Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

Directory of Open Access Journals (Sweden)

Rosa Lozano-Durán

2013-03-01

Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

Science.gov (United States)

Kant, Ravi; Dasgupta, Indranil

2017-07-01

Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

Science.gov (United States)

A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

NARCIS (Netherlands)

Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

2016-01-01

Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

Science.gov (United States)

Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

2018-02-01

Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

Science.gov (United States)

Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

2014-04-20

A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

Science.gov (United States)

Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

2015-06-01

Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

Science.gov (United States)

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

KAUST Repository

Idris, Ali

2010-12-01

A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

Directory of Open Access Journals (Sweden)

Huijuan Zhang

2016-08-01

Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

Directory of Open Access Journals (Sweden)

Barik Sailen

2001-12-01

Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth.

Science.gov (United States)

Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien

2017-07-01

The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

NARCIS (Netherlands)

Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

2013-01-01

As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

Science.gov (United States)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

Identification of Proteins Using iTRAQ and Virus-Induced Gene Silencing Reveals Three Bread Wheat Proteins Involved in the Response to Combined Osmotic-Cold Stress.

Science.gov (United States)

Zhang, Ning; Zhang, Lingran; Shi, Chaonan; Zhao, Lei; Cui, Dangqun; Chen, Feng

2018-05-25

Crops are often subjected to a combination of stresses in the field. To date, studies on the physiological and molecular responses of common wheat to a combination of osmotic and cold stresses, however, remain unknown. In this study, wheat seedlings exposed to osmotic-cold stress for 24 h showed inhibited growth, as well as increased lipid peroxidation, relative electrolyte leakage, and soluble sugar contents. iTRAQ-based quantitative proteome method was employed to determine the proteomic profiles of the roots and leaves of wheat seedlings exposed to osmotic-cold stress conditions. A total of 250 and 258 proteins with significantly altered abundance in the roots and leaves were identified, respectively, and the majority of these proteins displayed differential abundance, thereby revealing organ-specific differences in adaptation to osmotic-cold stress. Yeast two hybrid assay examined five pairs of stress/defense-related protein-protein interactions in the predicted protein interaction network. Furthermore, quantitative real-time PCR analysis indicated that abiotic stresses increased the expression of three candidate protein genes, i.e., TaGRP2, CDCP, and Wcor410c in wheat leaves. Virus-induced gene silencing indicated that three genes TaGRP2, CDCP, and Wcor410c were involved in modulating osmotic-cold stress in common wheat. Our study provides useful information for the elucidation of molecular and genetics bases of osmotic-cold combined stress in bread wheat.

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

Directory of Open Access Journals (Sweden)

Bianco Linda

2009-11-01

Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

DEFF Research Database (Denmark)

Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

2010-01-01

, the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

Science.gov (United States)

Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

2017-08-01

This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

Directory of Open Access Journals (Sweden)

Lehto Kirsi

2011-04-01

Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

Science.gov (United States)

Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

2018-06-01

Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

Directory of Open Access Journals (Sweden)

Huai-Juan Xiao

2014-05-01

Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.

Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

Science.gov (United States)

Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

2014-01-01

Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

Science.gov (United States)

Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

2007-11-01

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

Directory of Open Access Journals (Sweden)

Ida Bagus Andika

2016-09-01

Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

Directory of Open Access Journals (Sweden)

Sheng-Rui Liu

2017-09-01

Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

Directory of Open Access Journals (Sweden)

Yan Liang

2013-11-01

Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

Science.gov (United States)

Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

2015-01-01

Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

Directory of Open Access Journals (Sweden)

Mueller Nancy

2005-10-01

Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.

Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

Science.gov (United States)

Lou, Yonggen; Baldwin, Ian T.

2006-01-01

Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

Directory of Open Access Journals (Sweden)

Ruilin Wang

Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

Science.gov (United States)

Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

2015-07-28

West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

Science.gov (United States)

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

Directory of Open Access Journals (Sweden)

Shirley Lam

Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

Plum pox virus (PPV) genome expression in genetically engineered RNAi plants

Science.gov (United States)

An important approach to controlling sharka disease caused by Plum pox virus (PPV) is the development of PPV resistant plants using small interfering RNAs (siRNA) technology. In order to evaluate siRNA induced gene silencing, we studied, based on knowledge of the PPV genome sequence, virus genome t...

Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

Directory of Open Access Journals (Sweden)

Li Xiao Hui

2015-09-01

Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

Science.gov (United States)

Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

2012-07-01

HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

The Ebola virus VP35 protein is a suppressor of RNA silencing.

Directory of Open Access Journals (Sweden)

Joost Haasnoot

2007-06-01

Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

Directory of Open Access Journals (Sweden)

Arase Sachiko

2012-03-01

Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

International Nuclear Information System (INIS)

Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

2010-01-01

Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

Directory of Open Access Journals (Sweden)

Jinlong Guo

2015-01-01

Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

Directory of Open Access Journals (Sweden)

Laura Mejía-Teniente

2015-11-01

Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

Science.gov (United States)

Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

2015-11-25

Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

Stunned Silence: Gene Expression Programs in Human Cells Infected with Monkeypox or Vaccinia Virus

Science.gov (United States)

Rubins, Kathleen H.; Hensley, Lisa E.; Relman, David A.; Brown, Patrick O.

2011-01-01

Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV), an emerging human pathogen, and Vaccinia virus (VAC), a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated) MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA), or poly (I-C) was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C) induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection. PMID:21267444

Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

Science.gov (United States)

Podsakoff, G; Wong, K K; Chatterjee, S

1994-09-01

Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

Directory of Open Access Journals (Sweden)

Kathleen H Rubins

2011-01-01

Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

Comparative analysis of virus-derived small RNAs within cassava (Manihot esculenta Crantz) infected with cassava brown streak viruses.

Science.gov (United States)

Ogwok, Emmanuel; Ilyas, Muhammad; Alicai, Titus; Rey, Marie E C; Taylor, Nigel J

2016-04-02

Infection of plant cells by viral pathogens triggers RNA silencing, an innate antiviral defense mechanism. In response to infection, small RNAs (sRNAs) are produced that associate with Argonaute (AGO)-containing silencing complexes which act to inactivate viral genomes by posttranscriptional gene silencing (PTGS). Deep sequencing was used to compare virus-derived small RNAs (vsRNAs) in cassava genotypes NASE 3, TME 204 and 60444 infected with the positive sense single-stranded RNA (+ssRNA) viruses cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV), the causal agents of cassava brown streak disease (CBSD). An abundance of 21-24nt vsRNAs was detected and mapped, covering the entire CBSV and UCBSV genomes. The 21nt vsRNAs were most predominant, followed by the 22 nt class with a slight bias toward sense compared to antisense polarity, and a bias for adenine and uracil bases present at the 5'-terminus. Distribution and frequency of vsRNAs differed between cassava genotypes and viral genomes. In susceptible genotypes TME 204 and 60444, CBSV-derived sRNAs were seen in greater abundance than UCBSV-derived sRNAs. NASE 3, known to be resistant to UCBSV, accumulated negligible UCBSV-derived sRNAs but high populations of CBSV-derived sRNAs. Transcript levels of cassava homologues of AGO2, DCL2 and DCL4, which are central to the gene-silencing complex, were found to be differentially regulated in CBSV- and UCBSV-infected plants across genotypes, suggesting these proteins play a role in antiviral defense. Irrespective of genotype or viral pathogen, maximum populations of vsRNAs mapped to the cytoplasmic inclusion, P1 and P3 protein-encoding regions. Our results indicate disparity between CBSV and UCBSV host-virus interaction mechanisms, and provide insight into the role of virus-induced gene silencing as a mechanism of resistance to CBSD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

Science.gov (United States)

Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

2012-10-05

The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

Directory of Open Access Journals (Sweden)

Caroline Claude

Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

Science.gov (United States)

Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

2013-05-01

The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

Differential RNAi responses of Nicotiana benthamiana individuals transformed with a hairpin-inducing construct during Plum pox virus challenge.

Science.gov (United States)

Montes, Christian; Castro, Álvaro; Barba, Paola; Rubio, Julia; Sánchez, Evelyn; Carvajal, Denisse; Aguirre, Carlos; Tapia, Eduardo; DelÍ Orto, Paola; Decroocq, Veronique; Prieto, Humberto

2014-10-01

Gene silencing and large-scale small RNA analysis can be used to develop RNA interference (RNAi)-based resistance strategies for Plum pox virus (PPV), a high impact disease of Prunus spp. In this study, a pPPViRNA hairpin-inducing vector harboring two silencing motif-rich regions of the PPV coat protein (CP) gene was evaluated in transgenic Nicotiana benthamiana (NB) plants. Wild-type NB plants infected with a chimeric PPV virus (PPV::GFP) exhibited affected leaves with mosaic chlorosis congruent to GFP fluorescence at 21 day post-inoculation; transgenic lines depicted a range of phenotypes from fully resistant to susceptible. ELISA values and GFP fluorescence intensities were used to select transgenic-resistant (TG-R) and transgenic-susceptible (TG-S) lines for further characterization of small interfering RNAs (siRNAs) by large-scale small RNA sequencing. In infected TG-S and untransformed (WT) plants, the observed siRNAs were nearly exclusively 21- and 22-nt siRNAs that targeted the whole PPV::GFP genome; 24-nt siRNAs were absent in these individuals. Challenged TG-R plants accumulated a full set of 21- to 24-nt siRNAs that were primarily associated with the selected motif-rich regions, indicating that a trans-acting siRNAs process prevented viral multiplication. BLAST analysis identified 13 common siRNA clusters targeting the CP gene. 21-nt siRNA sequences were associated with the 22-nt siRNAs and the scarce 23- and 24-nt molecules in TG-S plants and with most of the observed 22-, 23-, and 24-nt siRNAs in TG-R individuals. These results validate the use of a multi-hot spot silencing vector against PPV and elucidate the molecules by which hairpin-inducing vectors initiate RNAi in vivo.

Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

OpenAIRE

Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

2009-01-01

Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

OpenAIRE

Podsakoff, G; Wong, K K; Chatterjee, S

1994-01-01

Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthe...

Virus-induced plasma membrane aquaporin PsPIP2;1 silencing inhibits plant water transport of Pisum sativum.

Science.gov (United States)

Song, Juanjuan; Ye, Guoliang; Qian, Zhengjiang; Ye, Qing

2016-12-01

Aquaporins (AQPs) are known to facilitate water transport across cell membranes, but the role of a single AQP in regulating plant water transport, particularly in plants other than Arabidopsis remains largely unexplored. In the present study, a virus-induced gene silencing (VIGS) technique was employed to suppress the expression of a specific plasma membrane aquaporin PsPIP2;1 of Pea plants (Pisum sativum), and subsequent effects of the gene suppression on root hydraulic conductivity (Lp r ), leaf hydraulic conductivity (K leaf ), root cell hydraulic conductivity (Lp rc ), and leaf cell hydraulic conductivity (Lp lc ) were investigated, using hydroponically grown Pea plants. Compared with control plants, VIGS-PsPIP2;1 plants displayed a significant suppression of PsPIP2;1 in both roots and leaves, while the expression of other four PIP isoforms (PsPIP1;1, PsPIP1;2, PsPIP2;2, and PsPIP2;3) that were simultaneously monitored were not altered. As a consequence, significant declines in water transport of VIGS-PsPIP2;1 plants were observed at both organ and cell levels, i.e., as compared to control plants, Lp r and K leaf were reduced by 29 %, and Lp rc and Lp lc were reduced by 20 and 29 %, respectively. Our results demonstrate that PsPIP2;1 alone contributes substantially to root and leaf water transport in Pea plants, and highlight VIGS a useful tool for investigating the role of a single AQP in regulating plant water transport.

Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.

Science.gov (United States)

Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee

2017-12-01

Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

Directory of Open Access Journals (Sweden)

Howard Amanda

2005-03-01

Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

A stable RNA virus-based vector for citrus trees

International Nuclear Information System (INIS)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe; Dawson, William O.

