic index, and nuclear division index (NDI). Also, all decreases were concentration-dependent (except NDI at 24 h treatment period). Consequently, the findings of this research showed that flurbiprofen had cytotoxic effects in human blood lymphocytes.
Nocchi, Samara Requena; de Moura-Costa, Gislaine Franco; Novello, Claudio Roberto; Rodrigues, Juliana; Longhini, Renata; de Mello, João Carlos Palazzo; Filho, Benedito Prado Dias; Nakamura, Celso Vataru; Ueda-Nakamura, Tânia
2016-01-01
Herpes simplex virus type 1 (HSV-1) is associated with orofacial infections and is transmitted by direct contact with infected secretions. Several efforts have been expended in the search for drugs to the treatment for herpes. Schinus terebinthifolius is used in several illnesses and among them, for the topical treatment of skin wounds, especially wounds of mucous membranes, whether infected or not. To evaluate the cytotoxicity and anti-HSV-1 activity of the crude hydroethanolic extract (CHE) from the stem bark of S. terebinthifolius, as well as its fractions and isolated compounds. The CHE was subjected to bioguided fractionation. The anti-HSV-1 activity and the cytotoxicity of the CHE, its fractions, and isolated compounds were evaluated in vitro by SRB method. A preliminar investigation of the action of CHE in the virus-host interaction was conducted by the same assay. CHE presented flavan-3-ols and showed anti-HSV-1 activity, better than its fractions and isolated compounds. The class of substances found in CHE can bind to proteins to form unstable complexes and enveloped viruses, as HSV-1 may be vulnerable to this action. Our results suggest that the CHE interfered with virion envelope structures, masking viral receptors that are necessary for adsorption or entry into host cells. The plant investigated exhibited potential for future development treatment against HSV-1, but further tests are necessary, especially to elucidate the mechanism of action of CHE, as well as preclinical and clinical studies to confirm its safety and efficacy. Crude hydroethanolic extract (CHE) presents promising activity against herpes simplex virus type 1 (HSV 1), with selectivity index (SI) = 22.50CHE has flavan-3-ols in its composition, such as catechin and gallocatechinThe fractions and isolated compounds obtained from CHE by bioguided fractionation are less active than the CHE against HSV-1CHE interferes with viral entry process in the host cell and acts directly on the viral
induced acute cytotoxicity in human cervical epithelial carcinoma cells
African Journals Online (AJOL)
Molecular basis of arsenite (As +3 )-induced acute cytotoxicity in human cervical epithelial carcinoma cells. ... Libyan Journal of Medicine ... Methods: After performing cytotoxic assays on a human epithelial carcinoma cell line, expression analysis was done by quantitative polymerase chain reaction, western blotting, and ...
Banerjee, Nivedita; Talcott, Stephen; Safe, Stephen; Mertens –Talcott, Susanne U
2012-01-01
Several studies have demonstrated that polyphenolics from pomegranate (Punica granatum L.) are potent inhibitors of cancer cell proliferation and induce apoptosis, cell cycle arrest, and also decrease inflammation in vitro and vivo. There is growing evidence that botanicals exert their cytotoxic and anti-inflammatory activities, at least in part, by decreasing specificity protein (Sp) transcription factors. These are overexpressed in breast-tumors and regulate genes important for cancer cell survival and inflammation such as the p65 unit of NF-κB. Moreover, previous studies have shown that Pg extracts decrease inflammation in lung cancer cell lines by inhibiting phosphatidylinositol 3,4,5-trisphosphate (PI3K)-dependent phosphorylation of AKT in vitro and inhibiting the activation of NF-kB in vivo. The objective of this study was to investigate the roles of miR-27a-ZBTB10-Sp and miR-155-SHIP-1-PI3K on the anti-inflammatory and cytotoxic activity of pomegranate extract. Pg extract (2.5–50 µg/ml) inhibited growth of BT-474 and MDA-MB-231 cells but not the non-cancer MCF-10F and MCF-12F cells. Pg extract significantly decreased Sp1, Sp3, and Sp4 as well as miR-27a in BT474 and MDA-MB-231 cells and increased expression of the transcriptional repressor ZBTB10. A significant decrease in Sp proteins and Sp-regulated genes was also observed. Pg extract also induced SHIP-1 expression and this was accompanied by downregulation of miRNA-155 and inhibition of PI3K-dependent phosphorylation of AKT. Similar results were observed in tumors from nude mice bearing BT474 cells as xenografts and treated with Pg extract. The effects of antagomirs and knockdown of SHIP-1 by RNA interference confirmed that the anti-inflammatory and cytotoxic effects of Pg extract were partly due to the disruption of both miR-27a-ZBTB10 and miR-155-SHIP-1. In summary the anticancer activities of Pg extract in breast cancer cells were due in part to targeting microRNAs155 and 27a. Both pathways play an
The Effect of Hydrocotyle sibthorpioides Lam. Extracts on In Vitro Dengue Replication
Directory of Open Access Journals (Sweden)
Fitrien Husin
2015-01-01
Full Text Available Objective. To investigate the potential effect of Hydrocotyle sibthorpioides Lam. (H. sibthorpioides extracts against in vitro dengue viral replication. Methods. The cytotoxicity of H. sibthorpioides was evaluated using a cell viability assay. Cells were pre- and posttreated with water and methanol extracts of H. sibthorpioides, and the viral inhibitory effect was investigated by observing the morphological changes, which were further confirmed by plaque assay. Results. The methanolic extract cytotoxicity was higher in Vero and C6/36 cells than the cytotoxicity of the water extract. Preincubation of the cells with H. sibthorpioides extract showed nonexistent to mild prophylactic effects. The posttreatment of Vero cells with H. sibthorpioides methanolic extract presented higher antidengue activities when compared with the water extract. Surprisingly, posttreatment of C6/36 cells resulted in an enhancement of viral replication. Conclusion. H. sibthorpioides had variable effects on dengue viral replication, depending on the treatment, cell lines, and solvent types. This study provides important novel insights on the phytomedicinal properties of H. sibthorpioides extracts on dengue virus.
International Nuclear Information System (INIS)
Reddy, N. Jayachandra; Nagoor Vali, D.; Rani, M.; Rani, S. Sudha
2014-01-01
Silver nanoparticles synthesized through bio-green method has been reported to have biomedical applications to control pathogenic microbes as it is cost effective compared to commonly used physical and chemical methods. In present study, silver nanoparticles were synthesized using aqueous Piper longum fruit extract (PLFE) and confirmed by UV–visible spectroscopy. The nanoparticles were spherical in shape with an average particle size of 46 nm as determined by scanning electronic microscopy (SEM) and dynamic light scattering (DLS) particle size analyzer respectively. FT-IR spectrum revealed the capping of the phytoconstituents, probably polyphenols from P. longum fruit extract and stabilizing the nanoparticles. Further the ferric ion reducing test, confirmed that the capping agents were condensed tannins. The aqueous P. longum fruit extract (PLFE) and the green synthesized silver nanoparticles (PLAgNPs) showed powerful antioxidant properties in in vitro antioxidant assays. The results from the antimicrobial assays suggested that green synthesized silver nanoparticles (PLAgNPs) were more potent against pathogenic bacteria than the P. longum fruit extract (PLFE) alone. The nanoparticles also showed potent cytotoxic effect against MCF-7 breast cancer cell lines with an IC 50 value of 67 μg/ml/24 h by the MTT assay. These results support the advantages of using bio-green method for synthesizing silver nanoparticles with antioxidant, antimicrobial and cytotoxic activities those are simple and cost effective as well. - Highlights: • 46 nm spherical shaped P. longum fruit silver nanoparticles was prepared. • Capping and reducing bioactive plant compounds with in nanoparticles were condensed tannins. • Particles are potent antioxidant and anti microbial in biological systems. • They are cytotoxic against MCF-7 cell lines
Energy Technology Data Exchange (ETDEWEB)
Reddy, N. Jayachandra; Nagoor Vali, D.; Rani, M.; Rani, S. Sudha, E-mail: sadrassudha@gmail.com
2014-01-01
Silver nanoparticles synthesized through bio-green method has been reported to have biomedical applications to control pathogenic microbes as it is cost effective compared to commonly used physical and chemical methods. In present study, silver nanoparticles were synthesized using aqueous Piper longum fruit extract (PLFE) and confirmed by UV–visible spectroscopy. The nanoparticles were spherical in shape with an average particle size of 46 nm as determined by scanning electronic microscopy (SEM) and dynamic light scattering (DLS) particle size analyzer respectively. FT-IR spectrum revealed the capping of the phytoconstituents, probably polyphenols from P. longum fruit extract and stabilizing the nanoparticles. Further the ferric ion reducing test, confirmed that the capping agents were condensed tannins. The aqueous P. longum fruit extract (PLFE) and the green synthesized silver nanoparticles (PLAgNPs) showed powerful antioxidant properties in in vitro antioxidant assays. The results from the antimicrobial assays suggested that green synthesized silver nanoparticles (PLAgNPs) were more potent against pathogenic bacteria than the P. longum fruit extract (PLFE) alone. The nanoparticles also showed potent cytotoxic effect against MCF-7 breast cancer cell lines with an IC 50 value of 67 μg/ml/24 h by the MTT assay. These results support the advantages of using bio-green method for synthesizing silver nanoparticles with antioxidant, antimicrobial and cytotoxic activities those are simple and cost effective as well. - Highlights: • 46 nm spherical shaped P. longum fruit silver nanoparticles was prepared. • Capping and reducing bioactive plant compounds with in nanoparticles were condensed tannins. • Particles are potent antioxidant and anti microbial in biological systems. • They are cytotoxic against MCF-7 cell lines.
IN VITRO CYTOTOXICITY OF AROMATIC AEROBIC BIOTRANSFORMATION PRODUCTS IN BLUEGILL SUNFISH BF-2 CELLS
Toluene (methylbenzene) is a common environmental pollutant that is found in many hazardous waste sites and it is an aquifer contaminant. A concern is the potential risk to human and ecosystem health due to exposure to toluene and its major biotransformation products. The cytotox...
Antinociceptive, cytotoxic and antibacterial activities of Cleome viscosa leaves
Directory of Open Access Journals (Sweden)
Utpal Bose
2011-02-01
Full Text Available The methanol extract of the dried leaves of Cleome viscosa L., Cleomaceae, was investigated for its possible antinociceptive, cytotoxic and antibacterial activities in animal models. The extract produced significant writhing inhibition in acetic acid-induced writhing in mice at the oral doses of 250 and 500 mg/kg body weight (p<0.001 comparable to the standard drug diclofenac sodium at the dose of 25 mg/kg of body weight (p<0.001. The crude extract produced the most prominent cytotoxic activity against brine shrimp Artemia salina (LC50 28.18 μg/mL and LC90 112.20 μg/mL. The extract of C. viscosa L. exhibited significant in vitro antibacterial activity against Staphylococcus saprophyticus, Shigella sonnie, Salmonella typhi, Vibrio cholera, Streptococcus epidermidis, Shigella flexneri and Staphylococcus aureus with the zones of inhibition ranging from 10.76 to 16.34 mm. The obtained results provide a support for the use of this plant in traditional medicine and its further investigation.
Coté, Héloïse; Boucher, Marie-Anne; Pichette, André; Legault, Jean
2017-05-25
Background: Tanacetum vulgare L. (Asteraceae) is a perennial herb that has been used to treat multiple ailments. Regional variability of the chemical composition of T. vulgare essential oils is well-known. Despite these regional chemotypes, most relevant studies did not analyze the complete chemical composition of the T. vulgare essential oil and its constituents in relation to their biological activities. Here, we assess the anti-inflammatory, antioxidant, antibacterial, and cytotoxic activities of T. vulgare collected from northern Quebec (Saguenay-Lac-St-Jean), Canada. Methods: Essential oil was extracted from plants by steam distillation and analyzed using GC-FID. Biological activities of essential oil and its main constituents were evaluated in vitro. Results: We identified the major compounds as camphor, borneol, and 1,8-cineole. The oil possesses anti-inflammatory activity inhibiting NO production. It also inhibits intracellular DCFH oxidation induced by tert-butylhydroperoxide. Anti-inflammatory activity of essential oil appears driven mainly by α-humulene while antioxidant activity is provided by α-pinene and caryophyllene oxide. Essential oil from T vulgare was active against both Escherichia coli and Staphylococcus aureus with camphor and caryophyllene oxide responsible for antibacterial activity. Finally, T. vulgare essential oil was slightly cytotoxic against the human healthy cell line WS1 while α-humulene and caryophyllene oxide were moderately cytotoxic against A-549, DLD-1, and WS1. Conclusion: We report, for the first time, links between the specific compounds found in T. vulgare essential oil and anti-inflammatory, antioxidant, antibacterial, and cytotoxic activities. T. vulgare essential oil possesses interesting biological properties.
Directory of Open Access Journals (Sweden)
Héloïse Coté
2017-05-01
Full Text Available Background: Tanacetum vulgare L. (Asteraceae is a perennial herb that has been used to treat multiple ailments. Regional variability of the chemical composition of T. vulgare essential oils is well-known. Despite these regional chemotypes, most relevant studies did not analyze the complete chemical composition of the T. vulgare essential oil and its constituents in relation to their biological activities. Here, we assess the anti-inflammatory, antioxidant, antibacterial, and cytotoxic activities of T. vulgare collected from northern Quebec (Saguenay-Lac-St-Jean, Canada. Methods: Essential oil was extracted from plants by steam distillation and analyzed using GC-FID. Biological activities of essential oil and its main constituents were evaluated in vitro. Results: We identified the major compounds as camphor, borneol, and 1,8-cineole. The oil possesses anti-inflammatory activity inhibiting NO production. It also inhibits intracellular DCFH oxidation induced by tert-butylhydroperoxide. Anti-inflammatory activity of essential oil appears driven mainly by α-humulene while antioxidant activity is provided by α-pinene and caryophyllene oxide. Essential oil from T vulgare was active against both Escherichia coli and Staphylococcus aureus with camphor and caryophyllene oxide responsible for antibacterial activity. Finally, T. vulgare essential oil was slightly cytotoxic against the human healthy cell line WS1 while α-humulene and caryophyllene oxide were moderately cytotoxic against A-549, DLD-1, and WS1. Conclusion: We report, for the first time, links between the specific compounds found in T. vulgare essential oil and anti-inflammatory, antioxidant, antibacterial, and cytotoxic activities. T. vulgare essential oil possesses interesting biological properties.
A simple and efficient in vitro method for metabolism studies of radiotracers
International Nuclear Information System (INIS)
Lee, Sang-Yoon; Choe, Yearn Seong; Kim, Dong Hyun; Park, Bok-Nam; Kim, Sang Eun; Choi, Yong; Lee, Kyung-Han; Lee, Jeewoo; Kim, Byung-Tae
2001-01-01
In vitro metabolism of acetylcholinesterase inhibitors containing 3-[ 18 F]fluoromethylbenzyl- ([ 18 F]1) and 4-[ 18 F]fluorobenzyl-piperidine moieties ([ 18 F]2) was studied and compared with the in vivo metabolism. Defluorination of the [ 18 F]1 mainly occurred to generate [ 18 F]fluoride ion both in vitro and in vivo. In contrast, the [ 18 F]2 was converted into an unknown polar metabolite in both metabolism methods and another metabolite, 4-[ 18 F]fluorobenzoic acid in vitro. These results demonstrated that the in vitro method can be used to predict the in vivo metabolism of both radiotracers
In Vitro Antimicrobial, Antioxidant, Cytotoxicity and GC-MS Analysis of Mazus goodenifolius
Directory of Open Access Journals (Sweden)
Muhammad Riaz
2012-12-01
Full Text Available The antimicrobial, antioxidant and cytotoxic properties of Mazus goodenifolius (Hornem. Pennell essential oil, methanol extract and some solvent-extracted subfractions of the latter were appraised. A qualitative, quantitative analysis of the classes of phytochemicals in the various fractions and GC-MS analysis of the essential oil was carried out. The activity of the plant extract and various subfractions against selected bacterial (Pasturella multocida, Escherichia coli, Bacillus subtilis and Staphylococcus aureus and fungal strains (Aspergillus niger, Aspergillus flavus, Alternaria alternata and Rhizopus solani was evaluated. The antioxidant activity was assayed using the DPPH radical scavenging and % inhibition of linoleic acid peroxidation tests. In the DPPH radical scavenging test the IC50 values ranged from 7.21 to 91.79 µg/mL, and in the latter the range of % peroxidation inhibition was 35.42–93.48%. Protective effects of the absolute methanol extract, which had the highest content of phenolics and flavonoids, against H2O2 induced oxidative damage in plasmid pBR322 DNA was also evaluated, and it was found to offer some protection at the highest tested dose (1,000 µg/mL. Finally the cytotoxicity of the plant extract, fractions and essential oil was analyzed by examining haemolytic activity against human blood erythrocytes (RBCs, whereby the % lysis of RBCs was found to be in the range of 1.65 to 4.01%.
Institute of Scientific and Technical Information of China (English)
Davood; Mahdian; Milad; Iranshahy; Abolfazl; Shakeri; Azar; Hoseini; Hoda; Yavari; Melika; Nazemi; Mehrdad; Iranshahi
2015-01-01
Objective: To screen the cytotoxic effects of some marine sponges extracts on HeLa and PC12 cells.Methods: Five marine sponges including Ircinia echinata(I. echinata), Dysidea avara,Axinella sinoxea, Haliclona tubifera and Haliclona violacea were collected from the Persian Gulf(Hengam Island). The cytotoxic effect of these sponges was evaluated by using MTT assay. The metabolic high performance liquid chromatography fingerprint of I. echinata was also carried out at two wavelengths(254 and 280 nm).Results: Among the sponges tested in this study, the extracts of I. echinata and Dysidea avara possessed the cytotoxic effect on HeLa and PC12 cells. The obtained fractions from high performance liquid chromatography were evaluated for their cytotoxic properties against the cell lines. The isolated fractions did not show significant cytotoxic properties.Conclusions: I. echinata could be considered as a potential extract for chemotherapy.Further investigation is needed to determine the accuracy of mechanism.
