Chloroquine inhibits dengue virus type 2 replication in Vero cells but not in C6/36 cells.

Science.gov (United States)

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU). These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.

[Establishment and application of a Vero cell line stably expressing raccoon dog SLAM, the cellular receptor of canine distemper virus].

Science.gov (United States)

Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei

2012-12-04

The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.

The influence of 60Co gamma rays to cell reproduction (An experiment using low dose levels on vero and primary monkey kidney cells)

International Nuclear Information System (INIS)

Danusupadmo, C.J. Sugiarto

1985-01-01

Vero and primary monkey kidney cells in culture were gamma irradiated with doses of 0, 0.4 and 0.8 Gy at a dose-rate of 1.30-1.45x10 3 Gy/hour. At harvest time 3 days post irradiation, 0.4 Gy proved to be able to lower the number of vero cells in such a degree that it became significantly different from the control, whereas 0.8 Gy could not suppress the number of primary cells to a level that differed significantly from its control. At harvest time of 7 days post irradiation, 0.4 Gy was found effective in lowering both vero and primary cells so that the number of the harvested cells were significantly different from the controls. At harvest time of 3 days post irradiation, 0.8 Gy caused both cell types reached levels that were not significantly different from 0.4 Gy, but at 7 days post irradiation the number of vero cells was very significantly different from that of 0.4 Gy, while the number of primary cells remained equal to that of 0.4 Gy. This phenomenon showed that irradiation could cause greater injurious effect at more advanced post irradiation times, while the more proliferative vero cells proved to be more susceptible to irradiation than primary cells, but at the same time more potential in performing repair. (author)

Avian metapneumovirus M2:2 protein inhibits replication in Vero cells: modification facilitates live vaccine development.

Science.gov (United States)

Clubbe, Jayne; Naylor, Clive J

2011-11-28

Throughout the world, avian metapneumovirus (AMPV) infection of subtype A is principally controlled by two live vaccines both derived from UK field strain #8544. Improvements of those vaccines by use of reverse genetics technology was found to be hampered by the inability of #8544 to replicate in the commonly exploited Vero cell based reverse genetics system. A systematic reverse genetics based genome modification of a DNA copy of #8544, employing sequence data from a Vero grown, #8544 derived, live vaccine; was used to determine mutations required to facilitate virus recovery and replication in Vero cells. This identified a single coding substitution in the M2:2 reading frame as responsible. Furthermore, ablation of M2:2 was found to elicit the same outcome. M2:2 sequence analysis of seven AMPVs found Vero cell adaption to be associated with non similar amino acid changes in M2:2. The study shows that M2:2 modification of field virus #8544 will enable research leading to improved vaccines. This may have more general application to other AMPV field strains. Copyright © 2011 Elsevier Ltd. All rights reserved.

Adaptation of high-growth influenza H5N1 vaccine virus in Vero cells: implications for pandemic preparedness.

Directory of Open Access Journals (Sweden)

Yu-Fen Tseng

Full Text Available Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14, a reassortant virus between A/Vietnam/1194/2004 (H5N1 virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15 was generated and can grow over 10(8 TCID(50/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes.

A purified inactivated Japanese encephalitis virus vaccine made in Vero cells.

Science.gov (United States)

Srivastava, A K; Putnak, J R; Lee, S H; Hong, S P; Moon, S B; Barvir, D A; Zhao, B; Olson, R A; Kim, S O; Yoo, W D; Towle, A C; Vaughn, D W; Innis, B L; Eckels, K H

2001-08-14

A second generation, purified, inactivated vaccine (PIV) against Japanese encephalitis (JE) virus was produced and tested in mice where it was found to be highly immunogenic and protective. The JE-PIV was made from an attenuated strain of JE virus propagated in certified Vero cells, purified, and inactivated with formalin. Its manufacture followed current GMP guidelines for the production of biologicals. The manufacturing process was efficient in generating a high yield of virus, essentially free of contaminating host cell proteins and nucleic acids. The PIV was formulated with aluminum hydroxide and administered to mice by subcutaneous inoculation. Vaccinated animals developed high-titered JE virus neutralizing antibodies in a dose dependent fashion after two injections. The vaccine protected mice against morbidity and mortality after challenge with live, virulent, JE virus. Compared with the existing licensed mouse brain-derived vaccine, JE-Vax, the Vero cell-derived JE-PIV was more immunogenic and as effective as preventing encephalitis in mice. The JE-PIV is currently being tested for safety and immunogenicity in volunteers.

TIM1 (HAVCR1 Is Not Essential for Cellular Entry of Either Quasi-enveloped or Naked Hepatitis A Virions

Directory of Open Access Journals (Sweden)

Anshuman Das

2017-09-01

Full Text Available Receptor molecules play key roles in the cellular entry of picornaviruses, and TIM1 (HAVCR1 is widely accepted to be the receptor for hepatitis A virus (HAV, an unusual, hepatotropic human picornavirus. However, its identification as the hepatovirus receptor predated the discovery that hepatoviruses undergo nonlytic release from infected cells as membrane-cloaked, quasi-enveloped HAV (eHAV virions that enter cells via a pathway distinct from naked, nonenveloped virions. We thus revisited the role of TIM1 in hepatovirus entry, examining both adherence and infection/replication in cells with clustered regularly interspaced short palindromic repeat (CRISPR/Cas9-engineered TIM1 knockout. Cell culture-derived, gradient-purified eHAV bound Huh-7.5 human hepatoma cells less efficiently than naked HAV at 4°C, but eliminating TIM1 expression caused no difference in adherence of either form of HAV, nor any impact on infection and replication in these cells. In contrast, TIM1-deficient Vero cells showed a modest reduction in quasi-enveloped eHAV (but not naked HAV attachment and replication. Thus, TIM1 facilitates quasi-enveloped eHAV entry in Vero cells, most likely by binding phosphatidylserine (PtdSer residues on the eHAV membrane. Both Tim1−/− Ifnar1−/− and Tim4−/− Ifnar1−/− double-knockout mice were susceptible to infection upon intravenous challenge with infected liver homogenate, with fecal HAV shedding and serum alanine aminotransferase (ALT elevations similar to those in Ifnar1−/− mice. However, intrahepatic HAV RNA and ALT elevations were modestly reduced in Tim1−/−Ifnar1−/− mice compared to Ifnar1−/− mice challenged with a lower titer of gradient-purified HAV or eHAV. We conclude that TIM1 is not an essential hepatovirus entry factor, although its PtdSer-binding activity may contribute to the spread of quasi-enveloped virus and liver injury in mice.

A NEW COPPER (II)-IMIDAZOLE DERIVATIVE EFFECTIVELY INHIBITS REPLICATION OF DENV-2 IN VERO CELL

Science.gov (United States)

Sucipto, Teguh Hari; Churrotin, Siti; Setyawati, Harsasi; Martak, Fahimah; Mulyatno, Kris Cahyo; Amarullah, Ilham Harlan; Kotaki, Tomohiro; Kameoka, Masanori; Yotopranoto, Subagyo; Soegijanto, and Soegeng

2018-01-01

Background: Dengue is a kind of infectious disease that was distributed in the tropical and sub-tropical areas. To date, there is no clinically approved dengue vaccine or antiviral for humans, even though there have been great efforts towards this end. Therefore, finding the effective compound against dengue virus (DENV) replication is very important. Among the complex compounds, copper(II)-imidazole derivatives are of interest because of their biological and medicinal benefits. Materials and Methods: In the present study, antiviral activity of [Cu(2,4,5-triphenylimidazole)2]n, was evaluated against different stages of dengue virus type 2 (DENV-2) replication in Vero cell using focus forming unit reduction assay and quantitative ELISA. Results: [Cu(2,4,5-triphenylimidazole)2]n inhibited DENV-2 replication in Vero cells with IC50 = 2.3 μg/ml and SI= 19.42 when cells were treated 2 days after virus infection, whereas its CC50 for cytotoxicity to Vero cells was 44.174 μg/ml. Conclusion: The compound has high anti-DENV2 activity, less toxicity, and a high possibility to be considered a drug candidate. PMID:29619441

Virus-producing cells determine the host protein profiles of HIV-1 virion cores

Science.gov (United States)

2012-01-01

Background Upon HIV entry into target cells, viral cores are released and rearranged into reverse transcription complexes (RTCs), which support reverse transcription and also protect and transport viral cDNA to the site of integration. RTCs are composed of viral and cellular proteins that originate from both target and producer cells, the latter entering the target cell within the viral core. However, the proteome of HIV-1 viral cores in the context of the type of producer cells has not yet been characterized. Results We examined the proteomic profiles of the cores purified from HIV-1 NL4-3 virions assembled in Sup-T1 cells (T lymphocytes), PMA and vitamin D3 activated THP1 (model of macrophages, mMΦ), and non-activated THP1 cells (model of monocytes, mMN) and assessed potential involvement of identified proteins in the early stages of infection using gene ontology information and data from genome-wide screens on proteins important for HIV-1 replication. We identified 202 cellular proteins incorporated in the viral cores (T cells: 125, mMΦ: 110, mMN: 90) with the overlap between these sets limited to 42 proteins. The groups of RNA binding (29), DNA binding (17), cytoskeleton (15), cytoskeleton regulation (21), chaperone (18), vesicular trafficking-associated (12) and ubiquitin-proteasome pathway-associated proteins (9) were most numerous. Cores of the virions from SupT1 cells contained twice as many RNA binding proteins as cores of THP1-derived virus, whereas cores of virions from mMΦ and mMN were enriched in components of cytoskeleton and vesicular transport machinery, most probably due to differences in virion assembly pathways between these cells. Spectra of chaperones, cytoskeletal proteins and ubiquitin-proteasome pathway components were similar between viral cores from different cell types, whereas DNA-binding and especially RNA-binding proteins were highly diverse. Western blot analysis showed that within the group of overlapping proteins, the level of

Lipophilic organic pollutants induce changes in phospholipid and membrane protein composition leading to Vero cell morphological change.

Science.gov (United States)

Liao, Ting T; Wang, Lei; Jia, Ru W; Fu, Xiao H; Chua, Hong

2014-01-01

Membrane damage related to morphological change in Vero cells is a sensitive index of the composite biotoxicity of trace lipophilic chemicals. However, judging whether the morphological change in Vero cells happens and its ratio are difficult because it is not a quantitative characteristic. To find biomarkers of cell morphological change for quantitatively representing the ratio of morphological changed cell, the mechanism of cell membrane damage driven by typical lipophilic chemicals, such as trichlorophenol (TCP) and perfluorooctanesulphonate (PFOS), was explored. The ratio of morphologically changed cells generally increased with increased TCP or PFOS concentrations, and the level of four major components of phospholipids varied with concentrations of TCP or PFOS, but only the ratio of phosphatidylcholine (PC)/phosphatidylethanolamine (PE) decreased regularly as TCP or PFOS concentrations increased. Analysis of membrane proteins showed that the level of vimentin in normal cell membranes is high, while it decreases or vanishes after TCP exposure. These variations in phospholipid and membrane protein components may result in membrane leakage and variation in rigid structure, which leads to changes in cell morphology. Therefore, the ratio of PC/PE and amount of vimentin may be potential biomarkers for representing the ratio of morphological changed Vero cell introduced by trace lipophilic compounds, thus their composite bio-toxicity.

Morphogenesis of the infectious HIV-1 virion

Directory of Open Access Journals (Sweden)

Jun-Ichi eSakuragi

2011-12-01

Full Text Available The virion of HIV-1 is spherical and viral glycoprotein spikes (gp120, gp41 protrude from its envelope. The characteristic cone-shaped core exists within the virion, caging the ribonucleoprotein (RNP complex, which is comprised of viral RNA, nucleocapsid (NC and viral enzymes. The HIV-1 virion is budded and released from the infected cell as an immature donut-shaped particle. During or immediately after release, viral protease (PR is activated and subsequently processes the viral structural protein Gag. Through this maturation process, virions acquire infectivity, but its mechanism and transition of morphology largely remain unclear. Recent technological advances in experimental devices and techniques have made it possible to closely dissect the viral production site on the cell, the exterior – or even the interior – of an individual virion, and many new aspects on virion morphology and maturation. In this manuscript, I review the morphogenesis of HIV-1 virions. I focus on several studies, including some of our recent findings, which examined virion formation and/or maturation processes. The story of novel compound, which inhibits virion maturation, and the importance of maturation research are also discussed.

Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance

Science.gov (United States)

Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen

2015-01-01

The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

Assessment of cytotoxicity of Portulaca oleracea Linn. against human colon adenocarcinoma and vero cell line

Science.gov (United States)

Mali, Prashant Y.

2015-01-01

Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374

Broad target cell selectivity of Kaposi's sarcoma-associated herpesvirus glycoprotein-mediated cell fusion and virion entry

International Nuclear Information System (INIS)

Kaleeba, Johnan A.R.; Berger, Edward A.

2006-01-01

The molecular mechanism of Kaposi's sarcoma-associated herpesvirus (KSHV, human herpesvirus 8) entry is poorly understood. We tested a broad variety of cell types of diverse species and tissue origin for their ability to function as targets in a quantitative reporter gene assay for KSHV-glycoprotein-mediated cell fusion. Several human, non-human primate, and rabbit cell lines were efficient targets, whereas rodent and all human lymphoblastoid cell lines were weak targets. Parallel findings were obtained with a virion entry assay using a recombinant KSHV encoding a reporter gene. No correlation was observed between target cell activity and surface expression of α3β1 integrin, a proposed KSHV receptor. We hypothesize that target cell permissiveness in both the cell fusion and virion entry assays reflects the presence of a putative KSHV fusion-entry receptor

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

Energy Technology Data Exchange (ETDEWEB)

Clark, Kristina B. [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); Hsiao, Hui-Mien; Bassit, Leda [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Crowe, James E. [Departments of Pediatrics, Pathology, Microbiology, and Immunology, Vanderbilt University, Nashville, TN (United States); Schinazi, Raymond F. [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Perng, Guey Chuen [Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Villinger, Francois [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); New Iberia Research Center, University of Louisiana at Lafayette, New Iberia, LA (United States)

2016-06-15

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

International Nuclear Information System (INIS)

Clark, Kristina B.; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E.; Schinazi, Raymond F.; Perng, Guey Chuen; Villinger, Francois

2016-01-01

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

[Cytotoxic effect of Vibrio cholerae non-O1 on Vero cells].

Science.gov (United States)

Figueroa-Arredondo, P; García-Lozano, H; Gutiérrez-Cogco, L; Valdespino-Gómez, J L

1994-01-01

At the present time there is still in Mexico a diarrhoeal outbreak due to Vibrio cholerae O1. In INDRE we have isolated from the same outbreak last year (jan-apr), 70 strains of Vibrio cholerae Non-O1. These were isolated from patients with a diarrhoeal illness different from cholera. Patients were of different ages and sex, and from various geographic areas. The isolated strains were confirmed by serological agglutination test with polyclonal antisera, and they neither belong to O1 serogroup or O139. We assayed all the 70 strains in Vero cells, searching for cytotoxic effect, probably attributed to cholera toxin, or any other toxin. The strains were screened by PCR for cholera toxin gene detection, and negative results were obtained. We have found only one CT-producer strain, but it was a rough one so, we are not able to affirm that is not a V. cholerae O1 serotype. Vibrio cholerae Non-O1 strains, tested in Vero cells assay, produced cytotoxic effect within 24 h. It was found that 48/70 strains (66.6%), had cytotoxic activity, showing rounding and then lysis of cells. From our results we concluded that this cytotoxic effect, is not cholera toxin related, instead we propose it could be due to an unknown virulence factor, probably a different toxin in mexican Vibrio cholerae Non-O1 strains.

Purification of infectious human herpesvirus 6A virions and association of host cell proteins

Directory of Open Access Journals (Sweden)

Garoff Henrik

2007-10-01

Full Text Available Abstract Background Viruses that are incorporating host cell proteins might trigger autoimmune diseases. It is therefore of interest to identify possible host proteins associated with viruses, especially for enveloped viruses that have been suggested to play a role in autoimmune diseases, like human herpesvirus 6A (HHV-6A in multiple sclerosis (MS. Results We have established a method for rapid and morphology preserving purification of HHV-6A virions, which in combination with parallel analyses with background control material released from mock-infected cells facilitates qualitative and quantitative investigations of the protein content of HHV-6A virions. In our iodixanol gradient purified preparation, we detected high levels of viral DNA by real-time PCR and viral proteins by metabolic labelling, silver staining and western blots. In contrast, the background level of cellular contamination was low in the purified samples as demonstrated by the silver staining and metabolic labelling analyses. Western blot analyses showed that the cellular complement protein CD46, the receptor for HHV-6A, is associated with the purified and infectious virions. Also, the cellular proteins clathrin, ezrin and Tsg101 are associated with intact HHV-6A virions. Conclusion Cellular proteins are associated with HHV-6A virions. The relevance of the association in disease and especially in autoimmunity will be further investigated.

TIM1 (HAVCR1) Is Not Essential for Cellular Entry of Either Quasi-enveloped or Naked Hepatitis A Virions.