2007-01-01

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter. These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

International Nuclear Information System (INIS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

2015-01-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

A DUF-246 family glycosyltransferase-like gene affects male fertility and the biosynthesis of pectic arabinogalactans

DEFF Research Database (Denmark)

Stonebloom, Solomon; Ebert, Berit; Xiong, Guangyan

2016-01-01

rates of pollen tube formation in pollen from pagr heterozygotes. To characterize a loss-of-function phenotype for PAGR, the Nicotiana benthamiana orthologs, NbPAGR-A and B, were transiently silenced using Virus Induced Gene Silencing. NbPAGR-silenced plants exhibited reduced internode and petiole...

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

An intronic microRNA silences genes that are functionally antagonistic to its host gene.

Science.gov (United States)

Barik, Sailen

2008-09-01

MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

Directory of Open Access Journals (Sweden)

Neeraj K. Dubey

2017-09-01

Full Text Available RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp. are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma: transient expression using Tobacco rattle virus (TRV:pma as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill. plants harboring a hairpin construct (pBINPLUS35:pma. siRNA-mediated transgene-silencing (20–24 nt was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes.

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing

2010-05-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

STAT6 silencing induces hepatocellular carcinoma-derived cell apoptosis and growth inhibition by decreasing the RANKL expression.

Science.gov (United States)

Qing, Tian; Yamin, Zhang; Guijie, Wang; Yan, Jin; Zhongyang, Shen

2017-08-01

Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC) patients. The objective of this study was to investigate the effects and mechanism of STAT6 in human HCC cells. We found that STAT6 silencing significantly inhibited HepG2 and Hep3B cell survival and proliferation. We observed that depletion of STAT6 increased HepG2 and Hep3B cell apoptosis by using a histone DNA ELISA detection kit. STAT6 silencing induced expression of apoptosis-associated genes Bax and caspase-3/7 and inhibited anti-apoptosis gene Bcl-2 levels. We also observed that STAT6 silencing downregulated the expression of receptor activator of NF-κB ligand (RANKL). Our results demonstrated that treatment with pcDNA3.1-RANKL abolished STAT6 depletion-induced HepG2 and Hep3B cell apoptosis and growth inhibition. Based on these findings, we believe that RANKL plays a major role in STAT6-induced HCC cell apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis

DEFF Research Database (Denmark)

Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette

2004-01-01

elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...

Flexible tools for gene expression and silencing in tomato.

Science.gov (United States)

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

Science.gov (United States)

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

DEFF Research Database (Denmark)

Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

2016-01-01

repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

International Nuclear Information System (INIS)

Verma, Saguna; Ziegler, Katja; Ananthula, Praveen; Co, Juliene K.G.; Frisque, Richard J.; Yanagihara, Richard; Nerurkar, Vivek R.

2006-01-01

Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarray technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML

Comparative Analysis of RNAi-Based Methods to Down-Regulate Expression of Two Genes Expressed at Different Levels in Myzus persicae

Directory of Open Access Journals (Sweden)

Michaël Mulot

2016-11-01

Full Text Available With the increasing availability of aphid genomic data, it is necessary to develop robust functional validation methods to evaluate the role of specific aphid genes. This work represents the first study in which five different techniques, all based on RNA interference and on oral acquisition of double-stranded RNA (dsRNA, were developed to silence two genes, ALY and Eph, potentially involved in polerovirus transmission by aphids. Efficient silencing of only Eph transcripts, which are less abundant than those of ALY, could be achieved by feeding aphids on transgenic Arabidopsis thaliana expressing an RNA hairpin targeting Eph, on Nicotiana benthamiana infected with a Tobacco rattle virus (TRV-Eph recombinant virus, or on in vitro-synthesized Eph-targeting dsRNA. These experiments showed that the silencing efficiency may differ greatly between genes and that aphid gut cells seem to be preferentially affected by the silencing mechanism after oral acquisition of dsRNA. In addition, the use of plants infected with recombinant TRV proved to be a promising technique to silence aphid genes as it does not require plant transformation. This work highlights the need to pursue development of innovative strategies to reproducibly achieve reduction of expression of aphid genes.

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

Virus-induced down-regulation of GmERA1A and GmERA1B genes enhances the stomatal response to abscisic acid and drought resistance in soybean.

Directory of Open Access Journals (Sweden)

Takuya Ogata

Full Text Available Drought is a major threat to global soybean production. The limited transformation potential and polyploid nature of soybean have hindered functional analysis of soybean genes. Previous research has implicated farnesylation in the plant's response to abscisic acid (ABA and drought tolerance. We therefore used virus-induced gene silencing (VIGS to evaluate farnesyltransferase genes, GmERA1A and GmERA1B (Glycine max Enhanced Response to ABA1-A and -B, as potential targets for increasing drought resistance in soybean. Apple latent spherical virus (ALSV-mediated GmERA1-down-regulated soybean leaves displayed an enhanced stomatal response to ABA and reduced water loss and wilting under dehydration conditions, suggesting that GmERA1A and GmERA1B negatively regulate ABA signaling in soybean guard cells. The findings provide evidence that the ALSV-VIGS system, which bypasses the need to generate transgenic plants, is a useful tool for analyzing gene function using only a single down-regulated leaf. Thus, the ALSV-VIGS system could constitute part of a next-generation molecular breeding pipeline to accelerate drought resistance breeding in soybean.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

Science.gov (United States)

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

Science.gov (United States)

Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

2007-09-18

Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

A Virus-Induced Assay for Functional Dissection and Analysis of Monocot and Dicot Flowering Time Genes.

Science.gov (United States)

Qin, Cheng; Chen, Weiwei; Shen, Jiajia; Cheng, Linming; Akande, Femi; Zhang, Ke; Yuan, Chen; Li, Chunyang; Zhang, Pengcheng; Shi, Nongnong; Cheng, Qi; Liu, Yule; Jackson, Stephen; Hong, Yiguo

2017-06-01

Virus-induced flowering (VIF) uses virus vectors to express Flowering Locus T ( FT ) to induce flowering in plants. This approach has recently attracted wide interest for its practical applications in accelerating breeding in crops and woody fruit trees. However, the insight into VIF and its potential as a powerful tool for dissecting florigenic proteins remained to be elucidated. Here, we describe the mechanism and further applications of Potato virus X (PVX)-based VIF in the short-day Nicotiana tabacum cultivar Maryland Mammoth. Ectopic delivery of Arabidopsis ( Arabidopsis thaliana ) AtFT by PVX/AtFT did not induce the expression of the endogenous FT ortholog NtFT4 ; however, it was sufficient to trigger flowering in Maryland Mammoth plants grown under noninductive long-day conditions. Infected tobacco plants developed no systemic symptoms, and the PVX-based VIF did not cause transgenerational flowering. We showed that the PVX-based VIF is a much more rapid method to examine the impacts of single amino acid mutations on AtFT for floral induction than making individual transgenic Arabidopsis lines for each mutation. We also used the PVX-based VIF to demonstrate that adding a His- or FLAG-tag to the N or C terminus of AtFT could affect its florigenic activity and that this system can be applied to assay the function of FT genes from heterologous species, including tomato ( Solanum lycopersicum ) SFT and rice ( Oryza sativa ) Hd3a Thus, the PVX-based VIF represents a simple and efficient system to identify individual amino acids that are essential for FT-mediated floral induction and to test the ability of mono- and dicotyledonous FT genes and FT fusion proteins to induce flowering. © 2017 American Society of Plant Biologists. All Rights Reserved.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

Science.gov (United States)

Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

2015-06-01

Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Epigenetic silencing of apoptosis-inducing gene expression can be efficiently overcome by combined SAHA and TRAIL treatment in uterine sarcoma cells.

Directory of Open Access Journals (Sweden)

Leopold F Fröhlich

Full Text Available The lack of knowledge about molecular pathology of uterine sarcomas with a representation of 3-7% of all malignant uterine tumors prevents the establishment of effective therapy protocols. Here, we explored advanced therapeutic options to the previously discovered antitumorigenic effects of the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA by combined treatment with the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL/Apo-2L. In addition, we investigated the uterine sarcoma cell lines, MES-SA and ESS-1, regarding the underlying molecular mechanisms of SAHA and TRAIL-induced apoptosis and their resistance towards TRAIL. Compared to single SAHA or TRAIL treatment, the combination of SAHA with TRAIL led to complete cell death of both tumor cell lines after 24 to 48 hours. In contrast to single SAHA treatment, apoptosis occured faster and was more pronounced in ESS-1 cells than in MES-SA cells. Induction of SAHA- and TRAIL-induced apoptosis was accompanied by upregulation of the intrinsic apoptotic pathway via reduction of mitochondrial membrane potential, caspase-3, -6, and -7 activation, and PARP cleavage, but was also found to be partially caspase-independent. Apoptosis resistance was caused by reduced expression of caspase-8 and DR 4/TRAIL-R1 in ESS-1 and MES-SA cells, respectively, due to epigenetic silencing by DNA hypermethylation of gene promoter sequences. Treatment with the demethylating agent 5-Aza-2'-deoxycytidine or gene transfer therefore restored gene expression and increased the sensitivity of both cell lines against TRAIL-induced apoptosis. Our data provide evidence that deregulation of epigenetic silencing by histone acetylation and DNA hypermethylation might play a fundamental role in the origin of uterine sarcomas. Therefore, tumor growth might be efficiently overcome by a cytotoxic combinatorial treatment of HDAC inhibitors with TRAIL.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

2010-01-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian

2010-07-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

Science.gov (United States)

Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

2015-10-01

Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

Science.gov (United States)

Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

2014-10-01

Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

Small molecule antagonism of oxysterol-induced Epstein-Barr virus induced gene 2 (EBI2) activation

DEFF Research Database (Denmark)

Benned-Jensen, Tau; Madsen, Christian M; Arfelt, Kristine N

2013-01-01

The Epstein-Barr virus induced gene 2 (EBI2) was recently identified as the first oxysterol-activated 7TM receptor. EBI2 is essential for B cell trafficking within lymphoid tissues and thus the humoral immune response in general. Here we characterize the antagonism of the non-peptide molecule GSK...

Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco.

Science.gov (United States)

Baek, Eseul; Yoon, Ju-Yeon; Palukaitis, Peter

2017-10-01

To facilitate quantification of gene expression changes in virus-infected tobacco plants, eight housekeeping genes were evaluated for their stability of expression during infection by one of three systemically-infecting viruses (cucumber mosaic virus, potato virus X, potato virus Y) or a hypersensitive-response-inducing virus (tobacco mosaic virus; TMV) limited to the inoculated leaf. Five reference-gene validation programs were used to establish the order of the most stable genes for the systemically-infecting viruses as ribosomal protein L25 > β-Tubulin > Actin, and the least stable genes Ubiquitin-conjugating enzyme (UCE) genes were EF1α > Cysteine protease > Actin, and the least stable genes were GAPDH genes, three defense responsive genes were examined to compare their relative changes in gene expression caused by each virus. Copyright © 2017 Elsevier Inc. All rights reserved.

GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

Directory of Open Access Journals (Sweden)

Guillaume Jannot

2016-12-01

Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

Directory of Open Access Journals (Sweden)

Lim Chee Liew

Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

Science.gov (United States)

Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

2017-11-24

To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

Science.gov (United States)

Bazot, Quentin; Paschos, Kostas; Allday, Martin J

2018-04-01

Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

Characterization of the env gene and long terminal repeat of molecularly cloned Friend mink cell focus-inducing virus DNA.

OpenAIRE

Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A

1984-01-01

The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...

Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

Directory of Open Access Journals (Sweden)

Sirjana Devi Shrestha

Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

Science.gov (United States)

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Hepatitis B virus DNA polymerase gene polymorphism based ...

African Journals Online (AJOL)

Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

The Cucumber vein yellowing virus silencing suppressor P1b can functionally replace HCPro in Plum pox virus infection in a host-specific manner.

Science.gov (United States)

Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian

2012-02-01

Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.

IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes.