Institute of Scientific and Technical Information of China (English)
Davood Mahdian; Milad Iranshahy; Abolfazl Shakeri; Azar Hoseini; Hoda Yavari; Melika Nazemi; Mehrdad Iranshahi
2015-01-01
Objective:To screen the cytotoxic effects of some marine sponges extracts on HeLa and PC12 cells. Methods: Five marine sponges including Ircinia echinata (I. echinata), Dysidea avara, Axinella sinoxea, Haliclona tubifera and Haliclona violacea were collected from the Persian Gulf (Hengam Island). The cytotoxic effect of these sponges was evaluated by using MTT assay. The metabolic high performance liquid chromatography fingerprint of I. echinata was also carried out at two wavelengths (254 and 280 nm). Results:Among the sponges tested in this study, the extracts of I. echinata and Dysidea avara possessed the cytotoxic effect on HeLa and PC12 cells. The obtained fractions from high performance liquid chromatography were evaluated for their cytotoxic properties against the cell lines. The isolated fractions did not show significant cytotoxic properties. Conclusions:I. echinata could be considered as a potential extract for chemotherapy. Further investigation is needed to determine the accuracy of mechanism.
Short-chain analogs of luteinizing hormone-releasing hormone containing cytotoxic moieties.
Janáky, T; Juhász, A; Rékási, Z; Serfözö, P; Pinski, J; Bokser, L; Srkalovic, G; Milovanovic, S; Redding, T W; Halmos, G
1992-11-01
Five hexapeptide and heptapeptide analogs of luteinizing hormone-releasing hormone (LH-RH) were synthesized for use as carriers for cytotoxic compounds. These short analogs were expected to enhance target selectivity of the antineoplastic agents linked to them. Native LH-RH-(3-9) and LH-RH-(4-9) containing D-lysine and D-ornithine at position 6 were amidated with ethylamine and acylated on the N terminus. The receptor-binding affinity of one hexapeptide carrier AJ-41 (Ac-Ser-Tyr-D-Lys-Leu-Arg-Pro-NH-Et) to human breast cancer cell membranes was similar to that of [D-Trp6]LH-RH. Alkylating nitrogen mustards (melphalan, Ac-melphalan), anthraquinone derivatives including anticancer antibiotic doxorubicin, antimetabolite (methotrexate), and cisplatin-like platinum complex were linked to these peptides through their omega-amino group at position 6. The hybrid molecules showed no LH-RH agonistic activity in vitro and in vivo but had nontypical antagonistic effects on pituitary cells in vitro at the doses tested. These analogs showed a wide range of receptor-binding affinities to rat pituitaries and cell membranes of human breast cancer and rat Dunning prostate cancer. Several of these conjugates exerted some cytotoxic effects on MCF-7 breast cancer cell line.
Energy Technology Data Exchange (ETDEWEB)
Sayes, Christie M.; Reed, Kenneth L. [DuPont Haskell Global Centers for Health and Environmental Sciences (United States); Subramoney, Shekhar; Abrams, Lloyd [DuPont Corporate Center for Analytical Services (United States); Warheit, David B., E-mail: David.B.Warheit@USA.dupont.co [DuPont Haskell Global Centers for Health and Environmental Sciences (United States)
2009-02-15
Risk evaluations for nanomaterials require the generation of hazard data as well as exposure assessments. Most of the validated nanotoxicity studies have been conducted using in vivo experimental designs. It would be highly desirable to develop in vitro pulmonary hazard tests to assess the toxicity of fine and nanoscale particle-types. However, in vitro evaluations for pulmonary hazards are known to have limited predictive value for identifying in vivo lung toxicity effects. Accordingly, this study investigated the capacity of in vitro screening studies to predict in vivo pulmonary toxicity of several fine or nanoparticle-types following exposures in rats. Initially, complete physicochemical characterization of particulates was conducted, both in the dry and wet states. Second, rats were exposed by intratracheal instillation to 1 or 5 mg/kg of the following particle-types: carbonyl iron, crystalline silica, amorphous silica, nanoscale zinc oxide, or fine zinc oxide. Inflammation and cytotoxicity endpoints were measured at 24 h, 1 week, 1 month and 3 months post-instillation exposure. In addition, histopathological analyses of lung tissues were conducted at 3 months post-exposure. Pulmonary cell in vitro studies consisted of three different culture conditions at 4 different time periods. These included (1) rat L2 lung epithelial cells, (2) primary rat alveolar macrophages, and (3) alveolar macrophage-L2 lung epithelial cell co-cultures which were incubated with the same particles as tested in the in vivo study for 1, 4, 24, or 48 h. Cell culture fluids were evaluated for cytotoxicity endpoints and inflammatory cytokines at the different time periods in an attempt to match the biomarkers assessed in the in vivo study. Results of in vivo pulmonary toxicity studies demonstrated that instilled carbonyl iron particles produced little toxicity. Crystalline silica and amorphous silica particle exposures produced substantial inflammatory and cytotoxic effects initially, but
International Nuclear Information System (INIS)
Sayes, Christie M.; Reed, Kenneth L.; Subramoney, Shekhar; Abrams, Lloyd; Warheit, David B.
2009-01-01
Risk evaluations for nanomaterials require the generation of hazard data as well as exposure assessments. Most of the validated nanotoxicity studies have been conducted using in vivo experimental designs. It would be highly desirable to develop in vitro pulmonary hazard tests to assess the toxicity of fine and nanoscale particle-types. However, in vitro evaluations for pulmonary hazards are known to have limited predictive value for identifying in vivo lung toxicity effects. Accordingly, this study investigated the capacity of in vitro screening studies to predict in vivo pulmonary toxicity of several fine or nanoparticle-types following exposures in rats. Initially, complete physicochemical characterization of particulates was conducted, both in the dry and wet states. Second, rats were exposed by intratracheal instillation to 1 or 5 mg/kg of the following particle-types: carbonyl iron, crystalline silica, amorphous silica, nanoscale zinc oxide, or fine zinc oxide. Inflammation and cytotoxicity endpoints were measured at 24 h, 1 week, 1 month and 3 months post-instillation exposure. In addition, histopathological analyses of lung tissues were conducted at 3 months post-exposure. Pulmonary cell in vitro studies consisted of three different culture conditions at 4 different time periods. These included (1) rat L2 lung epithelial cells, (2) primary rat alveolar macrophages, and (3) alveolar macrophage-L2 lung epithelial cell co-cultures which were incubated with the same particles as tested in the in vivo study for 1, 4, 24, or 48 h. Cell culture fluids were evaluated for cytotoxicity endpoints and inflammatory cytokines at the different time periods in an attempt to match the biomarkers assessed in the in vivo study. Results of in vivo pulmonary toxicity studies demonstrated that instilled carbonyl iron particles produced little toxicity. Crystalline silica and amorphous silica particle exposures produced substantial inflammatory and cytotoxic effects initially, but
Which iodinated contrast media is the least cytotoxic to human disc cells?
Kim, Kyung-Hyun; Park, Jeong-Yoon; Park, Hyo-Suk; Kuh, Sung-Uk; Chin, Dong-Kyu; Kim, Keun-Su; Cho, Yong-Eun
2015-05-01
Iodinated contrast media (CM) is commonly used for various intradiscal injections such as in discography and endoscopic spinal surgery. However, CM has been shown to be toxic to renal tissue due to its ionic strength and osmolarity and as a result of iodine-induced cytotoxicity, which has raised concern over whether there are similar negative effects on disc cells. This in vitro study was designed to identify the least cytotoxic iodinated CM to the human disc cell among four different physiochemical iodinated contrast dyes. In vitro laboratory study. Intervertebral disc tissue was obtained by discectomy from a total of 10 lumbar disc patients undergoing surgery and disc cells were isolated. The human disc cells were grown in 3D alginate bead culture with 0, 0.1, 10, and 100 mg/mL CM solutions (ionic dimer, ionic monomer, non-ionic dimer, and non-ionic monomer) and mannitol as a control for 2 days. The living cells were analyzed with trypan blue staining. Fluorescence-activated cell sorting analysis was performed using Annexin V and propidium iodide (PI) and 3D alginate bead immunostaining to identify live, apoptotic, and necrotic cells. Human disc cell death was time- and dose-dependent in response to CM and more necrosis was observed than apoptosis. In addition, non-ionic dimeric CM (iodixanol) showed the least toxic effect on human disc cells, followed by non-ionic monomeric (iopromide), ionic dimeric (ioxaglate), and ionic monomeric CM (ioxithalamate). Contrast media is cytotoxic to human disc cells in a dose- and time-dependent manner. This in vitro study revealed that, among four different CM preparations, non-ionic dimeric CM is the least detrimental to human disc cell viability. Careful attention should be paid to the type of CM chosen for discography and endoscopic spinal surgery. It is also necessary to investigate the detrimental effects of CM on disc cells and disc degeneration in further in vivo studies. Copyright © 2015 Elsevier Inc. All rights
Autonomously bioluminescent mammalian cells for continuous and real-time monitoring of cytotoxicity.
Xu, Tingting; Close, Dan M; Webb, James D; Ripp, Steven A; Sayler, Gary S
2013-10-28
Mammalian cell-based in vitro assays have been widely employed as alternatives to animal testing for toxicological studies but have been limited due to the high monetary and time costs of parallel sample preparation that are necessitated due to the destructive nature of firefly luciferase-based screening methods. This video describes the utilization of autonomously bioluminescent mammalian cells, which do not require the destructive addition of a luciferin substrate, as an inexpensive and facile method for monitoring the cytotoxic effects of a compound of interest. Mammalian cells stably expressing the full bacterial bioluminescence (luxCDABEfrp) gene cassette autonomously produce an optical signal that peaks at 490 nm without the addition of an expensive and possibly interfering luciferin substrate, excitation by an external energy source, or destruction of the sample that is traditionally performed during optical imaging procedures. This independence from external stimulation places the burden for maintaining the bioluminescent reaction solely on the cell, meaning that the resultant signal is only detected during active metabolism. This characteristic makes the lux-expressing cell line an excellent candidate for use as a biosentinel against cytotoxic effects because changes in bioluminescent production are indicative of adverse effects on cellular growth and metabolism. Similarly, the autonomous nature and lack of required sample destruction permits repeated imaging of the same sample in real-time throughout the period of toxicant exposure and can be performed across multiple samples using existing imaging equipment in an automated fashion.
Kwon, Jae-Sung; Lee, Sang-Bae; Kim, Kwang-Mahn; Kim, Kyoung-Nam
2014-11-01
Vinyl polysiloxane (VPS) is elastomeric dental impression material which, despite having very few reports of adverse reactions, has shown high levels of cytotoxicity that is difficult to be interpreted without referencing to the positive control material. Therefore, in this study, positive control VPS was developed using sodium lauryl sulfate (SLS) for the reference of cytotoxicity test. The positive control VPS with SLS was formed with a different proportion of SLS (0, 1, 2, 4, 8 and 16 wt%) added to the base. The cytotoxicity test was then carried out using the extractions or dilutions of the extractions from each of the test samples using murine fibroblast cells (L929). The final product of positive control VPS behaved similar to commercially available VPS; being initially liquid-like and then becoming rubber-like. Ion chromatography showed that the level of SLS released from the product increased as the proportion of added SLS increased, consequently resulting in an increased level of cytotoxicity. Also, the commercially available VPS was less cytotoxic than the positive control VPS with more or equal to 2 wt% of SLS. However, even the VPS with the highest SLS (16 wt%) did not cause oral mucosa irritation during the animal study. The positive control VPS was successfully produced using SLS, which will be useful in terms of providing references during in vitro cytotoxicity testing.
Antioxidant, pro-oxidant and cytotoxic properties of parsley.
Dorman, H J Damien; Lantto, Tiina A; Raasmaja, Atso; Hiltunen, Raimo
2011-06-01
Parsley (Petroselinum crispum) leaves were macerated with a mixture of methanol: water: acetic acid to produce a crude extract which was then defatted with (40°-60°) petrol. Antioxidant activity of the extract was evaluated using a battery of in vitro assays, viz., iron(iii) reduction, iron(ii) chelation and free radical scavenging assays. Evaluation of the pro-oxidant activity of the extract was based upon its effects upon DNA fragmentation and protein carbonylation. Cytotoxicity and apoptotic effects of the extract were determined in non-cancerous CV1-P fibroblast and cancerous A375 melanoma cells using MTT and LDH tests and caspase 3-like activity assay. The highest concentration, 2.0 mg ml(-1), decreased the viability of both cell lines, however, the cancerous melanoma cells were slightly susceptible to the effects. The observed cytotoxicity was not due to the caspase 3 activity. In conclusion, the toxicity might be explained by the pro-oxidative activity of components within the extract against proteins and/or DNA but it is not related to caspase 3-dependent apoptosis within cells.
International Nuclear Information System (INIS)
Wilson, W.R.; Anderson, R.F.
1989-01-01
Nitracrine (NC) is an electron affinic DNA intercalating agent and a potent hypoxia-selective cytotoxin and radiosensitizer in cell culture. Although NC is too cytotoxic and too rapidly metabolized to provide hypoxic cell radiosensitization in tumors, it is of mechanistic interest as an example of a DNA affinic radiosensitizer. We have observed a rapid chemical reaction between NC and reduced glutathione (GSH), which suggests that the observed potent in vitro cytotoxicity and radiosensitization might be dependent on thiol depletion by the large extracellular reservoir of drug. However, no GSH depletion was observed under conditions providing radiosensitization or rapid cell killing, and prior depletion of GSH by buthionine sulphoximine had no effect on cytotoxicity or formation of macromolecular adducts. Further, the intracellular reaction of NC with GSH is slower than predicted on the basis of the measured second order rate constant and the total intracellular concentrations of both species. The results are consistent with a role for DNA binding in protecting NC from reaction with GSH, and in improving the efficiency with which reduced electrophilic metabolites react with DNA in preference to GSH
Myrtus comunis and Eucalyptus camaldulensis cytotoxicity on breast cancer cells
Directory of Open Access Journals (Sweden)
Hrubik Jelena D.
2012-01-01
Full Text Available In vitro cytotoxicity of methanol, ethyl acetate, n-buthanol, and water extracts of Myrtus communis L. and Eucalyptus camaldulensis Dehnh. was examined against two human breast cancer cell lines (MCF 7 and MDA-MB-231 using MTT and SRB assays. The results showed significant cytotoxic potential of examined extracts, with IC50 values ranging from 7 to 138 μg/ml for M. communis and 3-250 μg/ml for E. camaldulensis. The two plants generally expressed similar activity, and no significant difference in cell line’s sensitivity towards extracts was observed. The results indicate to M. communis and E. camaldulensis as candidates for thorough chemical analyses for identification of active compounds, and eventually for attention in the process of discovery of new natural products in the control of cancer. [Projekat Ministarstva nauke Republike Srbije, br. 173037 i br. 172058
International Nuclear Information System (INIS)
Gan, Lin Ling; Fang, Bo; Zhou, Cheng He
2010-01-01
A series of azole-containing piperazine derivatives have been designed and synthesized. The obtained compounds were investigated in vitro for their antibacterial, antifungal and cytotoxic activities. The preliminary results showed that most compounds exhibited moderate to significant antibacterial and antifungal activities in vitro. 1-(4-((4-chlorophenyl) (phenyl)methyl)piperazin-1-yl)-2-(1H-imidazol-1-yl)ethanone and 1-(4-((4-Chlorophenyl)(phenyl)methyl)piperazin-1- yl)-2-(2-phenyl-1H-imidazol-1-yl)ethanone gave remarkable and broad-spectrum antimicrobial efficacy against all tested strains with MIC values ranging from 3.1 to 25 μg/mL, and exhibited comparable activities to the standard drugs chloramphenicol and fluconazole in clinic. Moreover, 2-((4-((4-chlorophenyl)(phenyl)methyl)piperazin-1-yl)methyl)- 1H-benzo[d]imidazole was found to be the most effective in vitro against the PC-3 cell line, reaching growth inhibition values (36.4, 60.1 and 76.5%) for each tested concentration: 25 μM, 50 μM and 100 μM in dose-dependent manner. The results also showed that the azole ring had noticeable effect on their antimicrobial and cytotoxic activities, and imidazole and benzimidazole moiety were much more favourable to biological activity than 1,2,4-triazole
Energy Technology Data Exchange (ETDEWEB)
Gan, Lin Ling; Fang, Bo; Zhou, Cheng He [Southwest University, Chongqing (China)
2010-12-15
A series of azole-containing piperazine derivatives have been designed and synthesized. The obtained compounds were investigated in vitro for their antibacterial, antifungal and cytotoxic activities. The preliminary results showed that most compounds exhibited moderate to significant antibacterial and antifungal activities in vitro. 1-(4-((4-chlorophenyl) (phenyl)methyl)piperazin-1-yl)-2-(1H-imidazol-1-yl)ethanone and 1-(4-((4-Chlorophenyl)(phenyl)methyl)piperazin-1- yl)-2-(2-phenyl-1H-imidazol-1-yl)ethanone gave remarkable and broad-spectrum antimicrobial efficacy against all tested strains with MIC values ranging from 3.1 to 25 μg/mL, and exhibited comparable activities to the standard drugs chloramphenicol and fluconazole in clinic. Moreover, 2-((4-((4-chlorophenyl)(phenyl)methyl)piperazin-1-yl)methyl)- 1H-benzo[d]imidazole was found to be the most effective in vitro against the PC-3 cell line, reaching growth inhibition values (36.4, 60.1 and 76.5%) for each tested concentration: 25 μM, 50 μM and 100 μM in dose-dependent manner. The results also showed that the azole ring had noticeable effect on their antimicrobial and cytotoxic activities, and imidazole and benzimidazole moiety were much more favourable to biological activity than 1,2,4-triazole.