Science.gov (United States)

Das, Anshuman; Hirai-Yuki, Asuka; González-López, Olga; Rhein, Bethany; Moller-Tank, Sven; Brouillette, Rachel; Hensley, Lucinda; Misumi, Ichiro; Lovell, William; Cullen, John M; Whitmire, Jason K; Maury, Wendy; Lemon, Stanley M

2017-09-05

Receptor molecules play key roles in the cellular entry of picornaviruses, and TIM1 (HAVCR1) is widely accepted to be the receptor for hepatitis A virus (HAV), an unusual, hepatotropic human picornavirus. However, its identification as the hepatovirus receptor predated the discovery that hepatoviruses undergo nonlytic release from infected cells as membrane-cloaked, quasi-enveloped HAV (eHAV) virions that enter cells via a pathway distinct from naked, nonenveloped virions. We thus revisited the role of TIM1 in hepatovirus entry, examining both adherence and infection/replication in cells with clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-engineered TIM1 knockout. Cell culture-derived, gradient-purified eHAV bound Huh-7.5 human hepatoma cells less efficiently than naked HAV at 4°C, but eliminating TIM1 expression caused no difference in adherence of either form of HAV, nor any impact on infection and replication in these cells. In contrast, TIM1-deficient Vero cells showed a modest reduction in quasi-enveloped eHAV (but not naked HAV) attachment and replication. Thus, TIM1 facilitates quasi-enveloped eHAV entry in Vero cells, most likely by binding phosphatidylserine (PtdSer) residues on the eHAV membrane. Both Tim1 -/- Ifnar1 -/- and Tim4 -/- Ifnar1 -/- double-knockout mice were susceptible to infection upon intravenous challenge with infected liver homogenate, with fecal HAV shedding and serum alanine aminotransferase (ALT) elevations similar to those in Ifnar1 -/- mice. However, intrahepatic HAV RNA and ALT elevations were modestly reduced in Tim1 -/- Ifnar1 -/- mice compared to Ifnar1 -/- mice challenged with a lower titer of gradient-purified HAV or eHAV. We conclude that TIM1 is not an essential hepatovirus entry factor, although its PtdSer-binding activity may contribute to the spread of quasi-enveloped virus and liver injury in mice. IMPORTANCE T cell immunoglobulin and mucin-containing domain protein 1 (TIM1) was reported more than

Production of Newcastle Disease Virus by Vero Cells Grown on Cytodex 1 Microcarriers in a 2-Litre Stirred Tank Bioreactor

Directory of Open Access Journals (Sweden)

Mohd Azmir Arifin

2010-01-01

Full Text Available The aim of this study is to prepare a model for the production of Newcastle disease virus (NDV lentogenic F strain using cell culture in bioreactor for live attenuated vaccine preparation. In this study, firstly we investigated the growth of Vero cells in several culture media. The maximum cell number was yielded by culture of Vero cells in Dulbecco's Modified Eagle Medium (DMEM which was 1.93×106 cells/ml. Secondly Vero cells were grown in two-litre stirred tank bioreactor by using several commercial microcarriers. We achieved the maximum cell concentration about 7.95×105 cells/ml when using Cytodex 1. Later we produced Newcastle Disease virus in stirred tank bioreactor based on the design developed using Taguchi L4 method. Results reveal that higher multiplicity of infection (MOI and size of cell inoculums can yield higher virus titer. Finally, virus samples were purified using high-speed centrifugation based on 3∗∗(3-1 Fractional Factorial Design. Statistical analysis showed that the maximum virus titer can be achieved at virus sample concentration of 58.45% (v/v, centrifugation speed of 13729 rpm, and centrifugation time of 4 hours. As a conclusion, high yield of virus titer could be achieved through optimization of cell culture in bioreactor and separation by high-speed centrifugation.

Antigenic properties of the human immunodeficiency virus envelope glycoprotein gp120 on virions bound to target cells.

Directory of Open Access Journals (Sweden)

Meron Mengistu

2015-03-01

Full Text Available The HIV-1 envelope glycoprotein, gp120, undergoes multiple molecular interactions and structural rearrangements during the course of host cell attachment and viral entry, which are being increasingly defined at the atomic level using isolated proteins. In comparison, antigenic markers of these dynamic changes are essentially unknown for single HIV-1 particles bound to target cells. Such markers should indicate how neutralizing and/or non-neutralizing antibodies might interdict infection by either blocking infection or sensitizing host cells for elimination by Fc-mediated effector function. Here we address this deficit by imaging fluorescently labeled CCR5-tropic HIV-1 pseudoviruses using confocal and superresolution microscopy to track the exposure of neutralizing and non-neutralizing epitopes as they appear on single HIV-1 particles bound to target cells. Epitope exposure was followed under conditions permissive or non-permissive for viral entry to delimit changes associated with virion binding from those associated with post-attachment events. We find that a previously unexpected array of gp120 epitopes is exposed rapidly upon target cell binding. This array comprises both neutralizing and non-neutralizing epitopes, the latter being hidden on free virions yet capable of serving as potent targets for Fc-mediated effector function. Under non-permissive conditions for viral entry, both neutralizing and non-neutralizing epitope exposures were relatively static over time for the majority of bound virions. Under entry-permissive conditions, epitope exposure patterns changed over time on subsets of virions that exhibited concurrent variations in virion contents. These studies reveal that bound virions are distinguished by a broad array of both neutralizing and non-neutralizing gp120 epitopes that potentially sensitize a freshly engaged target cell for destruction by Fc-mediated effector function and/or for direct neutralization at a post-binding step

Virion assembly factories in the nucleus of polyomavirus-infected cells.

Directory of Open Access Journals (Sweden)

Kimberly D Erickson

Full Text Available Most DNA viruses replicate in the cell nucleus, although the specific sites of virion assembly are as yet poorly defined. Electron microscopy on freeze-substituted, plastic-embedded sections of murine polyomavirus (PyV-infected 3T3 mouse fibroblasts or mouse embryonic fibroblasts (MEFs revealed tubular structures in the nucleus adjacent to clusters of assembled virions, with virions apparently "shed" or "budding" from their ends. Promyelocytic leukemia nuclear bodies (PML-NBs have been suggested as possible sites for viral replication of polyomaviruses (BKV and SV40, herpes simplex virus (HSV, and adenovirus (Ad. Immunohistochemistry and FISH demonstrated co-localization of the viral T-antigen (Tag, PyV DNA, and the host DNA repair protein MRE11, adjacent to the PML-NBs. In PML⁻/⁻ MEFs the co-localization of MRE11, Tag, and PyV DNA remained unchanged, suggesting that the PML protein itself was not responsible for their association. Furthermore, PyV-infected PML⁻/⁻ MEFs and PML⁻/⁻ mice replicated wild-type levels of infectious virus. Therefore, although the PML protein may identify sites of PyV replication, neither the observed "virus factories" nor virus assembly were dependent on PML. The ultrastructure of the tubes suggests a new model for the encapsidation of small DNA viruses.

Serum-free microcarrier based production of replication deficient Influenza vaccine candidate virus lacking NS1 using Vero cells

Directory of Open Access Journals (Sweden)

Yan Mylene L

2011-08-01

Full Text Available Abstract Background Influenza virus is a major health concern that has huge impacts on the human society, and vaccination remains as one of the most effective ways to mitigate this disease. Comparing the two types of commercially available Influenza vaccine, the live attenuated virus vaccine is more cross-reactive and easier to administer than the traditional inactivated vaccines. One promising live attenuated Influenza vaccine that has completed Phase I clinical trial is deltaFLU, a deletion mutant lacking the viral Nonstructural Protein 1 (NS1 gene. As a consequence of this gene deletion, this mutant virus can only propagate effectively in cells with a deficient interferon-mediated antiviral response. To demonstrate the manufacturability of this vaccine candidate, a batch bioreactor production process using adherent Vero cells on microcarriers in commercially available animal-component free, serum-free media is described. Results Five commercially available animal-component free, serum-free media (SFM were evaluated for growth of Vero cells in agitated Cytodex 1 spinner flask microcarrier cultures. EX-CELL Vero SFM achieved the highest cell concentration of 2.6 × 10^6 cells/ml, whereas other SFM achieved about 1.2 × 10^6 cells/ml. Time points for infection between the late exponential and stationary phases of cell growth had no significant effect in the final virus titres. A virus yield of 7.6 Log10 TCID50/ml was achieved using trypsin concentration of 10 μg/ml and MOI of 0.001. The Influenza vaccine production process was scaled up to a 3 liter controlled stirred tank bioreactor to achieve a cell density of 2.7 × 10^6 cells/ml and virus titre of 8.3 Log10 TCID50/ml. Finally, the bioreactor system was tested for the production of the corresponding wild type H1N1 Influenza virus, which is conventionally used in the production of inactivated vaccine. High virus titres of up to 10 Log10 TCID50/ml were achieved. Conclusions We describe for the

Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

Directory of Open Access Journals (Sweden)

Warrilow David

2008-12-01

Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

International Nuclear Information System (INIS)

Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.

1986-01-01

The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated 35 S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with 32 P-ATP (in vitro method) or 32 Pi (in vivo method). Finally, analysis of 3 H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells

Generation of a Vero-Based Packaging Cell Line to Produce SV40 Gene Delivery Vectors for Use in Clinical Gene Therapy Studies

Directory of Open Access Journals (Sweden)

Miguel G. Toscano

2017-09-01

Full Text Available Replication-defective (RD recombinant simian virus 40 (SV40-based gene delivery vectors hold a great potential for clinical applications because of their presumed non-immunogenicity and capacity to induce immune tolerance to the transgene products in humans. However, the clinical use of SV40 vectors has been hampered by the lack of a packaging cell line that produces replication-competent (RC free SV40 particles in the vector production process. To solve this problem, we have adapted the current SV40 vector genome used for the production of vector particles and generated a novel Vero-based packaging cell line named SuperVero that exclusively expresses the SV40 large T antigen. SuperVero cells produce similar numbers of SV40 vector particles compared to the currently used packaging cell lines, albeit in the absence of contaminating RC SV40 particles. Our unique SV40 vector platform named SVac paves the way to clinically test a whole new generation of SV40-based therapeutics for a broad range of important diseases.

Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

International Nuclear Information System (INIS)

Sandvig, K.; Olsnes, S.

1988-01-01

Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of 45 Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

International Nuclear Information System (INIS)

Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.

2013-01-01

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

Energy Technology Data Exchange (ETDEWEB)

Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)

2013-07-05

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

International Nuclear Information System (INIS)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang

2012-01-01

Highlights: ► Vero cell-based HPAI H5N1 vaccine with stable high yield. ► Stable high yield derived from the YNVa H3N2 backbone. ► H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains

Directory of Open Access Journals (Sweden)

Geyer Matthias

2007-10-01

Full Text Available Abstract Background The Nef protein of Human Immunodeficiency Viruses optimizes viral spread in the infected host by manipulating cellular transport and signal transduction machineries. Nef also boosts the infectivity of HIV particles by an unknown mechanism. Recent studies suggested a correlation between the association of Nef with lipid raft microdomains and its positive effects on virion infectivity. Furthermore, the lipidome analysis of HIV-1 particles revealed a marked enrichment of classical raft lipids and thus identified HIV-1 virions as an example for naturally occurring membrane microdomains. Since Nef modulates the protein composition and function of membrane microdomains we tested here if Nef also has the propensity to alter microdomain lipid composition. Results Quantitative mass spectrometric lipidome analysis of highly purified HIV-1 particles revealed that the presence of Nef during virus production from T lymphocytes enforced their raft character via a significant reduction of polyunsaturated phosphatidylcholine species and a specific enrichment of sphingomyelin. In contrast, Nef did not significantly affect virion levels of phosphoglycerolipids or cholesterol. The observed alterations in virion lipid composition were insufficient to mediate Nef's effect on particle infectivity and Nef augmented virion infectivity independently of whether virus entry was targeted to or excluded from membrane microdomains. However, altered lipid compositions similar to those observed in virions were also detected in detergent-resistant membrane preparations of virus producing cells. Conclusion Nef alters not only the proteome but also the lipid composition of host cell microdomains. This novel activity represents a previously unrecognized mechanism by which Nef could manipulate HIV-1 target cells to facilitate virus propagation in vivo.

DETECTION OF HUMAN ANTI-ZIKA VIRUS IgG BY ELISA USING AN ANTIGEN FROM in vitro INFECTED VERO CELLS: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

Laura Masami SUMITA

Full Text Available SUMMARY Zika virus (ZKV infection is a huge public health problem in Brazil because of the increased incidence of microcephaly in neonates from infected mothers. Detection of specific IgG antibodies in maternal serum samples constitutes an important approach for diagnosing ZKV infection and evaluating its relationship with neonatal microcephaly. However, as there is no serological test produced in Brazil to detect IgM and IgG antibodies against ZKV, we sought to examine specific IgG in serum samples from patients or suspected mothers to detect previous infection and to test for specificity with regard to flaviviral infections occurring in the same area. Brazilian Zika virus native antigens were obtained from infected Vero cell layers or free virions in the culture medium and then used in ELISA. We tested sera from eight ZKV RNA-diagnosed infected patients (ZKVR, seven neonates with microcephaly and their mothers after delivery (MM, 140 dengue virus IgM-positive (DM and IgG (DG-positive patients, and 100 yellow fever (YF-vaccinated patients. According to the ELISA, ZKVR samples were mostly positive (7/8, and all the MM serum samples were positive for ZKV IgG (7/7. In contrast, cross-reactions for dengue or yellow fever-vaccinated patients were observed, including DM (48/95, DG (10/45 or YF (3/100 serum samples; however, these cross-reactions exhibited low antigen avidity so that 6 M urea largely removed this cross-reactivity, with only a few cross-reacting samples remaining (8/140. ELISA based on extracted virions was much more specific, with all ZKVR (8/8 and MM sera being positive for ZKV IgG (7/7 and only borderline cross-reactivity found for DM (6/95, DG (3/45 or YF (4/100-vaccinated serum samples. This technique (ELISA can identify specific IgG in ZKV-infected patients and may be helpful in diagnosing congenital infetions after maternal RNA virus clearance or in epidemiological studies.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

Energy Technology Data Exchange (ETDEWEB)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China); Wang, Yue [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People' s Republic of China (China); Liao, Guoyang [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

Reduction of virion-associated σ1 fibers on oncolytic reovirus variants promotes adaptation toward tumorigenic cells.

Science.gov (United States)

Mohamed, Adil; Teicher, Carmit; Haefliger, Sarah; Shmulevitz, Maya

2015-04-01

Wild-type mammalian orthoreovirus serotype 3 Dearing (T3wt) is nonpathogenic in humans but preferentially infects and kills cancer cells in culture and demonstrates promising antitumor activity in vivo. Using forward genetics, we previously isolated two variants of reovirus, T3v1 and T3v2, with increased infectivity toward a panel of cancer cell lines and improved in vivo oncolysis in a murine melanoma model relative to that of T3wt. Our current study explored how mutations in T3v1 and T3v2 promote infectivity. Reovirions contain trimers of σ1, the reovirus cell attachment protein, at icosahedral capsid vertices. Quantitative Western blot analysis showed that purified T3v1 and T3v2 virions had ∼ 2- and 4-fold-lower levels of σ1 fiber than did T3wt virions. Importantly, using RNA interference to reduce σ1 levels during T3wt production, we were able to generate wild-type reovirus with reduced levels of σ1 per virion. As σ1 levels were reduced, virion infectivity increased by 2- to 5-fold per cell-bound particle, demonstrating a causal relationship between virion σ1 levels and the infectivity of incoming virions. During infection of tumorigenic L929 cells, T3wt, T3v1, and T3v2 uncoated the outer capsid proteins σ3 and μ1C at similar rates. However, having started with fewer σ1 molecules, a complete loss of σ1 was achieved sooner for T3v1 and T3v2. Distinct from intracellular uncoating, chymotrypsin digestion, as a mimic of natural enteric infection, resulted in more rapid σ3 and μ1C removal, unique disassembly intermediates, and a rapid loss of infectivity for T3v1 and T3v2 compared to T3wt. Optimal infectivity toward natural versus therapeutic niches may therefore require distinct reovirus structures and σ1 levels. Wild-type reovirus is currently in clinical trials as a potential cancer therapy. Our molecular studies on variants of reovirus with enhanced oncolytic activity in vitro and in vivo now show that distinct reovirus structures promote

The pestivirus Erns glycoprotein interacts with E2 in both infected cells and mature virions

International Nuclear Information System (INIS)

Lazar, Catalin; Zitzmann, Nicole; Dwek, Raymond A.; Branza-Nichita, Norica

2003-01-01

E rns is a pestivirus envelope glycoprotein indispensable for virus attachment and infection of target cells. Unlike the other two envelope proteins E1 and E2, E rns lacks a transmembrane domain and a vast quantity is secreted into the medium of infected cells. The protein is also present in fractions of pure pestivirus virions, raising the important and intriguing question regarding the mechanism of its attachment to the pestivirus envelope. In this study a direct interaction between E rns and E2 glycoproteins was demonstrated in both pestivirus-infected cells and mature virions. By co- and sequential immunoprecipitation we showed that an E rns -E2 heterodimer is assembled very early after translation of the viral polyprotein and before its processing is completed. Our results suggest that E rns is attached to the pestivirus envelope via a direct interaction with E2 and explain the role of E rns in the initial virus-target cell interaction

Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells

OpenAIRE

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR a...