Science.gov (United States)

Xu, Lei; Zhou, Xinying; Wang, Wenshi; Wang, Yijin; Yin, Yuebang; Laan, Luc J W van der; Sprengers, Dave; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

2016-10-01

IFN regulatory factor 1 (IRF1) is one of the most important IFN-stimulated genes (ISGs) in cellular antiviral immunity. Although hepatitis E virus (HEV) is a leading cause of acute hepatitis worldwide, how ISGs counteract HEV infection is largely unknown. This study was conducted to investigate the effect of IRF1 on HEV replication. Multiple cell lines were used in 2 models that harbor HEV. In different HEV cell culture systems, IRF1 effectively inhibited HEV replication. IRF1 did not trigger IFN production, and chromatin immunoprecipitation sequencing data analysis revealed that IRF1 bound to the promoter region of signal transducers and activators of transcription 1 (STAT1). Functional assay confirmed that IRF1 could drive the transcription of STAT1, resulting in elevation of total and phosphorylated STAT1 proteins and further activating the transcription of a panel of downstream antiviral ISGs. By pharmacological inhibitors and RNAi-mediated gene-silencing approaches, we revealed that antiviral function of IRF1 is dependent on the JAK-STAT cascade. Furthermore, induction of ISGs and the anti-HEV effect of IRF1 overlapped that of IFNα, but was potentiated by ribavirin. We demonstrated that IRF1 effectively inhibits HEV replication through the activation of the JAK-STAT pathway, and the subsequent transcription of antiviral ISGs, but independent of IFN production.-Xu, L., Zhou, X., Wang, W., Wang, Y., Yin, Y., van der Laan, L. J. W., Sprengers, D., Metselaar, H. J., Peppelenbosch, M. P., Pan, Q. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes. © FASEB.

Identification of a maize chlorotic dwarf virus silencing suppressor protein

Science.gov (United States)

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

Poly(ADP-ribose) polymerase inhibitors suppress UV-induced human immunodeficiency virus type 1 gene expression at the posttranscriptional level

International Nuclear Information System (INIS)

Yamagoe, S.; Kohda, T.; Oishi, M.

1991-01-01

Gene expression of human immunodeficiency virus type 1 (HIV-1) is induced not only by trans activation mediated through a gene product (tat) encoded by the virus but also by treatment of virus-carrying cells with DNA-damaging agents such as UV light. Employing an artificially constructed DNA in which the chloramphenicol acetyltransferase gene was placed under the control of the HIV-1 long terminal repeat, we analyzed the induction process in HeLa cells and found that inhibitors of poly(ADP-ribose) polymerase suppressed UV-induced HIV-1 gene expression but not tat-mediated expression. We also found that suppression occurs at the posttranscriptional level. These results indicate that HIV-1 gene expression is activated by at least two different mechanisms, one of which involves poly-ADP ribosylation. A possible new role of poly-ADP ribosylation in the regulation of specific gene expression is also discussed

Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

Science.gov (United States)

Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

2018-05-01

Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

DEFF Research Database (Denmark)

Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil

2010-01-01

-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...

Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

NARCIS (Netherlands)

Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

2001-01-01

Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

Science.gov (United States)

Baril, Martin; Es-Saad, Salwa; Chatel-Chaix, Laurent; Fink, Karin; Pham, Tram; Raymond, Valérie-Ann; Audette, Karine; Guenier, Anne-Sophie; Duchaine, Jean; Servant, Marc; Bilodeau, Marc; Cohen, Eric; Grandvaux, Nathalie; Lamarre, Daniel

2013-01-01

To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1) promoter following Sendai virus (SeV) infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR)-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1) upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3) inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

Directory of Open Access Journals (Sweden)

Martin Baril

Full Text Available To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1 promoter following Sendai virus (SeV infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I-like receptor (RLR-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1 upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3 inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

An Ultrasensitive Mechanism Regulates Influenza Virus-Induced Inflammation.

Directory of Open Access Journals (Sweden)

Jason E Shoemaker

2015-06-01

Full Text Available Influenza viruses present major challenges to public health, evident by the 2009 influenza pandemic. Highly pathogenic influenza virus infections generally coincide with early, high levels of inflammatory cytokines that some studies have suggested may be regulated in a strain-dependent manner. However, a comprehensive characterization of the complex dynamics of the inflammatory response induced by virulent influenza strains is lacking. Here, we applied gene co-expression and nonlinear regression analysis to time-course, microarray data developed from influenza-infected mouse lung to create mathematical models of the host inflammatory response. We found that the dynamics of inflammation-associated gene expression are regulated by an ultrasensitive-like mechanism in which low levels of virus induce minimal gene expression but expression is strongly induced once a threshold virus titer is exceeded. Cytokine assays confirmed that the production of several key inflammatory cytokines, such as interleukin 6 and monocyte chemotactic protein 1, exhibit ultrasensitive behavior. A systematic exploration of the pathways regulating the inflammatory-associated gene response suggests that the molecular origins of this ultrasensitive response mechanism lie within the branch of the Toll-like receptor pathway that regulates STAT1 phosphorylation. This study provides the first evidence of an ultrasensitive mechanism regulating influenza virus-induced inflammation in whole lungs and provides insight into how different virus strains can induce distinct temporal inflammation response profiles. The approach developed here should facilitate the construction of gene regulatory models of other infectious diseases.

Developing an Alternanthera mosaic virus vector for efficient clonging of Whitefly cDNA RNAi to screen gene function

Science.gov (United States)

Alternanthera mosaic virus (AltMV; genus Potexvirus) is distinguished from the type member of the genus, Potato virus X by features of viral movement and variation within triple gene block protein 1 (TGB1). AltMV TGB1 variants TGB1L88 and TGB1P88 confer strong and weak silencing suppression, respect...

Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

Directory of Open Access Journals (Sweden)

Zhimin Zheng

2015-05-01

Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

Flowering Without Vernalization in Winter Canola (Brassica napus: use of Virus-Induced Gene Silencing (VIGS to accelerate genetic gain

Directory of Open Access Journals (Sweden)

Raúl Álvarez-Venegas

2010-01-01

Full Text Available Ciclos de reproducción cortos y la oportunidad de incrementar la ganancia genética, junto con el estudio de las bases moleculares de la vernalización, son áreas esenciales de investigación dentro de la biología de plantas. Varios métodos se han empleado para lograr el silenciamiento génico en plantas, pero ninguno reportado a la fecha para canola (Brassica napus, y en particular para inducir la floración sin vernalización en líneas de invierno a través del uso de secuencias sentido de DNA en vectores diseñados para el silenciamiento génico inducido por virus (VIGS. La presente investigación provee los métodos para transitoriamente regular a la baja, por medio de VIGS, genes de la vernalización en plantas anuales de invierno, específicamente la familia de genes de Flowering Locus C (FLC en canola de invierno (BnFLC1 a BnFLC5. La regulación a la baja de estos genes permite a las plantas anuales de invierno florecer sin vernalización y, consecuentemente, provee los medios para acelerar la ganancia genética. El sistema de silenciamiento propuesto puede ser utilizado para regular a la baja familias de genes, para determinar la función génica, y para inducir la floración sin la vernalización en líneas de invierno tanto del género Brassica como de muchos cultivos importantes de invierno.

Robust RNA silencing-mediated resistance to Plum pox virus under variable abiotic and biotic conditions.

Science.gov (United States)

Di Nicola, Elisa; Tavazza, Mario; Lucioli, Alessandra; Salandri, Laura; Ilardi, Vincenza

2014-10-01

Some abiotic and biotic conditions are known to have a negative impact on post-transcriptional gene silencing (PTGS), thus representing a potential concern for the production of stable engineered virus resistance traits. However, depending on the strategy followed to achieve PTGS of the transgene, different responses to external conditions can be expected. In the present study, we utilized the Nicotiana benthamiana–Plum pox virus (PPV) pathosystem to evaluate in detail the stability of intron-hairpin(ihp)-mediated virus resistance under conditions known to adversely affect PTGS. The ihp plants grown at low or high temperatures were fully resistant to multiple PPV challenges, different PPV inoculum concentrations and even to a PPV isolate differing from the ihp construct by more than 28% at the nucleotide level. In addition, infections of ihp plants with viruses belonging to Cucumovirus, Potyvirus or Tombusvirus, all known to affect PTGS at different steps, were not able to defeat PPV resistance. Low temperatures did not affect the accumulation of transgenic small interfering RNAs (siRNAs), whereas a clear increase in the amount of siRNAs was observed during infections sustained by Cucumber mosaic virus and Potato virus Y. Our results show that the above stress factors do not represent an important concern for the production,through ihp-PTGS technology, of transgenic plants having robust virus resistance traits.

Social isolation stress induces ATF-7 phosphorylation and impairs silencing of the 5-HT 5B receptor gene

Science.gov (United States)

Maekawa, Toshio; Kim, Seungjoon; Nakai, Daisuke; Makino, Chieko; Takagi, Tsuyoshi; Ogura, Hiroo; Yamada, Kazuyuki; Chatton, Bruno; Ishii, Shunsuke

2010-01-01

Many symptoms induced by isolation rearing of rodents may be relevant to neuropsychiatric disorders, including depression. However, identities of transcription factors that regulate gene expression in response to chronic social isolation stress remain elusive. The transcription factor ATF-7 is structurally related to ATF-2, which is activated by various stresses, including inflammatory cytokines. Here, we report that Atf-7-deficient mice exhibit abnormal behaviours and increased 5-HT receptor 5B (Htr5b) mRNA levels in the dorsal raphe nuclei. ATF-7 silences the transcription of Htr5B by directly binding to its 5′-regulatory region, and mediates histone H3-K9 trimethylation via interaction with the ESET histone methyltransferase. Isolation-reared wild-type (WT) mice exhibit abnormal behaviours that resemble those of Atf-7-deficient mice. Upon social isolation stress, ATF-7 in the dorsal raphe nucleus is phosphorylated via p38 and is released from the Htr5b promoter, leading to the upregulation of Htr5b. Thus, ATF-7 may have a critical role in gene expression induced by social isolation stress. PMID:19893493

Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

Science.gov (United States)

Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

2006-10-01

Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

Novel system uses probasin-based promoter, transcriptional silencers and amplification loop to induce high-level prostate expression

Directory of Open Access Journals (Sweden)

Yu Hong

2007-02-01

Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.

Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections.

Science.gov (United States)

Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung

2018-05-01

The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Directory of Open Access Journals (Sweden)

Jiangyu Wu

2013-01-01

Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Science.gov (United States)

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Concurrent epigenetic silencing of wnt/β-catenin pathway inhibitor genes in B cell chronic lymphocytic leukaemia

International Nuclear Information System (INIS)

Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B

2012-01-01

The Wnt/β-catenin signalling is aberrantly activated in primary B cell chronic lymphocytic leukaemia (CLL). Epigenetic silencing of pathway inhibitor genes may be a mechanism for its activation. In this study, we investigated systematically and quantitatively the methylation status of 12 Wnt/β-catenin pathway inhibitor genes – CDH1, DACT1, DKK1, DKK2, DKK3, DKK4, SFRP1, SFRP2, SFRP3, SFRP4, SFRP5 and WIF1 – in the cell lines EHEB and MEC-1 as well as patient samples. Quantification of DNA methylation was performed by means of bisulphite pyrosequencing and confirmed by bisulphite Sanger sequencing. Gene expression was analysed by qPCR using GAPDH as internal control. E-cadherin and β-catenin protein quantification was carried out by microsphere-based immunoassays. Methylation differences observed between the patient and control groups were tested using generalised least squares models. For 10 genes, a higher methylation level was observed in tumour material. Only DKK4 exhibited similarly high methylation levels in both tumour and normal specimens, while DACT1 was always essentially unmethylated. However, also for these inhibitors, treatment of cells with the demethylating agent 5-aza-2´-deoxycytidine resulted in an induction of their expression, as shown by quantitative PCR, suggesting an indirect epigenetic control of activity. While the degree of demethylation and its transcriptional consequences differed between the genes, there was an overall high correlation of demethylation and increased activity. Protein expression studies revealed that no constitutive Wnt/β-catenin signalling occurred in the cell lines, which is in discrepancy with results from primary CLL. However, treatment with 5-aza-2´-deoxycytidine caused accumulation of β-catenin. Simultaneously, E-cadherin expression was strongly induced, leading to the formation of a complex with β-catenin and thus demonstrating its epigenetically regulated inhibition effect. The results suggest an

Infection-Induced Retrotransposon-Derived Noncoding RNAs Enhance Herpesviral Gene Expression via the NF-κB Pathway.