In vitro antioxidant and cytotoxic properties of ethanol extract of Alpinia oxyphylla fruits.
Wang, Cheng-zhong; Yuan, Hui-hui; Bao, Xiao-li; Lan, Min-bo
2013-11-01
Alpinia oxyphylla Miquel (Zingiberaceae) is a traditional Chinese herbal medicine widely used for the treatment of intestinal disorders, urosis and diuresis. However, information about antioxidant and cytotoxic properties of its fruits remains to be elucidated. The ethanol crude extract (CE) and its fractions [petroleum ether fraction (PF), ethyl acetate fraction (EF), n-butanol fraction (BF) and water fraction (WF) extracted by petroleum ether, ethyl acetate, n-butanol and water, respectively] of A. oxyphylla fruits were investigated for their antioxidant activity and cytotoxicity. The total phenolic content (TPC) and antioxidant activity of the extracts were determined by Folin-Ciocalteu reagent, 1,1-diphenyl-2-picrylhydrazyl (DPPH(•)), Trolox equivalent antioxidant capacity and reducing power assay. Cytotoxicity of the extracts (0-200 μg/mL) was tested on six human cancer cell lines (breast cancer cell line, cervix carcinoma cell line, lung adenocarcinoma cell line, liver carcinoma cell line, gastric cancer cell line and colon cancer cell line) using the sulforhodamine B assay. The TPC of extracts varied from 8.2 to 20.3 mg gallic acid equivalents/g dry weight. DPPH radical scavenging effect of extracts decreased in the order of EF > BF > CE > PF > WF, with IC50 values ranging from 74.7 to 680.8 μg/mL. 2,2-azo-bis(3-Ethylbenzothiazoline-6-sulfoic acid) diammonium salt scavenging activity ranged from 0.118 to 0.236 mmol Trolox equivalence/mg extract. The extracts exhibited concentration-dependent reducing power, and EF showed the highest reducing ability. A satisfactory correlation (R(2) > 0.826) between TPC and antioxidant activity was observed. In addition, EF, PF and CE exhibited potent anticancer effects on six cancer cell lines with IC50 values ranging from 40.1 to 166.3 μg/mL. The ethanol extract of A. oxyphylla fruit, especially the EF, was found to possess potent antioxidant and anticancer activities, and thus a great
A simple and efficient in vitro method for metabolism studies of radiotracers
Energy Technology Data Exchange (ETDEWEB)
Lee, Sang-Yoon; Choe, Yearn Seong E-mail: yschoe@samsung.co.krjeewoo@snu.ac.kr; Kim, Dong Hyun; Park, Bok-Nam; Kim, Sang Eun; Choi, Yong; Lee, Kyung-Han; Lee, Jeewoo E-mail: yschoe@samsung.co.krjeewoo@snu.ac.kr; Kim, Byung-Tae
2001-05-01
In vitro metabolism of acetylcholinesterase inhibitors containing 3-[{sup 18}F]fluoromethylbenzyl- ([{sup 18}F]1) and 4-[{sup 18}F]fluorobenzyl-piperidine moieties ([{sup 18}F]2) was studied and compared with the in vivo metabolism. Defluorination of the [{sup 18}F]1 mainly occurred to generate [{sup 18}F]fluoride ion both in vitro and in vivo. In contrast, the [{sup 18}F]2 was converted into an unknown polar metabolite in both metabolism methods and another metabolite, 4-[{sup 18}F]fluorobenzoic acid in vitro. These results demonstrated that the in vitro method can be used to predict the in vivo metabolism of both radiotracers.
Directory of Open Access Journals (Sweden)
Qian Hua Xia
2016-09-01
Full Text Available Plant constituents could act as chelating/reducing or capping agents for synthesis of silver nanoparticles (AgNPs. The green synthesis of AgNPs has been considered as an environmental friendly and cost-effective alternative to other fabrication methods. The present work described the biosynthesis of AgNPs using callus extracts from Taxus yunnanensis and evaluated their antibacterial activities in vitro and potential cytotoxicity in cancer cells. Callus extracts were able to reduce silver nitrate at 1 mM in 10 min. Transmission electron microscope (TEM indicated the synthesized AgNPs were spherical with the size range from 6.4 to 27.2 nm. X-ray diffraction (XRD confirmed the AgNPs were in the form of nanocrystals. Fourier transform infrared spectroscopy (FTIR suggested phytochemicals in callus extracts were possible reducing and capping agents. The AgNPs exhibited effective inhibitory activity against all tested human pathogen bacteria and the inhibition against Gram-positive bacteria was stronger than that of Gram-negative bacteria. Furthermore, they exhibited stronger cytotoxic activity against human hepatoma SMMC-7721 cells and induced noticeable apoptosis in SMMC-7721 cells, but showed lower cytotoxic against normal human liver cells (HL-7702. Our results suggested that biosynthesized AgNPs could be an alternative measure in the field of antibacterial and anticancer therapeutics.
Wroblewska, Katarzyna; Kucinska, Małgorzata; Murias, Marek; Lulek, Janina
2015-09-01
The aim of our study was to examine the irritation potential of new eye drops containing 2% choline salicylate (CS) as an active pharmaceutical ingredient (API) and various polymers increasing eye drop viscosity (hydroxyethylcellulose, hydroxypropyl methylcellulose, methylcellulose, polyvinyl alcohol, polyvinylpyrrolidone). The standard method for assessing the potential of irritating substances has been the Draize rabbit eye test. However the European Centre for Validation of Alternative Methods and the Coordinating Committee for Validation of Alternative Methods recommend, short time exposure (STE) in vitro tests as an alternative method for assessing eye irritation. The eye irritation potential was determined using cytotoxicity test methods for rabbit corneal cell line (SIRC) after 5 min exposure. The viability of cells was determined using two cytotoxicity assays: MTT and Neutral Red Uptake. According to the irritation rankings for the short time exposure test, all tested eye drops are classified as non-irritating (cell viability >70%).
International Nuclear Information System (INIS)
Guo, M.; Wang, X.; Zhou, H.M.; Li, L.; Nie, F.L.; Cheng, Y.; Zheng, Y.F.
2012-01-01
Porous silver scaffolds, with the porosity ranging from 68% to 81% and the apparent density ranging from 0.4 to 1 g⋅cm −3 were prepared by electroplating method using cellular carbon skeleton as the substrate. The microstructure, mechanical property, cytotoxicity and antibacterial activity of the prepared porous silver scaffold were studied. The present porous silver scaffolds had a highly three-dimensional trabecular porous structure with the porosity and the apparent density close to that of the cancellous bone. Furthermore, the mechanical property such as elastic modulus and yield strength of the porous silver scaffolds were lower than that of commercial available porous Ti and porous Ti alloys but much closer to that of the cancellous bone and porous Ta. In addition, study of in vitro behavior showed that the porous silver scaffold possessed significant antibacterial capability of inhibition of bacterial proliferation and adherence against Staphylococcus aureus and Staphylococcus epidermidis, and little cytotoxicity to Mg-63 cell line and NIH-3T3 cell line. Consequently, the porous silver scaffolds prepared by electrodeposition possess a promising application for bone implants. - Highlights: ► Porous Ag scaffolds were produced by electroplating Ag on cellular carbon skeleton. ► Porous Ag scaffolds have the porosity 68–81% and the apparent density 0.4–1 g⋅cm −3 . ► The mechanical property of porous Ag is close to cancellous bone and porous Ta. ► Porous Ag inhibits the proliferation and adherence of S. aureus and S. epidermidis.
A reproducible accelerated in vitro release testing method for PLGA microspheres.
Shen, Jie; Lee, Kyulim; Choi, Stephanie; Qu, Wen; Wang, Yan; Burgess, Diane J
2016-02-10
The objective of the present study was to develop a discriminatory and reproducible accelerated in vitro release method for long-acting PLGA microspheres with inner structure/porosity differences. Risperidone was chosen as a model drug. Qualitatively and quantitatively equivalent PLGA microspheres with different inner structure/porosity were obtained using different manufacturing processes. Physicochemical properties as well as degradation profiles of the prepared microspheres were investigated. Furthermore, in vitro release testing of the prepared risperidone microspheres was performed using the most common in vitro release methods (i.e., sample-and-separate and flow through) for this type of product. The obtained compositionally equivalent risperidone microspheres had similar drug loading but different inner structure/porosity. When microsphere particle size appeared similar, porous risperidone microspheres showed faster microsphere degradation and drug release compared with less porous microspheres. Both in vitro release methods investigated were able to differentiate risperidone microsphere formulations with differences in porosity under real-time (37 °C) and accelerated (45 °C) testing conditions. Notably, only the accelerated USP apparatus 4 method showed good reproducibility for highly porous risperidone microspheres. These results indicated that the accelerated USP apparatus 4 method is an appropriate fast quality control tool for long-acting PLGA microspheres (even with porous structures). Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
M. Ian Gilmour; Silvia O' Connor; Colin A.J. Dick; C. Andrew Miller; William P. Linak [U.S. Environmental Protection Agency, Research Triangle Park, NC (United States). National Health and Environmental Effects Research Laboratory
2004-03-01
Exposure to airborne particulate matter (PM) has been associated with adverse health effects in humans. Pulmonary inflammatory responses were examined in CD1 mice after intratracheal instillation of 25 or 100 {mu}g of ultrafine ({lt}0.2 {mu}m), fine ({lt}2.5 {mu}m), and coarse ({gt}2.5 {mu}m) coal fly ash from a combusted Montana subbituminous coal, and of fine and coarse fractions from a combusted western Kentucky bituminous coal. After 18 hr, the lungs were lavaged and the bronchoalveolar fluid was assessed for cellular influx, biochemical markers, and pro-inflammatory cytokines. The responses were compared with saline and endotoxin as negative and positive controls, respectively. On an equal mass basis, the ultrafine particles from combusted Montana coal induced a higher degree of neutrophil inflammation and cytokine levels than did the fine or coarse PM. The western Kentucky fine PM caused a moderate degree of inflammation and protein levels in bronchoalveolar fluid that were higher than the Montana fine PM. Coarse PM did not produce any significant effects. In vitro experiments with rat alveolar macrophages showed that of the particles tested, only the Montana ultrafine displayed significant cytotoxicity. It is concluded that fly ash toxicity is inversely related with particle size and is associated with increased sulfur and trace element content. 42 refs., 5 figs., 3 tabs.
Eliassen, Liv Tone; Berge, Gerd; Leknessund, Arild; Wikman, Mari; Lindin, Inger; Løkke, Cecilie; Ponthan, Frida; Johnsen, John Inge; Sveinbjørnsson, Baldur; Kogner, Per; Flaegstad, Trond; Rekdal, Øystein
2006-08-01
Antimicrobial peptides have been shown to exert cytotoxic activity towards cancer cells through their ability to interact with negatively charged cell membranes. In this study the cytotoxic effect of the antimicrobial peptide, LfcinB was tested in a panel of human neuroblastoma cell lines. LfcinB displayed a selective cytotoxic activity against both MYCN-amplified and non-MYCN-amplified cell lines. Non-transformed fibroblasts were not substantially affected by LfcinB. Treatment of neuroblastoma cells with LfcinB induced rapid destabilization of the cytoplasmic membrane and formation of membrane blebs. Depolarization of the mitochondria membranes and irreversible changes in the mitochondria morphology was also evident. Immuno- and fluorescence-labeled LfcinB revealed that the peptide co-localized with mitochondria. Furthermore, treatment of neuroblastoma cells with LfcinB induced cleavage of caspase-6, -7 and -9 followed by cell death. However, neither addition of the pan-caspase inhibitor, zVAD-fmk, or specific caspase inhibitors could reverse the cytotoxic effect induced by LfcinB. Treatment of established SH-SY-5Y neuroblastoma xenografts with repeated injections of LfcinB resulted in significant tumor growth inhibition. These results revealed a selective destabilizing effect of LfcinB on two important targets in the neuroblastoma cells, the cytoplasmic- and the mitochondria membrane. Copyright (c) 2006 Wiley-Liss, Inc.
Bain, Peter A; Kumar, Anu
2018-05-01
The widespread use of hydraulic fracturing (HF) in oil and gas extraction operations has led to concern over environmental risks posed by chemicals used in HF fluids. Here we employed a suite of stable luciferase reporter gene assays to investigate the potential for selected HF chemicals or geogenics to activate or antagonise nuclear receptor signalling. We screened three biocides (bronopol [BP], glutaraldehyde [GA], and tetrakis(hydroxymethyl)phosphonium sulfate [THPS]), a surfactant (2-butoxyethanol), a friction reducer (polyacrylamide), and a coal seam geogenic (o-cresol) for their potential to act as agonists or antagonists of the estrogen receptor, androgen receptor, progesterone receptor (PR), glucocorticoid receptor or peroxisome proliferator-activated receptor gamma (PPARγ). None of the chemicals induced luciferase activity in any of assays used in the study. In antagonistic mode, BP, GA and THPS caused reductions in luciferase activity in the reporter assays at higher concentrations (50-100 μM), while at low concentrations (2-10 μM) GA and THPS enhanced luciferase activity in some assays relative to controls. None of the other tested chemicals exhibited antagonism in the selected assays. In most cases, altered receptor signalling only occurred at concentrations exhibiting cytotoxicity. However, PPARγ activity, and to a lesser extent PR activity, were inhibited by THPS at sub-cytotoxic concentrations. The majority of binary combinations tested exhibited significantly less-than-additive cytotoxicity, and none of the combinations exhibited synergistic cytotoxicity. In summary, the results of the present study indicate that the selected chemicals are not likely to function as direct agonists of the nuclear receptors tested, and only one chemical, THPS was an apparent partial antagonist of two nuclear receptors. Copyright © 2017. Published by Elsevier Ltd.
In vitro toxicology of respirable Montserrat volcanic ash.
Wilson, M R; Stone, V; Cullen, R T; Searl, A; Maynard, R L; Donaldson, K
2000-11-01
In July 1995 the Soufriere Hills volcano on the island of Montserrat began to erupt. Preliminary reports showed that the ash contained a substantial respirable component and a large percentage of the toxic silica polymorph, cristobalite. In this study the cytotoxicity of three respirable Montserrat volcanic ash (MVA) samples was investigated: M1 from a single explosive event, M2 accumulated ash predominantly derived from pyroclastic flows, and M3 from a single pyroclastic flow. These were compared with the relatively inert dust TiO(2) and the known toxic quartz dust, DQ12. Surface area of the particles was measured with the Brunauer, Emmet, and Teller (BET) adsorption method and cristobalite content of MVA was determined by x ray diffraction (XRD). After exposure to particles, the metabolic competence of the epithelial cell line A549 was assessed to determine cytotoxic effects. The ability of the particles to induce sheep blood erythrocyte haemolysis was used to assess surface reactivity. Treatment with either MVA, quartz, or titanium dioxide decreased A549 epithelial cell metabolic competence as measured by ability to reduce 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). On addition of mannitol, the cytotoxic effect was significantly less with M1, quartz, and TiO(2). All MVA samples induced a dose dependent increase in haemolysis, which, although less than the haemolysis induced by quartz, was significantly greater than that induced by TiO(2). Addition of mannitol and superoxide dismutase (SOD) significantly reduced the haemolytic activity only of M1, but not M2 or M3, the samples derived from predominantly pyroclastic flow events. Neither the cristobalite content nor the surface area of the MVA samples correlated with observed in vitro reactivity. A role for reactive oxygen species could only be shown in the cytotoxicity of M1, which was the only sample derived from a purely explosive event. These results suggest that in general the
Effect of varying incubation periods on cytotoxicity and virucidal ...
African Journals Online (AJOL)
Backgrounds: Justicia gendarussa Burm.f. has an anti-HIV activity. This study was conducted to evaluate the effects of incubation periods on the cytotoxicity and virucidal activities of the J. gendarussa leaves extract on MOLT-4 cells. Materials and Methods: The cytotoxicity assay was evaluated by using the WST-1 test with ...
Kruisbeek, A.M.; Steinmeier, F.A.
1980-01-01
Much data support the notion that with increasing age a decline in T cell effector function occurs. In the present study, qualitative rather than quantitative age-related changes in vitro alloreactive cytotoxic T lymphocyte (CTL) responses were observed. The level of specific alloreactive CTL
Yana I. Pylina; Dmitry M. Shadrin; Oksana G. Shevchenko; Olga M. Startseva; Igor O. Velegzhaninov; Dmitry V. Belykh; Ilya O. Velegzhaninov
2017-01-01
In the present work, we investigated the dark and photoinduced cytotoxic activity of the new chlorophyll-a derivatives which contain the substituents of oligoethylene glycol on the periphery of their macrocycles. These compounds were tested using human cell lines to estimate their potential as photosensitizers for photodynamic therapy of cancer. It was shown that all the tested compounds have expressed photoinduced cytotoxic activity in vitro. Detailed study of the biological activity of one ...