Benefits of oxygen and nitrogen plasma treatment in Vero cell affinity to poly(lactide-co-glycolide acid

Directory of Open Access Journals (Sweden)

Andrea Rodrigues Esposito

2013-01-01

Full Text Available Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. it is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. in this study, poly(lactide-co-glycolide, plga, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on vero cells culture. the plga membranes, which were characterized by sem and contact angle, showed increased surface rugosity and narrower contact angles. cell adhesion, cytotoxicity assay, sem and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction. Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. It is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. Plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. In this study, poly(lactide-co-glycolide, PLGA, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on Vero cells culture. The PLGA membranes, which were characterized by SEM and contact angle, showed increased surface rugosity and narrower contact angles. Cell adhesion, cytotoxicity assay, SEM and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction.

Antioxidant and antigenotoxic role of recombinant human erythropoeitin against alkylating agents: cisplatin and mitomycin C in cultured Vero cells.

Science.gov (United States)

Rjiba-Touati, Karima; Ayed-Boussema, Imen; Soualeh, Nidhal; Achour, Abdellatif; Bacha, Hassen; Abid, Salwa

2013-08-01

Cisplatin (CDDP) and mitomycin C (MMC), two alkylating agents used against various solid tumours, are a common source of acute kidney injury. Thus, strategies for minimizing CDDP and MMC toxicity are of a clinical interest. In this study, we aimed to investigate the protective role of recombinant human erythropoietin (rhEPO) against oxidative stress and genotoxicity induced by CDDP and MMC in cultured Vero cells. Three types of treatments were performed: (i) cells were treated with rhEPO 24 h before exposure to CDDP/MMC (pre-treatment), (ii) cells were treated with rhEPO and CDDP/MMC simultaneously (co-treatment), (iii) cells were treated with rhEPO 24 h after exposure to CDDP/MMC (post-treatment). Our results showed that rhEPO decreased the reactive oxygen species levels, the malondialdehyde levels and ameliorated glutathione (reduced and oxidized glutathione) modulation induced by CDDP and MMC in cultured Vero cells. Furthermore, rhEPO administration prevented alkylating agents-induced DNA damage accessed by comet test. Altogether, our results suggested a protective role of rhEPO, against CDDP- and MMC-induced oxidative stress and genotoxicity, especially in pre-treatment condition.

Baculovirus virions displaying Plasmodium berghei circumsporozoite protein protect mice against malaria sporozoite infection

International Nuclear Information System (INIS)

Yoshida, Shigeto; Kondoh, Daisuke; Arai, Eriko; Matsuoka, Hiroyuki; Seki, Chisato; Tanaka, Takao; Okada, Masaji; Ishii, Akira

2003-01-01

The display of foreign proteins on the surface of baculovirus virions has provided a tool for the analysis of protein-protein interactions and for cell-specific targeting in gene transfer applications. To evaluate the baculovirus display system as a vaccine vehicle, we have generated a recombinant baculovirus (AcNPV-CSPsurf) that displays rodent malaria Plasmodium berghei circumsporozoite protein (PbCSP) on the virion surface as a fusion protein with the major baculovirus envelope glycoprotein gp64. The PbCSP-gp64 fusion protein was incorporated and oligomerized on the virion surface and led to a 12-fold increase in the binding activity of AcNPV-CSPsurf virions to HepG2 cells. Immunization with adjuvant-free AcNPV-CSPsurf virions induced high levels of antibodies and gamma interferon-secreting cells against PbCSP and protected 60% of mice against sporozoite challenge. These data demonstrate that AcNPV-CSPsurf displays sporozoite-like PbCSP on the virion surface and possesses dual potentials as a malaria vaccine candidate and a liver-directed gene delivery vehicle

Efficient Capsid Antigen Presentation From Adeno-Associated Virus Empty Virions In Vivo.

Science.gov (United States)

Pei, Xiaolei; Earley, Lauriel Freya; He, Yi; Chen, Xiaojing; Hall, Nikita Elexa; Samulski, Richard Jude; Li, Chengwen

2018-01-01

Adeno-associated virus (AAV) vectors have been successfully applied in clinical trials for hemophilic patients. Although promising, the clinical results suggest that the capsid-specific CD8+T cell response has a negative effect on therapeutic success. In an in vitro analysis using an engineered AAV virus carrying immune-dominant SIINFEKL peptide in the capsid backbone, we have previously demonstrated that capsid antigen presentation from full (genome containing) AAV capsids requires endosome escape and is proteasome dependent and that no capsid antigen presentation is induced from empty virions. In the present study, we examined capsid antigen presentation from administration of empty virions in animal models. In wild-type mice, similar to AAV full particles, capsid antigen presentation from AAV empty virion infection was dose dependent, and the kinetics studies showed that antigen presentation was detected from 2 to 40 days after AAV empty virion administration. In the transporter associated with antigen processing 1 deficient (TAP-/-) mice, capsid antigen presentation was inhibited from both AAV full and empty virions, but higher inhibition was achieved from AAV full particle administration than that from empty virions. This indicates that the pathway of capsid antigen presentation from AAV transduction is dependent on proteasome-mediated degradation of AAV capsids (mainly for full particles) and that the endosomal pathway may also play a role in antigen presentation from empty particles but not full virions. The capsid antigen presentation efficiency from AAV preparations was positively correlated with the amount of empty virions contaminated with full particles. Collectively, the results indicate that contamination of AAV empty virions induces efficient antigen presentation in vivo and the mechanism of capsid antigen presentation from empty virions involves both endosomal and proteasomal pathways. The elucidation of capsid antigen presentation from AAV empty

Aggravation of cold-induced injury in Vero-B4 cells by RPMI 1640 medium – Identification of the responsible medium components

Directory of Open Access Journals (Sweden)

Pless-Petig Gesine

2012-10-01

Full Text Available Abstract Background In modern biotechnology, there is a need for pausing cell lines by cold storage to adapt large-scale cell cultures to the variable demand for their products. We compared various cell culture media/solutions for cold storage of Vero-B4 kidney cells, a cell line widely used in biotechnology. Results Cold storage in RPMI 1640 medium, a recommended cell culture medium for Vero-B4 cells, surprisingly, strongly enhanced cold-induced cell injury in these cells in comparison to cold storage in Krebs-Henseleit buffer or other cell culture media (DMEM, L-15 and M199. Manufacturer, batch, medium supplements and the most likely components with concentrations outside the range of the other media/solutions (vitamin B12, inositol, biotin, p-aminobenzoic acid did not cause this aggravation of cold-induced injury in RPMI 1640. However, a modified Krebs-Henseleit buffer with a low calcium concentration (0.42 mM, a high concentration of inorganic phosphate (5.6 mM, and glucose (11.1 mM; i.e. concentrations as in RPMI 1640 evoked a cell injury and loss of metabolic function corresponding to that observed in RPMI 1640. Deferoxamine improved cell survival and preserved metabolic function in modified Krebs-Henseleit buffer as well as in RPMI 1640. Similar Ca2+ and phosphate concentrations did not increase cold-induced cell injury in the kidney cell line LLC-PK1, porcine aortic endothelial cells or rat hepatocytes. However, more extreme conditions (Ca2+ was nominally absent and phosphate concentration raised to 25 mM as in the organ preservation solution University of Wisconsin solution also increased cold-induced injury in rat hepatocytes and porcine aortic endothelial cells. Conclusion These data suggest that the combination of low calcium and high phosphate concentrations in the presence of glucose enhances cold-induced, iron-dependent injury drastically in Vero-B4 cells, and that a tendency for this pathomechanism also exists in other cell types.

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Science.gov (United States)

Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad

2016-01-01

Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Directory of Open Access Journals (Sweden)

Mahmoud Huleihel

Full Text Available Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA was performed on the Raman spectra after principal component analysis (PCA with a leave one out (LOO approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines

Directory of Open Access Journals (Sweden)

Syahida Ahmad

2012-10-01

Full Text Available The direct feeding of Jatropha meal containing phorbol esters (PEs indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang and African green monkey kidney (Vero cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 μg/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA values as positive control i.e., 124.5 and 106.3 μg/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-δ and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-δ and caspase-3 as their mode of actions.

A Study on Recovery from Potentially Lethal Damage induced by γ-Irradiation in Plateau-phase Vero Cells in vitro

International Nuclear Information System (INIS)

Kim, Il Han; Choi, Eun Kyung; Ha, Sung Whan; Park, Charn Il; Cha, Chang Yong

1988-01-01

Recovery from potentially lethal damage (PLDR) after irradiation was studied in plateau-phase culture of Vero cells in vitro. Unfed plateau-phase cells were irradiated with dose of 1 to 9 Gy using Cs-137 irradiator. Cells then were incubated again and left in situ for 0, 1, 2, 3, 4, 5, 6 and 24 hours and then were trypsinized, explanted, and subcultured in fresh RPMI-1640 media containing 0.33% agar. Cell survival was measured by colony forming ability. An adequate number of heavily irradiated Vero cells were added as feeder cells to make the total cell number constant in every culture dish. As the postirradiation in situ incubation time increased, surviving fraction increased saturation level at 2 to 4 hours after in situ incubation. As the radiation dose increased, the rate of PLDR also increased. In analysis of cell survival curve fitted to the linear-quadratic model, the linear inactivation coefficient (a) decreased largely and reached nearly to zero but the quadratic inactivation coefficient (b) increased minimally by increment of postirradiation in situ incubation time. So PLDR mainly affected the damage expressed as a. In the multitarget model, significant change was not obtained in D0 but in Dq. Therefore, shoulder region in cell survival curve was mainly affected by PLDR and terminal slope was not influenced at all. And dose-modifying factor by PLDR was relatively higher in shoulder region, that is, in low dose area below 3 Gy

VERO MODA Settles in Taobao Mall

Institute of Scientific and Technical Information of China (English)

2010-01-01

@@ In the wake of the successive opening up of Jack&Jones' and ONLY's official flagship stores in Taobao Mall, the Danish Bestseller Fashion Group's other brand, VERO MODA, landed the Mall on July 2nd. At present, the first two brands' online sales have exceeded 500 million yuan per month. Based on the encouraging sales figures, VERO MODA, as Bestseller's third-largest brand on Taobao platform, is expected to scale new network marketing miracle.

BST2/CD317 counteracts human coronavirus 229E productive infection by tethering virions at the cell surface

Energy Technology Data Exchange (ETDEWEB)

Wang, Shiu-Mei [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan (China); Huang, Kuo-Jung [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Wang, Chin-Tien, E-mail: chintien@ym.edu.tw [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan (China)

2014-01-20

Bone marrow stromal antigen 2 (BST2), an interferon-inducible antiviral factor, has been shown to block the release of various enveloped viruses from cells. It has also been identified as an innate immune system component. Most enveloped viruses subject to BST2 restriction bud at the plasma membrane. Here we report our findings that (a) the production of human coronavirus 229E (HCoV-229E) progeny viruses, whose budding occurs at the ER-Golgi intermediate compartment (ERGIC), markedly decreases in the presence of BST2; and (b) BST2 knockdown expression results in enhanced HCoV-229E virion production. Electron microscopy analyses indicate that HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. Our results suggest that BST2 exerts a broad blocking effect against enveloped virus release, regardless of whether budding occurs at the plasma membrane or intracellular compartments. - Highlights: • BST2 knockdown expression results in enhanced HCoV-229E egress. • HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. • HCoV-229E infection at high MOI can significantly downregulate HeLa BST2 and rescue HIV-1 egress.

The influence of serum substituents on serum-free Vero cell conditioned culture media manufactured from Dulbecco's modified Eagle medium in mouse embryo culture.

Science.gov (United States)

Lee, Jong-Seon; Kim, Ju-Hwan; Seo, Young-Seok; Yang, Jung-Bo; Kim, Yong-Il; Kim, Hye-Jin; Lee, Ki-Hwan

2013-09-01

This study was conducted to examine the influences of supplementation of the serum substituents and available period of serum-free Vero cell conditioned media (SF-VCM) manufactured from Dulbecco's modified Eagle medium cultured with Vero cells for in vitro development of mouse preimplantation embryos. A total of 1,099 two-cell embryos collected from imprinting control region mice were cultured in SF-VCM with 10% and 20% human follicular fluid (hFF), serum substitute supplement (SSS), and serum protein substitute (SPS). Development of embryos was observed every 24 hours. Results between different groups were analyzed by chi-square test, and considered statistically significant when P-value was less than 0.05. The rates of embryonic development cultured in SF-VCM supplemented with serum substituents were significantly higher compare with serum-free group (P media up to 4 weeks did not affect on embryonic development.

Virions and intracellular nucleocapsids produced during mixed heterotypic influenza infection of MDCK cells

International Nuclear Information System (INIS)

Sklyanskaya, E.I.; Varich, N.L.; Amvrosieva, T.V.; Kaverin, N.V.

1985-01-01

Phenotypically mixed virus yields, obtained by coinfection of MDCK cells with influenza A/WSN/33 and B/Lee/40 viruses, contained both A/WSN/33 and B/Lee/40 NP proteins, as revealed by polyacrylamide gel electrophoresis of the purified 14 C-amino acids-labeled virus. Virions were lysed with 0.6 M KCl-Triton X-100 buffer, and nucleocapsids were immunoprecipitated with antibodies against NP protein of influenza A virus. Polyacrylamide gel electrophoresis of the immunoprecipitate revealed NP protein of A/WSN/33 but not of B/Lee/40 virus. However, in similar experiments with the lysates of doubly infected cells, the band of B/Lee/40 NP protein was revealed in the polyacrylamide gel electrophoresis patterns of the immunoprecipitates. In an attempt to analyze the RNA content of the immune complexes, the authors absorbed the lysates of doubly infected [ 3 H]uridine-labeled cells with protein A-containing Staphylococcus aureus covered with antibodies against the NP protein of influenza A virus. RNA extracted from the immune complexes contained genomic RNA segments of both A/WSN/33 and B/Lee/40 viruses. In control samples containing an artificial mixture of cell lysates separately infected with each virus, the analysis revealed homologous components (i.e., A/WSN/33 NP protein or RNA segments) in the immune complexes. The results suggest the presence of phenotypically mixed nucleocapsids in the cells doubly infected with influenza A and B viruses; in the course of the virion formation, the nucleocapsids lacking the heterologous NP protein are selected

Canine distemper virus utilizes different receptors to infect chicken embryo fibroblasts and vero cells.

Science.gov (United States)

Chen, Jun; Liang, Xiu; Chen, Pei-fu

2011-04-01

Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.

Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

Directory of Open Access Journals (Sweden)

Mendel Friedman

2013-08-01

Full Text Available Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1 in Vero cells by two independent assays: the green fluorescent protein (GFP assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed.

Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

International Nuclear Information System (INIS)

Yeung, Y.-S.; Yip, C.-W.; Hon, C.-C.; Chow, Ken Y.C.; Ma, Iris C.M.; Zeng Fanya; Leung, Frederick C.C.

2008-01-01

We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level

Abortive replication of Bombyx mori nucleopolyhedrovirus in Sf9 and High Five cells: Defective nuclear transport of the virions

International Nuclear Information System (INIS)

Katou, Yasuhiro; Ikeda, Motoko; Kobayashi, Michihiro

2006-01-01

Despite close genetic relationship, Bombyx mori nucleopolyhedrovirus (BmNPV) and Autographa californica multicapsid NPV (AcMNPV) display a distinct host range property. Here, BmNPV replication was examined in Sf9 and High Five cells that were nonproductive for BmNPV infection but supported high titers of AcMNPV replication. Recombinant BmNPV, vBm/gfp/lac, containing bm-ie1 promoter-driven egfp showed that few Sf9 and High Five cells infected with vBm/gfp/lac expressed EGFP, while large proportion of EGFP-expressing cells was observed when transfected with vBm/gfp/lac DNA. Immunocytochemical analysis showed that BmNPV was not imported into the nucleus of these two cell lines, while recombinant BmNPV, vBmΔ64/ac-gp64 possessing AcMNPV gp64 was imported into the nucleus, yielding progeny virions in High Five cells, but not Sf9 cells. These results indicate that the defective nuclear import of infected virions due to insufficient BmNPV GP64 function is involved in the restricted BmNPV replication in Sf9 and High Five cells

Characterization and detection of Vero cells infected with Herpes Simplex Virus type 1 using Raman spectroscopy and advanced statistical methods.