Directory of Open Access Journals (Sweden)

John Karijolich

Full Text Available Short interspersed nuclear elements (SINEs are highly abundant, RNA polymerase III-transcribed noncoding retrotransposons that are silenced in somatic cells but activated during certain stresses including viral infection. How these induced SINE RNAs impact the host-pathogen interaction is unknown. Here we reveal that during murine gammaherpesvirus 68 (MHV68 infection, rapidly induced SINE RNAs activate the antiviral NF-κB signaling pathway through both mitochondrial antiviral-signaling protein (MAVS-dependent and independent mechanisms. However, SINE RNA-based signaling is hijacked by the virus to enhance viral gene expression and replication. B2 RNA expression stimulates IKKβ-dependent phosphorylation of the major viral lytic cycle transactivator protein RTA, thereby enhancing its activity and increasing progeny virion production. Collectively, these findings suggest that SINE RNAs participate in the innate pathogen response mechanism, but that herpesviruses have evolved to co-opt retrotransposon activation for viral benefit.

Complete suppression of viral gene expression is associated with the onset and progression of lymphoid malignancy: observations in Bovine Leukemia Virus-infected sheep

Directory of Open Access Journals (Sweden)

Burny Arsène

2007-07-01

Full Text Available Abstract Background During malignant progression, tumor cells need to acquire novel characteristics that lead to uncontrolled growth and reduced immunogenicity. In the Bovine Leukemia Virus-induced ovine leukemia model, silencing of viral gene expression has been proposed as a mechanism leading to immune evasion. However, whether proviral expression in tumors is completely suppressed in vivo was not conclusively demonstrated. Therefore, we studied viral expression in two selected experimentally-infected sheep, the virus or the disease of which had features that made it possible to distinguish tumor cells from their nontransformed counterparts. Results In the first animal, we observed the emergence of a genetically modified provirus simultaneously with leukemia onset. We found a Tax-mutated (TaxK303 replication-deficient provirus in the malignant B-cell clone while functional provirus (TaxE303 had been consistently monitored over the 17-month aleukemic period. In the second case, both non-transformed and transformed BLV-infected cells were present at the same time, but at distinct sites. While there was potentially-active provirus in the non-leukemic blood B-cell population, as demonstrated by ex-vivo culture and injection into naïve sheep, virus expression was completely suppressed in the malignant B-cells isolated from the lymphoid tumors despite the absence of genetic alterations in the proviral genome. These observations suggest that silencing of viral genes, including the oncoprotein Tax, is associated with tumor onset. Conclusion Our findings suggest that silencing is critical for tumor progression and identify two distinct mechanisms-genetic and epigenetic-involved in the complete suppression of virus and Tax expression. We demonstrate that, in contrast to systems that require sustained oncogene expression, the major viral transforming protein Tax can be turned-off without reversing the transformed phenotype. We propose that suppression

Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

DEFF Research Database (Denmark)

Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

2018-01-01

)-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

Science.gov (United States)

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

Directory of Open Access Journals (Sweden)

Fangquan Wang

2016-05-01

Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

Science.gov (United States)

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

Energy Technology Data Exchange (ETDEWEB)

Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)

2016-08-15

Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

International Nuclear Information System (INIS)

Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

2016-01-01

Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

Science.gov (United States)

Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

2016-10-13

PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector.

Directory of Open Access Journals (Sweden)

Yong Chen

2017-11-01

Full Text Available Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Early function of the Abutilon mosaic virus AC2 gene as a replication brake.

Science.gov (United States)

Krenz, Björn; Deuschle, Kathrin; Deigner, Tobias; Unseld, Sigrid; Kepp, Gabi; Wege, Christina; Kleinow, Tatjana; Jeske, Holger

2015-04-01

The C2/AC2 genes of monopartite/bipartite geminiviruses of the genera Begomovirus and Curtovirus encode important pathogenicity factors with multiple functions described so far. A novel function of Abutilon mosaic virus (AbMV) AC2 as a replication brake is described, utilizing transgenic plants with dimeric inserts of DNA B or with a reporter construct to express green fluorescent protein (GFP). Their replicational release upon AbMV superinfection or the individual and combined expression of epitope-tagged AbMV AC1, AC2, and AC3 was studied. In addition, the effects were compared in the presence and in the absence of an unrelated tombusvirus suppressor of silencing (P19). The results show that AC2 suppresses replication reproducibly in all assays and that AC3 counteracts this effect. Examination of the topoisomer distribution of supercoiled DNA, which indicates changes in the viral minichromosome structure, did not support any influence of AC2 on transcriptional gene silencing and DNA methylation. The geminiviral AC2 protein has been detected here for the first time in plants. The experiments revealed an extremely low level of AC2, which was slightly increased if constructs with an intron and a hemagglutinin (HA) tag in addition to P19 expression were used. AbMV AC2 properties are discussed with reference to those of other geminiviruses with respect to charge, modification, and size in order to delimit possible reasons for the different behaviors. The (A)C2 genes encode a key pathogenicity factor of begomoviruses and curtoviruses in the plant virus family Geminiviridae. This factor has been implicated in the resistance breaking observed in agricultural cotton production. AC2 is a multifunctional protein involved in transcriptional control, gene silencing, and regulation of basal biosynthesis. Here, a new function of Abutilon mosaic virus AC2 in replication control is added as a feature of this protein in viral multiplication, providing a novel finding on

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

Science.gov (United States)

Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

2016-01-01

ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

Science.gov (United States)

Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

2016-11-15

Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

Science.gov (United States)

Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

2012-09-01

The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

Salicylic acid and jasmonic acid are essential for systemic resistance against tobacco mosaic virus in Nicotiana benthamiana.

Science.gov (United States)

Zhu, Feng; Xi, De-Hui; Yuan, Shu; Xu, Fei; Zhang, Da-Wei; Lin, Hong-Hui

2014-06-01

Systemic resistance is induced by pathogens and confers protection against a broad range of pathogens. Recent studies have indicated that salicylic acid (SA) derivative methyl salicylate (MeSA) serves as a long-distance phloem-mobile systemic resistance signal in tobacco, Arabidopsis, and potato. However, other experiments indicate that jasmonic acid (JA) is a critical mobile signal. Here, we present evidence suggesting both MeSA and methyl jasmonate (MeJA) are essential for systemic resistance against Tobacco mosaic virus (TMV), possibly acting as the initiating signals for systemic resistance. Foliar application of JA followed by SA triggered the strongest systemic resistance against TMV. Furthermore, we use a virus-induced gene-silencing-based genetics approach to investigate the function of JA and SA biosynthesis or signaling genes in systemic response against TMV infection. Silencing of SA or JA biosynthetic and signaling genes in Nicotiana benthamiana plants increased susceptibility to TMV. Genetic experiments also proved the irreplaceable roles of MeSA and MeJA in systemic resistance response. Systemic resistance was compromised when SA methyl transferase or JA carboxyl methyltransferase, which are required for MeSA and MeJA formation, respectively, were silenced. Moreover, high-performance liquid chromatography-mass spectrometry analysis indicated that JA and MeJA accumulated in phloem exudates of leaves at early stages and SA and MeSA accumulated at later stages, after TMV infection. Our data also indicated that JA and MeJA could regulate MeSA and SA production. Taken together, our results demonstrate that (Me)JA and (Me)SA are required for systemic resistance response against TMV.

RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

International Nuclear Information System (INIS)

Beck, Markus; Strand, Michael R.

2003-01-01

The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

Science.gov (United States)

Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

2016-05-31

Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

Science.gov (United States)

Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

2015-10-02

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal for avirulence and RNA silencing suppression

NARCIS (Netherlands)

Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.

2014-01-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)

A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

Energy Technology Data Exchange (ETDEWEB)

Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

1989-09-01

Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

Science.gov (United States)

Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

2014-02-01

The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

Science.gov (United States)

Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

2011-05-01

There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Science.gov (United States)

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Generation and characterization of P gene-deficient rabies virus

International Nuclear Information System (INIS)

Shoji, Youko; Inoue, Satoshi; Nakamichi, Kazuo; Kurane, Ichiro; Sakai, Takeo; Morimoto, Kinjiro

2004-01-01

Rabies virus (RV) deficient in the P gene was generated by reverse genetics from cDNA of HEP-Flury strain lacking the entire P gene. The defective virus was propagated and amplified by rescue of virus, using a cell line that complemented the functions of the deficient gene. The P gene-deficient (def-P) virus replicated its genome and produced progeny viruses in the cell lines that constitutively expressed the P protein, although it grew at a slightly retarded rate compared to the parental strain. In contrast, no progeny virus was produced in the infected host when the def-P virus-infected cells that did not express the P protein. However, we found that the def-P virus had the ability to perform primary transcription (by the virion-associated polymerase) in the infected host without de novo P protein synthesis. The def-P virus was apathogenic in adult and suckling mice, even when inoculated intracranially. Inoculation of def-P virus in mice induced high levels of virus-neutralizing antibody (VNA) and conferred protective immunity against a lethal rabies infection. These results demonstrate the potential utility of gene-deficient virus as a novel live attenuated rabies vaccine

Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

KAUST Repository

Ntui, Valentine Otang

2015-04-22

Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

KAUST Repository

Ntui, Valentine Otang; Kong, Kynet; Khan, Raham Sher; Igawa, Tomoko; Janavi, Gnanaguru Janaky; Rabindran, Ramalingam; Nakamura, Ikuo; Mii, Masahiro

2015-01-01

Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

Characteristics of siRNAs derived from Southern rice black-streaked dwarf virus in infected rice and their potential role in host gene regulation.

Science.gov (United States)

Xu, Donglin; Zhou, Guohui

2017-02-10

Virus-derived siRNAs (vsiRNAs)-mediated RNA silencing plays important roles in interaction between plant viruses and their hosts. Southern rice black-streaked dwarf virus (SRBSDV) is a newly emerged devastating rice reovirus with ten dsRNA genomic segments. The characteristics of SRBSDV-derived siRNAs and their biological implications in SRBSDV-rice interaction remain unexplored. VsiRNAs profiling from SRBSDV-infected rice samples was done via small RNA deep sequencing. The putative rice targets of abundantly expressed vsiRNAs were bioinformatically predicted and subjected to functional annotation. Differential expression analysis of rice targets and RNA silencing components between infected and healthy samples was done using RT-qPCR. The vsiRNA was barely detectable at 14 days post infection (dpi) but abundantly present along with elevated expression level of the viral genome at 28 dpi. From the 28-dpi sample, 70,878 reads of 18 ~ 30-nt vsiRNAs were recognized (which mostly were 21-nt and 22-nt), covering 75 ~ 91% of the length of the ten genomic segments respectively. 86% of the vsiRNAs had a rice genes, including several types of host resistance or pathogenesis related genes encoding F-box/LRR proteins, receptor-like protein kinases, universal stress proteins, tobamovirus multiplication proteins, and RNA silencing components OsDCL2a and OsAGO17 respectively, some of which showed down regulation in infected plants in RT-qPCR. GO and KEGG classification showed that a majority of the predicted targets were related to cell parts and cellular processes and involved in carbohydrate metabolism, translation, and signal transduction. The silencing component genes OsDCL2a, OsDCL2b, OsDCL4, and OsAGO18 were down regulated, while OsAGO1d, OsAGO2, OsRDR1 and OsRDR6 were up regulated, significantly, upon SRBSDV infection. SRBSDV can regulate the expression of rice RNA silencing pathway components and the virus might compromise host defense and influence host

Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

International Nuclear Information System (INIS)

Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

2014-01-01

Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

Science.gov (United States)

Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

2017-10-13

Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cytomegalovirus replicon-based regulation of gene expression in vitro and in vivo.