Directory of Open Access Journals (Sweden)
Norma Elizabeth Moreno-Anzúrez
2017-01-01
Full Text Available The genetically transformed hairy root line LRT 7.31 obtained by infecting leaf explants of Lopezia racemosa Cav with the Agrobacterium rhizogenes strain ATCC15834/pTDT, was evaluated to identify the anti-inflammatory and cytotoxic compounds reported previously for the wild plant. After several subcultures of the LRT 7.31 line, the bio-guided fractionation of the dichloromethane–methanol (1:1 extract obtained from dry biomass afforded a fraction that showed important in vivo anti-inflammatory, and in vitro cytotoxic activities. Chemical separation of the active fraction allowed us to identify the triterpenes ursolic (1 and oleanolic (2 acids, and (23R-2α,3β,23,28-tetrahydroxy-14,15-dehydrocampesterol (3 as the anti-inflammatory principles of the active fraction. A new molecule 3 was characterized by spectroscopic analysis of its tetraacetate derivative 3a. This compound was not described in previous reports of callus cultures, in vitro germinated seedlings and wild plant extracts of whole L. racemosa plants. The anti-inflammatory and cytotoxic activities displayed by the fraction are associated to the presence of compounds 1–3. The present study reports the obtaining of the transformed hairy roots, the bioguided isolation of the new molecule 3, and its structure characterization.
Directory of Open Access Journals (Sweden)
Aymé Fernández-Calienes Valdés
2010-08-01
Full Text Available Terrestrial plants have been demonstrated to be sources of antimalarial compounds. In Cuba, little is known about antimalarial potentials of plant species used as medicinals. For that reason, we evaluated the antimalarial activity of 14 plant species used in Cuba as antimalarial, antipyretic and/or antiparasitic. Hydroalcoholic extracts were prepared and tested in vitro for the antimalarial activity against Plasmodium falciparum Ghana strain and over human cell line MRC-5 to determine cytotoxicity. Parasite multiplication was determined microscopically by the direct count of Giemsa stained parasites. A colorimetric assay was used to quantify cytotoxicity. Nine extracts showed IC50 values lower than 100 µg/mL against P. falciparum, four extracts were classified as marginally active (SI 10. B. vulgaris showed the most potent and specific antiplasmodial action (IC50 = 4.7 µg/mL, SI = 28.9. Phytochemical characterization of active extracts confirmed the presence of triterpenoids in B. vulgaris and polar compounds with phenol free groups and fluorescent metabolites in both extracts as major phytocompounds, by thin layer chromatography. In conclusion, antimalarial use of B. vulgaris and P. hysterophorus was validated. B. vulgaris and P. granatum extracts were selected for follow-up because of their strong antimalarial activity.Las plantas terrestres han demostrado ser fuentes de compuestos antimaláricos. En Cuba, el conocimiento sobre el potencial antimalárico de las plantas medicinales es escaso. Por esta razón, evaluamos la actividad antimalárica de 14 especies de plantas usadas en Cuba como antimaláricas, antipiréticas y/o antiparasitarias. Se prepararon extractos hidroalcohólicos y se probaron in vitro frente a la cepa Ghana de Plasmodium falciparum para la actividad antimalárica y frente a la línea celular humana MRC-5 para determinar citotoxicidad. La multiplicación de los parásitos se determinó microscópicamente mediante el
Goudarzi, Fariba; Asadi, Asadollah; Afsharpour, Maryam; Jamadi, Robab Hassanvand
2018-05-01
The aim of this study was an in vitro evaluation and comparison of the cytotoxic effects of free nisin and nisin-loaded PLA-PEG-PLA nanoparticles on gastrointestinal (AGS and KYSE-30), hepatic (HepG2), and blood (K562) cancer cell lines. To create this novel anti-cancer drug delivery system, the nanoparticles were synthesized and then loaded with nisin. Subsequently, their biocompatibility, ability to enter cells, and physicochemical properties, including formation, size, and shape, were studied using hemolysis, fluorescein isothiocyanate (FITC), Fourier transform infrared (FTIR) spectroscopy, dynamic light scattering (DLS), and scanning electron microscopy (SEM), respectively. Then, its loading efficiency and release kinetics were examined to assess the potential impact of this formulation for the nanoparticle carrier candidacy. The cytotoxicities of nisin and nisin-loaded nanoparticles were evaluated by using the MTT and Neutral Red (NR) uptake assays. Detections of the apoptotic cells were done via Ethidium Bromide (EB)/Acridine Orange (AO) staining. The FTIR spectra, SEM images, and DLS graph confirmed the formations of the nanoparticles and nisin-loaded nanoparticles with spherical, distinct, and smooth surfaces and average sizes of 100 and 200 nm, respectively. The loading efficiency of the latter nanoparticles was about 85-90%. The hemolysis test represented their non-cytotoxicities and the FITC images indicated their entrance inside the cells. An increase in the percentage of apoptotic cells was observed through EB/AO staining. These results demonstrated that nisin had a cytotoxic effect on AGS, KYSE-30, HepG2, and K562 cancer cell lines, while the cytotoxicity of nisin-loaded nanoparticles was more than that of the free nisin.
Cramer, Benedikt; Königs, Maika; Humpf, Hans-Ulrich
2008-07-23
The mycotoxin ochratoxin A is degraded by up to 90% during coffee roasting. In order to investigate this degradation, model heating experiments with ochratoxin A were carried out, and the reaction products were analyzed by HPLC-DAD and HPLC-MS/MS. Two ochratoxin A degradation products were identified, and their structure and absolute configuration were determined. As degradation reactions, the isomerization to 14-(R)-ochratoxin A and the decarboxylation to 14-decarboxy-ochratoxin A were identified. Subsequently, an analytical method for the determination of these compounds in roasted coffee was developed. Quantification was carried out by HPLC-MS/MS and the use of stable isotope dilution analysis. By using this method for the analysis of 15 coffee samples from the German market, it could be shown that, during coffee roasting, the ochratoxin A diastereomer 14-(R)-ochratoxin A was formed in amounts of up to 25.6% relative to ochratoxin A. The decarboxylation product was formed only in traces. For toxicity evaluations, first preliminary cell culture assays were performed with the two new substances. Both degradation products exhibited higher IC50 values and caused apoptotic effects with higher concentrations than ochratoxin A in cultured human kidney epithelial cells. Thus, these cell culture data suggest that the degradation products are less cytotoxic than ochratoxin A.
Correlating cytotoxicity to elution behaviors of composite resins in term of curing kinetic.
Meng, Junquan; Yang, Huichuan; Cao, Man; Li, Lei; Cai, Qing
2017-09-01
Cytotoxicity of photocurable composite resins is a key issue for their safe use in dental restoration. Curing kinetic and elution behaviors of the composite resin would have decisive effects on its cytotoxicity. In this study, composite resins composed of bisphenol-glycidyl dimethacrylate (Bis-GMA), triethyleneglycol dimethacrylate (TEGDMA), camphorquinone (CQ), N,N-dimethylaminoethyl methacrylate (DMAEMA) and barium glass powders were prepared by setting the photoinitiators CQ/DMAEMA at 0.5wt%, 1wt% or 3wt% of the total weight of Bis-GMA/TEGDMA. The ratio of Bis-GMA/TEGDMA was 6:4, the ratio of CQ/DMAEMA was 1:1, and the incorporated inorganic powder was 75wt%. Then, curing kinetics were studied by using real-time Fourier transform infrared spectroscopy (FTIR) and photo-DSC (differential scanning calorimeter). Elution behaviors in both ethanol solution and deionized water were monitored by using liquid chromatogram/mass spectrometry (LC/MS). Cytotoxicity was evaluated by in vitro culture of L929 fibroblasts. Finally, they were all analyzed and correlated in terms of initiator contents. It was found that the commonly used 0.5wt% of photoinitiators was somewhat insufficient in obtaining composite resin with low cytotoxicity. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Hanane Boutennoun
2017-03-01
Full Text Available In this study, methanol extract from Achillea odorata was evaluated for its phenolic contents using Folin–Ciocalteu reagent, and antioxidant activity using: 1,1-diphenyl-2-picrylhidrazyl (DPPH radical scavenging activity, reducing activity of H2O2 and ferric reducing power assay. The total phenolic content was determined as gallic acid (GAE equivalent. Flavonoids and flavonols contents were determined as quercetin (QE equivalents. The cytotoxicity of the plant extract was tested against three tumor cell lines: MCF-7, Hep2 and WEHI using 3-(4,5-dimethyl thiazol-2-yl-2,5-diphynyl tetrazolium bromide (MTT assay. Preliminary screening was concluded in the presence of substances with large therapeutic values. The total phenolic content confirmed the presence of total phenolics in the extract and showed strong association with antioxidant activity. An important content of flavonoids and flavonols was also detected. The results of the antioxidant activities obtained indicate that A. odorata recorded a good capacity. For the cytotoxic activity, the results showed the plant extract significantly inhibited tumor cell growth and colony formation at various concentrations.
An efficient analysis of nanomaterial cytotoxicity based on bioimpedance
International Nuclear Information System (INIS)
Kandasamy, Karthikeyan; Kim, Sanghyo; Choi, Cheol Soo
2010-01-01
In the emerging nanotechnology field, there is an urgent need for the development of a significant and sensitive method that can be used to analyse and compare the cytotoxicities of nanomaterials such as carbon nanotubes (CNTs) and gold nanoparticles (AuNPs), since such materials can be applied as contrast agents or drug delivery carriers. The bioimpedance system possesses great potential in many medical research fields including nanotechnology. Electric cell-substrate impedance sensing (ECIS) is a particular bioimpedance system that offers a real-time, non-invasive, and quantitative measurement method for the cytotoxicity of various materials. The present work compared the cytotoxicity of AuNPs to that of purchased single-walled carbon nanotubes (SWCNTs). The size-controlled and monodispersed AuNPs were synthesized under autoclaved conditions and reduced by ascorbic acid (AA) whereas the purchased SWCNTs were used without any surface modifications. Bioimpedance results were validated by conventional WST-1 and trypan blue assays, and transmission electron microscopy (TEM) and field emission scanning electron microscopy (FE-SEM) were performed to examine nanomaterials inside the VERO cells. This research evaluates the ability of the ECIS system compared to those of conventional methods in analyzing the cytotoxicity of AuNPs and SWCNTs with higher sensitivity under real-time conditions.
International Nuclear Information System (INIS)
Volkan Tekin; Zumrut Biber Muftuler, F.; Ozge Kozgus Guldu; Ayfer Yurt Kilcar; Ilker Medine, E.; Perihan Unak; Murat Yavuz; Ege University, Bornova, Izmir; Suna Timur
2015-01-01
WST-1-based cytotoxicity assay of lawsone (LW) was performed on MCF7, Caco2, BJ and Keratinocyte cells and viabilities were found as over 90 % for all cells. Significant wound healing effect of LW was reported on Keratinocyte cells. Antibacterial and antifungal activities of LW were tested on seven microorganisms with three concentrations and 1,000 µg/disc of LW showed antibacterial effect on Bacillus subtilis. In vitro cell incorporation of radioiodinated LW ( 131 I-LW) was evaluated on same cells. Keratinocyte cells uptake were 5 times more. Consequently, 131 I-LW was found usable for researches about especially skin diseases in addition to breast and intestinal cancer. (author)
Anti·red cell activity of lymphocytotoxic antibodies: and in vitro and in ...
African Journals Online (AJOL)
The need to obtain non-toxic antilymphocyre sera (ALS) led to the in vitro and in vivo evaluarion of its crossreactivity for red cells. The findings showed thar the antibodies coating the erythrocytes in vitro are idenrical with the antibodies that sensitize lymphocytes by the cytotoxicity rest. It would appear that rhe observed ...
Al-Musayeib, Nawal M; Mothana, Ramzi A; Al-Massarani, Shaza; Matheeussen, An; Cos, Paul; Maes, Louis
2012-09-25
The present study investigated the in vitro antiprotozoal activity of sixteen selected medicinal plants. Plant materials were extracted with methanol and screened in vitro against erythrocytic schizonts of Plasmodium falciparum, intracellular amastigotes of Leishmania infantum and Trypanosoma cruzi and free trypomastigotes of T. brucei. Cytotoxic activity was determined against MRC-5 cells to assess selectivity. The criterion for activity was an IC₅₀ Albizia lebbeck pericarp, Caralluma sinaica, Periploca aphylla and Prosopius juliflora. Activity against T. brucei was obtained in Prosopis juliflora. Cytotoxicity (MRC-5 IC₅₀ < 10 μg/mL) and hence non-specific activities were observed for Conocarpus lancifolius.
Mahmoudvand, Hossein; Ayatollahi Mousavi, Seyyed Amin; Sepahvand, Asghar; Sharififar, Fariba; Ezatpour, Behrouz; Gorohi, Fatemeh; Saedi Dezaki, Ebrahim; Jahanbakhsh, Sareh
2014-01-01
In this study, in vitro antidermatophytic activity against Trichophyton mentagrophytes, Trichophyton rubrum, Microsporum canis, and Microsporum gypseum was studied by disk diffusion test and assessment of minimum inhibitory concentration (MIC) using CLSI broth macrodilution method (M38-A2). Moreover, antileishmanial and cytotoxicity activity of B. vulgaris and berberine against promastigotes of Leishmania major and Leishmania tropica were evaluated by colorimetric MTT assay. The findings indicated that the various extracts of B. vulgaris particularly berberine showed high potential antidermatophytic against pathogenic dermatophytes tested with MIC values varying from 0.125 to >4 mg/mL. The results revealed that B. vulgaris extracts as well as berberine were effective in inhibiting L. major and L. tropica promastigotes growth in a dose-dependent manner with IC50 (50% inhibitory concentration) values varying from 2.1 to 26.6 μ g/mL. Moreover, it could be observed that berberine as compared with B. vulgaris exhibited more cytotoxicity against murine macrophages with CC50 (cytotoxicity concentration for 50% of cells) values varying from 27.3 to 362.6 μ g/mL. Results of this investigation were the first step in the search for new antidermatophytic and antileishmanial drugs. However, further works are required to evaluate exact effect of these extracts in animal models as well as volunteer human subjects.
Directory of Open Access Journals (Sweden)
Susi Endrini
2015-01-01
Full Text Available Background: This study aimed to analyze the cytotoxicity effect of γ-sitosterol isolated from “Kejibeling” (Strobilanthes crispus, a medicinal plant, on several cancer cell lines. The mechanisms of the effects were studied through the expression of cancer-caused gene, c-myc and apoptotic pathways.Methods: This in vitro study was done using human colon cancer cell lines (Caco-2, liver cancer cell lines (HepG2, hormone-dependent breast cancer cell lines (MCF-7 and the normal liver cell lines (Chang Liver. The cytotoxic effect was measured through MTT assay and the potential cytotoxic value was calculated by determining the toxic concentration which may kill up to 50% of the total cell used (IC50. Meanwhile, the cytotoxic mechanism was studied by determining the effect of adding γ-sitosterol to the c-myc gene expression by reverse transciptase-polymerase chain reaction (RT-PCR. The effect of γ-sitosterol through apoptotic pathway was studied by using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay.Results: γ-sitosterol was cytotoxic against Caco-2, HepG2, and MCF-7 with IC50-values of 8.3, 21.8, and 28.8 μg/mL, respectively. There were no IC50-values obtained from this compound against Chang Liver cell line. This compound induced apotosis on Caco-2 and HepG2 cell lines and suppressed the c-myc genes expression in both cells.Conclusion: γ-sitosterol was cytotoxic against colon and liver cancer cell lines and the effect was mediated by down-regulation of c-myc expression and induction of the apoptotic pathways.
van der Waal, S V; Scheres, N; de Soet, J J; Wesselink, P R; Crielaard, W
2015-02-01
To investigate the cytotoxicity of a modified salt solution (MSS) and evaluate the antimicrobial properties of MSS on in vitro biofilm models. In a metabolic assay, fibroblasts derived from periodontal ligaments (PDL) of human extracted teeth were cultured and challenged with MSS or controls. Then, in active attachment biofilm models, the efficacy of MSS in the presence of dentine powder and in eliminating mature biofilms was investigated. In the dentine assay, a biofilm of Enterococcus faecalis was employed. For the final assay, microorganisms were retrieved from infected root canals and cultured to produce biofilms. After the treatments with MSS or the controls, the biofilms were collected, serially diluted and plated. The colony-forming units were counted. One-way anova was used to analyse the differences between the groups. A P 0.05). In endodontic biofilms, the culturable bacteria were equally reduced by MSS, 2% chlorhexidine (CHX) or 2% sodium hypochlorite (NaOCl) (P > 0.05). Modified salt solution is noncytotoxic in vitro and has good antimicrobial properties equal to CHX and NaOCl. Although the results are promising, ex vivo and in vivo studies are needed before its use as an interappointment root canal dressing can be considered. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.
Using a homogenization-evaporation method, beta-carotene (BC) loaded nano-particles were prepared with different ratios of food-grade sodium caseinate (SC), whey protein isolate (WPI), or soy protein isolate (SPI) to BC and evaluated for their physiochemical stability, in vitro cytotoxicity, and cel...
Directory of Open Access Journals (Sweden)
Hiranmoy Das
Full Text Available Molecular-focused cancer therapies, e.g., molecularly targeted therapy and immunotherapy, so far demonstrate only limited efficacy in cancer patients. We hypothesize that underestimating the role of biophysical factors that impact the delivery of drugs or cytotoxic cells to the target sites (for associated preferential cytotoxicity or cell signaling modulation may be responsible for the poor clinical outcome. Therefore, instead of focusing exclusively on the investigation of molecular mechanisms in cancer cells, convection-diffusion of cytotoxic molecules and migration of cancer-killing cells within tumor tissue should be taken into account to improve therapeutic effectiveness. To test this hypothesis, we have developed a mathematical model of the interstitial diffusion and uptake of small cytotoxic molecules secreted by T-cells, which is capable of predicting breast cancer growth inhibition as measured both in vitro and in vivo. Our analysis shows that diffusion barriers of cytotoxic molecules conspire with γδ T-cell scarcity in tissue to limit the inhibitory effects of γδ T-cells on cancer cells. This may increase the necessary ratios of γδ T-cells to cancer cells within tissue to unrealistic values for having an intended therapeutic effect, and decrease the effectiveness of the immunotherapeutic treatment.