Science.gov (United States)

Salman, A; Shufan, E; Zeiri, L; Huleihel, M

2014-07-01

Herpes viruses are involved in a variety of human disorders. Herpes Simplex Virus type 1 (HSV-1) is the most common among the herpes viruses and is primarily involved in human cutaneous disorders. Although the symptoms of infection by this virus are usually minimal, in some cases HSV-1 might cause serious infections in the eyes and the brain leading to blindness and even death. A drug, acyclovir, is available to counter this virus. The drug is most effective when used during the early stages of the infection, which makes early detection and identification of these viral infections highly important for successful treatment. In the present study we evaluated the potential of Raman spectroscopy as a sensitive, rapid, and reliable method for the detection and identification of HSV-1 viral infections in cell cultures. Using Raman spectroscopy followed by advanced statistical methods enabled us, with sensitivity approaching 100%, to differentiate between a control group of Vero cells and another group of Vero cells that had been infected with HSV-1. Cell sites that were "rich in membrane" gave the best results in the differentiation between the two categories. The major changes were observed in the 1195-1726 cm(-1) range of the Raman spectrum. The features in this range are attributed mainly to proteins, lipids, and nucleic acids. Copyright © 2014. Published by Elsevier Inc.

Proteomic analysis of the herpes simplex virus 1 virion protein 16 transactivator protein in infected cells.

Science.gov (United States)

Suk, Hyung; Knipe, David M

2015-06-01

The herpes simplex virus 1 virion protein 16 (VP16) tegument protein forms a transactivation complex with the cellular proteins host cell factor 1 (HCF-1) and octamer-binding transcription factor 1 (Oct-1) upon entry into the host cell. VP16 has also been shown to interact with a number of virion tegument proteins and viral glycoprotein H to promote viral assembly, but no comprehensive study of the VP16 proteome has been performed at early times postinfection. We therefore performed a proteomic analysis of VP16-interacting proteins at 3 h postinfection. We confirmed the interaction of VP16 with HCF-1 and a large number of cellular Mediator complex proteins, but most surprisingly, we found that the major viral protein associating with VP16 is the infected cell protein 4 (ICP4) immediate-early (IE) transactivator protein. These results raise the potential for a new function for VP16 in associating with the IE ICP4 and playing a role in transactivation of early and late gene expression, in addition to its well-documented function in transactivation of IE gene expression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prosopis juliflora Pods Alkaloid-rich Fraction: In vitro Anthelmintic Activity on Goat Gastrointestinal Parasites and Its Cytotoxicity on Vero Cells.

Science.gov (United States)

Lima, Helimar Gonçalves; Gomes, Danilo Cavalcante; Santos, Nathália Silva; Dias, Êuder Reis; Botura, Mariana Borges; Batatinha, Maria José Moreira; Branco, Alexsandro

2017-10-01

This study was designed to assess the in vitro anthelmintic activity of the fraction containing alkaloid from Prosopis juliflora pods on goat gastrointestinal nematodes using the egg hatch assay (EHA), larval migration inhibition assay (LMIA), and larval motility assay (LMA). The alkaloid-rich fraction (AF) - content juliprosopine as major alkaloid - was obtained from ethyl acetate extract after fractionation in Sephadex LH-20 chromatography column and its characterization were made by nuclear magnetic resonance analysis together with literature data comparison. The concentrations tested were 4.0, 2.67, 1.78, 1.19, and 0.79 mg/mL (EHA) and 4 mg/mL (LMIA and LMA). The in vitro cytotoxicity on Vero cell cultures was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and trypan blue tests. High ovicidal activity was observed with IC 50 and IC 90 values at 1.1 and 1.43 mg/mL for AF. On the other hand, this fraction showed low larvicidal activity and high toxic effect. Thus, P. juliflora pod alkaloid rich-fraction has ovicidal activity in vitro against goat gastrointestinal nematodes and cytotoxic in Vero cell cultures. Prosopis juliflora alkaloid-rich fraction (AF) showed in vitro anthelmintic effect against gastrointestinal nematodes of goatsThe AF was more effective against eggs than third larval stage (L 3 ) of gastrointestinal nematodesThe AF showed cytotoxicity activity on Vero cell lineThe juliprosopine was the main alkaloid found in the AF from P. juliflora pods. Abbreviations used: AF: Alkaloid-rich fraction; DMSO: Dimethyl sulfoxide; EE: Ethyl acetate extract; EHA: Egg hatch assay; IC50: Inhibitory concentration 50%; IC90: Inhibitory concentration 90%; L3: Infective larvae; LMA: Larval motility assay; LMIA: Larval migration inhibition assay; MTT: Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; PBS: Phosphate buffered saline; RPMI: Roswell Park Memorial Institute médium; TLC

Structural lability of Barley stripe mosaic virus virions.

Directory of Open Access Journals (Sweden)

Valentin V Makarov

Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

The virion RNA species of the Kirsten murine sarcoma-leukemia virus complex released from a clonally related series of mouse cells

International Nuclear Information System (INIS)

Clewley, J.P.; Avery, R.J.

1982-01-01

We have characterized the virion RNA species of Kirsten sarcoma (KiSV) and Kirsten leukemia (KiLV) viruses released from a clonally related series of mouse cells (14). We have identified the KiLV and KiSV genome RNAs. In addition to the viral RNA species we find large amounts of a virus-like RNA (VL30 RNA), which is heterogeneous and shows variability in its expression. The amount of VL30 RNA in virions does not correlate with the state of transformation of the cells releasing the virus or the ability of the virus to transform other cells. Characterization of RNA rescued from non-producer cells has revealed a sarcoma virus (KiSVsub(SB3) with an oligonucleotide fingerprint different from that of a standard KiSV RNA, suggesting that it has lost some viral sequences. The oligonucleotide fingerprints of KiLV and VL30 RNAs are distinct from each other and from those reported for other murine leukemia virus RNAs. (Author)

Receptor-binding properties of modern human influenza viruses primarily isolated in Vero and MDCK cells and chicken embryonated eggs

International Nuclear Information System (INIS)

Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai

2003-01-01

To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses

Dynamics of actin-based movement by Rickettsia rickettsii in vero cells.

Science.gov (United States)

Heinzen, R A; Grieshaber, S S; Van Kirk, L S; Devin, C J

1999-08-01

Actin-based motility (ABM) is a virulence mechanism exploited by invasive bacterial pathogens in the genera Listeria, Shigella, and Rickettsia. Due to experimental constraints imposed by the lack of genetic tools and their obligate intracellular nature, little is known about rickettsial ABM relative to Listeria and Shigella ABM systems. In this study, we directly compared the dynamics and behavior of ABM of Rickettsia rickettsii and Listeria monocytogenes. A time-lapse video of moving intracellular bacteria was obtained by laser-scanning confocal microscopy of infected Vero cells synthesizing beta-actin coupled to green fluorescent protein (GFP). Analysis of time-lapse images demonstrated that R. rickettsii organisms move through the cell cytoplasm at an average rate of 4.8 +/- 0.6 micrometer/min (mean +/- standard deviation). This speed was 2.5 times slower than that of L. monocytogenes, which moved at an average rate of 12.0 +/- 3.1 micrometers/min. Although rickettsiae moved more slowly, the actin filaments comprising the actin comet tail were significantly more stable, with an average half-life approximately three times that of L. monocytogenes (100.6 +/- 19.2 s versus 33.0 +/- 7.6 s, respectively). The actin tail associated with intracytoplasmic rickettsiae remained stationary in the cytoplasm as the organism moved forward. In contrast, actin tails of rickettsiae trapped within the nucleus displayed dramatic movements. The observed phenotypic differences between the ABM of Listeria and Rickettsia may indicate fundamental differences in the mechanisms of actin recruitment and polymerization.

Endophilins interact with Moloney murine leukemia virus Gag and modulate virion production

Directory of Open Access Journals (Sweden)

De Camilli Pietro

2003-12-01

Full Text Available Abstract Background The retroviral Gag protein is the central player in the process of virion assembly at the plasma membrane, and is sufficient to induce the formation and release of virus-like particles. Recent evidence suggests that Gag may co-opt the host cell's endocytic machinery to facilitate retroviral assembly and release. Results A search for novel partners interacting with the Gag protein of the Moloney murine leukemia virus (Mo-MuLV via the yeast two-hybrid protein-protein interaction assay resulted in the identification of endophilin 2, a component of the machinery involved in clathrin-mediated endocytosis. We demonstrate that endophilin interacts with the matrix or MA domain of the Gag protein of Mo-MuLV, but not of human immunodeficiency virus, HIV. Both exogenously expressed and endogenous endophilin are incorporated into Mo-MuLV viral particles. Titration experiments suggest that the binding sites for inclusion of endophilin into viral particles are limited and saturable. Knock-down of endophilin with small interfering RNA (siRNA had no effect on virion production, but overexpression of endophilin and, to a lesser extent, of several fragments of the protein, result in inhibition of Mo-MuLV virion production, but not of HIV virion production. Conclusions This study shows that endophilins interact with Mo-MuLV Gag and affect virion production. The findings imply that endophilin is another component of the large complex that is hijacked by retroviruses to promote virion production.

VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

Directory of Open Access Journals (Sweden)

Laura Lafon-Hughes

2014-10-01

Full Text Available Poly-ADP-ribose (PAR is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs and degraded by poly-ADP-ribose-glycohydrolase (PARG. Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair. Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt. In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO. PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications.

Proteomic characterization of murid herpesvirus 4 extracellular virions.

Directory of Open Access Journals (Sweden)

Sarah Vidick

Full Text Available Gammaherpesvirinae, such as the human Epstein-Barr virus (EBV and the Kaposi's sarcoma associated herpesvirus (KSHV are highly prevalent pathogens that have been associated with several neoplastic diseases. As EBV and KSHV are host-range specific and replicate poorly in vitro, animal counterparts such as Murid herpesvirus-4 (MuHV-4 have been widely used as models. In this study, we used MuHV-4 in order to improve the knowledge about proteins that compose gammaherpesviruses virions. To this end, MuHV-4 extracellular virions were isolated and structural proteins were identified using liquid chromatography tandem mass spectrometry-based proteomic approaches. These analyses allowed the identification of 31 structural proteins encoded by the MuHV-4 genome which were classified as capsid (8, envelope (9, tegument (13 and unclassified (1 structural proteins. In addition, we estimated the relative abundance of the identified proteins in MuHV-4 virions by using exponentially modified protein abundance index analyses. In parallel, several host proteins were found in purified MuHV-4 virions including Annexin A2. Although Annexin A2 has previously been detected in different virions from various families, its role in the virion remains controversial. Interestingly, despite its relatively high abundance in virions, Annexin A2 was not essential for the growth of MuHV-4 in vitro. Altogether, these results extend previous work aimed at determining the composition of gammaherpesvirus virions and provide novel insights for understanding MuHV-4 biology.

UV-Sensitivity of Shiga Toxin-Converting Bacteriophage Virions Φ24B, 933W, P22, P27 and P32

Directory of Open Access Journals (Sweden)

Sylwia Bloch

2015-09-01

Full Text Available Shiga toxin-converting bacteriophages (Stx phages are present as prophages in Shiga toxin-producing Escherichia coli (STEC strains. Theses phages can be transmitted to previously non-pathogenic E. coli cells making them potential producers of Shiga toxins, as they bear genes for these toxins in their genomes. Therefore, sensitivity of Stx phage virions to various conditions is important in both natural processes of spreading of these viruses and potential prophylactic control of appearance of novel pathogenic E. coli strains. In this report we provide evidence that virions of Stx phages are significantly more sensitive to UV irradiation than bacteriophage λ. Following UV irradiation of Stx virions at the dose of 50 J/m2, their infectivity dropped by 1–3 log10, depending on the kind of phage. Under these conditions, a considerable release of phage DNA from virions was observed, and electron microscopy analyses indicated a large proportion of partially damaged virions. Infection of E. coli cells with UV-irradiated Stx phages resulted in significantly decreased levels of expression of N and cro genes, crucial for lytic development. We conclude that inactivation of Stx virions caused by relatively low dose of UV light is due to damage of capsids that prevents effective infection of the host cells.

Neuraminidase treatment of respiratory syncytial virus-infected cells or virions, but not target cells, enhances cell-cell fusion and infection

International Nuclear Information System (INIS)

Barretto, Naina; Hallak, Louay K.; Peeples, Mark E.

2003-01-01

Respiratory syncytial virus (RSV) infection of HeLa cells induces fusion, but transient expression of the three viral glycoproteins induces fusion poorly, if at all. We found that neuraminidase treatment of RSV-infected cells to remove sialic acid (SA) increases fusion dramatically and that the same treatment of transiently transfected cells expressing the three viral glycoproteins, or even cells expressing the fusion (F) protein alone, results in easily detectable fusion. Neuraminidase treatment of the effector cells, expressing the viral glycoproteins, enhanced fusion while treatment of the target cells did not. Likewise, infectivity was increased by treating virions with neuraminidase, but not by treating target cells. Reduction of charge repulsion by removal of the negatively charged SA is unlikely to explain this effect, since removal of negative charges from either membrane would reduce charge repulsion. Infection with neuraminidase-treated virus remained heparan-sulfate-dependent, indicating that a novel attachment mechanism is not revealed by SA removal. Interestingly, neuraminidase enhancement of RSV infectivity was less pronounced in a virus expressing both the G and the F glycoproteins, compared to virus expressing only the F glycoprotein, possibly suggesting that the G protein sterically hinders access of the neuraminidase to its fusion-enhancing target

Association of Sendai virion envelope and a mouse surface membrane polypeptide on newly infected cells: lack of association with H-2K/D or alteration of viral immunogenicity

International Nuclear Information System (INIS)

Zarling, D.A.; Miskimen, J.A.; Fan, D.P; Fujimoto, E.K.; Smith, P.K.

1982-01-01

The reagent N-succinimidyl 4-azidophenyl-1,3'-dithiopropionate (SADP) was synthesized and then coupled to purified Sendai virions by the amino-reactive end of the SADP molecule. This SADP-coupled virus was fused into the membranes of surface radioiodinated P815 cells, and target structures were allowed to form. Next, the photosensitive group on SADP was activated with ultraviolet light to covalently couple the viral proteins to any neighboring cell surface proteins. The cellular neighbors were isolated from detergent extracts of membrane proteins after immunoprecipitation with antibody specific for Sendai virion proteins. The covalent cross-links between the nonradioactive Sendai proteins and the radioiodinated cellular polypeptide neighbors were broken, and the host cell polypeptides were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and detected by autoradiography. One of these neighboring cellular proteins had an apparent m.w. of 17,000, and none was found with the characteristic size and tryptic map of either the H-2K or D gene products. Thus, the H-2K or D proteins are unlikely to be SADP- detectable neighbors of Sendai viral antigens recognized by CTL. In further experiments, the complexes of Sendai virion proteins crosslinked to cellular polypeptide neighbors were isolated from the membrane of newly infected cells and were shown to be able to stimulate CTL in vitro with approximately the same efficiency as uncross-linked Sendai virion proteins. Thus, Sendai viral proteins in the membrane of newly infected cells do not appear to be in highly immunogenic complexes with either H-2K/D or any other cellular proteins

Safety and immunogenicity of adjuvanted inactivated split-virion and whole-virion influenza A (H5N1) vaccines in children: a phase I-II randomized trial.

Science.gov (United States)

Wu, Jiang; Liu, Shu-Zhen; Dong, Shan-Shan; Dong, Xiao-Ping; Zhang, Wu-Li; Lu, Min; Li, Chang-Gui; Zhou, Ji-Chen; Fang, Han-Hua; Liu, Yan; Liu, Li-Ying; Qiu, Yuan-Zheng; Gao, Qiang; Zhang, Xiao-Mei; Chen, Jiang-Ting; Zhong, Xiang; Yin, Wei-Dong; Feng, Zi-Jian

2010-08-31

Highly pathogenic avian influenza A virus H5N1 has the potential to cause a pandemic. Many prototype pandemic influenza A (H5N1) vaccines had been developed and well evaluated in adults in recent years. However, data in children are limited. Herein we evaluate the safety and immunogenicity of adjuvanted split-virion and whole-virion H5N1 vaccines in children. An open-labelled phase I trial was conducted in children aged 3-11 years to receive aluminum-adjuvated, split-virion H5N1 vaccine (5-30 microg) and in children aged 12-17 years to receive aluminum-adjuvated, whole-virion H5N1 vaccine (5-15 microg). Safety of the two formulations was assessed. Then a randomized phase II trial was conducted, in which 141 children aged 3-11 years received the split-virion vaccine (10 or 15 microg) and 280 children aged 12-17 years received the split-virion vaccine (10-30 microg) or the whole-virion vaccine (5 microg). Serum samples were collected for hemagglutination-inhibition (HI) assays. 5-15 microg adjuvated split-virion vaccines were well tolerated in children aged 3-11 years and 5-30 microg adjuvated split-virion vaccines and 5 microg adjuvated whole-virion vaccine were well tolerated in children aged 12-17 years. Most local and systemic reactions were mild or moderate. Before vaccination, all participants were immunologically naïve to H5N1 virus. Immune responses were induced after the first dose and significantly boosted after the second dose. In 3-11 years children, the 10 and 15 microg split-virion vaccine induced similar responses with 55% seroconversion and seroprotection (HI titer >or=1:40) rates. In 12-17 years children, the 30 microg split-virion vaccine induced the highest immune response with 71% seroconversion and seroprotection rates. The 5 microg whole-virion vaccine induced higher response than the 10 microg split-virion vaccine did. The aluminum-adjuvanted, split-virion prototype pandemic influenza A (H5N1) vaccine showed good safety and immunogenicity in

Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

Science.gov (United States)

Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

2016-08-02

In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

Dynamics of HIV-containing compartments in macrophages reveal sequestration of virions and transient surface connections.