Directory of Open Access Journals (Sweden)

Hermine Mohr

Full Text Available There is increasing evidence for a connection between DNA replication and the expression of adjacent genes. Therefore, this study addressed the question of whether a herpesvirus origin of replication can be used to activate or increase the expression of adjacent genes. Cell lines carrying an episomal vector, in which reporter genes are linked to the murine cytomegalovirus (MCMV origin of lytic replication (oriLyt, were constructed. Reporter gene expression was silenced by a histone-deacetylase-dependent mechanism, but was resolved upon lytic infection with MCMV. Replication of the episome was observed subsequent to infection, leading to the induction of gene expression by more than 1000-fold. oriLyt-based regulation thus provided a unique opportunity for virus-induced conditional gene expression without the need for an additional induction mechanism. This principle was exploited to show effective late trans-complementation of the toxic viral protein M50 and the glycoprotein gO of MCMV. Moreover, the application of this principle for intracellular immunization against herpesvirus infection was demonstrated. The results of the present study show that viral infection specifically activated the expression of a dominant-negative transgene, which inhibited viral growth. This conditional system was operative in explant cultures of transgenic mice, but not in vivo. Several applications are discussed.

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Directory of Open Access Journals (Sweden)

Sha Lu

Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

Directory of Open Access Journals (Sweden)

Praveen Guleria

Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

Science.gov (United States)

Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

2015-01-01

RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector

International Nuclear Information System (INIS)

Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi; Mathews, Lydia; Lucas, William T.; Murphy, Cynthia G.; Felber, Barbara K.; Pavlakis, George N.; Deluca, Neal A.; Knipe, David M.

2007-01-01

Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli β-galactosidase induced durable β-gal-specific IgG and CD8 + T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes

An adeno-associated virus-based intracellular sensor of pathological nuclear factor-κB activation for disease-inducible gene transfer.

Directory of Open Access Journals (Sweden)

Abdelwahed Chtarto

Full Text Available Stimulation of resident cells by NF-κB activating cytokines is a central element of inflammatory and degenerative disorders of the central nervous system (CNS. This disease-mediated NF-κB activation could be used to drive transgene expression selectively in affected cells, using adeno-associated virus (AAV-mediated gene transfer. We have constructed a series of AAV vectors expressing GFP under the control of different promoters including NF-κB -responsive elements. As an initial screen, the vectors were tested in vitro in HEK-293T cells treated with TNF-α. The best profile of GFP induction was obtained with a promoter containing two blocks of four NF-κB -responsive sequences from the human JCV neurotropic polyoma virus promoter, fused to a new tight minimal CMV promoter, optimally distant from each other. A therapeutical gene, glial cell line-derived neurotrophic factor (GDNF cDNA under the control of serotype 1-encapsidated NF-κB -responsive AAV vector (AAV-NF was protective in senescent cultures of mouse cortical neurons. AAV-NF was then evaluated in vivo in the kainic acid (KA-induced status epilepticus rat model for temporal lobe epilepsy, a major neurological disorder with a central pathophysiological role for NF-κB activation. We demonstrate that AAV-NF, injected in the hippocampus, responded to disease induction by mediating GFP expression, preferentially in CA1 and CA3 neurons and astrocytes, specifically in regions where inflammatory markers were also induced. Altogether, these data demonstrate the feasibility to use disease-activated transcription factor-responsive elements in order to drive transgene expression specifically in affected cells in inflammatory CNS disorders using AAV-mediated gene transfer.

The Whitefly Bemisia tabaci Knottin-1 Gene Is Implicated in Regulating the Quantity of Tomato Yellow Leaf Curl Virus Ingested and Transmitted by the Insect

Directory of Open Access Journals (Sweden)

Aliza Hariton Shalev

2016-07-01

Full Text Available The whitefly Bemisia tabaci is a major pest to agricultural crops. It transmits begomoviruses, such as Tomato yellow leaf curl virus (TYLCV, in a circular, persistent fashion. Transcriptome analyses revealed that B. tabaci knottin genes were responsive to various stresses. Upon ingestion of tomato begomoviruses, two of the four knottin genes were upregulated, knot-1 (with the highest expression and knot-3. In this study, we examined the involvement of B. tabaci knottin genes in relation to TYLCV circulative transmission. Knottins were silenced by feeding whiteflies with knottin dsRNA via detached tomato leaves. Large amounts of knot-1 transcripts were present in the abdomen of whiteflies, an obligatory transit site of begomoviruses in their circulative transmission pathway; knot-1 silencing significantly depleted the abdomen from knot-1 transcripts. Knot-1 silencing led to an increase in the amounts of TYLCV ingested by the insects and transmitted to tomato test plants by several orders of magnitude. This effect was not observed following knot-3 silencing. Hence, knot-1 plays a role in restricting the quantity of virions an insect may acquire and transmit. We suggest that knot-1 protects B. tabaci against deleterious effects caused by TYLCV by limiting the amount of virus associated with the whitefly vector.

Trichodiene Production in a Trichoderma harzianum erg1-Silenced Strain Provides Evidence of the Importance of the Sterol Biosynthetic Pathway in Inducing Plant Defense-Related Gene Expression.

Science.gov (United States)

Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S

2015-11-01

Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp.

RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

Directory of Open Access Journals (Sweden)

Jian Liu

2014-01-01

Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

Science.gov (United States)

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

Science.gov (United States)

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

Science.gov (United States)

Foda, Bardees M; Singh, Upinder

2015-08-21

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

Directory of Open Access Journals (Sweden)

Satoshi Iizuka

Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

The novel white spot syndrome virus-induced gene, PmERP15, encodes an ER stress-responsive protein in black tiger shrimp, Penaeus monodon.

Science.gov (United States)

Leu, Jiann-Horng; Liu, Kuan-Fu; Chen, Kuan-Yu; Chen, Shu-Hwa; Wang, Yu-Bin; Lin, Chung-Yen; Lo, Chu-Fang

2015-04-01

By microarray screening, we identified a white spot syndrome virus (WSSV)-strongly induced novel gene in gills of Penaeus monodon. The gene, PmERP15, encodes a putative transmembrane protein of 15 kDa, which only showed some degree of similarity (54-59%) to several unknown insect proteins, but had no hits to shrimp proteins. RT-PCR showed that PmERP15 was highly expressed in the hemocytes, heart and lymphoid organs, and that WSSV-induced strong expression of PmERP15 was evident in all tissues examined. Western blot analysis likewise showed that WSSV strongly up-regulated PmERP15 protein levels. In WSSV-infected hemocytes, immunofluorescence staining showed that PmERP15 protein was colocalized with an ER enzyme, protein disulfide isomerase, and in Sf9 insect cells, PmERP15-EGFP fusion protein colocalized with ER -Tracker™ Red dye as well. GRP78, an ER stress marker, was found to be up-regulated in WSSV-infected P. monodon, and both PmERP15 and GRP78 were up-regulated in shrimp injected with ER stress inducers tunicamycin and dithiothreitol. Silencing experiments showed that although PmERP15 dsRNA-injected shrimp succumbed to WSSV infection more rapidly, the WSSV copy number had no significant changes. These results suggest that PmERP15 is an ER stress-induced, ER resident protein, and its induction in WSSV-infected shrimp is caused by the ER stress triggered by WSSV infection. Furthermore, although PmERP15 has no role in WSSV multiplication, its presence is essential for the survival of WSSV-infected shrimp. Copyright © 2014 Elsevier Ltd. All rights reserved.

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

VIGS for dissecting mechanisms involved in the symbiotic interaction of microbes with plants

DEFF Research Database (Denmark)

Grønlund, Mette

2015-01-01

Virus-induced gene silencing (VIGS) is an alternative reverse genetics tool for silencing of genes in some plants which are difficult to transform. The pea early browning virus (PEBV) has been developed as a VIGS vector and used in pea for functional analysis of several genes. Here, a PEBV-VIGS p...

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

Science.gov (United States)

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Evaluation of a SUMO E2 conjugating enzyme involved in resistance to Clavibacter michiganensis subsp. michiganensis in Solanum peruvianum, through a tomato mottle virus VIGS assay

Directory of Open Access Journals (Sweden)

Mayra Janeth Esparza-Araiza

2015-12-01

Full Text Available Clavibacter michiganensis subsp. michiganensis (Cmm causes bacterial wilt and canker of tomato. Currently, no Solanum lycopersicum resistant varieties are commercially available, but some degree of Cmm resistance has been identified in Solanum peruvianum. Previous research showed up-regulation of a SUMO E2 conjugating enzyme (SCEI transcript in resistant S. peruvianum compared to susceptible S. lycopersicum following infection by Cmm. In order to test the role of SCEI in resistance to Cmm, a fragment of the gene from S. peruvianum was cloned into a novel virus-induced gene-silencing (VIGS vector based on the geminivirus Tomato Mottle Virus (ToMoV. Using biolistic inoculation, the ToMoV-based VIGS vector was shown to be effective in S. peruvianum by silencing the magnesium chelatase gene, which resulted in leaf bleaching. The ToMoV_SCEI construct resulted in approx. 61% silencing of SCEI in leaves of S. peruvianum as determined by quantitative RT-PCR. VIGS of SCEI in S. peruvianum resulted in unilateral wilting (15 dpi and subsequent death (20 dpi of the entire plant after Cmm inoculation, whereas empty vector-treated plants only showed wilting in the Cmm-inoculated leaf. SCEI-silenced plants also showed higher Cmm colonization with an average of 4.5 times more damaged tissue compared to the empty vector control plants. SCEI appears to play an important role in the innate immunity of S. peruvianum against Cmm, perhaps through the regulation of WRKY transcription factors, which may lead to expression of proteins involved in salicylic acid-dependent defense responses.

Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

Science.gov (United States)

Guleria, Praveen; Yadav, Sudesh Kumar

2013-01-01

Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

Molecular characterisation of lumpy skin disease virus and sheeppox virus based on P32 gene

Directory of Open Access Journals (Sweden)

P.M.A.Rashid

2017-06-01

Full Text Available Lumpy skin disease virus (LSDV and sheeppox virus (SPV have a considerable economic impact on the cattle and small ruminant industry. They are listed in group A of contagious disease by the World Organization for Animal Health (OIE. This study addressed molecular characterisation of first LSDV outbreak and an endemic SPV in Kurdistan region of Iraq based on P32 gene. The results indicated that P32 gene can be successfully used for diagnosis of LSDV. The phylogenic and molecular analysis showed that there may be a new LSDV isolate circulating in Kurdistan which uniquely shared the same characteristic amino acid sequence with SPV and GPV, leucine at amino acid position 51 in P32 gene as well as few genetically distinct SPV causing pox disease in Kurdistan sheep. This study provided sequence information of P32 gene for several LSDV isolates, which positively affects the epidemiological study of Capripoxvirus

RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

Directory of Open Access Journals (Sweden)

Paul McVeigh

2014-09-01

Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

Directory of Open Access Journals (Sweden)

Johann Lavaud

Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

Science.gov (United States)

Vugrinec, Sascha; Kroth, Peter G.

2012-01-01

Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

Molecular characterization of oxysterol binding to the Epstein-Barr virus-induced gene 2 (GPR183)

DEFF Research Database (Denmark)

Benned-Jensen, Tau; Norn, Christoffer; Laurent, Stephane

2012-01-01

, the family of G protein-coupled seven transmembrane-spanning receptors (7TM receptors) was added to this group. Specifically, the Epstein-Barr virus-induced gene 2 (EBI2 or GPR183) was shown to be activated by several oxysterols, most potently by 7α,25-dihydroxycholesterol (7α,25-OHC). Nothing is known about...

Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

Science.gov (United States)

Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

2016-01-01

Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

Science.gov (United States)

Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

2015-01-01

The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

Epstein-Barr virus: a master epigenetic manipulator.

Science.gov (United States)

Scott, Rona S

2017-10-01

Like all herpesviruses, the ability of Epstein-Barr virus (EBV) to establish life-long persistent infections is related to a biphasic viral lifecycle that involves latency and reactivation/lytic replication. Memory B cells serve as the EBV latency compartment where silencing of viral gene expression allows maintenance of the viral genome, avoidance of immune surveillance, and life-long carriage. Upon viral reactivation, viral gene expression is induced for replication, progeny virion production, and viral spread. EBV uses the host epigenetic machinery to regulate its distinct viral gene expression states. However, epigenetic manipulation by EBV affects the host epigenome by reprogramming cells in ways that leave long-lasting, oncogenic phenotypes. Such virally-induced epigenetic alterations are evident in EBV-associated cancers. Copyright © 2017 Elsevier B.V. All rights reserved.

Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

Science.gov (United States)

Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

2017-05-01

Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

Science.gov (United States)

Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

2018-07-01

Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

Directory of Open Access Journals (Sweden)

Manuel Rubio

Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Bypass of cell cycle arrest induced by transient DNMT1 post-transcriptional silencing triggers aneuploidy in human cells

Directory of Open Access Journals (Sweden)

Barra Viviana

2012-02-01

Full Text Available Abstract Background Aneuploidy has been acknowledged as a major source of genomic instability in cancer, and it is often considered the result of chromosome segregation errors including those caused by defects in genes controlling the mitotic spindle assembly, centrosome duplication and cell-cycle checkpoints. Aneuploidy and chromosomal instability has been also correlated with epigenetic alteration, however the molecular basis of this correlation is poorly understood. Results To address the functional connection existing between epigenetic changes and aneuploidy, we used RNA-interference to silence the DNMT1 gene, encoding for a highly conserved member of the DNA methyl-transferases. DNMT1 depletion slowed down proliferation of near-diploid human tumor cells (HCT116 and triggered G1 arrest in primary human fibroblasts (IMR90, by inducing p53 stabilization and, in turn, p21waf1 transactivation. Remarkably, p53 increase was not caused by DNA damage and was not observed after p14-ARF post-transcriptional silencing. Interestingly, DNMT1 silenced cells with p53 or p14-ARF depleted did not arrest in G1 but, instead, underwent DNA hypomethylation and became aneuploid. Conclusion Our results suggest that DNMT1 depletion triggers a p14ARF/p53 dependent cell cycle arrest to counteract the aneuploidy induced by changes in DNA methylation.

Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

Directory of Open Access Journals (Sweden)

Marianna Feretzaki

2016-03-01

Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

KAUST Repository

Zolea, Fabiana

2015-10-09

The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

KAUST Repository

Zolea, Fabiana; Biamonte, Flavia; Candeloro, Patrizio; Di Sanzo, Maddalena; Cozzi, Anna; Di Vito, Anna; Quaresima, Barbara; Lobello, Nadia; Trecroci, Francesca; Di Fabrizio, Enzo M.; Levi, Sonia; Cuda, Giovanni; Costanzo, Francesco

2015-01-01

The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

Science.gov (United States)

Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

2006-12-20

MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

Directory of Open Access Journals (Sweden)

Liyang Chen

2015-11-01

Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

ADP-glucose pyrophosphorylase gene plays a key role in the quality of corm and yield of cormels in gladiolus

International Nuclear Information System (INIS)

Seng, Shanshan; Wu, Jian; Sui, Juanjuan; Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna; Yi, Mingfang

2016-01-01

Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.

ADP-glucose pyrophosphorylase gene plays a key role in the quality of corm and yield of cormels in gladiolus

Energy Technology Data Exchange (ETDEWEB)

Seng, Shanshan, E-mail: seshsh108@126.com [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Wu, Jian [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Sui, Juanjuan [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); College of Biology, Fuyang Normal College, Qinghe Western Road 100#, Fuyang 236037, Anhui (China); Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Yi, Mingfang, E-mail: ymfang@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China)

2016-05-20

Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

Science.gov (United States)

Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

2014-01-01

SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

Distinct cellular responses differentiating alcohol- and hepatitis C virus-induced liver cirrhosis

Directory of Open Access Journals (Sweden)

Boix Loreto

2006-11-01

Full Text Available Abstract Background Little is known at the molecular level concerning the differences and/or similarities between alcohol and hepatitis C virus induced liver disease. Global transcriptional profiling using oligonucleotide microarrays was therefore performed on liver biopsies from patients with cirrhosis caused by either chronic alcohol consumption or chronic hepatitis C virus (HCV. Results Global gene expression patterns varied significantly depending upon etiology of liver disease, with a greater number of differentially regulated genes seen in HCV-infected patients. Many of the gene expression changes specifically observed in HCV-infected cirrhotic livers were expectedly associated with activation of the innate antiviral immune response. We also compared severity (CTP class of cirrhosis for each etiology and identified gene expression patterns that differentiated ethanol-induced cirrhosis by class. CTP class A ethanol-cirrhotic livers showed unique expression patterns for genes implicated in the inflammatory response, including those related to macrophage activation and migration, as well as lipid metabolism and oxidative stress genes. Conclusion Stages of liver cirrhosis could be differentiated based on gene expression patterns in ethanol-induced, but not HCV-induced, disease. In addition to genes specifically regulating the innate antiviral immune response, mechanisms responsible for differentiating chronic liver damage due to HCV or ethanol may be closely related to regulation of lipid metabolism and to effects of macrophage activation on deposition of extracellular matrix components.

Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

International Nuclear Information System (INIS)

Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

2013-01-01

Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

Energy Technology Data Exchange (ETDEWEB)

Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

2012-10-05

Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

Directory of Open Access Journals (Sweden)

Yusuke Ohnishi

-strand siRNA elements, which possibly increase the assembly of antisense-strand (guide siRNAs into RNA-induced silencing complexes (RISCs, may enhance ASP-RNAi in the case of inert siRNA duplexes. Therefore, the data presented here suggest that structural modification of functional portions of an siRNA duplex by base substitution could greatly influence allele discrimination and gene silencing, thereby contributing to enhancement of ASP-RNAi.

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

Science.gov (United States)

de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

2014-02-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

Science.gov (United States)

Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

2012-11-07

CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

The Ebola virus VP35 protein is a suppressor of RNA silencing

NARCIS (Netherlands)

Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

2007-01-01

RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

Energy Technology Data Exchange (ETDEWEB)

Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)

2017-03-15

We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

International Nuclear Information System (INIS)

Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash

2017-01-01

We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

Analysis of gene expression in fetal and adult cells infected with rubella virus

International Nuclear Information System (INIS)

Adamo, Maria Pilar; Zapata, Marta; Frey, Teryl K.

2008-01-01

Congenital infection with rubella virus (RUB) leads to persistent infection and congenital defects and we showed previously that primary human fetal fibroblasts did not undergo apoptosis when infected with RUB, which could promote fetal virus persistence [Adamo, P., Asis, L., Silveyra, P., Cuffini, C., Pedranti, M., Zapata, M., 2004. Rubella virus does not induce apoptosis in primary human embryo fibroblasts cultures: a possible way of viral persistence in congenital infection. Viral Immunol. 17, 87-100]. To extend this observation, gene chip analysis was performed on a line of primary human fetal fibroblasts (10 weeks gestation) and a line of human adult lung fibroblasts (which underwent apoptosis in response to RUB infection) to compare gene expression in infected and uninfected cells. A total of 632 and 516 genes were upregulated or downregulated in the infected fetal and adult cells respectively in comparison to uninfected cells, however only 52 genes were regulated in both cell types. Although the regulated genes were different, across functional gene categories the patterns of gene regulation were similar. In general, regulation of pro- and anti-apoptotic genes following infection appeared to favor apoptosis in the adult cells and lack of apoptosis in the fetal cells, however there was a greater relative expression of anti-apoptotic genes and reduced expression of pro-apoptotic genes in uninfected fetal cells versus uninfected adult cells and thus the lack of apoptosis in fetal cells following RUB infection was also due to the prevailing background of gene expression that is antagonistic to apoptosis. In support of this hypothesis, it was found that of a battery of five chemicals known to induce apoptosis, two induced apoptosis in the adult cells, but not in fetal cells, and two induced apoptosis more rapidly in the adult cells than in fetal cells (the fifth did not induce apoptosis in either). A robust interferon-stimulated gene response was induced

Isolation and Characterization of Pepper Genes Interacting with the CMV-P1 Helicase Domain.

Directory of Open Access Journals (Sweden)

Yoomi Choi

Full Text Available Cucumber mosaic virus (CMV is a destructive pathogen affecting Capsicum annuum (pepper production. The pepper Cmr1 gene confers resistance to most CMV strains, but is overcome by CMV-P1 in a process dependent on the CMV-P1 RNA1 helicase domain (P1 helicase. Here, to identify host factors involved in CMV-P1 infection in pepper, a yeast two-hybrid library derived from a C. annuum 'Bukang' cDNA library was screened, producing a total of 76 potential clones interacting with the P1 helicase. Beta-galactosidase filter lift assay, PCR screening, and sequencing analysis narrowed the candidates to 10 genes putatively involved in virus infection. The candidate host genes were silenced in Nicotiana benthamiana plants that were then inoculated with CMV-P1 tagged with the green fluorescent protein (GFP. Plants silenced for seven of the genes showed development comparable to N. benthamiana wild type, whereas plants silenced for the other three genes showed developmental defects including stunting and severe distortion. Silencing formate dehydrogenase and calreticulin-3 precursor led to reduced virus accumulation. Formate dehydrogenase-silenced plants showed local infection in inoculated leaves, but not in upper (systemic leaves. In the calreticulin-3 precursor-silenced plants, infection was not observed in either the inoculated or the upper leaves. Our results demonstrate that formate dehydrogenase and calreticulin-3 precursor are required for CMV-P1 infection.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

International Nuclear Information System (INIS)

Huang, Shang-Lang; Chao, Chuck C.-K.

2015-01-01

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

Energy Technology Data Exchange (ETDEWEB)

Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

2015-06-16

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

Science.gov (United States)

Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

2013-09-01

An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

Science.gov (United States)

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

Directory of Open Access Journals (Sweden)

Sateesh Krishnamurthy

2012-01-01

Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

Inhibition of virus replication by RNA interference

NARCIS (Netherlands)

Haasnoot, P. C. Joost; Cupac, Daniel; Berkhout, Ben

2003-01-01

RNA interference (RNAi) is a sequence-specific gene-silencing mechanism in eukaryotes, which is believed to function as a defence against viruses and transposons. Since its discovery, RNAi has been developed into a widely used technique for generating genetic knock-outs and for studying gene

Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

Directory of Open Access Journals (Sweden)

Jose C Garcia-Garcia

2009-06-01

Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

Science.gov (United States)

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

Cis-drivers and trans-drivers of bovine leukemia virus oncogenesis.

Science.gov (United States)

Safari, Roghaiyeh; Hamaidia, Malik; de Brogniez, Alix; Gillet, Nicolas; Willems, Luc

2017-10-01

The bovine leukemia virus (BLV) is a retrovirus inducing an asymptomatic and persistent infection in ruminants and leading in a minority of cases to the accumulation of B-lymphocytes (lymphocytosis, leukemia or lymphoma). Although the mechanisms of oncogenesis are still largely unknown, there is clear experimental evidence showing that BLV infection drastically modifies the pattern of gene expression of the host cell. This alteration of the transcriptome in infected B-lymphocytes results first, from a direct activity of viral proteins (i.e. transactivation of gene promoters, protein-protein interactions), second, from insertional mutagenesis by proviral integration (cis-activation) and third, from gene silencing by microRNAs. Expression of viral proteins stimulates a vigorous immune response that indirectly modifies gene transcription in other cell types (e.g. cytotoxic T-cells, auxiliary T-cells, macrophages). In principle, insertional mutagenesis and microRNA-associated RNA interference can modify the cell fate without inducing an antiviral immunity. Despite a tight control by the immune response, the permanent attempts of the virus to replicate ultimately induce mutations in the infected cell. Accumulation of these genomic lesions and Darwinian selection of tumor clones are predicted to lead to cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

Science.gov (United States)

Wu, H; Zhang, J; Shi, H

2016-01-01

Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)

2012-03-23

Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.

Epstein-Barr virus-induced gene 3 (EBI3) polymorphisms and expression are associated with susceptibility to pulmonary tuberculosis.

Science.gov (United States)

Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue

2015-07-01

Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

RNAi: antiviral therapy against dengue virus.