LENUS (Irish Health Repository)
Power, C
2012-02-03
Bacterial lipoprotein (BLP) is the most abundant protein in gram-negative bacterial cell walls, heavily outweighing lipopolysaccharide (LPS). Herein we present findings demonstrating the potent in vitro effects of BLP on neutrophil (PMN) activation status, function, and capacity to transmigrate an endothelial monolayer. PMNs are the principal effectors of the initial host response to injury or infection and constitute a significant threat to invading bacterial pathogens. The systemic inflammatory response syndrome (SIRS) is characterised by significant host tissue injury mediated, in part, by uncontrolled regulation of PMN cytotoxic activity. We found that BLP-activated human PMN as evidenced by increased CD11b\\/CD18 (Mac-1) expression. Up-regulation of PMN Mac-1 in response to BLP occurred independently of membrane-bound CD14 (mCD14). A similar up-regulation of intercellular adhesion molecule-1 (ICAM-1) on endothelial cells was observed whilst E-Selectin expression was unaffected. PMN transmigration across a human umbilical vein endothelial cell (HUVEC) monolayer was markedly increased after treating either PMN\\'s or HUVEC independently with BLP. This increased transmigration did not occur as a result of any direct effect of BLP on HUVEC monolayer permeability, assessed objectively using the passage of FITC-labeled Dextran-70. BLP primed PMN for enhanced respiratory burst and superoxide anion production in response to PMA, but did not influence phagocytosis of opsonized Escherichia coli. BLP far exceeds LPS as a gram-negative bacterial wall component, these findings therefore implicate BLP as an additional putative mediator of SIRS arising from gram-negative infection.
International Nuclear Information System (INIS)
Stephen Inbaraj, B; Kao, T H; Tsai, T Y; Chiu, C P; Kumar, R; Chen, B H
2011-01-01
Magnetite nanoparticles (MNPs) modified with sodium and calcium salts of poly(γ-glutamic acid) (NaPGA and CaPGA) were synthesized by the coprecipitation method, followed by characterization and evaluation of their antibacterial and cytotoxic effects. Superparamagnetic MNPs are particularly attractive for magnetic driving as well as bacterial biofilm and cell targeting in in vivo applications. Characterization of synthesized MNPs by the Fourier transform infrared spectra and magnetization curves confirmed the PGA coating on MNPs. The mean diameter of NaPGA- and CaPGA-coated MNPs as determined by transmission electron microscopy was 11.8 and 14 nm, respectively, while the x-ray diffraction pattern revealed the as-synthesized MNPs to be pure magnetite. Based on agar dilution assay, both NaPGA- and CaPGA-coated MNPs showed a lower minimum inhibitory concentration in Salmonella enteritidis SE 01 than the commercial antibiotics linezolid and cefaclor, but the former was effective against Escherichia coli ATCC 8739 and Staphylococcus aureus ATCC 10832, whereas the latter was effective against Escherichia coli O157:H7 TWC 01. An in vitro cytotoxicity study in human skin fibroblast cells as measured by MTT assay implied the as-synthesized MNPs to be nontoxic. This outcome demonstrated that both γ-PGA-modified MNPs are cytocompatible and possess antibacterial activity in vitro, and thereby should be useful in in vivo studies for biomedical applications.
Energy Technology Data Exchange (ETDEWEB)
Stephen Inbaraj, B; Kao, T H; Tsai, T Y; Chiu, C P; Kumar, R; Chen, B H, E-mail: 002622@mail.fju.edu.tw [Department of Food Science, Fu Jen University, Taipei 242, Taiwan (China)
2011-02-18
Magnetite nanoparticles (MNPs) modified with sodium and calcium salts of poly({gamma}-glutamic acid) (NaPGA and CaPGA) were synthesized by the coprecipitation method, followed by characterization and evaluation of their antibacterial and cytotoxic effects. Superparamagnetic MNPs are particularly attractive for magnetic driving as well as bacterial biofilm and cell targeting in in vivo applications. Characterization of synthesized MNPs by the Fourier transform infrared spectra and magnetization curves confirmed the PGA coating on MNPs. The mean diameter of NaPGA- and CaPGA-coated MNPs as determined by transmission electron microscopy was 11.8 and 14 nm, respectively, while the x-ray diffraction pattern revealed the as-synthesized MNPs to be pure magnetite. Based on agar dilution assay, both NaPGA- and CaPGA-coated MNPs showed a lower minimum inhibitory concentration in Salmonella enteritidis SE 01 than the commercial antibiotics linezolid and cefaclor, but the former was effective against Escherichia coli ATCC 8739 and Staphylococcus aureus ATCC 10832, whereas the latter was effective against Escherichia coli O157:H7 TWC 01. An in vitro cytotoxicity study in human skin fibroblast cells as measured by MTT assay implied the as-synthesized MNPs to be nontoxic. This outcome demonstrated that both {gamma}-PGA-modified MNPs are cytocompatible and possess antibacterial activity in vitro, and thereby should be useful in in vivo studies for biomedical applications.
Cytotoxic triterpenoid saponins from Clematis tangutica.
Zhao, Min; Da-Wa, Zhuo-Ma; Guo, Da-Le; Fang, Dong-Mei; Chen, Xiao-Zhen; Xu, Hong-Xi; Gu, Yu-Cheng; Xia, Bing; Chen, Lei; Ding, Li-Sheng; Zhou, Yan
2016-10-01
Eight previously undescribed oleanane-type triterpenoid saponins, clematangoticosides A-H, together with eight known saponins, were isolated from the whole plants of Clematis tangutica (Maxim.) Korsh. Their structures were elucidated by extensive spectroscopic analysis, in combination with chemical methods (acid hydrolysis and mild alkaline hydrolysis). Clematangoticosides D-G were found to be unusual 23, 28-bidesmosidic glycosides. The cytotoxic activities of all of the isolated saponins were evaluated against the four human cancer cell lines SGC-7901, HepG2, HL-60 and U251MG. Clematoside S, sapindoside B, kalopanax saponin A, and koelreuteria saponin A exhibited cytotoxicity against all of the test cancer cell lines with IC50 values in the range of 1.88-27.20 μM, while clematangoticoside D and F showed selective cytotoxicity against SGC-7901 with IC50 values of 24.22 and 21.35 μM, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Emmanuel Mouafo Tekwu
2017-01-01
Full Text Available Schistosomiasis is a Neglected Tropical Diseases which can be prevented with mass deworming chemotherapy. The reliance on a single drug, praziquantel, is a motivation for the search of novel antischistosomal compounds. This study investigated the anthelmintic activity of the stem bark and roots of Rauwolfia vomitoria against two life stages of Schistosoma mansoni. Both plant parts were found to be active against cercariae and adult worms. Within 2 h of exposure all cercariae were killed at a concentration range of 62.5–1000 µg/mL and 250–1000 µg/mL of R. vomitoria stem bark and roots, respectively. The LC50 values determined for the stem bark after 1 and 2 h of exposure were 207.4 and 61.18 µg/mL, respectively. All adult worms exposed to the concentrations range of 250–1000 µg/mL for both plant parts died within 120 h of incubation. The cytotoxic effects against HepG2 and Chang liver cell assessed using MTT assay method indicated that both plant extracts which were inhibitory to the proliferation of cell lines with IC50 > 20 μg/mL appear to be safe. This report provides the first evidence of in vitro schistosomicidal potency of R. vomitoria with the stem bark being moderately, but relatively, more active and selective against schistosome parasites. This suggests the presence of promising medicinal constituent(s.
Synthesis of geranylhydroquinone derivatives with potential cytotoxic activity
Energy Technology Data Exchange (ETDEWEB)
Baeza, Evelyn; Catalan, Karen; Pena-Cortes, Hugo; Espinoza, Luis, E-mail: luis.espinozac@usm.cl [Departamento de Quimica, Universidad Tecnica Federico Santa Maria, Valparaiso (Chile); Villena, Joan [Facultad de Medicina, Universidad de Valparaiso, Centro Regional de Estudios en Alimentos Saludables, Valparaiso (Chile); Carrasco, Hector [Departamento de Ciencias Quimicas, Universidad Andres Bello, Campus Vina del Mar (Chile)
2012-07-01
Natural geranylhydroquinone 1 and geranyl-p-methoxyphenol 2 were prepared by Electrophilic Aromatic Substitution (EAS) reactions between geraniol and 1,4-hydroquinone or p-methoxyphenol respectively, using BF{sub 3} {center_dot}Et{sub 2}O as a catalyst. Furthermore, natural geranylquinone 3, geranyl-1,4-dimethoxyquinone 4 and the new geranyl-4-methoxyphenyl acetate 5 were obtained by chemical transformations of 1 and 2. The compounds were evaluated for their in vitro cytotoxicity activities against cultured human cancer cells of PC-3 human prostate cancer, MCF-7 and MDA-MB-231 breast carcinoma, and Dermal Human ibroblasts DHF. IC{sub 50} values were in the {mu}M range. (author)
Directory of Open Access Journals (Sweden)
Hurrell T
2013-06-01
Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use
In vitro Cell Viability by CellProfiler® Software as Equivalent to MTT Assay.
Gasparini, Luciana S; Macedo, Nayana D; Pimentel, Elisângela F; Fronza, Marcio; Junior, Valdemar L; Borges, Warley S; Cole, Eduardo R; Andrade, Tadeu U; Endringer, Denise C; Lenz, Dominik
2017-07-01
This study evaluated in vitro cell viability by the colorimetric MTT stands for 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay compared to image analysis by CellProfiler ® software. Hepatoma (Hepa-1c1c7) and fibroblast (L929) cells were exposed to isolated substances, camptothecin, lycorine, tazettine, albomaculine, 3-epimacronine, trispheridine, galanthine and Padina gymnospora , Sargassum sp. methanolic extract, and Habranthus itaobinus Ravenna ethyl acetate in different concentrations. After MTT assay, cells were stained with Panotic dye kit. Cell images were obtained with an inverted microscope equipped with a digital camera. The images were analyzed by CellProfiler ® . No cytotoxicity at the highest concentration analyzed for 3-epimacronine, albomaculine, galanthine, trispheridine, P. gymnospora extract and Sargassum sp. extract where detected. Tazettine offered cytotoxicity only against the Hepa1c1c7 cell line. Lycorine, camptothecin, and H. itaobinus extract exhibited cytotoxic effects in both cell lines. The viability methods tested were correlated demonstrated by Bland-Atman test with normal distribution with mean difference between the two methods close to zero, bias value 3.0263. The error was within the limits of the confidence intervals and these values had a narrow difference. The correlation between the two methods was demonstrated by the linear regression plotted as R 2 . CellProfiler ® image analysis presented similar results to the MTT assay in the identification of viable cells, and image analysis may assist part of biological analysis procedures. The presented methodology is inexpensive and reproducible. In vitro cell viability assessment with MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay may be replaced by image analysis by CellProfiler ® . The viability methods
Synthesis, antimicrobial and cytotoxicity evaluation of new cholesterol congeners
Directory of Open Access Journals (Sweden)
Mohamed Ramadan El Sayed Aly
2015-10-01
Full Text Available 3β-Azidocholest-5-ene (3 and (3β-3-(prop-2-yn-1-yloxycholest-5-ene (10 were prepared as substrates to synthesize a variety of three-motif pharmacophoric conjugates through CuAAC. Basically, these conjugates included cholesterol and 1,2,3-triazole moieties, while the third, the pharmacophore, was either a chalcone, a lipophilic residue or a carbohydrate tag. These compounds were successfully prepared in good yields and characterized by NMR, MS and IR spectroscopic techniques. Chalcone conjugate 6c showed the best antimicrobial activity, while the lactoside conjugate 27 showed the best cytotoxic effect in vitro.
Energy Technology Data Exchange (ETDEWEB)
Tang, G.H. [Xian Medical Univ. (China); Shen, Y.; Shen, H.M. [National Univ. of Singapore (Singapore)] [and others
1996-12-31
Methyl tert-butyl ether (MTBE) is a widely used oxygenate in unleaded gasoline; however, few studies have been conducted on the toxicity of this compound. This study evaluates the cytotoxic and DNA-damaging effects of MTBE and its metabolites in a human haemopoietic cell line, HL-60. The metabolites of MTBE studied include tertiary butyl alcohol (TBA), {alpha}-hydroxyisobutyric acid (HIBA), and formaldehyde. Comet assay is used to assess DNA damage, and the cytotoxicity is investigated by lactate dehydrogenease (LDH) release. The results show no significant cytotoxic effects of MTBE, TBA, and HIBA over a concentration ranging from 1 to 30 mM. Formaldehyde, in contrast, causes a substantial LDH release at a concentration of 5 {mu}M. Hydrogen peroxide, a known oxidative agent, at concentrations ranging from 10 to 100 {mu}M, produces a significant dose-related increase in DNA damage, whereas a much higher concentration of MTBE (1 to 30 mM) is required to produce a similar observation. The genotoxic effects of TBA and HIBA appear to be identical to that of MTBE. Conversely, DNA damage is observed for formaldehyde at a relatively low concentration range (5 to 100 {mu}M). These findings suggest that MTBE and its metabolites, except formaldehyde, have relatively low cytotoxic and genotoxic effects. 16 refs., 4 figs.
International Nuclear Information System (INIS)
Urgut, O.S.; Ozturk, I.I.; Banti, C.N.; Kourkoumelis, N.; Manoli, M.; Tasiopoulos, A.J.; Hadjikakou, S.K.