Directory of Open Access Journals (Sweden)

Raphaël Gaudin

Full Text Available During HIV pathogenesis, infected macrophages behave as "viral reservoirs" that accumulate and retain virions within dedicated internal Virus-Containing Compartments (VCCs. The nature of VCCs remains ill characterized and controversial. Using wild-type HIV-1 and a replication-competent HIV-1 carrying GFP internal to the Gag precursor, we analyzed the biogenesis and evolution of VCCs in primary human macrophages. VCCs appear roughly 14 hours after viral protein synthesis is detected, initially contain few motile viral particles, and then mature to fill up with virions that become packed and immobile. The amount of intracellular Gag, the proportion of dense VCCs, and the density of viral particles in their lumen increased with time post-infection. In contrast, the secretion of virions, their infectivity and their transmission to T cells decreased overtime, suggesting that HIV-infected macrophages tend to pack and retain newly formed virions into dense compartments. A minor proportion of VCCs remains connected to the plasma membrane overtime. Surprisingly, live cell imaging combined with correlative light and electron microscopy revealed that such connections can be transient, highlighting their dynamic nature. Together, our results shed light on the late phases of the HIV-1 cycle and reveal some of its macrophage specific features.

Virion Glycoprotein-Mediated Immune Evasion by Human Cytomegalovirus: a Sticky Virus Makes a Slick Getaway

Science.gov (United States)

Gardner, Thomas J.

2016-01-01

SUMMARY The prototypic herpesvirus human cytomegalovirus (CMV) exhibits the extraordinary ability to establish latency and maintain a chronic infection throughout the life of its human host. This is even more remarkable considering the robust adaptive immune response elicited by infection and reactivation from latency. In addition to the ability of CMV to exist in a quiescent latent state, its persistence is enabled by a large repertoire of viral proteins that subvert immune defense mechanisms, such as NK cell activation and major histocompatibility complex antigen presentation, within the cell. However, dissemination outside the cell presents a unique existential challenge to the CMV virion, which is studded with antigenic glycoprotein complexes targeted by a potent neutralizing antibody response. The CMV virion envelope proteins, which are critical mediators of cell attachment and entry, possess various characteristics that can mitigate the humoral immune response and prevent viral clearance. Here we review the CMV glycoprotein complexes crucial for cell attachment and entry and propose inherent properties of these proteins involved in evading the CMV humoral immune response. These include viral glycoprotein polymorphism, epitope competition, Fc receptor-mediated endocytosis, glycan shielding, and cell-to-cell spread. The consequences of CMV virion glycoprotein-mediated immune evasion have a major impact on persistence of the virus in the population, and a comprehensive understanding of these evasion strategies will assist in designing effective CMV biologics and vaccines to limit CMV-associated disease. PMID:27307580

A Human Nuclear Shuttling Protein That Interacts with Human Immunodeficiency Virus Type 1 Matrix Is Packaged into Virions

Science.gov (United States)

Gupta, Kalpana; Ott, David; Hope, Thomas J.; Siliciano, Robert F.; Boeke, Jef D.

2000-01-01

Active nuclear import of the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC) is essential for the productive infection of nondividing cells. Nuclear import of the PIC is mediated by the HIV-1 matrix protein, which also plays several critical roles during viral entry and possibly during virion production facilitating the export of Pr55Gag and genomic RNA. Using a yeast two-hybrid screen, we identified a novel human virion-associated matrix-interacting protein (VAN) that is highly conserved in vertebrates and expressed in most human tissues. Its expression is upregulated upon activation of CD4+ T cells. VAN is efficiently incorporated into HIV-1 virions and, like matrix, shuttles between the nucleus and cytoplasm. Furthermore, overexpression of VAN significantly inhibits HIV-1 replication in tissue culture. We propose that VAN regulates matrix nuclear localization and, by extension, both nuclear import of the PIC and export of Pr55Gag and viral genomic RNA during virion production. Our data suggest that this regulatory mechanism reflects a more global process for regulation of nucleocytoplasmic transport. PMID:11090181

Herpesvirus papio 2 encodes a virion host shutoff function.

Science.gov (United States)

Bigger, John E; Martin, David W

2002-12-05

Infection of baboons with herpesvirus papio 2 (HVP-2) produces a disease that is similar to human infection with herpes simplex viruses (HSV). Molecular characterization of HVP-2 has demonstrated that the virion contains a factor which rapidly shuts off host cell protein synthesis after infection. Reduction of host cell protein synthesis occurs in parallel with the degradation of mRNA species. A homolog of the HSV virion host shutoff (vhs) gene was identified by Southern and DNA sequence analysis. The sequence of the HVP-2 vhs gene homolog had greater than 70% identity with the vhs genes of HSV 1 and 2. Disruption of the HVP-2 vhs open reading frame diminished the ability of the virus to shut off protein synthesis and degrade cellular mRNA, indicating that this gene was responsible for the vhs activity. The HVP-2 model system provides the opportunity to study the biological role of vhs in the context of a natural primate host. Further development of this system will provide a platform for proof-of-concept studies that will test the efficacy of vaccines that utilize vhs-deficient viruses.

Recruitment of a SAP18-HDAC1 complex into HIV-1 virions and its requirement for viral replication.

Directory of Open Access Journals (Sweden)

Masha Sorin

2009-06-01

Full Text Available HIV-1 integrase (IN is a virally encoded protein required for integration of viral cDNA into host chromosomes. INI1/hSNF5 is a component of the SWI/SNF complex that interacts with HIV-1 IN, is selectively incorporated into HIV-1 (but not other retroviral virions, and modulates multiple steps, including particle production and infectivity. To gain further insight into the role of INI1 in HIV-1 replication, we screened for INI1-interacting proteins using the yeast two-hybrid system. We found that SAP18 (Sin3a associated protein 18 kD, a component of the Sin3a-HDAC1 complex, directly binds to INI1 in yeast, in vitro and in vivo. Interestingly, we found that IN also binds to SAP18 in vitro and in vivo. SAP18 and components of a Sin3A-HDAC1 complex were specifically incorporated into HIV-1 (but not SIV and HTLV-1 virions in an HIV-1 IN-dependent manner. Using a fluorescence-based assay, we found that HIV-1 (but not SIV virion preparations harbour significant deacetylase activity, indicating the specific recruitment of catalytically active HDAC into the virions. To determine the requirement of virion-associated HDAC1 to HIV-1 replication, an inactive, transdominant negative mutant of HDAC1 (HDAC1(H141A was utilized. Incorporation of HDAC1(H141A decreased the virion-associated histone deacetylase activity. Furthermore, incorporation of HDAC1(H141A decreased the infectivity of HIV-1 (but not SIV virions. The block in infectivity due to virion-associated HDAC1(H141A occurred specifically at the early reverse transcription stage, while entry of the virions was unaffected. RNA-interference mediated knock-down of HDAC1 in producer cells resulted in decreased virion-associated HDAC1 activity and a reduction in infectivity of these virions. These studies indicate that HIV-1 IN and INI1/hSNF5 bind SAP18 and selectively recruit components of Sin3a-HDAC1 complex into HIV-1 virions. Furthermore, HIV-1 virion-associated HDAC1 is required for efficient early post

The progressive adaptation of a georgian isolate of African swine fever virus to vero cells leads to a gradual attenuation of virulence in swine corresponding to major modifications of the viral genome.

Science.gov (United States)

Krug, Peter W; Holinka, Lauren G; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R; Borca, Manuel V

2015-02-01

African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been

Vero cell technology for rapid development of inactivated whole virus vaccines for emerging viral diseases.

Science.gov (United States)

Barrett, P Noel; Terpening, Sara J; Snow, Doris; Cobb, Ronald R; Kistner, Otfried

2017-09-01

Rapid development and production of vaccines against emerging diseases requires well established, validated, robust technologies to allow industrial scale production and accelerated licensure of products. Areas covered: A versatile Vero cell platform has been developed and utilized to deliver a wide range of candidate and licensed vaccines against emerging viral diseases. This platform builds on the 35 years' experience and safety record with inactivated whole virus vaccines such as polio vaccine. The current platform has been optimized to include a novel double inactivation procedure in order to ensure a highly robust inactivation procedure for novel emerging viruses. The utility of this platform in rapidly developing inactivated whole virus vaccines against pandemic (-like) influenza viruses and other emerging viruses such as West Nile, Chikungunya, Ross River and SARS is reviewed. The potential of the platform for development of vaccines against other emerging viruses such as Zika virus is described. Expert commentary: Use of this platform can substantially accelerate process development and facilitate licensure because of the substantial existing data set available for the cell matrix. However, programs to provide vaccines against emerging diseases must allow alternative clinical development paths to licensure, without the requirement to carry out large scale field efficacy studies.

Konsentrasi Aman Kurkumin dan PGV-0 terhadap Sel Vero Berdasarkan Hasil Uji Sitotoksik

Directory of Open Access Journals (Sweden)

Dewi Marbawati

2015-08-01

Full Text Available Curcumin (1,7-bis(3-methoxyphenyl 4'hidroksi -1.6 heptadien, 3,5-dione is the yellow pigment of Curcuma longa. Curcumin has various biological activities such as antioxidant, antibacterial, antifungal, antiprotozoal and antivirus. Various benefits of curcumin can not be separated from the weakness which is not stable to pH and light. Pentagamavunon-0 (PGV-0 were made by changing the β diketone group on cluster analog of curcumin into monoketon while eliminating active methylene group so it is more stable to pH and light. PGV-0 also has potential as a stronger antioxidant and antiinflammatory agent than other curcumin analogues. The objective of this research was to determine the safe concentrations of curcumin and PGV-0 on vero cells due to the increased use of the two compounds through the cytotoxic test. This research includes experimental research. Cytotoxic test performed with microculture tetrazolium technique (MTT method. Use of MTT to evaluate the cytotoxic is based on changes of tetrazolium salt into formazan crystals by mitochondrial enzyme succinate dehydrogenase with the help of cellular NADH. The results showed that the safe concentrations of curcumin and PGV-0 on vero cells respectively are 6.25 and 1.5625 ppm. Based on the cytotoxic test the secure concentration of curcumin was higher than PGV-0.

Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

International Nuclear Information System (INIS)

Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

1987-01-01

The rates of bicarbonate-dependent uptake and efflux of 22 Na + in Vero cells were studied and compared with the uptake and efflux of 36 Cl - . Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na + was much less affected by changes in pH. The bicarbonate-linked uptake of 22 Na + was dependent on internal Cl- but not on internal Na + . At a constant external concentration of HCO 3 -, the amount of 22 Na + associated with the cells increased when the internal concentration of HCO 3 - decreased and vice versa, which is compatible with the possibility that the ion pair NaCO 3 - is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of 36 Cl - both in the absence and presence of Na + . At alkaline internal pH, HCO 3 - stimulated the efflux of 36 Cl - from preloaded cells, while at acidic internal pH both Na + and HCO 3 - were required to induce 36 Cl - efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane

Mechanism of Human Influenza Virus RNA Persistence and Virion Survival in Feces: Mucus Protects Virions From Acid and Digestive Juices.

Science.gov (United States)

Hirose, Ryohei; Nakaya, Takaaki; Naito, Yuji; Daidoji, Tomo; Watanabe, Yohei; Yasuda, Hiroaki; Konishi, Hideyuki; Itoh, Yoshito

2017-07-01

Although viral RNA or infectious virions have been detected in the feces of individuals infected with human influenza A and B viruses (IAV/IBV), the mechanism of viral survival in the gastrointestinal tract remains unclear. We developed a model that attempts to recapitulate the conditions encountered by a swallowed virus. While IAV/IBV are vulnerable to simulated digestive juices (gastric acid and bile/pancreatic juice), highly viscous mucus protects viral RNA and virions, allowing the virus to retain its infectivity. Our results suggest that virions and RNA present in swallowed mucus are not inactivated or degraded by the gastrointestinal environment, allowing their detection in feces. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.

Science.gov (United States)

Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena

2015-08-20

Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fine structure of the vaccinia virion determined by controlled degradation and immunolocalization

International Nuclear Information System (INIS)

Moussatche, Nissin; Condit, Richard C.

2015-01-01

The vaccinia virion is a membraned, slightly flattened, barrel-shaped particle, with a complex internal structure featuring a biconcave core flanked by lateral bodies. Although the architecture of the purified mature virion has been intensely characterized by electron microscopy, the distribution of the proteins within the virion has been examined primarily using biochemical procedures. Thus, it has been shown that non-ionic and ionic detergents combined or not with a sulfhydryl reagent can be used to disrupt virions and, to a limited degree, separate the constituent proteins in different fractions. Applying a controlled degradation technique to virions adsorbed on EM grids, we were able to immuno-localize viral proteins within the virion particle. Our results show after NP40 and DTT treatment, membrane proteins are removed from the virion surface revealing proteins that are associated with the lateral bodies and the outer layer of the core wall. Combined treatment using high salt and high DTT removed lateral body proteins and exposed proteins of the internal core wall. Cores treated with proteases could be disrupted and the internal components were exposed. Cts8, a mutant in the A3 protein, produces aberrant virus that, when treated with NP-40 and DTT, releases to the exterior the virus DNA associated with other internal core proteins. With these results, we are able to propose a model for the structure the vaccinia virion

Proteomic analysis of the EhV-86 virion

Directory of Open Access Journals (Sweden)

Lilley Kathryn S

2008-03-01

Full Text Available Abstract Background Emiliania huxleyi virus 86 (EhV-86 is the type species of the genus Coccolithovirus within the family Phycodnaviridae. The fully sequenced 407,339 bp genome is predicted to encode 473 protein coding sequences (CDSs and is the largest Phycodnaviridae sequenced to date. The majority of EhV-86 CDSs exhibit no similarity to proteins in the public databases. Results Proteomic analysis by 1-DE and then LC-MS/MS determined that the virion of EhV-86 is composed of at least 28 proteins, 23 of which are predicted to be membrane proteins. Besides the major capsid protein, putative function can be assigned to 4 other components of the virion: two lectin proteins, a thioredoxin and a serine/threonine protein kinase. Conclusion This study represents the first steps toward the identification of the protein components that make up the EhV-86 virion. Aside from the major capsid protein, whose function in the virion is well known and defined, the nature of the other proteins suggest roles involved with viral budding, caspase activation, signalling, anti-oxidation, virus adsorption and host range determination.

Mixed genotype transmission bodies and virions contribute to the maintenance of diversity in an insect virus

Science.gov (United States)

Clavijo, Gabriel; Williams, Trevor; Muñoz, Delia; Caballero, Primitivo; López-Ferber, Miguel

2010-01-01

An insect nucleopolyhedrovirus naturally survives as a mixture of at least nine genotypes. Infection by multiple genotypes results in the production of virus occlusion bodies (OBs) with greater pathogenicity than those of any genotype alone. We tested the hypothesis that each OB contains a genotypically diverse population of virions. Few insects died following inoculation with an experimental two-genotype mixture at a dose of one OB per insect, but a high proportion of multiple infections were observed (50%), which differed significantly from the frequencies predicted by a non-associated transmission model in which genotypes are segregated into distinct OBs. By contrast, insects that consumed multiple OBs experienced higher mortality and infection frequencies did not differ significantly from those of the non-associated model. Inoculation with genotypically complex wild-type OBs indicated that genotypes tend to be transmitted in association, rather than as independent entities, irrespective of dose. To examine the hypothesis that virions may themselves be genotypically heterogeneous, cell culture plaques derived from individual virions were analysed to reveal that one-third of virions was of mixed genotype, irrespective of the genotypic composition of the OBs. We conclude that co-occlusion of genotypically distinct virions in each OB is an adaptive mechanism that favours the maintenance of virus diversity during insect-to-insect transmission. PMID:19939845

Antibody-Mediated Internalization of Infectious HIV-1 Virions Differs among Antibody Isotypes and Subclasses.