Science.gov (United States)

Idrees, Sobia; Ashfaq, Usman A

2013-03-01

Dengue virus infection has become a global threat affecting around 100 countries in the world. Currently, there is no licensed antiviral agent available against dengue. Thus, there is a strong need to develop therapeutic strategies that can tackle this life threatening disease. RNA interference is an important and effective gene silencing process which degrades targeted RNA by a sequence specific process. Several studies have been conducted during the last decade to evaluate the efficiency of siRNA in inhibiting dengue virus replication. This review summarizes siRNAs as a therapeutic approach against dengue virus serotypes and concludes that siRNAs against virus and host genes can be next generation treatment of dengue virus infection.

Cell-surface antigens associated with dualtropic and thymotropic murine leukemia viruses inducing thymic and nonthymic lymphomas

International Nuclear Information System (INIS)

Haas, M.; Patch, V.

1980-01-01

Unique type-specific antigens were detected on cells infected with dualtropic and thymotropic viruses and x-ray-induced T cell- and B cell-malignant lymphomas of C57BL/6 mice. These findings support the contention that T cell lymphoma (TCL)-inducing and B cell lymphoma (BCL)-indcing viruses isolated from x-irradiated C57BL/6 mice are env gene recombinants in which ecotropic gene sequences have been substituted by xenotropic sequences. We found that unique antigenicities are associated with each TCL-inducing and BCL-inducing dualtropic virus, and that the thymotropic TCL-inducing virus isolates represent a separate serologic group. These virus mapping experiments indicated that many serologically different recombinant viruses can be isolated from C57BL/6 mice. It is suggested that many distinct recombinant viruses may exist in lymphomagenic C57BL/6 mice, some of which are associated with specific lyphoma induction

Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

Directory of Open Access Journals (Sweden)

Hanoch Goldshmidt

2010-01-01

Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

Hepatitis B virus enhances cisplatin-induced hepatotoxicity via a mechanism involving suppression of glucose-regulated protein of 78 Kda.

Science.gov (United States)

Zhang, Xiaoxue; Zhang, Rui; Yang, HuiOu; Xiang, Qian; Jiang, Qing; He, Qi; Zhang, Ting; Chen, Chen; Zhu, Huifen; Wang, Qiang; Ning, Qin; Li, Yiwu; Lei, Ping; Shen, Guanxin

2016-07-25

Cisplatin is a classical platinum-based chemotherapeutic drug used in the treatment of many cancer types, including hepatocellular carcinoma (HCC). The application of cisplatin is significantly limited by its toxicity, which may be affected by various biological factors. Persistence of Hepatitis B virus (HBV) infection leads to HCC development and may be associated with higher incidence of severe hepatitis during chemotherapy. However, whether HBV alters the susceptibility of hepatocytes to cisplatin remains poorly understood. Here, we demonstrate that HBV transfection enhanced cisplatin-induced hepatotoxicity via a mechanism involving suppression of glucose-regulated protein of 78 KDa (Grp78), a major stress-induced chaperone that localizes to the endoplasmic reticulum. Silencing Grp78 gene increased the susceptibility of HepG2 to cisplatin by activating caspase-3. Grp78 expression was down-regulated by HBV infection both in vitro and in liver tissues of patients. We compared the cisplatin sensitivity of hepatoma cells either expressing (HepG2.2.15 cells) or not expressing the entire Hepatitis B Virus genome (HepG2). HepG2.2.15 cells showed increased sensitivity to cisplatin and a higher apoptosis rate. Overexpression of Grp78 counteracted the increase of sensitivity of HepG2.215 cells to cisplatin. Furthermore, we found that HBV disrupted Grp78 synthesis in response to cisplatin stimulation, which may trigger severe and prolonged endoplasmic reticulum (ER) stress that can induce cellular apoptosis. Our findings provide new information into the effect of HBV in the modulation of Grp78 expression, and, consequently on cisplatin-induced hepatotoxicity during viral infection. Copyright © 2016. Published by Elsevier Ireland Ltd.

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

Directory of Open Access Journals (Sweden)

Masaki Takahashi

2015-01-01

Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

Directory of Open Access Journals (Sweden)

Maria V Chiantore

Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

The human T-lymphotropic virus type I tax gene can cooperate with the ras oncogene to induce neoplastic transformation of cells.

Science.gov (United States)

Pozzatti, R; Vogel, J; Jay, G

1990-01-01

Epidemiologic studies have linked infection by the human T-lymphotropic virus type I (HTLV-I) with the development of adult T-cell leukemia. The low penetrance of the virus and the long latency for disease manifestation are factors that obscure the role of HTLV-I infection in oncogenesis. We have used an in vitro transformation assay system to determine directly whether the HTLV-I tax gene has transformation potential. Transfection of the tax gene alone into early-passage rat embryo fibroblasts did not induce morphological alterations. However, cotransfection of tax with the selectable marker plasmid pRSVneo gave rise to G418-resistant colonies that could be established as immortalized cell lines. Cotransfection of tax with the ras oncogene into rat embryo fibroblasts gave rise to foci of transformed cells that were highly tumorigenic in nude mice. These data represent a direct demonstration of the oncogenic potential of the tax gene in nonlymphoid cells and establish HTLV-I as a transforming virus.

Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

Science.gov (United States)

Vozárová, Z; Žilová, M; Šubr, Z

2015-12-01

Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

Bioinformatics analysis of the factors controlling type I IFN gene expression in autoimmune disease and virus-induced immunity

Directory of Open Access Journals (Sweden)

Di eFeng

2013-09-01

Full Text Available Patients with systemic lupus erythematosus (SLE and Sjögren's syndrome (SS display increased levels of type I IFN-induced genes. Plasmacytoid dendritic cells (PDCs are natural interferon producing cells and considered to be a primary source of IFN-α in these two diseases. Differential expression patterns of type I IFN inducible transcripts can be found in different immune cell subsets and in patients with both active and inactive autoimmune disease. A type I IFN gene signature generally consists of three groups of IFN-induced genes - those regulated in response to virus-induced type I IFN, those regulated by the IFN-induced mitogen-activated protein kinase/extracellular-regulated kinase (MAPK/ERK pathway, and those by the IFN-induced phosphoinositide-3 kinase (PI-3K pathway. These three groups of type I IFN-regulated genes control important cellular processes such as apoptosis, survival, adhesion, and chemotaxis, that when dysregulated, contribute to autoimmunity. With the recent generation of large datasets in the public domain from next-generation sequencing and DNA microarray experiments, one can perform detailed analyses of cell type-specific gene signatures as well as identify distinct transcription factors that differentially regulate these gene signatures. We have performed bioinformatics analysis of data in the public domain and experimental data from our lab to gain insight into the regulation of type I IFN gene expression. We have found that the genetic landscape of the IFNA and IFNB genes are occupied by transcription factors, such as insulators CTCF and cohesin, that negatively regulate transcription, as well as IRF5 and IRF7, that positively and distinctly regulate IFNA subtypes. A detailed understanding of the factors controlling type I IFN gene transcription will significantly aid in the identification and development of new therapeutic strategies targeting the IFN pathway in autoimmune disease.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

DEFF Research Database (Denmark)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

2016-01-01

/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

A Respiratory Syncytial Virus Vaccine Vectored by a Stable Chimeric and Replication-Deficient Sendai Virus Protects Mice without Inducing Enhanced Disease.

Science.gov (United States)

Wiegand, Marian Alexander; Gori-Savellini, Gianni; Gandolfo, Claudia; Papa, Guido; Kaufmann, Christine; Felder, Eva; Ginori, Alessandro; Disanto, Maria Giulia; Spina, Donatella; Cusi, Maria Grazia

2017-05-15

Respiratory syncytial virus (RSV) is a major cause of severe respiratory infections in children and elderly people, and no marketed vaccine exists. In this study, we generated and analyzed a subunit vaccine against RSV based on a novel genome replication-deficient Sendai virus (SeV) vector. We inserted the RSV F protein, known to be a genetically stable antigen, into our vector in a specific way to optimize the vaccine features. By exchanging the ectodomain of the SeV F protein for its counterpart from RSV, we created a chimeric vectored vaccine that contains the RSV F protein as an essential structural component. In this way, the antigen is actively expressed on the surfaces of vaccine particles in its prefusion conformation, and as recently reported for other vectored vaccines, the occurrence of silencing mutations of the transgene in the vaccine genome can be prevented. In addition, its active gene expression contributes to further stimulation of the immune response. In order to understand the best route of immunization, we compared vaccine efficacies after intranasal (i.n.) or intramuscular (i.m.) immunization of BALB/c mice. Via both routes, substantial RSV-specific immune responses were induced, consisting of serum IgG and neutralizing antibodies, as well as cytotoxic T cells. Moreover, i.n. immunization was also able to stimulate specific mucosal IgA in the upper and lower respiratory tract. In virus challenge experiments, animals were protected against RSV infection after both i.n. and i.m. immunization without inducing vaccine-enhanced disease. Above all, the replication-deficient SeV appeared to be safe and well tolerated. IMPORTANCE Respiratory syncytial virus (RSV) is a major cause of respiratory diseases in young children and elderly people worldwide. There is a great demand for a licensed vaccine. Promising existing vaccine approaches based on live-attenuated vaccines or viral vectors have suffered from unforeseen drawbacks related to immunogenicity

Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

Directory of Open Access Journals (Sweden)

Xiaohui eLi

2015-06-01

Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

Science.gov (United States)

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant.

Science.gov (United States)

Garcia-Ruiz, Hernan; Gabriel Peralta, Sergio M; Harte-Maxwell, Patricia A

2018-03-14

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana . Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection.

Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

Science.gov (United States)

Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

2018-06-15

The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

Science.gov (United States)

Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

2017-08-01

Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

International Nuclear Information System (INIS)

Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

2009-01-01

Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

Directory of Open Access Journals (Sweden)

Dewi Elfidasari

2013-04-01

Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

Science.gov (United States)

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

Science.gov (United States)

Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

2015-03-01

The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

Science.gov (United States)

Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

2016-10-01

Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

Science.gov (United States)

Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2014-06-01

Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

Directory of Open Access Journals (Sweden)

Kuchipudi Suresh V

2012-10-01

Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

Radiation-induced Epstein-Barr virus reactivation in gastric cancer cells with latent EBV infection.

Science.gov (United States)

Nandakumar, Athira; Uwatoko, Futoshi; Yamamoto, Megumi; Tomita, Kazuo; Majima, Hideyuki J; Akiba, Suminori; Koriyama, Chihaya

2017-07-01

Epstein-Barr virus, a ubiquitous human herpes virus with oncogenic activity, can be found in 6%-16% of gastric carcinomas worldwide. In Epstein-Barr virus-associated gastric carcinoma, only a few latent genes of the virus are expressed. Ionizing irradiation was shown to induce lytic Epstein-Barr virus infection in lymphoblastoid cell lines with latent Epstein-Barr virus infection. In this study, we examined the effect of ionizing radiation on the Epstein-Barr virus reactivation in a gastric epithelial cancer cell line (SNU-719, an Epstein-Barr virus-associated gastric carcinoma cell line). Irradiation with X-ray (dose = 5 and 10 Gy; dose rate = 0.5398 Gy/min) killed approximately 25% and 50% of cultured SNU-719 cells, respectively, in 48 h. Ionizing radiation increased the messenger RNA expression of immediate early Epstein-Barr virus lytic genes (BZLF1 and BRLF1), determined by real-time reverse transcription polymerase chain reaction, in a dose-dependent manner at 48 h and, to a slightly lesser extent, at 72 h after irradiation. Similar findings were observed for other Epstein-Barr virus lytic genes (BMRF1, BLLF1, and BcLF1). After radiation, the expression of transforming growth factor beta 1 messenger RNA increased and reached a peak in 12-24 h, and the high-level expression of the Epstein-Barr virus immediate early genes can convert latent Epstein-Barr virus infection into the lytic form and result in the release of infectious Epstein-Barr virus. To conclude, Ionizing radiation activates lytic Epstein-Barr virus gene expression in the SNU-719 cell line mainly through nuclear factor kappaB activation. We made a brief review of literature to explore underlying mechanism involved in transforming growth factor beta-induced Epstein-Barr virus reactivation. A possible involvement of nuclear factor kappaB was hypothesized.

Ebola virus infection induces irregular dendritic cell gene expression.