2016-01-01
ABSTRACT: Antimony(III) halide complexes of the formulae {[SbBr(Me 2 DTC) 2 ] n } (1), {[SbI(Me 2 DTC) 2 ] n } (2) and {[(Me 2 DTC) 2 Sb(μ 2 -I)Sb(Me 2 DTC) 2 ] + .I 3 − } (3) (Me 2 DTC = dimethyldithiocarbomate) were synthesized from SbX 3 , (X = Br or I) and tetramethylthiuram monosulfide (Me 4 tms) or tetramethylthiuram disulfide (Me 4 tds). The complexes were characterized by melting point (m.p.), elemental analysis (e.a.), Fourier-transform Infra-Red (FT-IR), Fourier-transform Raman (FT-Raman), Nuclear Magnetic Resonance ( 1 H, 13 C-NMR) spectroscopy and Thermogravimetric-Differential Thermal Analysis (TG-DTA). Crystal structures of complexes 1–3 were determined with single crystal X-ray diffraction analysis. Complexes 1 and 2 are polymers with distorted square pyramidal (SP) geometry in each monomeric unit, whereas complex 3 is ionic, containing an iodonium linkage Sb–I + –Sb and an I 3 − counter anion; to the best of our knowledge, this is the first ionic antimony(III) iodide complex. The in vitro cytotoxic activity of 1–3 against human adenocarcinoma cells: breast (MCF-7) and cervix (HeLa) cells and non-cancerous cells: MRC-5 (normal human fetal lung fibroblast cells) was evaluated with trypan blue (TB) and sulforhodamine B (SRB) assays. Among antimony(III) compounds with sulfur containing ligand, those of dithiocarbamates exhibit significant cytotoxic activity. Hirshfeld surface volumes were analyzed to clarify the nature of the intermolecular interactions by the 2D fingerprint plot. Molecules with lower H-all atoms inter-molecular interactions exhibit the higher activity against MCF-7 cells. The in vivo genotoxicity of 1–3 was evaluated by the mean of Allium cepa test. Alterations in the mitotic index values due to the chromosomal aberrations were observed in the case of complexes 2 and 3. Since, no such alteration is caused by 1, it makes this compound candidate for further study as potential drug. - Graphical abstract: The in vitro
Energy Technology Data Exchange (ETDEWEB)
Urgut, O.S. [Department of Chemistry, Namık Kemal University, 59030, Tekirdag (Turkey); Ozturk, I.I., E-mail: iiozturk@nku.edu.tr [Department of Chemistry, Namık Kemal University, 59030, Tekirdag (Turkey); Banti, C.N., E-mail: cbanti@cc.uoi.gr [Section of Inorganic and Analytical Chemistry, Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece); Kourkoumelis, N., E-mail: nkourkou@uoi.gr [Medical Physics Laboratory, Medical School, University of Ioannina, Ioannina, 45110 (Greece); Manoli, M.; Tasiopoulos, A.J. [Department of Chemistry, University of Cyprus, Nicosia (Cyprus); Hadjikakou, S.K., E-mail: shadjika@uoi.gr [Section of Inorganic and Analytical Chemistry, Department of Chemistry, University of Ioannina, 45110 Ioannina (Greece)
2016-01-01
ABSTRACT: Antimony(III) halide complexes of the formulae {[SbBr(Me_2DTC)_2]_n} (1), {[SbI(Me_2DTC)_2]_n} (2) and {[(Me_2DTC)_2Sb(μ_2-I)Sb(Me_2DTC)_2]"+.I_3"−} (3) (Me{sub 2}DTC = dimethyldithiocarbomate) were synthesized from SbX{sub 3}, (X = Br or I) and tetramethylthiuram monosulfide (Me{sub 4}tms) or tetramethylthiuram disulfide (Me{sub 4}tds). The complexes were characterized by melting point (m.p.), elemental analysis (e.a.), Fourier-transform Infra-Red (FT-IR), Fourier-transform Raman (FT-Raman), Nuclear Magnetic Resonance ({sup 1}H,{sup 13}C-NMR) spectroscopy and Thermogravimetric-Differential Thermal Analysis (TG-DTA). Crystal structures of complexes 1–3 were determined with single crystal X-ray diffraction analysis. Complexes 1 and 2 are polymers with distorted square pyramidal (SP) geometry in each monomeric unit, whereas complex 3 is ionic, containing an iodonium linkage Sb–I{sup +}–Sb and an I{sub 3}{sup −} counter anion; to the best of our knowledge, this is the first ionic antimony(III) iodide complex. The in vitro cytotoxic activity of 1–3 against human adenocarcinoma cells: breast (MCF-7) and cervix (HeLa) cells and non-cancerous cells: MRC-5 (normal human fetal lung fibroblast cells) was evaluated with trypan blue (TB) and sulforhodamine B (SRB) assays. Among antimony(III) compounds with sulfur containing ligand, those of dithiocarbamates exhibit significant cytotoxic activity. Hirshfeld surface volumes were analyzed to clarify the nature of the intermolecular interactions by the 2D fingerprint plot. Molecules with lower H-all atoms inter-molecular interactions exhibit the higher activity against MCF-7 cells. The in vivo genotoxicity of 1–3 was evaluated by the mean of Allium cepa test. Alterations in the mitotic index values due to the chromosomal aberrations were observed in the case of complexes 2 and 3. Since, no such alteration is caused by 1, it makes this compound candidate for further study as potential drug. - Graphical
Directory of Open Access Journals (Sweden)
Jui-Hua Hsieh
Full Text Available Cytotoxicity is a commonly used in vitro endpoint for evaluating chemical toxicity. In support of the U.S. Tox21 screening program, the cytotoxicity of ~10K chemicals was interrogated at 0, 8, 16, 24, 32, & 40 hours of exposure in a concentration dependent fashion in two cell lines (HEK293, HepG2 using two multiplexed, real-time assay technologies. One technology measures the metabolic activity of cells (i.e., cell viability, glo while the other evaluates cell membrane integrity (i.e., cell death, flor. Using glo technology, more actives and greater temporal variations were seen in HEK293 cells, while results for the flor technology were more similar across the two cell types. Chemicals were grouped into classes based on their cytotoxicity kinetics profiles and these classes were evaluated for their associations with activity in the Tox21 nuclear receptor and stress response pathway assays. Some pathways, such as the activation of H2AX, were associated with the fast-responding cytotoxicity classes, while others, such as activation of TP53, were associated with the slow-responding cytotoxicity classes. By clustering pathways based on their degree of association to the different cytotoxicity kinetics labels, we identified clusters of pathways where active chemicals presented similar kinetics of cytotoxicity. Such linkages could be due to shared underlying biological processes between pathways, for example, activation of H2AX and heat shock factor. Others involving nuclear receptor activity are likely due to shared chemical structures rather than pathway level interactions. Based on the linkage between androgen receptor antagonism and Nrf2 activity, we surmise that a subclass of androgen receptor antagonists cause cytotoxicity via oxidative stress that is associated with Nrf2 activation. In summary, the real-time cytotoxicity screen provides informative chemical cytotoxicity kinetics data related to their cytotoxicity mechanisms, and with our
Tenenbaum, S; DiNardo, J; Morris, W E; Wolf, B A; Schnetzinger, R W
1984-10-01
A quantitative in vitro method for phototoxic evaluation of chemicals has been developed and validated. The assay uses Saccharomyces cerevisiae, seeded in an agar overlay on top of a plate count agar base. 8-Methoxy psoralen is used as a reference standard against which materials are measured. Activity is quantified by cytotoxicity measured as zones of inhibition. Several known phototoxins (heliotropine, lyral, phantolid, and bergamot oil) and photoallergens (6-methyl coumarin and musk ambrette) are used to validate the assay. An excellent correlation is observed between in vivo studies employing Hartley albino guinea pigs and the in vitro assay for several fragrance raw materials and other chemicals. The in vitro assay exhibits a greater sensitivity from 2-500 fold. For three fragrance oils, the in vitro assay detects low levels of photobiological activity while the in vivo assay is negative. Although the in vitro assay does not discriminate between phototoxins and photoallergens, it can be used for screening of raw materials so that reduction in animal usage can be achieved while maintaining the protection of the consumer.
Ma, Pengju; Li, Ting; Xing, Huaixin; Wang, Suzhen; Sun, Yingui; Sheng, Xiugui; Wang, Kaiguo
2017-05-01
There is a compelling need for prolonged local anesthetic that would be used for analgesia with a single administration. However, due to the low molecular weight of local anesthetics (LA) (lidocaine, bupivacaine, procaine, dibucaine, etc), they present fast systemic absorption. The aim of the present study was to develop and evaluate bupivacaine lipid-polymer hybrid nanoparticles (BVC LPNs), and compared with BVC loaded PLGA nanoparticles (BVC NPs). Their morphology, particle size, zeta potential and drug loading capacity were evaluated. In vitro release study, stability and cytotoxicity were studied. In vivo evaluation of anesthetic effects was performed on animal models. A facile nanoprecipitation and self-assembly method was optimized to obtain BVC LPNs, composed of PLGA, lecithin and DSPE-PEG 2000 , of ∼175nm particle size. Compared to BVC NPs, BVC LPNs exhibited prolonged in vitro release in phosphate-buffered saline (pH=7.4). Further, BVC LPNs displayed enhanced in vitro stability in 10% FBS and lower cytotoxicity (the concentration of BVC ranging from 1.0μM to 20μM). In addition, BVC LPNs exhibited significantly prolonged analgesic duration. These results demonstrate that the LPNs could function as promising drug delivery system for overcoming the drawbacks of poor stability and rapid drug leakage, and prolonging the anesthetic effect with slight toxicity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Low cytotoxicity fluorescent PAMAM dendrimer as gene carriers for monitoring the delivery of siRNA
Energy Technology Data Exchange (ETDEWEB)
Guan, Lingmei [Sichuan University, State Key Laboratory of Bio-resources and Eco-environment, The Ministry of Education, College of Life Sciences (China); Huang, Saipeng [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China); Chen, Zhao [Xi’an Jiaotong University, School of Science (China); Li, Yanchao [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China); Liu, Ke [Sichuan University, State Key Laboratory of Bio-resources and Eco-environment, The Ministry of Education, College of Life Sciences (China); Liu, Yang, E-mail: yliu@iccas.ac.cn; Du, Libo, E-mail: dulibo@iccas.ac.cn [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China)
2015-09-15
Visual detection of gene vectors has attracted a great deal of attention due to the application of these vectors in monitoring and evaluating the effect of gene carriers in living cells. A non-viral vector, the fluorescent PAMAM dendrimer (F-PAMAM), was synthesized through conjugation of PAMAM dendrimers and fluorescein. In vitro and ex vivo experiments show that F-PAMAM exhibits superphotostability, low cytotoxicity and facilitates endocytosis by A549 cells. The vector has a high siRNA binding affinity and it increases the efficiency of cy5-siRNA delivery in A549 cells, in comparison with a cy5-siRNA monomer. Our results provide a new method for simultaneously monitoring the delivery of siRNA and its non-viral carriers in living cells.
International Nuclear Information System (INIS)
Somchit, N.; Ngee, C.S.; Yaakob, A.; Ahmad, Z.; Zakaria, Z.A.
2009-01-01
Itraconazole and fluconazole have been reported to induce hepatotoxicity in patients. The present study was designed to investigate the role of cytochrome P450 inhibitors, SKF 525A, and curcumin pretreatment on the cytotoxicity of antifungal drugs fluconazole and itraconazole. For 3 consecutive days, female rats were administered daily SKF 525A or curcumin (5 and 25?mg/kg). Control rats received an equivalent amount of dosed vehicle. The animals were anaesthetised 24 hours after receiving the last dose for liver perfusion. Hepatocytes were then exposed to various concentrations of antifungal drugs. In vitro incubation of hepatocytes with itraconazole revealed significantly lower viability when compared to fluconazole as assessed by lactate dehydrogenase, aspartate aminotransferase and alanine aminotransferase activities. The cytotoxicity of itraconazole was enhanced when incubated with hepatocytes pretreated with SKF 525A. SKF 525A had no effects on the cytotoxicity of fluconazole. Curcumin failed to either increase or decrease the cytotoxicity of both antifungal drugs. ATP levels also showed significant decrease in both itraconazole and fluconazole incubated hepatocytes. However, SKF 525A pretreated hepatocytes had significantly lower ATP levels after itraconazole incubations. Collectively, these results confirm the involvement of cytochrome P450 in the cytoprotection in itraconazole induced hepatocyte toxicity. Differences of the effects of SKF 525A on the cytotoxicity induced by itraconazole and fluconazole may be due to the differences on the metabolism of each antifungal drug in vivo.
Energy Technology Data Exchange (ETDEWEB)
Lee, Pei-Ling; Chen, Bo-Chia; Gollavelli, Ganesh [Department of Chemistry, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Shen, Sin-Yu [Graduate Institute of Medical Science, Taipei Medical University, Taipei 11031, Taiwan (China); Yin, Yu-Sheng; Lei, Shiu-Ling [Department of Chemistry, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Jhang, Cian-Ling; Lee, Woan-Ruoh [Department of Dermatology, Taipei Medical University, Taipei 11031, Taiwan (China); Ling, Yong-Chien, E-mail: ycling@mx.nthu.edu.tw [Department of Chemistry, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Graduate Institute of Medical Science, Taipei Medical University, Taipei 11031, Taiwan (China)
2014-07-30
Highlights: • Assorted material, chemical, and toxicological analysis methods were used to confirm the shape, size, crystalline structure, and aggregation properties of ZnO NPS as well as their dissolution behavior and effect on HaCaT cell viability. • The developed TOF-SIMS and CLSM imaging method for rapid and sensitive study of ZnO NPs in HaCaT cells was validated by comparative and correlative analyses to aforementioned experimental results. • The imaging results demonstrate spatially-resolved cytotoxicity relationship between intracellular ZnO NPs concentration, {sup 40}Ca/{sup 39}K ratio, phosphocholine fragments, and glutathione fragments. CLSM images reveal the localization of ZnO NPs in cytoplasm and nuclei. • The trend of change in TOF-SIMS spectra and images of ZnO NPs treated HaCaT cells demonstrate the possible mode of actions by ZnO NP involves cell membrane disruption, cytotoxic response, and ROS mediated apoptosis. - Abstract: Zinc oxide nanoparticles (ZnO NPs) exhibit novel physiochemical properties and have found increasing use in sunscreen products and cosmetics. The potential toxicity is of increasing concern due to their close association with human skin. A time-of-flight secondary ion mass spectrometry (TOF-SIMS) and confocal laser scanning microscopy (CLSM) imaging method was developed and validated for rapid and sensitive cytotoxicity study of ZnO NPs using human skin equivalent HaCaT cells as a model system. Assorted material, chemical, and toxicological analysis methods were used to confirm their shape, size, crystalline structure, and aggregation properties as well as dissolution behavior and effect on HaCaT cell viability in the presence of various concentrations of ZnO NPs in aqueous media. Comparative and correlative analyses of aforementioned results with TOF-SIMS and CLSM imaging results exhibit reasonable and acceptable outcome. A marked drop in survival rate was observed with 50 μg/ml ZnO NPs. The CLSM images reveal the
Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants.
Alves, Celha Borges Costa; Segurado, Márcio Nunes; Dorta, Miriam Cristina Leandro; Dias, Fátima Ribeiro; Lenza, Maurício Guilherme; Lenza, Marcos Augusto
2016-01-01
To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Six mini-implants (Conexão(tm), Neodent(tm) and SIN(tm)) were separately immersed in artificial saliva (pH 6.76) for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM). The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p < 0.05 considered significant. Statistical analysis was carried out with Graph Pad PRISM software Version 4.0. No changes in cell viability or morphology were observed. Mini-implants SEM images revealed smooth surfaces with no obvious traces of corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Orthodontic mini-implants manufactured by Conexão(tm), Neodent(tm) and SIN(tm) present high corrosion resistance and are not cytotoxic.
Study of Galfenol direct cytotoxicity and remote microactuation in cells.
Vargas-Estevez, Carolina; Blanquer, Andreu; Dulal, Prabesh; Pérez Del Real, Rafael; Duch, Marta; Ibáñez, Elena; Barrios, Leonardo; Murillo, Gonzalo; Torras, Núria; Nogués, Carme; Stadler, Bethanie J H; Plaza, José A; Esteve, Jaume
2017-09-01
Remote microactuators are of great interest in biology and medicine as minimally-invasive tools for cellular stimulation. Remote actuation can be achieved by active magnetostrictive transducers which are capable of changing shape in response to external magnetic fields thereby creating controlled displacements. Among the magnetostrictive materials, Galfenol, the multifaceted iron-based smart material, offers high magnetostriction with robust mechanical properties. In order to explore these capabilities for biomedical applications, it is necessary to study the feasibility of material miniaturization in standard fabrication processes as well as evaluate the biocompatibility. Here we develop a technology to fabricate, release, and suspend Galfenol-based microparticles, without affecting the integrity of the material. The morphology, composition and magnetic properties of the material itself are characterized. The direct cytotoxicity of Galfenol is evaluated in vitro using human macrophages, osteoblast and osteosarcoma cells. In addition, cytotoxicity and actuation of Galfenol microparticles in suspension are evaluated using human macrophages. The biological parameters analyzed indicate that Galfenol is not cytotoxic, even after internalization of some of the particles by macrophages. The microparticles were remotely actuated forming intra- and extracellular chains that did not impact the integrity of the cells. The results propose Galfenol as a suitable material to develop remote microactuators for cell biology studies and intracellular applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cytotoxicity and genotoxicity of lipid nanocapsules.
Le Roux, Gaël; Moche, Hélène; Nieto, Alejandro; Benoit, Jean-Pierre; Nesslany, Fabrice; Lagarce, Frédéric
2017-06-01
Lipid nanocapsules (LNCs) offer a promising method for the entrapment and nanovectorisation of lipophilic molecules. This new type of nanocarrier, formulated according to a solvent-free process and using only regulatory-approved components, exhibits many prerequisites for being well tolerated. Although toxicological reference values have already been obtained in mice, interaction of LNCs at the cell level needs to be elucidated. LNCs, measuring from 27.0±0.1nm (25nm LNCs) and 112.1±1.8nm (100nm LNCs) and with a zeta potential between -38.7±1.2mV and +9.18±0.4mV, were obtained by a phase inversion process followed by post-insertion of carboxy- or amino-DSPE-PEG. Trypan blue, MTS and neutral red uptake (NRU) assays were performed to evaluate the cytotoxicity of LNCs on mouse macrophage-like cells RAW264.7 after 24h of exposure. The determination of 50% lethal concentration (LC50) showed a size effect of LNCs on toxicity profiles: LC50 ranged from 1.036mg/L (MTS) and 0.477mg/mL (NRU) for 25nm LNCs, to 4.42mg/mL (MTS) and 2.18mg/mL (NRU) for 100nm LNCs. Surfactant Solutol® HS15 has been shown to be the only constituent to exhibit cytotoxicity; its LC50 reached 0.427mg/mL. Moreover, LNCs were not more toxic than their components in simple mixtures. At sublethal concentration, 100nm LNCs only were able to induce a significant production of nitric oxide (NO) by RAW264.7 cells, as assessed by the Griess reaction. Again, surfactant was the only component responsible for an increased NO release (1.8±0.2-fold). Genotoxicity assays revealed no DNA damage on human lymphocytes in both the in vitro Comet and micronucleus assays using 4-hour and 24-hour treatments, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.
CYTOTOXIC, α-CHYMOTRYPSIN AND UREASE INHIBITION ACTIVITIES OF THE PLANT Heliotropium dasycarpum L.
Ghaffari, Muhammad Abuzar; Chaudhary, Bashir Ahmed; Uzair, Muhammad; Ashfaq, Khuram
2016-01-01
The aim of this study was to investigate Cytotoxic, α-Chymotrypsin and Urease inhibition activities of the plant Heliotropium dasycarpum . Dichloromethane and methanol extracts of the plant were evaluated for cytotoxic, α-Chymotrypsin and Urease inhibition by using in vivo Brine Shrimp lethality bioassay and in vitro enzymatic inhibition assays respectively. The methanol extract of the plant exhibited significant cytotoxic activity. Out of 30 brine shrimp larvae, 2 (6%), 26 (86%) and 28 (93%) larvae were survived at concentration of 1000μg/ml, 100μg/ml and 10μg/ml respectively with LD50; 215.837. Similarly 21 (70%), 25 (83%), 29 (96%) larvae were survived of dichloromethane plant extract with LD50; 6170.64. The methanol and dichloromethane extract exhibited 10.50±0.18% and 41.51±0.15% α-chymotrypsin enzyme inhibition respectively with IC 50 values of greater than 500 μmol. The methanol extract showed 24.39±0.21% Urease enzyme inhibition with IC 50 values of greater than 400 μmol While dichloromethane extract has 11.46±0.09% enzyme inhibition with IC 50 values of greater than 500 μmol. The results clearly indicated that Heliotropium dasycarpum has cytotoxic potential and enzyme inhibition properties. Further study is needed to screen out antitumor and anti-ulcerative agents.