Science.gov (United States)

Tay, Matthew Zirui; Liu, Pinghuang; Williams, LaTonya D; McRaven, Michael D; Sawant, Sheetal; Gurley, Thaddeus C; Xu, Thomas T; Dennison, S Moses; Liao, Hua-Xin; Chenine, Agnès-Laurence; Alam, S Munir; Moody, M Anthony; Hope, Thomas J; Haynes, Barton F; Tomaras, Georgia D

2016-08-01

Emerging data support a role for antibody Fc-mediated antiviral activity in vaccine efficacy and in the control of HIV-1 replication by broadly neutralizing antibodies. Antibody-mediated virus internalization is an Fc-mediated function that may act at the portal of entry whereby effector cells may be triggered by pre-existing antibodies to prevent HIV-1 acquisition. Understanding the capacity of HIV-1 antibodies in mediating internalization of HIV-1 virions by primary monocytes is critical to understanding their full antiviral potency. Antibody isotypes/subclasses differ in functional profile, with consequences for their antiviral activity. For instance, in the RV144 vaccine trial that achieved partial efficacy, Env IgA correlated with increased risk of HIV-1 infection (i.e. decreased vaccine efficacy), whereas V1-V2 IgG3 correlated with decreased risk of HIV-1 infection (i.e. increased vaccine efficacy). Thus, understanding the different functional attributes of HIV-1 specific IgG1, IgG3 and IgA antibodies will help define the mechanisms of immune protection. Here, we utilized an in vitro flow cytometric method utilizing primary monocytes as phagocytes and infectious HIV-1 virions as targets to determine the capacity of Env IgA (IgA1, IgA2), IgG1 and IgG3 antibodies to mediate HIV-1 infectious virion internalization. Importantly, both broadly neutralizing antibodies (i.e. PG9, 2G12, CH31, VRC01 IgG) and non-broadly neutralizing antibodies (i.e. 7B2 mAb, mucosal HIV-1+ IgG) mediated internalization of HIV-1 virions. Furthermore, we found that Env IgG3 of multiple specificities (i.e. CD4bs, V1-V2 and gp41) mediated increased infectious virion internalization over Env IgG1 of the same specificity, while Env IgA mediated decreased infectious virion internalization compared to IgG1. These data demonstrate that antibody-mediated internalization of HIV-1 virions depends on antibody specificity and isotype. Evaluation of the phagocytic potency of vaccine

Selective dansylation of M protein within intact influenza virions

Energy Technology Data Exchange (ETDEWEB)

Robertson, B.H.; Bennett, J.C.; Compans, R.W.

1982-12-01

Exposure of purified influenza virions to (/sup 14/C)dansyl chloride resulted in the covalent attachment of the dansyl chromophore to the virion. Gel electrophoresis revealed that the dansyl chromophore was specifically coupled to the internal membrane (M) protein. Purification of the M protein by gel filtration followed by cyanogen bromide cleavage and peptide fractionation revealed that four of six peptide peaks contained dansyl label. Acid hydrolysis of the separated peptide peaks followed by thin-layer chromatography revealed that dansyl label was coupled to lysine residues present in these peptides. The results of these investigations have demonstrated that the M protein molecule is the major viral polypeptide labeled when intact virions are exposed to dansyl chloride.

Selective dansylation of M protein within intact influenza virions

International Nuclear Information System (INIS)

Robertson, B.H.; Bennett, J.C.; Compans, R.W.

1982-01-01

Exposure of purified influenza virions to [ 14 C]dansyl chloride resulted in the covalent attachment of the dansyl chromophore to the virion. Gel electrophoresis revealed that the dansyl chromophore was specifically coupled to the internal membrane (M) protein. Purification of the M protein by gel filtration followed by cyanogen bromide cleavage and peptide fractionation revealed that four of six peptide peaks contained dansyl label. Acid hydrolysis of the separated peptide peaks followed by thin-layer chromatography revealed that dansyl label was coupled to lysine residues present in these peptides. The results of these investigations have demonstrated that the M protein molecule is the major viral polypeptide labeled when intact virions are exposed to dansyl chloride

The herpes simplex virus 2 virion-associated ribonuclease vhs interferes with stress granule formation.

Science.gov (United States)

Finnen, Renée L; Hay, Thomas J M; Dauber, Bianca; Smiley, James R; Banfield, Bruce W

2014-11-01

In a previous study, it was observed that cells infected with herpes simplex virus 2 (HSV-2) failed to accumulate stress granules (SGs) in response to oxidative stress induced by arsenite treatment. As a follow-up to this observation, we demonstrate here that disruption of arsenite-induced SG formation by HSV-2 is mediated by a virion component. Through studies on SG formation in cells infected with HSV-2 strains carrying defective forms of UL41, the gene that encodes vhs, we identify vhs as a virion component required for this disruption. Cells infected with HSV-2 strains producing defective forms of vhs form SGs spontaneously late in infection. In addition to core SG components, these spontaneous SGs contain the viral immediate early protein ICP27 as well as the viral serine/threonine kinase Us3. As part of these studies, we reexamined the frameshift mutation known to reside within the UL41 gene of HSV-2 strain HG52. We demonstrate that this mutation is unstable and can rapidly revert to restore wild-type UL41 following low-multiplicity passaging. Identification of the involvement of virion-associated vhs in the disruption of SG formation will enable mechanistic studies on how HSV-2 is able to counteract antiviral stress responses early in infection. In addition, the ability of Us3 to localize to stress granules may indicate novel roles for this viral kinase in the regulation of translation. Eukaryotic cells respond to stress by rapidly shutting down protein synthesis and storing mRNAs in cytoplasmic stress granules (SGs). Stoppages in protein synthesis are problematic for all viruses as they rely on host cell machinery to synthesize viral proteins. Thus, many viruses target SGs for disruption or modification. Infection by herpes simplex virus 2 (HSV-2) was previously observed to disrupt SG formation induced by oxidative stress. In this follow-up study, we identify virion host shutoff protein (vhs) as a viral protein involved in this disruption. The

SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

International Nuclear Information System (INIS)

Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S

2014-01-01

Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit

A three-dimensional comparison of tick-borne flavivirus infection in mammalian and tick cell lines.

Directory of Open Access Journals (Sweden)

Danielle K Offerdahl

Full Text Available Tick-borne flaviviruses (TBFV are sustained in nature through cycling between mammalian and tick hosts. In this study, we used African green monkey kidney cells (Vero and Ixodes scapularis tick cells (ISE6 to compare virus-induced changes in mammalian and arthropod cells. Using confocal microscopy, transmission electron microscopy (TEM, and electron tomography (ET, we examined viral protein distribution and the ultrastructural changes that occur during TBFV infection. Within host cells, flaviviruses cause complex rearrangement of cellular membranes for the purpose of virus replication. Virus infection was accompanied by a marked expansion in endoplasmic reticulum (ER staining and markers for TBFV replication were localized mainly to the ER in both cell lines. TEM of Vero cells showed membrane-bound vesicles enclosed in a network of dilated, anastomosing ER cisternae. Virions were seen within the ER and were sometimes in paracrystalline arrays. Tubular structures or elongated vesicles were occasionally noted. In acutely and persistently infected ISE6 cells, membrane proliferation and vesicles were also noted; however, the extent of membrane expansion and the abundance of vesicles were lower and no viral particles were observed. Tubular profiles were far more prevalent in persistently infected ISE6 cells than in acutely infected cells. By ET, tubular profiles, in persistently infected tick cells, had a cross-sectional diameter of 60-100 nm, reached up to 800 nm in length, were closed at the ends, and were often arranged in fascicle-like bundles, shrouded with ER membrane. Our experiments provide analysis of viral protein localization within the context of both mammalian and arthropod cell lines as well as both acute and persistent arthropod cell infection. Additionally, we show for the first time 3D flavivirus infection in a vector cell line and the first ET of persistent flavivirus infection.

Structure of Hepatitis E Virion-Sized Particle Reveals an RNA-Dependent Viral Assembly Pathway

Energy Technology Data Exchange (ETDEWEB)

Xing, L.; Wall, J.; Li, T.-C.; Mayazaki, N.; Simon, M. N.; Moore, M.; Wang, C.-Y.; Takeda, N.; Wakita, T.; Miyamura, T.; Cheng, R. H.

2010-10-22

Hepatitis E virus (HEV) induces acute hepatitis in humans with a high fatality rate in pregnant women. There is a need for anti-HEV research to understand the assembly process of HEV native capsid. Here, we produced a large virion-sized and a small T=1 capsid by expressing the HEV capsid protein in insect cells with and without the N-terminal 111 residues, respectively, for comparative structural analysis. The virion-sized capsid demonstrates a T=3 icosahedral lattice and contains RNA fragment in contrast to the RNA-free T=1 capsid. However, both capsids shared common decameric organization. The in vitro assembly further demonstrated that HEV capsid protein had the intrinsic ability to form decameric intermediate. Our data suggest that RNA binding is the extrinsic factor essential for the assembly of HEV native capsids.

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

International Nuclear Information System (INIS)

Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H

2016-01-01

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

Energy Technology Data Exchange (ETDEWEB)

Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)

2016-06-15

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

Ebola virion attachment and entry into human macrophages profoundly effects early cellular gene expression.

Directory of Open Access Journals (Sweden)

Victoria Wahl-Jensen

2011-10-01

Full Text Available Zaire ebolavirus (ZEBOV infections are associated with high lethality in primates. ZEBOV primarily targets mononuclear phagocytes, which are activated upon infection and secrete mediators believed to trigger initial stages of pathogenesis. The characterization of the responses of target cells to ZEBOV infection may therefore not only further understanding of pathogenesis but also suggest possible points of therapeutic intervention. Gene expression profiles of primary human macrophages exposed to ZEBOV were determined using DNA microarrays and quantitative PCR to gain insight into the cellular response immediately after cell entry. Significant changes in mRNA concentrations encoding for 88 cellular proteins were observed. Most of these proteins have not yet been implicated in ZEBOV infection. Some, however, are inflammatory mediators known to be elevated during the acute phase of disease in the blood of ZEBOV-infected humans. Interestingly, the cellular response occurred within the first hour of Ebola virion exposure, i.e. prior to virus gene expression. This observation supports the hypothesis that virion binding or entry mediated by the spike glycoprotein (GP(1,2 is the primary stimulus for an initial response. Indeed, ZEBOV virions, LPS, and virus-like particles consisting of only the ZEBOV matrix protein VP40 and GP(1,2 (VLP(VP40-GP triggered comparable responses in macrophages, including pro-inflammatory and pro-apoptotic signals. In contrast, VLP(VP40 (particles lacking GP(1,2 caused an aberrant response. This suggests that GP(1,2 binding to macrophages plays an important role in the immediate cellular response.

Human Cytomegalovirus Exploits Interferon-Induced Transmembrane Proteins To Facilitate Morphogenesis of the Virion Assembly Compartment

Science.gov (United States)

Xie, Maorong; Xuan, Baoqin; Shan, Jiaoyu; Pan, Deng; Sun, Yamei; Shan, Zhao; Zhang, Jinping; Yu, Dong

2014-01-01

ABSTRACT Recently, interferon-induced transmembrane proteins (IFITMs) have been identified to be key effector molecules in the host type I interferon defense system. The invasion of host cells by a large range of RNA viruses is inhibited by IFITMs during the entry step. However, the roles of IFITMs in DNA virus infections have not been studied in detail. In this study, we report that human cytomegalovirus (HCMV), a large human DNA virus, exploits IFITMs to facilitate the formation of the virion assembly compartment (vAC) during infection of human fibroblasts. We found that IFITMs were expressed constitutively in human embryonic lung fibroblasts (MRC5 cells). HCMV infection inhibited IFITM protein accumulation in the later stages of infection. Overexpression of an IFITM protein in MRC5 cells slightly enhanced HCMV production and knockdown of IFITMs by RNA interference reduced the virus titer by about 100-fold on day 8 postinfection, according to the findings of a virus yield assay at a low multiplicity of infection. Virus gene expression and DNA synthesis were not affected, but the typical round structure of the vAC was not formed after the suppression of IFITMs, thereby resulting in defective virion assembly and the production of less infectious virion particles. Interestingly, the replication of herpes simplex virus, a human herpesvirus that is closely related to HCMV, was not affected by the suppression of IFITMs in MRC5 cells. These results indicate that IFITMs are involved in a specific pathway required for HCMV replication. IMPORTANCE HCMV is known to repurpose the interferon-stimulated genes (ISGs) viperin and tetherin to facilitate its replication. Our results expand the range of ISGs that can be exploited by HCMV for its replication. This is also the first report of a proviral function of IFITMs in DNA virus replication. In addition, whereas previous studies showed that IFITMs modulate virus entry, which is a very early stage in the virus life cycle, we

HIV-1 Infection of T Cells and Macrophages Are Differentially Modulated by Virion-Associated Hck: A Nef-Dependent Phenomenon

Directory of Open Access Journals (Sweden)

Gilda Tachedjian

2013-09-01

Full Text Available The proline repeat motif (PxxP of Nef is required for interaction with the SH3 domains of macrophage-specific Src kinase Hck. However, the implication of this interaction for viral replication and infectivity in macrophages and T lymphocytes remains unclear. Experiments in HIV-1 infected macrophages confirmed the presence of a Nef:Hck complex which was dependent on the Nef proline repeat motif. The proline repeat motif of Nef also enhanced both HIV-1 infection and replication in macrophages, and was required for incorporation of Hck into viral particles. Unexpectedly, wild-type Hck inhibited infection of macrophages, but Hck was shown to enhance infection of primary T lymphocytes. These results indicate that the interaction between Nef and Hck is important for Nef-dependent modulation of viral infectivity. Hck-dependent enhancement of HIV-1 infection of T cells suggests that Nef-Hck interaction may contribute to the spread of HIV-1 infection from macrophages to T cells by modulating events in the producer cell, virion and target cell.

Fusion between perinuclear virions and the outer nuclear membrane requires the fusogenic activity of herpes simplex virus gB.

Science.gov (United States)

Wright, Catherine C; Wisner, Todd W; Hannah, Brian P; Eisenberg, Roselyn J; Cohen, Gary H; Johnson, David C

2009-11-01

Herpesviruses cross nuclear membranes (NMs) in two steps, as follows: (i) capsids assemble and bud through the inner NM into the perinuclear space, producing enveloped virus particles, and (ii) the envelopes of these virus particles fuse with the outer NM. Two herpes simplex virus (HSV) glycoproteins, gB and gH (the latter, likely complexed as a heterodimer with gL), are necessary for the second step of this process. Mutants lacking both gB and gH accumulate in the perinuclear space or in herniations (membrane vesicles derived from the inner NM). Both gB and gH/gL are also known to act directly in fusing the virion envelope with host cell membranes during HSV entry into cells, i.e., both glycoproteins appear to function directly in different aspects of the membrane fusion process. We hypothesized that HSV gB and gH/gL also act directly in the membrane fusion that occurs during virus egress from the nucleus. Previous studies of the role of gB and gH/gL in nuclear egress involved HSV gB and gH null mutants that could potentially also possess gross defects in the virion envelope. Here, we produced recombinant HSV-expressing mutant forms of gB with single amino acid substitutions in the hydrophobic "fusion loops." These fusion loops are thought to play a direct role in membrane fusion by insertion into cellular membranes. HSV recombinants expressing gB with any one of four fusion loop mutations (W174R, W174Y, Y179K, and A261D) were unable to enter cells. Moreover, two of the mutants, W174Y and Y179K, displayed reduced abilities to mediate HSV cell-to-cell spread, and W174R and A261D exhibited no spread. All mutant viruses exhibited defects in nuclear egress, enveloped virions accumulated in herniations and in the perinuclear space, and fewer enveloped virions were detected on cell surfaces. These results support the hypothesis that gB functions directly to mediate the fusion between perinuclear virus particles and the outer NM.

Deletion of the Vaccinia Virus I2 Protein Interrupts Virion Morphogenesis, Leading to Retention of the Scaffold Protein and Mislocalization of Membrane-Associated Entry Proteins.

Science.gov (United States)

Hyun, Seong-In; Weisberg, Andrea; Moss, Bernard

2017-08-01

The I2L open reading frame of vaccinia virus (VACV) encodes a conserved 72-amino-acid protein with a putative C-terminal transmembrane domain. Previous studies with a tetracycline-inducible mutant demonstrated that I2-deficient virions are defective in cell entry. The purpose of the present study was to determine the step of replication or entry that is affected by loss of the I2 protein. Fluorescence microscopy experiments showed that I2 colocalized with a major membrane protein of immature and mature virions. We generated a cell line that constitutively expressed I2 and allowed construction of the VACV I2L deletion mutant vΔI2. As anticipated, vΔI2 was unable to replicate in cells that did not express I2. Unexpectedly, morphogenesis was interrupted at a stage after immature virion formation, resulting in the accumulation of dense spherical particles instead of brick-shaped mature virions with well-defined core structures. The abnormal particles retained the D13 scaffold protein of immature virions, were severely deficient in the transmembrane proteins that comprise the entry fusion complex (EFC), and had increased amounts of unprocessed membrane and core proteins. Total lysates of cells infected with vΔI2 also had diminished EFC proteins due to instability attributed to their hydrophobicity and failure to be inserted into viral membranes. A similar instability of EFC proteins had previously been found with unrelated mutants blocked earlier in morphogenesis that also accumulated viral membranes retaining the D13 scaffold. We concluded that I2 is required for virion morphogenesis, release of the D13 scaffold, and the association of EFC proteins with viral membranes. IMPORTANCE Poxviruses comprise a large family that infect vertebrates and invertebrates, cause disease in both in humans and in wild and domesticated animals, and are being engineered as vectors for vaccines and cancer therapy. In addition, investigations of poxviruses have provided insights into

In vitro culture of various species of microsporidia causing keratitis: Evaluation of three immortalized cell lines

Directory of Open Access Journals (Sweden)

Joseph J

2009-01-01

Full Text Available Being intracellular parasites, microsporidia can only be propagated in cell culture systems. This study evaluated three cell lines to determine the most suitable host-parasite In vitro system. Confluent monolayers of vero, SIRC, and HeLa cell lines, grown in 24-well tissue culture plates, were inoculated with varying concentrations (1 x 10 4 to 1 x 10 8 spores/mL of Vittaforma corneae, Encephalitozoon hellem, Encephalitozoon cuniculi, and Encephalitozoon intestinalis spores. Growth was compared quantitatively at weekly intervals. Encephalitozoon species showed the highest amount of growth when cultured in vero cell line, while there was no significant difference in their growth in SIRC and HeLa cell lines. In comparison, V. corneae showed the highest growth in SIRC cells, followed by vero cells. The analytical sensitivity was found to be 1 x 10 4 spores/mL for vero cell line compared to 1 x 10 5 spores/mL for SIRC cell line and 1 x 10 7 spores/mL for HeLa cell line. HeLa cells also showed rapid disruption of cells, and the spores could not be easily distinguished from cell debris. This is the first report of the comparison of vero, SIRC, and HeLa for the propagation of microsporidial spores. Vero cell line was found to be more sensitive than SIRC and HeLa cells, and we believe that the inclusion of vero cell line in the routine culture protocols of ocular parasitology laboratories would result in a significant increase in the diagnostic yield.

Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study

Science.gov (United States)

Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon

2016-12-01

The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.

77 FR 42425 - Amendment of Air Traffic Service (ATS) Routes in the Vicinity of Vero Beach, FL

Science.gov (United States)

2012-07-19

...This action amends the legal descriptions of Jet Routes J-45 and J-79, and VHF omnidirectional range (VOR) Federal airways V-3, V-51, V-159, V-225, V-295 and V-537, in the vicinity of Vero Beach, FL. The FAA is taking this action because the name of the Vero Beach, FL, VOR Tactical Air Navigation (VORTAC) facility, which is included in the descriptions of the above routes, is being changed to the Treasure VORTAC.

Ebola virus infection inversely correlates with the overall expression levels of promyelocytic leukaemia (PML protein in cultured cells

Directory of Open Access Journals (Sweden)

Szekely Laszlo

2003-04-01

Full Text Available Abstract Background Ebola virus causes severe, often fatal hemorrhagic fever in humans. The mechanism of escape from cellular anti-viral mechanisms is not yet fully understood. The promyelocytic leukaemia (PML associated nuclear body is part of the interferon inducible cellular defense system. Several RNA viruses have been found to interfere with the anti-viral function of the PML body. The possible interaction between Ebola virus and the PML bodies has not yet been explored. Results We found that two cell lines, Vero E6 and MCF7, support virus production at high and low levels respectively. The expression of viral proteins was visualized and quantified using high resolution immunofluorescence microscopy. Ebola encoded NP and VP35 accumulated in cytoplasmic inclusion bodies whereas VP40 was mainly membrane associated but it was also present diffusely in the cytoplasm as well as in the euchromatic areas of the nucleus. The anti-VP40 antibody also allowed the detection of extracellular virions. Interferon-alpha treatment decreased the production of all three viral proteins and delayed the development of cytopathic effects in both cell lines. Virus infection and interferon-alpha treatment induced high levels of PML protein expression in MCF7 but much less in Vero E6 cells. No disruption of PML bodies, a common phenomenon induced by a variety of different viruses, was observed. Conclusion We have established a simple fixation and immunofluorescence staining procedure that allows specific co-detection and precise sub-cellular localization of the PML nuclear bodies and the Ebola virus encoded proteins NP, VP35 and VP40 in formaldehyde treated cells. Interferon-alpha treatment delays virus production in vitro. Intact PML bodies may play an anti-viral role in Ebola infected cells.

Formation of virions is strictly required for turnip yellows virus long-distance movement in plants.

Science.gov (United States)

Hipper, Clémence; Monsion, Baptiste; Bortolamiol-Bécet, Diane; Ziegler-Graff, Véronique; Brault, Véronique

2014-02-01

Viral genomic RNA of the Turnip yellows virus (TuYV; genus Polerovirus; family Luteoviridae) is protected in virions formed by the major capsid protein (CP) and the minor component, the readthrough (RT*) protein. Long-distance transport, used commonly by viruses to systemically infect host plants, occurs in phloem sieve elements and two viral forms of transport have been described: virions and ribonucleoprotein (RNP) complexes. With regard to poleroviruses, virions have always been presumed to be the long-distance transport form, but the potential role of RNP complexes has not been investigated. Here, we examined the requirement of virions for polerovirus systemic movement by analysing CP-targeted mutants that were unable to form viral particles. We confirmed that TuYV mutants that cannot encapsidate into virions are not able to reach systemic leaves. To completely discard the possibility that the introduced mutations in CP simply blocked the formation or the movement of RNP complexes, we tested in trans complementation of TuYV CP mutants by providing WT CP expressed in transgenic plants. WT CP was able to facilitate systemic movement of TuYV CP mutants and this observation was always correlated with the formation of virions. This demonstrated clearly that virus particles are essential for polerovirus systemic movement.

Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

International Nuclear Information System (INIS)

Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

2008-01-01

Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

Eficiencia de cultivo in vitro de Toxoplasma gondii en las líneas celulares THP1 y Vero

Directory of Open Access Journals (Sweden)

Jorge Andrés Cuellar

2012-03-01

Full Text Available Introducción. El cultivo in vitro es un método importante para la obtención de Toxoplasma gondii confines de diagnóstico clínico o biotecnológico. Objetivo. Determinar el porcentaje de invasión y producción de T. gondii en las líneas celulares THP1y Vero. Materiales y métodos. Se determinó la curva de crecimiento para las células Vero y THP1 por conteoen hemocitómetro. Posteriormente, se identificó el porcentaje de invasión de T. gondii en células THP1y Vero por citometría de flujo, en diferentes proporciones célula/taquizoíto de 1/5, 1/20, 1/50. Por otrolado, se calculó el índice de rendimiento de T. gondii, cepa RH, y del aislamiento CIBM1 en célulasTHP1. Resultados. Las células Vero crecen más rápidamente que las células THP1, con un crecimientoexponencial en un periodo de siete días. El aislamiento CIBM1 infecta las células THP1 en las tresproporciones diferentes de 1/5,1/20 y 1/50 con porcentajes de invasión de 57,1 %, 15,5 % y 12,2 %, yen células Vero, de 25,3 %, 17,8 % y 8,8 %. La cepa RH de T. gondii mostró porcentajes de invasiónmás bajos, de 32,6 %, 14,8 % y 8,1 % en células THP1 y de 22,3 %, 14,1 % y 3,4 % en células Vero. Conclusiones. El aislamiento CIBM1 presentó mayor rendimiento con respecto a la cepa RH de T.gondii en células THP1, siendo estas células una buena línea para estudiar el proceso de invasión yprobar candidatos farmacológicos para reducir la infección por T. gondii.   doi: http://dx.doi.org/10.7705/biomedica.v32i3.485

Alteration of cell cycle progression by Sindbis virus infection

Energy Technology Data Exchange (ETDEWEB)

Yi, Ruirong; Saito, Kengo [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Isegawa, Naohisa [Laboratory Animal Center, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Shirasawa, Hiroshi, E-mail: sirasawa@faculty.chiba-u.jp [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan)

2015-07-10

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.

Alteration of cell cycle progression by Sindbis virus infection

International Nuclear Information System (INIS)

Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi

2015-01-01

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G 1 phase preferred to proliferate during S/G 2 phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G 1 phase than in cells infected during S/G 2 phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases

Kinetics of proton transport into influenza virions by the viral M2 channel.

Directory of Open Access Journals (Sweden)

Tijana Ivanovic

Full Text Available M2 protein of influenza A viruses is a tetrameric transmembrane proton channel, which has essential functions both early and late in the virus infectious cycle. Previous studies of proton transport by M2 have been limited to measurements outside the context of the virus particle. We have developed an in vitro fluorescence-based assay to monitor internal acidification of individual virions triggered to undergo membrane fusion. We show that rimantadine, an inhibitor of M2 proton conductance, blocks the acidification-dependent dissipation of fluorescence from a pH-sensitive virus-content probe. Fusion-pore formation usually follows internal acidification but does not require it. The rate of internal virion acidification increases with external proton concentration and saturates with a pK(m of ∼4.7. The rate of proton transport through a single, fully protonated M2 channel is approximately 100 to 400 protons per second. The saturating proton-concentration dependence and the low rate of internal virion acidification derived from authentic virions support a transporter model for the mechanism of proton transfer.

Importance of the short cytoplasmic domain of the feline immunodeficiency virus transmembrane glycoprotein for fusion activity and envelope glycoprotein incorporation into virions

International Nuclear Information System (INIS)

Celma, Cristina C.P.; Paladino, Monica G.; Gonzalez, Silvia A.; Affranchino, Jose L.

2007-01-01

The mature form of the envelope (Env) glycoprotein of lentiviruses is a heterodimer composed of the surface (SU) and transmembrane (TM) subunits. Feline immunodeficiency virus (FIV) possesses a TM glycoprotein with a cytoplasmic tail of approximately 53 amino acids which is unusually short compared with that of the other lentiviral glycoproteins (more than 100 residues). To investigate the relevance of the FIV TM cytoplasmic domain to Env-mediated viral functions, we characterized the biological properties of a series of Env glycoproteins progressively shortened from the carboxyl terminus. All the mutant Env proteins were efficiently expressed in feline cells and processed into the SU and TM subunits. Deletion of 5 or 11 amino acids from the TM C-terminus did not significantly affect Env surface expression, fusogenic activity or Env incorporation into virions, whereas removal of 17 or 23 residues impaired Env-mediated cell-to-cell fusion. Further truncation of the FIV TM by 29 residues resulted in an Env glycoprotein that was poorly expressed at the cell surface, exhibited only 20% of the wild-type Env fusogenic capacity and was inefficiently incorporated into virions. Remarkably, deletion of the TM C-terminal 35 or 41 amino acids restored or even enhanced Env biological functions. Indeed, these mutant Env glycoproteins bearing cytoplasmic domains of 18 or 12 amino acids were found to be significantly more fusogenic than the wild-type Env and were efficiently incorporated into virions. Interestingly, truncation of the TM cytoplasmic domain to only 6 amino acids did not affect Env incorporation into virions but abrogated Env fusogenicity. Finally, removal of the entire TM cytoplasmic tail or deletion of as many as 6 amino acids into the membrane-spanning domain led to a complete loss of Env functions. Our results demonstrate that despite its relatively short length, the FIV TM cytoplasmic domain plays an important role in modulating Env-mediated viral functions

Identification of the 15FRFG domain in HIV-1 Gag p6 essential for Vpr packaging into the virion

Directory of Open Access Journals (Sweden)

Zhu Henghu

2004-09-01

Full Text Available Abstract The auxiliary regulatory protein Vpr of HIV-1 is packaged in the virion through interaction with the Gag C-terminal p6 domain. Virion packaging of Vpr is critical for Vpr to exert functions in the HIV-1 life cycle. Previous studies suggest that Vpr interacts with a (Lxx4 domain in p6 for virion packaging. In the present study, mutational analysis of HIV-1 Gag p6 domain was performed in the context of the HIV-1 genome to examine the effect on virion packaging of Vpr. Surprisingly, Ala substitutions for Leu44 and Phe45 in the (Lxx4 domain or deletion of the whole (Lxx4 domain (amino acid #35–52 of the Gag p6 domain did not affect Vpr virion packaging. Vpr virion packaging was normal when amino acid #1–23 of the Gag p6 domain was preserved. Most importantly, Ala substitutions for Phe15, Arg16 and Phe17 in the context of amino acid #1–23 of the Gag p6 domain abolished Vpr virion packaging. Single Ala substitutions for Phe15 and Phe17 also abolished Vpr virion packaging, whereas Ala substitution for Arg16 had no effect. Our studies have revealed a novel signal sequence for Vpr packaging into the HIV-1 virion. The 15FRFG domain in p6 resembles the FxFG repeat sequences commonly found in proteins of the nuclear pore complex. These results have provided novel insights into the process of virion packaging of Vpr and suggest for the first time that Vpr may recognize the FxFG domain for both virion packaging and association with nuclear pores.

Human Papillomavirus (HPV) virion induced cancer and subfertility, two sides of the same coin.

Science.gov (United States)

Depuydt, C E; Beert, J; Bosmans, E; Salembier, G

2016-12-01

In the natural history of HPV infections, the HPV virions can induce two different pathways, namely the infec- tious virion producing pathway and the clonal transforming pathway. An overview is given of the burden that is associated with HPV infections that can both lead to cervical cancer and/or temporal subfertility. That HPV infections cause serious global health burden due to HPV-associated cancers is common knowledge, but that it is also responsible for a substantial part of idiopathic subfertility is greatly underestimated. The bulk of the detected HPV DNA whether in men or women is however infectious from origin. Because the dissociation between HPV viruses and HPV virions or infection and disease remains difficult for clinicians as well as for HPV detection, we propose a review of the different effects caused by the two different HPV virion induced pathways, and highlight the mechanisms that are responsible for causing transient subfertility and cancer.

Enzymatic treatment of duck hepatitis B virus: Topology of the surface proteins for virions and noninfectious subviral particles

International Nuclear Information System (INIS)

Franke, Claudia; Matschl, Urte; Bruns, Michael

2007-01-01

The large surface antigen L of duck hepatitis B virus exhibits a mixed topology with the preS domains of the protein alternatively exposed to the particles' interior or exterior. After separating virions from subviral particles (SVPs), we compared their L topologies and showed that both particle types exhibit the same amount of L with the following differences: 1-preS of intact virions was enzymatically digested with chymotrypsin, whereas in SVPs only half of preS was accessible, 2-phosphorylation of L at S118 was completely removed by phosphatase treatment only in virions, 3-iodine-125 labeling disclosed a higher ratio of exposed preS to S domains in virions compared to SVPs. These data point towards different surface architectures of virions and SVPs. Because the preS domain acts in binding to a cellular receptor of hepatocytes, our findings implicate the exclusion of SVPs as competitors for the receptor binding and entry of virions

Propagation of avian metapneumovirus subtypes A and B using chicken embryo related and other cell systems.

Science.gov (United States)

Coswig, Lia Treptow; dos Santos, Márcia Bianchi; Hafez, Hafez Mohamed; Ferreira, Helena Lage; Arns, Clarice Weis

2010-07-01

Primary isolation of avian metapneumovirus (aMPV) is carried out using tracheal organ culture (TOC) or chicken embryonated eggs with subsequent adaptation in chicken embryo fibroblasts (CEF) or Vero cultures. This study was conducted to evaluate six different cell lines and two avian culture systems for the propagation of aMPV subtypes A and B. The chicken embryo related (CER) cells were used successfully for primary isolation. In addition to Vero and baby hamster kidney (BHK-21) cells, CER cells were also shown to be the most appropriate for propagation of aMPV considering high titres. Propagation of A and B subtypes in CEF and TOC remained efficient after the primary isolation and several passages of viruses in the CER cell line. The growth curves were created using CER, Vero and BHK-21 cell lines. Compared with growth, both yielded higher titres in CER cells during the first 30 h after infection, but no significant difference was observed in the results obtained from CER and Vero cells. This data show that CER cells are adequate for aMPV subtypes A and B propagation, giving similar results to Vero cells. Copyright 2010 Elsevier B.V. All rights reserved.

RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

Energy Technology Data Exchange (ETDEWEB)

Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: pip.beard@roslin.ed.ac.uk [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)

2015-01-15

Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

Immunization with avian metapneumovirus harboring chicken Fc induces higher immune responses.

Science.gov (United States)

Paudel, Sarita; Easwaran, Maheswaran; Jang, Hyun; Jung, Ho-Kyoung; Kim, Joo-Hun; Shin, Hyun-Jin

2016-07-15

In this study, we evaluated the immune responses of avian metapneumovirus harboring chicken Fc molecule. Stable Vero cells expressing chicken Fc chimera on its surface (Vero-cFc) were established, and we confirmed that aMPV grown in Vero-cFc incorporated host derived chimera Fc into the aMPV virions. Immunization of chicken with aMPV-cFc induced higher level of antibodies and inflammatory cytokines; (Interferon (IFN)-γ and Interleukin (IL)-1β) compared to those of aMPV. The increased levels of antibodies and inflammatory cytokines in chicken immunized with aMPV-cFc were statistically significantly (p<0.05) to that of aMPV and control. The aMPV-cFc group also generated the highest neutralizing antibody response. After challenges, chickens immunized with aMPV-cFc showed much less pathological signs in nasal turbinates and trachea so that we could confirm aMPV-cFc induced higher protection than that of aMPV. The greater ability of aMPV harboring chicken Fc to that of aMPV presented it as a possible vaccine candidate. Copyright © 2016 Elsevier B.V. All rights reserved.

Vaccinia protein F12 has structural similarity to kinesin light chain and contains a motor binding motif required for virion export.