Science.gov (United States)

Melanson, Vanessa R; Kalina, Warren V; Williams, Priscilla

2015-02-01

Filoviruses subvert the human immune system in part by infecting and replicating in dendritic cells (DCs). Using gene arrays, a phenotypic profile of filovirus infection in human monocyte-derived DCs was assessed. Monocytes from human donors were cultured in GM-CSF and IL-4 and were infected with Ebola virus Kikwit variant for up to 48 h. Extracted DC RNA was analyzed on SuperArray's Dendritic and Antigen Presenting Cell Oligo GEArray and compared to uninfected controls. Infected DCs exhibited increased expression of cytokine, chemokine, antiviral, and anti-apoptotic genes not seen in uninfected controls. Significant increases of intracellular antiviral and MHC I and II genes were also noted in EBOV-infected DCs. However, infected DCs failed to show any significant difference in co-stimulatory T-cell gene expression from uninfected DCs. Moreover, several chemokine genes were activated, but there was sparse expression of chemokine receptors that enabled activated DCs to home to lymph nodes. Overall, statistically significant expression of several intracellular antiviral genes was noted, which may limit viral load but fails to stop replication. EBOV gene expression profiling is of vital importance in understanding pathogenesis and devising novel therapeutic treatments such as small-molecule inhibitors.

Genetic variation in toll-like receptors and retinoic acid-inducible gene I and outcome of hepatitis C virus infection

DEFF Research Database (Denmark)

Clausen, L N; Ladelund, S; Weis, N

2014-01-01

We evaluated the effects of genetic variation in toll-like receptors (TLR), retinoic acid-inducible gene I (RIG-I) and their signalling pathways on spontaneous hepatitis C virus (HCV) resolution. We screened 95 single-nucleotide polymorphisms (SNPs) in 22 genes. SNPs significantly associated...... with resolution in the discovery cohort were genotyped in a validation cohort. Multivariate logistic regression adjusted for sex, hepatitis B surface antigen, HIV infection and the interleukin-28B rs12979860 SNP was performed in the combined cohort. Haplotype reconstruction and linkage disequilibrium analysis...

5-HT1A receptor gene silencers Freud-1 and Freud-2 are differently expressed in the brain of rats with genetically determined high level of fear-induced aggression or its absence.

Science.gov (United States)

Kondaurova, Elena M; Ilchibaeva, Tatiana V; Tsybko, Anton S; Kozhemyakina, Rimma V; Popova, Nina K; Naumenko, Vladimir S

2016-09-01

Serotonin 5-HT1A receptor is known to play a crucial role in the mechanisms of genetically defined aggression. In its turn, 5-HT1A receptor functional state is under control of multiple factors. Among others, transcriptional factors Freud-1 and Freud-2 are known to be involved in the repression of 5-HT1A receptor gene expression. However, implication of these factors in the regulation of behavior is unclear. Here, we investigated the expression of 5-HT1A receptor and silencers Freud-1 and Freud-2 in the brain of rats selectively bred for 85 generations for either high level of fear-induced aggression or its absence. It was shown that Freud-1 and Freud-2 levels were different in aggressive and nonaggressive animals. Freud-1 protein level was decreased in the hippocampus, whereas Freud-2 protein level was increased in the frontal cortex of highly aggressive rats. There no differences in 5-HT1A receptor gene expression were found in the brains of highly aggressive and nonaggressive rats. However, 5-HT1A receptor protein level was decreased in the midbrain and increased in the hippocampus of highly aggressive rats. These data showed the involvement of Freud-1 and Freud-2 in the regulation of genetically defined fear-induced aggression. However, these silencers do not affect transcription of the 5-HT1A receptor gene in the investigated rats. Our data indicate the implication of posttranscriptional rather than transcriptional regulation of 5-HT1A receptor functional state in the mechanisms of genetically determined aggressive behavior. On the other hand, the implication of other transcriptional regulators for 5-HT1A receptor gene in the mechanisms of genetically defined aggression could be suggested. Copyright © 2016 Elsevier B.V. All rights reserved.

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

Dynamic gene expression analysis in a H1N1 influenza virus mouse pneumonia model.

Science.gov (United States)

Bao, Yanyan; Gao, Yingjie; Shi, Yujing; Cui, Xiaolan

2017-06-01

H1N1, a major pathogenic subtype of influenza A virus, causes a respiratory infection in humans and livestock that can range from a mild infection to more severe pneumonia associated with acute respiratory distress syndrome. Understanding the dynamic changes in the genome and the related functional changes induced by H1N1 influenza virus infection is essential to elucidating the pathogenesis of this virus and thereby determining strategies to prevent future outbreaks. In this study, we filtered the significantly expressed genes in mouse pneumonia using mRNA microarray analysis. Using STC analysis, seven significant gene clusters were revealed, and using STC-GO analysis, we explored the significant functions of these seven gene clusters. The results revealed GOs related to H1N1 virus-induced inflammatory and immune functions, including innate immune response, inflammatory response, specific immune response, and cellular response to interferon-beta. Furthermore, the dynamic regulation relationships of the key genes in mouse pneumonia were revealed by dynamic gene network analysis, and the most important genes were filtered, including Dhx58, Cxcl10, Cxcl11, Zbp1, Ifit1, Ifih1, Trim25, Mx2, Oas2, Cd274, Irgm1, and Irf7. These results suggested that during mouse pneumonia, changes in the expression of gene clusters and the complex interactions among genes lead to significant changes in function. Dynamic gene expression analysis revealed key genes that performed important functions. These results are a prelude to advancements in mouse H1N1 influenza virus infection biology, as well as the use of mice as a model organism for human H1N1 influenza virus infection studies.

Two complex, adenovirus-based vaccines that together induce immune responses to all four dengue virus serotypes.

Science.gov (United States)

Holman, David H; Wang, Danher; Raviprakash, Kanakatte; Raja, Nicholas U; Luo, Min; Zhang, Jianghui; Porter, Kevin R; Dong, John Y

2007-02-01

Dengue virus infections can cause hemorrhagic fever, shock, encephalitis, and even death. Worldwide, approximately 2.5 billion people live in dengue-infested regions with about 100 million new cases each year, although many of these infections are believed to be silent. There are four antigenically distinct serotypes of dengue virus; thus, immunity from one serotype will not cross-protect from infection with the other three. The difficulties that hamper vaccine development include requirements of the natural conformation of the envelope glycoprotein to induce neutralizing immune responses and the necessity of presenting antigens of all four serotypes. Currently, the only way to meet these requirements is to use a mixture of four serotypes of live attenuated dengue viruses, but safety remains a major problem. In this study, we have developed the basis for a tetravalent dengue vaccine using a novel complex adenovirus platform that is capable of expressing multiple antigens de novo. This dengue vaccine is constructed as a pair of vectors that each expresses the premembrane and envelope genes of two different dengue virus serotypes. Upon vaccination, the vaccine expressed high levels of the dengue virus antigens in cells to mimic a natural infection and induced both humoral and cellular immune responses against multiple serotypes of dengue virus in an animal model. Further analyses show the humoral responses were indeed neutralizing against all four serotypes. Our studies demonstrate the concept of mimicking infections to induce immune responses by synthesizing dengue virus membrane antigens de novo and the feasibility of developing an effective tetravalent dengue vaccine by vector-mediated expression of glycoproteins of the four serotypes.

Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

Science.gov (United States)

An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

Energy Technology Data Exchange (ETDEWEB)

Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

2016-03-18

Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

Science.gov (United States)

Tang, Wei; Newton, Ronald J; Weidner, Douglas A

2007-01-01

An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

Directory of Open Access Journals (Sweden)

Masci Stefania

2010-07-01

Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

Dengue Virus Infection of Aedes aegypti Requires a Putative Cysteine Rich Venom Protein.

Directory of Open Access Journals (Sweden)

Berlin Londono-Renteria

2015-10-01

Full Text Available Dengue virus (DENV is a mosquito-borne flavivirus that causes serious human disease and mortality worldwide. There is no specific antiviral therapy or vaccine for DENV infection. Alterations in gene expression during DENV infection of the mosquito and the impact of these changes on virus infection are important events to investigate in hopes of creating new treatments and vaccines. We previously identified 203 genes that were ≥5-fold differentially upregulated during flavivirus infection of the mosquito. Here, we examined the impact of silencing 100 of the most highly upregulated gene targets on DENV infection in its mosquito vector. We identified 20 genes that reduced DENV infection by at least 60% when silenced. We focused on one gene, a putative cysteine rich venom protein (SeqID AAEL000379; CRVP379, whose silencing significantly reduced DENV infection in Aedes aegypti cells. Here, we examine the requirement for CRVP379 during DENV infection of the mosquito and investigate the mechanisms surrounding this phenomenon. We also show that blocking CRVP379 protein with either RNAi or specific antisera inhibits DENV infection in Aedes aegypti. This work identifies a novel mosquito gene target for controlling DENV infection in mosquitoes that may also be used to develop broad preventative and therapeutic measures for multiple flaviviruses.

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Interferon induced IFIT family genes in host antiviral defense.

Science.gov (United States)

Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

2013-01-01

Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Directory of Open Access Journals (Sweden)

Ivyna Pau Ni Bong

2016-11-01

Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Science.gov (United States)

Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

2016-01-01

Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Effects of gene silencing of CypB on gastric cancer cells.

Science.gov (United States)

Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

2015-04-01

To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

DEFF Research Database (Denmark)

Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

2011-01-01

organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

Novel Feline Leukemia Virus Interference Group Based on the env Gene.

Science.gov (United States)

Miyake, Ariko; Watanabe, Shinya; Hiratsuka, Takahiro; Ito, Jumpei; Ngo, Minh Ha; Makundi, Isaac; Kawasaki, Junna; Endo, Yasuyuki; Tsujimoto, Hajime; Nishigaki, Kazuo

2016-05-01

Feline leukemia virus (FeLV) subgroups have emerged in infected cats via the mutation or recombination of the env gene of subgroup A FeLV (FeLV-A), the primary virus. We report the isolation and characterization of a novel env gene, TG35-2, and report that the TG35-2 pseudotype can be categorized as a novel FeLV subgroup. The TG35-2 envelope protein displays strong sequence identity to FeLV-A Env, suggesting that selection pressure in cats causes novel FeLV subgroups to emerge. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

Science.gov (United States)

Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

2014-07-01

Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

Type I J-domain NbMIP1 proteins are required for both Tobacco mosaic virus infection and plant innate immunity.

Directory of Open Access Journals (Sweden)

Yumei Du

Full Text Available Tm-2² is a coiled coil-nucleotide binding-leucine rich repeat resistance protein that confers durable extreme resistance against Tomato mosaic virus (ToMV and Tobacco mosaic virus (TMV by recognizing the viral movement protein (MP. Here we report that the Nicotiana benthamiana J-domain MIP1 proteins (NbMIP1s associate with tobamovirus MP, Tm-2² and SGT1. Silencing of NbMIP1s reduced TMV movement and compromised Tm-2²-mediated resistance against TMV and ToMV. Furthermore, silencing of NbMIP1s reduced the steady-state protein levels of ToMV MP and Tm-2². Moreover, NbMIP1s are required for plant resistance induced by other R genes and the nonhost pathogen Pseudomonas syringae pv. tomato (Pst DC3000. In addition, we found that SGT1 associates with Tm-2² and is required for Tm-2²-mediated resistance against TMV. These results suggest that NbMIP1s function as co-chaperones during virus infection and plant immunity.

Analysis of energetically biased transcripts of viruses and transposable elements

Directory of Open Access Journals (Sweden)

Rodrigo Secolin

2012-01-01

Full Text Available RNA interference (RNAi is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC. Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs.

Analysis of energetically biased transcripts of viruses and transposable elements

Science.gov (United States)

Secolin, Rodrigo; Pascoal, Vinícius D’Ávila Bitencourt; Lopes-Cendes, Iscia; Pereira, Tiago Campos

2012-01-01

RNA interference (RNAi) is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs) are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC) in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC). Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs. PMID:23271949

Interferon γ-inducible protein (IFI) 16 transcriptionally regulates type i interferons and other interferon-stimulated genes and controls the interferon response to both DNA and RNA viruses.