Osimitz, Thomas G; Welsh, William J; Ai, Ni; Toole, Colleen
2015-01-01
The paper presents results from the screening of seven monomers used by Eastman Chemical to make various polymers. Ethylene glycol, diethylene glycol, polytetramethylene glycol, isophthalic acid, monosodium-5-sulfoisophthalic acid, 1,4-cyclohexanedicarboxylic acid, and dimethylcyclohexanedicarboxylate were screened for potential androgenicity or estrogenicity. The following studies were conducted: QSAR for binding to the AR and ER, in vitro Androgen Receptor Binding Assay, in vitro Estrogen Receptor Binding Assays (alpha and beta isoforms), in vitro Androgen Receptor Transactivation Assay in human cells, and in vitro Estrogen Receptor Transactivation Assay in human cells. None of the QSAR models predicted that any of the monomers possessed appreciable binding affinity for either AR or ER. Binding assays showed no evidence of interaction with either the AR or the alpha or beta ER receptors. Similarly, the AR and ER transactivation assays were negative. Moreover, six of the seven monomers have been subjected to 13-week and developmental toxicity studies in rats with no androgen- or estrogen-related effects being noted. Given the negative results of the in vitro screening assays (except PMG which demonstrated cytotoxicity) as well as available repeated dose and developmental and reproductive studies, the data suggest that none of the monomers tested exhibit androgenic or estrogenic hazards. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Tanase, C E; Popa, M I; Sartoris, A; Unger, R E; Kirkpatrick, C J; Verestiuc, L
2013-01-01
This work reports on the physicochemical properties and in vitro cytotoxicity assessment of chitosan–calcium phosphate (Cs–CP) scaffolds for bone tissue engineering, which were synthesized by a novel biomimetic co-precipitation method. X-ray diffraction (XRD) along with scanning electron microscopy (SEM) analysis confirmed the porous morphology of the scaffolds and the amorphous nature of the inorganic phase with different crystallite sizes and the formation of various forms of calcium phosphate. Compressive mechanical testing revealed that the Young's modulus of the biomaterials is in the range of human trabecular bone. In vitro tests were performed on the biomaterials for up to 14 days to study the behavior of the osteoblast-like human cell line (MG63), primary human osteoblasts (HOS) and human dermal microvascular endothelial cells (HDMEC). The cytotoxicity was evaluated by the MTS assay for cell metabolism and the detection of membrane integrity (lactate dehydrogenase-LDH release). An expression of the vascular endothelial growth factor (VEGF) in the cell supernatants was quantified by ELISA. Cell viability gave values close to untreated controls for MG63 and HOS, while in the case of HDMEC the viability after 2 weeks in the cell culture was between 80–90%. The cytotoxicity induced by the Cs–CP scaffolds on MG63, HOS and HDMEC in vitro was evaluated by the amount of LDH released, which is a sensitive and accurate marker for cellular toxicity. The increased levels of VEGF obtained in the osteoblast culture highlights its important role in the regulation of vascularization and bone remodeling. The biological responses of the Cs–CP scaffolds demonstrate a similar proliferation and differentiation characteristics of the cells comparable to the controls. These results reveal that biomimetic Cs–CP composite scaffolds are promising biomaterials for bone tissue engineering; their in vivo response remains to be tested. (paper)
Phototoxicity and cytotoxicity of fullerol in human lens epithelial cells
International Nuclear Information System (INIS)
Roberts, Joan E.; Wielgus, Albert R.; Boyes, William K.; Andley, Usha; Chignell, Colin F.
2008-01-01
The water-soluble, hydroxylated fullerene [fullerol, nano-C 60 (OH) 22-26 ] has several clinical applications including use as a drug carrier to bypass the blood ocular barriers. We have assessed fullerol's potential ocular toxicity by measuring its cytotoxicity and phototoxicity induced by UVA and visible light in vitro with human lens epithelial cells (HLE B-3). Accumulation of nano-C 60 (OH) 22-26 in the cells was confirmed spectrophotometrically at 405 nm and cell viability estimated using MTS and LDH assays. Fullerol was cytotoxic to HLE B-3 cells maintained in the dark at concentrations higher than 20 μM. Exposure to either UVA or visible light in the presence of > 5 μM fullerol-induced phototoxic damage. When cells were pretreated with non-toxic antioxidants: 20 μM lutein, 1 mM N-acetyl cysteine, or 1 mM L-ascorbic acid prior to irradiation, only the singlet oxygen quencher-lutein significantly protected against fullerol photodamage. Apoptosis was observed in lens cells treated with fullerol whether or not the cells were irradiated, in the order UVA > visible light > dark. Dynamic light scattering (DLS) showed that in the presence of the endogenous lens protein α-crystallin, large aggregates of fullerol were reduced. In conclusion, fullerol is both cytotoxic and phototoxic to human lens epithelial cells. Although the acute toxicity of water-soluble nano-C 60 (OH) 22-26 is low, these compounds are retained in the body for long periods, raising concern for their chronic toxic effect. Before fullerols are used to deliver drugs to the eye, they should be tested for photo- and cytotoxicity in vivo
The effect of radiosterilization on cytotoxicity of polyurethane film
International Nuclear Information System (INIS)
Sheikh, N.
2003-01-01
Nowadays a sequence of tests for evaluation of sterilized biomaterial includes an initial set of tests in vitro, both biological (cell culture) and non-biological (mechanical tests). In this paper the cytotoxicity of a sterilized polyurethane film, in order to use as biomaterial, has been investigated. For this purpose NCO-terminated urethane prepolymer in medical quality was synthesized without ingredients beside monomers (polyethylene glycol/castor oil and toluene diisocyanate). The cured prepolymer films were prepared under ambient conditions due to the reaction of free NCO-groups of prepolymer with air moisture. The polyurethane films were sterilized by gamma-ray (25 kGy). The surface structure of sterilized polyurethane film was observed by SEM and compared to that of the unsterilized film. Also, the in vitro interaction of fibroblast cells and sterilized polyurethane film in culture medium containing serum was evaluated in comparison with control samples. Results showed no signs of cell toxicity
Ogbole, Omonike O; Segun, Peter A; Adeniji, Adekunle J
2017-11-22
Cancer is a leading cause of death world-wide, with approximately 17.5 million new cases and 8.7 million cancer related deaths in 2015. The problems of poor selectivity and severe side effects of the available anticancer drugs, have demanded the need for the development of safer and more effective chemotherapeutic agents. The present study was aimed at determining the cytotoxicities of 31 medicinal plants extracts, used in Nigerian ethnomedicine for the treatment of cancer. The plant extracts were screened for cytotoxicity, using the brine shrimp lethality assay (BSLA) and MTT cytotoxicity assay. Rhabdomyosarcoma (RD) cell line, normal Vero cell line and the normal prostate (PNT2) cell line were used for the MTT assay, while Artemia salina nauplii was used for the BSLA. The phytochemical composition of the active plant extracts was determined by high performance liquid chromatography (HPLC) analysis. The extract of Eluesine indica (L.) Gaertn (Poaceae), with a LC 50 value of 76.3 μg/mL, had the highest cytotoxicity on the brine shrimp larvae compared to cyclophosphamide (LC 50 = 101.3 μg/mL). Two plants extracts, Macaranga barteri Mull. Arg. (Euphorbiaceae) and Calliandra portoricensis (Jacq.) Benth (Leguminosae) exhibited significant cytotoxic activity against the RD cell line and had comparable lethal activity on the brine shrimps. Further cytotoxic investigation showed that the dichloromethane fraction of Macaranga barteri (DMB) and the ethyl acetate fraction of Calliandra portoricensis (ECP), exhibited approximately 6-fold and 4-fold activity, respectively, compared to cyclophosphamide on RD cell line. Determination of selective index (SI) using Vero and PNT2 cell line indicated that DMB and ECP displayed a high degree of selectivity against the cancer cell under investigation. HPLC analysis showed that 3,5dicaffeoylquinic acid, acteoside, kampferol-7-O-glucoside and bastadin 11 were the major components of DMB while the major components of ECP were
Directory of Open Access Journals (Sweden)
Kumbhare MR
2012-04-01
Full Text Available Objective: To assess the phytochemical constituents, total phenolic content, cytotoxicity and invitro antioxidant activity of stem bark extracts of Moringa oleifera (M. oleifera (Moringaceae. Methods: Brine shrimp lethality (BSL bioassay was used to investigate the cytotoxic effects. DPPH and nitric oxide radical scavenging activity was used to demonstrate antioxidant activity. Results: Phytochemical analysis revealed the presence of tannins, flavonoids, steroids and alkaloids. The LC 50 values were obtained for extracts as 850 毺 g/mL for petroleum ether extract, 800 毺 g/mL for chloroform extract and 900 毺 g/mL for methanol extract. The total phenolic content of the methanolic extract was 50.72% w/w, equivalent to gallic acid. Petroleum ether, chloroform and methanolic extracts of M. oleifera and standard ascorbic acid were found to be scavenger of DPPH radical with an IC 50 of 124.75, 112.08, 54.34 and 13.86 毺 g/mL, respectively. Methanolic extract was found to be good scavenger of DPPH radical. Petroleum ether, chloroform, ethyl acetate soluble fraction of methanolic extracts of M. oleifera and ascorbic acid were found to be scavenger of nitric oxide radical with an IC 50 of 93.32, 65.12, 54.83 and 12.59 毺 g/mL, respectively. Ethyl acetate soluble fraction was found to be good scavenger of nitric oxide radical. Conclusions: It can be concluded that the crude extracts of M. oleifera is a potential source of natural antioxidants, and this justifies its uses in folkloric medicines.
Heravi, Farzin; Ramezani, Mohammad; Poosti, Maryam; Hosseini, Mohsen; Shajiei, Arezoo; Ahrari, Farzaneh
2013-01-01
Background and aims. Incorporation of nano-particles to orthodontic bonding systems has been considered to prevent enamel demineralization around appliances. This study investigated cytotoxicity of Transbond XT adhesive containing 1 wt% titanium dioxide (TiO2) nano-particles. Materials and methods. Ten composite disks were prepared from each of the conventional and TiO2-containg composites and aged for 1, 3, 5, 7 and 14 days in Dulbecco's Modified Eagle's Medium (DMEM). The extracts were obtained and exposed to culture media of human gingival fibroblasts (HGF) and mouse L929 fibroblasts. Cell viability was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Results. Both adhesives were moderately toxic for HGF cells on the first day of the experiment, but the TiO2-containing adhesive produced significantly lower toxicity than the pure adhesive (P0.05). There was a significant reduction in cell toxicity with increasing pre-incubation time (Porthodontic adhesive containing TiO2 nano-particles indicated comparable or even lower toxicity than its nano-particle-free counterpart, indicating that incorporation of 1 wt% TiO2 nano-particles to the composite structure does not result in additional health hazards compared to that occurring with the pure adhesive.
International Nuclear Information System (INIS)
Lim, Chun Kyu; Kim, Suel-Kee; Ko, Duck Sung; Cho, Jea Won; Jun, Jin Hyun; An, Su-Yeon; Han, Jung Ho
2009-01-01
Potential applications of embryonic stem (ES) cells are not limited to regenerative medicine but can also include in vitro screening of various toxicants. In this study, we established mouse ES cell lines from isolated blastomeres of two-cell stage embryos and examined their potential use as an in vitro system for the study of developmental toxicity. Two ES cell lines were established from 69 blastomere-derived blastocysts (2.9%). The blastomere-derived ES (bm-ES) cells were treated with mono-(2-ethylhexyl) phthalate (MEHP) in an undifferentiated state or after directed differentiation into early neural cell types. We observed significantly decreased cell viability when undifferentiated bm-ES cells were exposed to a high dose of MEHP (1000 μM). The cytotoxic effects of MEHP were accompanied by increased DNA fragmentation, nuclear condensation, and activation of Caspase-3, which are biochemical and morphological features of apoptosis. Compared to undifferentiated bm-ES cells, considerably lower doses of MEHP (50 and 100 μM) were sufficient to induce cell death in early neurons differentiated from bm-ES cells. At the lower doses, the number of neural cells positive for the active form of Caspase-3 was greater than that for undifferentiated bm-ES cells. Thus, our data indicate that differentiating neurons are more sensitive to MEHP than undifferentiated ES cells, and that undifferentiated ES cells may have more efficient defense systems against cytotoxic stresses. These findings might contribute to the development of a new predictive screening method for assessment of hazards for developmental toxicity.
Novel MUC1 aptamer selectively delivers cytotoxic agent to cancer cells in vitro.
Directory of Open Access Journals (Sweden)
Yan Hu
Full Text Available Chemotherapy is a primary treatment for cancer, but its efficacy is often limited by the adverse effects of cytotoxic agents. Targeted drug delivery may reduce the non-specific toxicity of chemotherapy by selectively directing anticancer drugs to tumor cells. MUC1 protein is an attractive target for tumor-specific drug delivery owning to its overexpression in most adenocarcinomas. In this study, a novel MUC1 aptamer is exploited as the targeting ligand for carrying doxorubicin (Dox to cancer cells. We developed an 86-base DNA aptamer (MA3 that bound to a peptide epitope of MUC1 with a K(d of 38.3 nM and minimal cross reactivity to albumin. Using A549 lung cancer and MCF-7 breast cancer cells as MUC1-expressing models, MA3 was found to preferentially bind to MUC1-positive but not MUC1-negative cells. An aptamer-doxorubicin complex (Apt-Dox was formulated by intercalating doxorubicin into the DNA structure of MA3. Apt-Dox was found capable of carrying doxorubicin into MUC1-positive tumor cells, while significantly reducing the drug intake by MUC1-negative cells. Moreover, Apt-Dox retained the efficacy of doxorubicin against MUC1-positive tumor cells, but lowered the toxicity to MUC1-negative cells (P<0.01. The results suggest that the MUC1 aptamer may have potential utility as a targeting ligand for selective delivery of cytotoxic agent to MUC1-expressing tumors.
Calcium Contributes to the Cytotoxic Interaction Between Diclofenac and Cytokines.
Maiuri, Ashley R; Breier, Anna B; Turkus, Jonathan D; Ganey, Patricia E; Roth, Robert A
2016-02-01
Diclofenac (DCLF) is a widely used non-steroidal anti-inflammatory drug that is associated with idiosyncratic, drug-induced liver injury (IDILI) in humans. The mechanisms of DCLF-induced liver injury are unknown; however, patients with certain inflammatory diseases have an increased risk of developing IDILI, which raises the possibility that immune mediators play a role in the pathogenesis. DCLF synergizes with the cytokines tumor necrosis factor-alpha (TNF) and interferon-gamma (IFN) to cause hepatocellular apoptosis in vitro by a mechanism that involves activation of the endoplasmic reticulum (ER) stress response pathway and of the mitogen-activated protein kinases, c-Jun N-terminal kinase (JNK), and extracellular signal-regulated kinase (ERK). DCLF also causes an increase in intracellular calcium (Ca(++)) in hepatocytes, but the role of this in the cytotoxic synergy between DCLF and cytokines is unknown. We tested the hypothesis that Ca(++) contributes to DCLF/cytokine-induced cytotoxic synergy. Treatment of HepG2 cells with DCLF led to an increase in intracellular Ca(++) at 6 and 12 h, and this response was augmented in the presence of TNF and IFN at 12 h. The intracellular Ca(++) chelator BAPTA/AM reduced cytotoxicity and caspase-3 activation caused by DCLF/cytokine cotreatment. BAPTA/AM also significantly reduced DCLF-induced activation of the ER stress sensor, protein kinase RNA-like ER kinase (PERK), as well as activation of JNK and ERK. Treatment of cells with an inositol trisphosphate receptor antagonist almost completely eliminated DCLF/cytokine-induced cytotoxicity and decreased DCLF-induced activation of PERK, JNK, and ERK. These findings indicate that Ca(++) contributes to DCLF/cytokine-induced cytotoxic synergy by promoting activation of the ER stress-response pathway and JNK and ERK. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
A comparison of in vivo and in vitro methods for determining availability of iron from meals
International Nuclear Information System (INIS)
Schricker, B.R.; Miller, D.D.; Rasmussen, R.R.; Van Campen, D.
1981-01-01
A comparison is made between in vitro and human and rat in vivo methods for estimating food iron availability. Complex meals formulated to replicate meals used by Cook and Monsen (Am J Clin Nutr 1976;29:859) in human iron availability trials were used in the comparison. The meals were prepared by substituting pork, fish, cheese, egg, liver, or chicken for beef in two basic test meals and were evaluated for iron availability using in vitro and rat in vivo methods. When the criterion for comparison was the ability to show statistically significant differences between iron availability in the various meals, there was substantial agreement between the in vitro and human in vivo methods. There was less agreement between the human in vivo and the rat in vivo and between the in vivo and the rat in vivo and between the in vitro and the rat in vivo methods. Correlation analysis indicated significant agreement between in vitro and human in vivo methods. Correlation between the rat in vivo and human in vivo methods were also significant but correlations between the in vitro and rat in vivo methods were less significant and, in some cases, not significant. The comparison supports the contention that the in vitro method allows a rapid, inexpensive, and accurate estimation of nonheme iron availability in complex meals
Levatić, Jurica; Pavić, Kristina; Perković, Ivana; Uzelac, Lidija; Ester, Katja; Kralj, Marijeta; Kaiser, Marcel; Rottmann, Matthias; Supek, Fran; Zorc, Branka
2018-02-25
Primaquine (PQ) is a commonly used drug that can prevent the transmission of Plasmodium falciparum malaria, however toxicity limits its use. We prepared five groups of PQ derivatives: amides 1a-k, ureas 2a-k, semicarbazides 3a,b, acylsemicarbazides 4a-k and bis-ureas 5a-v, and evaluated them for antimalarial activity in vitro against the erythrocytic stage of P. falciparum NF54. Particular substituents, such as trityl (in 2j and 5r) and methoxybenzhydryl (in 3b and 5v) were associated with a favorable cytotoxicity-to-activity ratio. To systematically link structural features of PQ derivatives to antiplasmodial activity, we performed a quantitative structure-activity relationship (QSAR) study using the Support Vector Machines machine learning method. This yielded a highly accurate statistical model (R 2 = 0.776 in cross-validation), which was used to prioritize novel candidate compounds. Seven novel PQ-ureidoamides 10a-g were synthesized and evaluated for activity, highlighting the benzhydryl ureidoamides 10e and 10f derived from p-chlorophenylglycine. Further experiments on human cell lines revealed that 10e and 10f are an order of magnitude less toxic than PQ in vitro while having antimalarial activity indistinguishable from PQ. The toxicity profile of novel compounds 10 toward human cells was particularly favorable when the glucose-6-phosphate dehydrogenase (G6PD) was inhibited, while toxicity of PQ was exacerbated by G6PD inhibition. Our work therefore highlights promising lead compounds for the development of effective antimalarial drugs that may also be safer for G6PD-deficient patients. In addition, we provide computational inferences of antimalarial activity and cytotoxicity for thousands of PQ-like molecular structures. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Kato, Yukinari; Kunita, Akiko; Fukayama, Masashi; Abe, Shinji; Nishioka, Yasuhiko; Uchida, Hiroaki; Tahara, Hideaki; Yamada, Shinji; Yanaka, Miyuki; Nakamura, Takuro; Saidoh, Noriko; Yoshida, Kanae; Fujii, Yuki; Honma, Ryusuke; Takagi, Michiaki; Ogasawara, Satoshi; Murata, Takeshi; Kaneko, Mika K
2017-02-01
The interaction between podoplanin (PDPN) and C-type lectin-like receptor 2 (CLEC-2) is involved in tumor malignancy. We have established many monoclonal antibodies (mAbs) against human podoplanin using the cancer-specific mAb (CasMab) technology. LpMab-21, one of the mouse antipodoplanin mAbs, is of the IgG 2a subclass, and its minimum epitope was determined to be Thr76-Arg79 of the human podoplanin. Importantly, sialic acid is linked to Thr76; therefore, LpMab-21 is an antiglycopeptide mAb (GpMab). In this study, we investigated whether LpMab-21 shows antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) against human podoplanin-expressing cancer cell lines in vitro and also studied its antitumor activities using a xenograft model. LpMab-21 showed high ADCC and CDC activities against not only podoplanin-expressing Chinese hamster ovary cells but also LN319 glioblastoma cells and PC-10 lung cancer cells, both of which endogenously express podoplanin. Furthermore, LpMab-21 decreased tumor growth in vivo, indicating that LpMab-21 could be useful for antibody therapy against human podoplanin-expressing cancers.
Baby, Roshen Daniel; Subramaniam, Siva; Arumugam, Ilakkiya; Padmanabhan, Sridevi
2017-04-01
Our objective was to assess the antibacterial and cytotoxic effects of orthodontic stainless steel brackets coated with different phases of photocatalytic titanium oxide. From a total sample of 115 brackets, 68 orthodontic stainless steel brackets were coated with titanium oxide using a radiofrequency magnetron sputtering machine. The coated brackets were then converted into 34 each of the anatase and rutile phases of titanium oxide. These brackets were subdivided into 4 groups for antibacterial study and 3 groups for cytotoxicity study. Brackets for the antibacterial study were assessed against the Streptococcus mutans species using microbiologic tests. Three groups for the cytotoxicity study were assessed using the thiazolyl tetrazolium bromide assay. The antibacterial study showed that both phases were effective, but the rutile phase of photocatalytic titanium oxide had a greater bactericidal effect than did the anatase phase. The cytotoxicity study showed that the rutile phase had a greater decrease in viability of cells compared with the anatase phase. It is recommended that orthodontic brackets be coated with the anatase phase of titanium oxide since they exhibited a significant antibacterial property and were only slightly cytotoxic. Copyright © 2016 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hittelman Walter N
2011-08-01
Full Text Available Abstract Background The fusion protein VEGF121/rGel composed of the growth factor VEGF121 and the plant toxin gelonin targets the tumor neovasculature and exerts impressive anti-vascular effects. We have previously shown that VEGF121/rGel is cytotoxic to endothelial cells overexpressing VEGFR-2 but not to endothelial cells overexpressing VEGFR-1. In this study, we examined the basis for the specific toxicity of this construct and assessed its intracellular effects in vitro and in vivo. Methods We investigated the binding, cytotoxicity and internalization profile of VEGF121/rGel on endothelial cells expressing VEGFR-1 or VEGFR-2, identified its effects on angiogenesis models in vitro and ex vivo, and explored its intracellular effects on a number of molecular pathways using microarray analysis. Results Incubation of PAE/VEGFR-2 and PAE/VEGFR-1 cells with 125I-VEGF121/rGel demonstrated binding specificity that was competed with unlabeled VEGF121/rGel but not with unlabeled gelonin. Assessment of the effect of VEGF121/rGel on blocking tube formation in vitro revealed a 100-fold difference in IC50 levels between PAE/VEGFR-2 (1 nM and PAE/VEGFR-1 (100 nM cells. VEGF121/rGel entered PAE/VEGFR-2 cells within one hour of treatment but was not detected in PAE/VEGFR-1 cells up to 24 hours after treatment. In vascularization studies using chicken chorioallantoic membranes, 1 nM VEGF121/rGel completely inhibited bFGF-stimulated neovascular growth. The cytotoxic effects of VEGF121/rGel were not apoptotic since treated cells were TUNEL-negative with no evidence of PARP cleavage or alteration in the protein levels of select apoptotic markers. Microarray analysis of VEGF121/rGel-treated HUVECs revealed the upregulation of a unique "fingerprint" profile of 22 genes that control cell adhesion, apoptosis, transcription regulation, chemotaxis, and inflammatory response. Conclusions Taken together, these data confirm the selectivity of VEGF121/rGel for VEGFR-2
Czech Academy of Sciences Publication Activity Database
Moyo, M.; Aremu, A.O.; Chukwujekwu, J. C.; Grúz, Jiří; Skořepa, Jiří; Doležal, Karel; Katsvanga, C. A. T.; Van Staden, J.
2017-01-01
Roč. 31, č. 5 (2017), s. 713-720 ISSN 0951-418X R&D Projects: GA MŠk(CZ) LO1204; GA MŠk LK21306 Institutional support: RVO:61389030 Keywords : in-vitro * alzheimers-disease * alkaloids * extracts * antioxidant * coumarins * apoptosis * phylogeny * medicine * bacteria * acetylcholinesterase inhibition * Amaryllidaceae * antibacterial * cytotoxicity * flavonoids * phenolic acids Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 3.092, year: 2016
Directory of Open Access Journals (Sweden)
SE Hosseini
2014-02-01
Full Text Available Abstract Background & aim: Royal jelly, secreted by worker bees, has different biological activities on cells and tissues. The aim of this study was to evaluate the effects of royal jelly on peripheral blood mononuclear cells and on the tumor category of K562 cell line. Methods: In the present experimental study, three subjects were selected separately with three repetitions. K562 (104 cells and PBMC (105 cells with different concentrations of royal jelly (5, 10, 25, 50 and 100 mg/ml were cultured under standard conditions for 48 and 72 h separately. The fatality rate on PBMC cells and K562 cancer cells was evaluated by using MTT (Tetrazolium Dye-Reduction Assay. The number of viable cells in PBMC that were exposed for 48 hours with Royal Jelly was evaluated by trypan blue staining. Data were analyzed by ANOVA. Results: The royal jelly had no cytotoxicity effect on PBMC cells but at concentration of 50 and 100 mg/mL the cytotoxicity effect were observed on k562 cells whereas, at 10 and 25 mg/ml the number of PBMC viable cells increased. Conclusion: Due to the lack of lethality of royal jelly on PBMC cells and PBMC cell viability and an increase in the fatality rate of cancer cells in the future, royal jelly can be used as a potential candidate for treatment of leukemia. Keywords: Royal jelly, K562, peripheral blood mononuclear cell
In vitro methods for hazard assessment of industrial chemicals – opportunities and challenges
Directory of Open Access Journals (Sweden)
Chin Lin eWong
2015-05-01
Full Text Available Allergic contact dermatitis (ACD is a delayed-type hypersensitivity immune reaction mediated by T-lymphocytes as a result of repeated exposure of an allergen primarily on skin. ACD accounts for up to 95% of occupational skin diseases (OSDs, with epoxy resins implicated as one of the most common causes of ACD. Efficient high-throughput in vitro screening for accurate identification of compounds and materials that may pose hazardous risks in the workplace is crucial. At present, the murine local lymph node assay (LLNA is the ‘method of choice’ for predicting the sensitizing potency of contact allergens. As the 3Rs principles of reduction, refinement and replacement in animal testing has gained political and economic momentum, several in vitro screening methods have been developed for identifying potential contact allergens. To date, these latter methods have been utilized primarily to assess the skin sensitizing potential of the chemical components of cosmetic products with scant research attention as to the applicability of these methods to industrial chemicals, particularly epoxy resins. Herein we review the currently utilized in vitro methods and identify the knowledge gaps with regard to assessing the generalizability of in vitro screening methods for assessing the skin sensitizing potential of industrial chemicals.
Directory of Open Access Journals (Sweden)
Michele Savaris
2017-01-01
Full Text Available Biomaterials must meet certain fundamental requirements for their usage in living beings, such as biocompatibility, bifunctionality, and sterilizability, without having chemical and structural changes. The biocompatibility of poly(lactic acid (PLA films, shaped by compression, was evaluated after sterilization by ethylene oxide by a histological in vivo test with Wistar rats and cytotoxicity in cell adhesion in vitro. The cytotoxicity test was performed by the reduction of tetrazolium salt (MTT. Thermal and chemical changes in PLA films concerning the proposed sterilization process and characteristics were not observed to evidence polymer degradation due to sterilization. The analysis of the cytotoxicity by the MTT method has shown that the sterilized PLA films are not cytotoxic. The adhesion and proliferation of fibroblasts on PLA films were homogeneously distributed over the evaluation period, showing an elongated appearance with unnumbered cytoplasmic extensions and cell-cell interactions. By examining the biocompatibility in a histological study, a mild tissue inflammation was observed with the presence of fibrosis in the samples that had been exposed for 21 days in the rats’ bodies. PLA films sterilized with ethylene oxide did not exhibit cell adhesion in vitro and toxicity to the surrounding tissue in vivo and they may be used in future in vivo testing, according to histological findings in Wistar rats in the present study.
Chemosensitivity and radiosensitivity testing of freshly explanted human tumour cells in vitro
International Nuclear Information System (INIS)
Wells, J.
1977-10-01
In this thesis, in vitro testing for the chemosensitivity and radiosensitivity of freshly explanted human tumour cells is described. The cells were incubated with anti-tumour drugs and either a 6-day growth test performed or a clonal growth test as a measure of survival of cell reproductive capacity. It was shown that if one aims to develop a suitable in vitro method for predicting the subsequent response of human tumour cells in situ to cytotoxic chemotherapy, the test procedure must be initiated before the explanted cells have undergone significant growth in vitro. The survival of the reproductive capacity of tumour cell explants following X-radiation was also studied. Using a 'feeder' layer technique, values for the survival curve parameter Dsub(q) were in the range 400-610 rad and the values for D 0 were in the range 120-160 rad. The shape of the X-ray survival curves did not change when cells were retested after repeated subculturing in vitro. Therefore, unlike chemosensitivity measured by the same biological end-point, radiosensitivity apparently does not change once cells have reached their maximum growth potential. (UK)
Huges-Wirawan, Gladys Ratna Widhi Indrati
1978-01-01
This thesis describes a method to measure PHA-incluced cytotoxicity of human lymphocytes (nonspecific T-cell cytotoxicity), using 3H-thymidine prelabelled target cells (HeLa cells). The method has some advantages over the widely used 51Cr-release assay. Its application in two clinical conditions is
Energy Technology Data Exchange (ETDEWEB)
Pojo, M., E-mail: martapojo@ecsaude.uminho.pt; Cerqueira, S. R.; Mota, T.; Xavier-Magalhaes, A.; Ribeiro-Samy, S. [University of Minho, Life and Health Sciences Research Institute (ICVS), School of Health Sciences (Portugal); Mano, J. F.; Oliveira, J. M., E-mail: miguel.oliveira@dep.uminho.pt; Reis, R. L. [ICVS/3Bs, PT Government Associated Laboratory (Portugal); Sousa, N.; Costa, B. M.; Salgado, A. J. [University of Minho, Life and Health Sciences Research Institute (ICVS), School of Health Sciences (Portugal)
2013-05-15
Glioblastoma (GBM) is simultaneously the most common and most malignant subtype tumor of the central nervous system. These are particularly dramatic diseases ranking first among all human tumor types for tumor-related average years of life lost and for which curative therapies are not available. Recently, the use of nanoparticles as drug delivery systems (DDS) for tumor treatment has gained particular interest. In an attempt to evaluate the potential of carboxymethylchitosan/poly(amidoamine) (CMCht/PAMAM) dendrimer nanoparticles as a DDS, we aimed to evaluate its cytotoxicity and internalization efficiency in GBM cell models. CMCht/PAMAM-mediated cytotoxicity was evaluated in a GBM cell line (U87MG) and in human immortalized astrocytes (hTERT/E6/E7) by MTS and double-stranded DNA quantification. CMCht/PAMAM internalization was assessed by double fluorescence staining. Both cells lines present similar internalization kinetics when exposed to a high dose (400 {mu}g/mL) of these nanoparticles. However, the internalization rate was higher in tumor GBM cells as compared to immortalized astrocytes when cells were exposed to lower doses (200 {mu}g/mL) of CMCht/PAMAM for short periods (<24 h). After 48 h of exposure, both cell lines present {approx}100% of internalization efficiency for the tested concentrations. Importantly, short-term exposures (1, 6, 12, 24, and 48 h) did not show cytotoxicity, and long-term exposures (7 days) to CMCht/PAMAM induced only low levels of cytotoxicity in both cell lines ({approx}20% of decrease in metabolic activity). The high efficiency and rate of internalization of CMCht/PAMAM we show here suggest that these nanoparticles may be an attractive DDS for brain tumor treatment in the future.
Chromium cytotoxic effects on mammalian cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Levis, A G; Buttignol, M; Vettorato, L
1975-01-01
Chromium compounds, which have several industrial uses, are reported to be carcinogenic. The author, have, therefore, undertaken the study of K/sub 2/Cr/sub 2/O/sub 7/ effects on a cell line of Hamster fibroblasts (BHK), using specific radioactive precursors and determining the acid soluble pool, the RNA, DNA, and protein contents and specific activities. The K/sub 2/Cr/sub 2/O/sub 7/ induced changes in nucleic acid and protein specific activities are related to two different, dissociable effects: (1) a sudden inhibition of macromolecular syntheses, followed by a recovery period, and (2) an immediate, drastic stimulation of nucleoside transport into the cell, whereas amino acid transport is reduced. The effects on precursor permeability are not related to non specific changes of the plasma membrane, but they seem to be due to specific simulations and inhibitions of nucleoside and amino acid transport mechanisms. A human cell line (HEp) has been also tested, which is more sensitive to K/sup 2/Cr/sub 2/O/sub 7/ action than the BHK line. DNA synthesis as well as survival in single cell plating conditions show the same difference in sensitivity to K/sub 2/Cr/sub 2/O/sub 7/. Thus, the loss of indefinite cell division ability could be due to the blockage of DNA replication. It is suggested that the main chromium cytotoxic effect lies in a multiple attack to the DNA molecule, which gradually alters the DNA tertiary structure resulting in the blockage of replication capacity. This blockage may be reversible owing to the breakage of chromium-DNA bonds and to the induced instability of phosphodiester internucleotide bonds.
Functional analysis of HPV-like particle-activated Langerhans cells in vitro.
Yan, Lisa; Woodham, Andrew W; Da Silva, Diane M; Kast, W Martin
2015-01-01
Langerhans cells (LCs) are antigen-presenting cells responsible for initiating an immune response against human papillomaviruses (HPVs) entering the epithelial layer in vivo as they are the first immune cell that HPV comes into contact with. LCs become activated in response to foreign antigens, which causes internal signaling resulting in the increased expression of co-stimulatory molecules and the secretion of inflammatory cytokines. Functionally activated LCs are then capable of migrating to the lymph nodes where they interact with antigen-specific T cells and initiate an adaptive T-cell response in vivo. However, HPV has evolved in a manner that suppresses LC function, and thus the induction of antigen-specific T cells is hindered. While many methods exist to monitor the activity of LCs in vitro, the migration and induction of cytotoxic T cells is ultimately indicative of a functional immune response. Here, methods in analyzing functional migration and induction of antigen-specific T cells after stimulation of LCs with HPV virus-like particles in vitro are described.
CSIR Research Space (South Africa)
De Wet, H
2009-07-20
Full Text Available The cytotoxicity of crude alkaloid extracts obtained from the leaves and rhizomes of all the South African members of the family Menispermaceae (seven genera and 13 species) was tested against MCF7 (breast), UACC62 (melanoma) and TK10 (renal) cancer...
Lázaro-Díez, María; Navascués-Lejarza, Teresa; Remuzgo-Martínez, Sara; Navas, Jesús; Icardo, José Manuel; Acosta, Felix; Martínez-Martínez, Luis; Ramos-Vivas, José
2016-09-01
The molecular and genetic basis of Acinetobacter baumannii and Acinetobacter pittii virulence remains poorly understood, and there is still lack of knowledge in host cell response to these bacteria. In this study, we have used eleven clinical Acinetobacter strains (A. baumannii n = 5; A. pittii n = 6) to unravel bacterial adherence, invasion and cytotoxicity to human lung epithelial cells. Our results showed that adherence to epithelial cells by Acinetobacter strains is scarce and cellular invasion was not truly detected. In addition, all Acinetobacter strains failed to induce any cytotoxic effect on A549 cells. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.