Directory of Open Access Journals (Sweden)

Gareth W Morgan

2010-02-01

Full Text Available Vaccinia virus (VACV uses microtubules for export of virions to the cell surface and this process requires the viral protein F12. Here we show that F12 has structural similarity to kinesin light chain (KLC, a subunit of the kinesin-1 motor that binds cargo. F12 and KLC share similar size, pI, hydropathy and cargo-binding tetratricopeptide repeats (TPRs. Moreover, molecular modeling of F12 TPRs upon the crystal structure of KLC2 TPRs showed a striking conservation of structure. We also identified multiple TPRs in VACV proteins E2 and A36. Data presented demonstrate that F12 is critical for recruitment of kinesin-1 to virions and that a conserved tryptophan and aspartic acid (WD motif, which is conserved in the kinesin-1-binding sequence (KBS of the neuronal protein calsyntenin/alcadein and several other cellular kinesin-1 binding proteins, is essential for kinesin-1 recruitment and virion transport. In contrast, mutation of WD motifs in protein A36 revealed they were not required for kinesin-1 recruitment or IEV transport. This report of a viral KLC-like protein containing a KBS that is conserved in several cellular proteins advances our understanding of how VACV recruits the kinesin motor to virions, and exemplifies how viruses use molecular mimicry of cellular components to their advantage.

Nuclear Factor kappa B is required for the production of infectious human herpesvirus 8 virions

Directory of Open Access Journals (Sweden)

Negin N Blattman

2014-04-01

Full Text Available Human herpesvirus 8 (HHV8 infection leads to potent activation of nuclear factor kappa B (NFB in primary and transformed cells. We used recombinant HHV8 (rKSHV.219 expressing green fluorescent protein under the constitutive cellular promoter elongation factor 2 and red fluorescent protein under an early HHV8 lytic gene promoter T1.1, to monitor replication during infection of human foreskin fibroblasts (HF, noting changes in NFB activity. In primary HF, NFB levels do not affect HHV8 ability to establish infection or maintain latency. Furthermore, there was no effect on the percent of cells undergoing reactivation from latency, and there were similar numbers of released and cell associated HHV8 viral particles following reactivation in the presence of inhibitors. Reactivation of HHV8 in latently infected HF in the presence of NFB inhibitors resulted in production of viral particles that did not efficiently establish infection, due to deficiencies in binding and/or entry into normally permissive cells. Exogenous expression of glycoprotein M, an envelope protein involved in viral binding and entry was able to partially overcome the deficiency induced by NFB inhibitors. Our data indicate that in primary cells, NFB is not required for infection, establishment of latency, or entry into the lytic cycle, but is required for the expression of virion associated genes involved in the initial steps of virion infectivity. These studies suggest that strategies to inhibit NFB may prevent HHV8 spread and should be considered as a potential therapeutic target for preventing HHV8 associated diseases.

Lymphotropic Virions Affect Chemokine Receptor-Mediated Neural Signaling and Apoptosis: Implications for Human Immunodeficiency Virus Type 1-Associated Dementia

Science.gov (United States)

Zheng, Jialin; Ghorpade, Anuja; Niemann, Douglas; Cotter, Robin L.; Thylin, Michael R.; Epstein, Leon; Swartz, Jennifer M.; Shepard, Robin B.; Liu, Xiaojuan; Nukuna, Adeline; Gendelman, Howard E.

1999-01-01

Chemokine receptors pivotal for human immunodeficiency virus type 1 (HIV-1) infection in lymphocytes and macrophages (CCR3, CCR5, and CXCR4) are expressed on neural cells (microglia, astrocytes, and/or neurons). It is these cells which are damaged during progressive HIV-1 infection of the central nervous system. We theorize that viral coreceptors could effect neural cell damage during HIV-1-associated dementia (HAD) without simultaneously affecting viral replication. To these ends, we studied the ability of diverse viral strains to affect intracellular signaling and apoptosis of neurons, astrocytes, and monocyte-derived macrophages. Inhibition of cyclic AMP, activation of inositol 1,4,5-trisphosphate, and apoptosis were induced by diverse HIV-1 strains, principally in neurons. Virions from T-cell-tropic (T-tropic) strains (MN, IIIB, and Lai) produced the most significant alterations in signaling of neurons and astrocytes. The HIV-1 envelope glycoprotein, gp120, induced markedly less neural damage than purified virions. Macrophage-tropic (M-tropic) strains (ADA, JR-FL, Bal, MS-CSF, and DJV) produced the least neural damage, while 89.6, a dual-tropic HIV-1 strain, elicited intermediate neural cell damage. All T-tropic strain-mediated neuronal impairments were blocked by the CXCR4 antibody, 12G5. In contrast, the M-tropic strains were only partially blocked by 12G5. CXCR4-mediated neuronal apoptosis was confirmed in pure populations of rat cerebellar granule neurons and was blocked by HA1004, an inhibitor of calcium/calmodulin-dependent protein kinase II, protein kinase A, and protein kinase C. Taken together, these results suggest that progeny HIV-1 virions can influence neuronal signal transduction and apoptosis. This process occurs, in part, through CXCR4 and is independent of CD4 binding. T-tropic viruses that traffic in and out of the brain during progressive HIV-1 disease may play an important role in HAD neuropathogenesis. PMID:10482576

Syncytial Hepatitis of Tilapia ( Oreochromis niloticus L.) is Associated With Orthomyxovirus-Like Virions in Hepatocytes.

Science.gov (United States)

Del-Pozo, J; Mishra, N; Kabuusu, R; Cheetham, S; Eldar, A; Bacharach, E; Lipkin, W I; Ferguson, H W

2017-01-01

Using transmission electron microscopy (TEM), the presented work expands on the ultrastructural findings of an earlier report on "syncytial hepatitis," a novel disease of tilapia (SHT). Briefly, TEM confirmed the presence of an orthomyxovirus-like virus within the diseased hepatocytes but not within the endothelium. This was supported by observing extracellular and intracellular (mostly intraendosomal), 60-100 nm round virions with a trilaminar capsid containing up to 7 electron-dense aggregates. Other patterns noted included enveloped or filamentous virions and virion-containing cytoplasmic membrane folds, suggestive of endocytosis. Patterns atypical for orthymyxovirus included the formation of syncytia and the presence of virions within the perinuclear cisternae (suspected to be the Golgi apparatus). The ultrastructural morphology of SHT-associated virions is similar to that previously reported for tilapia lake virus (TiLV). A genetic homology was investigated using the available reverse transcriptase polymerase chain reaction (RT-PCR) probes for TiLV and comparing clinically sick with clinically normal fish and negative controls. By RT-PCR analysis, viral nucleic acid was detected only in diseased fish. Taken together, these findings strongly suggest that a virus is causally associated with SHT, that this virus shares ultrastructural features with orthomyxoviruses, and it presents with partial genetic homology with TiLV (190 nucleotides).

ACAM2000 clonal Vero cell culture vaccinia virus (New York City Board of Health strain)--a second-generation smallpox vaccine for biological defense.

Science.gov (United States)

Monath, Thomas P; Caldwell, Joseph R; Mundt, Wolfgang; Fusco, Joan; Johnson, Casey S; Buller, Mark; Liu, Jian; Gardner, Bridget; Downing, Greg; Blum, Paul S; Kemp, Tracy; Nichols, Richard; Weltzin, Richard

2004-10-01

The threat of smallpox as a biological weapon has spurred efforts to create stockpiles of vaccine for emergency preparedness. In lieu of preparing vaccine in animal skin (the original method), we cloned vaccinia virus (New York City Board of Health strain, Dryvax by plaque purification and amplified the clone in cell culture. The overarching goal was to produce a modern vaccine that was equivalent to the currently licensed Dryvax in its preclinical and clinical properties, and could thus reliably protect humans against smallpox. A variety of clones were evaluated, and many were unacceptably virulent in animal models. One clonal virus (ACAM1000) was selected and produced at clinical grade in MRC-5 human diploid cells. ACAM1000 was comparable to Dryvax in immunogenicity and protective activity but was less neurovirulent for mice and nonhuman primates. To meet requirements for large quantities of vaccine after the events of September 11th 2001, the ACAM1000 master virus seed was used to prepare vaccine (designated ACAM2000) at large scale in Vero cells under serum-free conditions. The genomes of ACAM1000 and ACAM2000 had identical nucleotide sequences, and the vaccines had comparable biological phenotypes. ACAM1000 and ACAM2000 were evaluated in three Phase 1 clinical trials. The vaccines produced major cutaneous reactions and evoked neutralizing antibody and cell-mediated immune responses in the vast majority of subjects and had a reactogenicity profile similar to that of Dryvax.

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Cell-to-cell movement of Alfalfa mosaic virus can be mediated by the movement proteins of Ilar-, bromo-, cucumo-, tobamo- and comoviruses and does not require virion formation.

Science.gov (United States)

Sánchez-Navarro, Jesús A; Carmen Herranz, María; Pallás, Vicente

2006-03-01

RNA 3 of Alfalfa mosaic virus (AMV) encodes the movement protein (MP) and coat protein (CP). Chimeric RNA 3 with the AMV MP gene replaced by the corresponding MP gene of Prunus necrotic ringspot virus, Brome mosaic virus, Cucumber mosaic virus or Cowpea mosaic virus efficiently moved from cell-to-cell only when the expressed MP was extended at its C-terminus with the C-terminal 44 amino acids of AMV MP. MP of Tobacco mosaic virus supported the movement of the chimeric RNA 3 whether or not the MP was extended with the C-terminal AMV MP sequence. The replacement of the CP gene in RNA 3 by a mutant gene encoding a CP defective in virion formation did not affect cell-to-cell transport of the chimera's with a functional MP. A GST pull-down technique was used to demonstrate for the first time that the C-terminal 44 amino acids of the MP of a virus belonging to the family Bromoviridae interact specifically with AMV virus particles. Together, these results demonstrate that AMV RNA 3 can be transported from cell-to-cell by both tubule-forming and non-tubule-forming MPs if a specific MP-CP interaction occurs.

Herpes simplex virus glycoproteins gB and gH function in fusion between the virion envelope and the outer nuclear membrane.

Science.gov (United States)

Farnsworth, Aaron; Wisner, Todd W; Webb, Michael; Roller, Richard; Cohen, Gary; Eisenberg, Roselyn; Johnson, David C

2007-06-12

Herpesviruses must traverse the nuclear envelope to gain access to the cytoplasm and, ultimately, to exit cells. It is believed that herpesvirus nucleocapsids enter the perinuclear space by budding through the inner nuclear membrane (NM). To reach the cytoplasm these enveloped particles must fuse with the outer NM and the unenveloped capsids then acquire a second envelope in the trans-Golgi network. Little is known about the process by which herpesviruses virions fuse with the outer NM. Here we show that a herpes simplex virus (HSV) mutant lacking both the two putative fusion glycoproteins gB and gH failed to cross the nuclear envelope. Enveloped virions accumulated in the perinuclear space or in membrane vesicles that bulged into the nucleoplasm (herniations). By contrast, mutants lacking just gB or gH showed only minor or no defects in nuclear egress. We concluded that either HSV gB or gH can promote fusion between the virion envelope and the outer NM. It is noteworthy that fusion associated with HSV entry requires the cooperative action of both gB and gH, suggesting that the two types of fusion (egress versus entry) are dissimilar processes.

Target-dependent enrichment of virions determines the reduction of high-throughput sequencing in virus discovery.

Directory of Open Access Journals (Sweden)

Randi Holm Jensen

Full Text Available Viral infections cause many different diseases stemming both from well-characterized viral pathogens but also from emerging viruses, and the search for novel viruses continues to be of great importance. High-throughput sequencing is an important technology for this purpose. However, viral nucleic acids often constitute a minute proportion of the total genetic material in a sample from infected tissue. Techniques to enrich viral targets in high-throughput sequencing have been reported, but the sensitivity of such methods is not well established. This study compares different library preparation techniques targeting both DNA and RNA with and without virion enrichment. By optimizing the selection of intact virus particles, both by physical and enzymatic approaches, we assessed the effectiveness of the specific enrichment of viral sequences as compared to non-enriched sample preparations by selectively looking for and counting read sequences obtained from shotgun sequencing. Using shotgun sequencing of total DNA or RNA, viral targets were detected at concentrations corresponding to the predicted level, providing a foundation for estimating the effectiveness of virion enrichment. Virion enrichment typically produced a 1000-fold increase in the proportion of DNA virus sequences. For RNA virions the gain was less pronounced with a maximum 13-fold increase. This enrichment varied between the different sample concentrations, with no clear trend. Despite that less sequencing was required to identify target sequences, it was not evident from our data that a lower detection level was achieved by virion enrichment compared to shotgun sequencing.

Observation of a cytopathogenic effect on cell lines used for routine viral cultures led to the diagnosis of lymphogranuloma venereum.

Science.gov (United States)

Busson, Laurent; Crucitti, Tania; De Foor, Marc; Van den Wijngaert, Sigi; Vandenberg, Olivier

2013-08-01

This article reports the fortuitous recovery of nine Chlamydia trachomatis serovar L strains in cell cultures (Vero and LLC-MK(2) cell line) designed for viral culture. Nine ano-genital swabs were inoculated on confluent Vero, MRC5 and LLC-MK(2) cell cultures. They were collected from HIV-positive patients who were primarily men who have sex with men (MSM) presenting ulcerations that mimicked herpes simplex infections. A cytopathogenic effect was observed on Vero and LLC-MK(2) cells on day 14. The presence of C trachomatis serovar L in the cell lines was confirmed by Real Time-PCR. C trachomatis serovar L can grow on Vero and LLC-MK(2) cell lines designed for viral cultures. Lymphogranuloma venereum must be considered as a differential diagnosis for herpes-like lesions, particularly in MSM with high-risk behaviours.

Evaluation of different continuous cell lines in the isolation of mumps virus by the shell vial method from clinical samples

Science.gov (United States)

Reina, J; Ballesteros, F; Mari, M; Munar, M

2001-01-01

Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211

Inhibition of Dengue Virus 3 in Mammalian Cell Culture by Synthetic ...

African Journals Online (AJOL)

HP

Purpose: To evaluate the inhibition of Dengue virus 3 by synthetic siRNAs targeting the untranslated regions UTR and structural regions of DENV3 genome in Vero-81 cell line. Methods: Vero-81 cells transfected with synthetic siRNAs were challenged by DENV3. The effectiveness of siRNAs was confirmed by four ...

The glycoprotein of measles virus

International Nuclear Information System (INIS)

Anttonen, O.; Jokinen, M.; Salmi, A.; Vainionpaeae, R.; Gahmberg, C.G.

1980-01-01

Measles virus was propagated in VERO cells and purified from the culture supernatants by two successive tartrate-density-gradient centrifugations. Surface carbohydrates were labelled both in vitro and in vivo with 3 H after treatment with galactose oxidase/NaB 3 H 4 or with [ 3 H]glucosamine. The major labelled glycoprotein in measles virions had a mol.wt. of 79000. After labelling with periodate/NaB 3 H 4 , which would result in specific labelling of sialic acid residues, the 79000-mol.wt. glycoprotein was very weakly labelled. This suggested that there is no or a very low amount of sialic acid in the virions. Further analysis of the glycoprotein showed that galactose is the terminal carbohydrate unit in the oligosaccharide, and the molecular weight of the glycopeptide obtained after Pronase digestion is about 3000. The oligosaccharide is attached to the polypeptide through an alkali-stable bond, indicating a N-glycosidic asparagine linkage. (author)

R5 HIV-1 envelope attracts dendritic cells to cross the human intestinal epithelium and sample luminal virions via engagement of the CCR5.

Science.gov (United States)

Cavarelli, Mariangela; Foglieni, Chiara; Rescigno, Maria; Scarlatti, Gabriella

2013-05-01

The gastrointestinal tract is a principal route of entry and site of persistence of human immunodeficiency virus type 1 (HIV-1). The intestinal mucosa, being rich of cells that are the main target of the virus, represents a primary site of viral replication and CD4(+) T-cell depletion. Here, we show both in vitro and ex vivo that HIV-1 of R5 but not X4 phenotype is capable of selectively triggering dendritic cells (DCs) to migrate within 30 min between intestinal epithelial cells to sample virions and transfer infection to target cells. The engagement of the chemokine receptor 5 on DCs and the viral envelope, regardless of the genetic subtype, drive DC migration. Viruses penetrating through transient opening of the tight junctions likely create a paracellular gradient to attract DCs. The formation of junctions with epithelial cells may initiate a haptotactic process of DCs and at the same time favour cell-to-cell viral transmission. Our findings indicate that HIV-1 translocation across the intestinal mucosa occurs through the selective engagement of DCs by R5 viruses, and may guide the design of new prevention strategies. Copyright © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

International Nuclear Information System (INIS)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-01-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of 125 I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of 125 I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies

A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis.

Science.gov (United States)

Dubrau, Danilo; Tortorici, M Alejandra; Rey, Félix A; Tautz, Norbert

2017-02-01

The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS) proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132), which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region) suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation.

A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis

Science.gov (United States)

Rey, Félix A.

2017-01-01

The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS) proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132), which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region) suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation. PMID:28151973

A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis.

Directory of Open Access Journals (Sweden)

Danilo Dubrau

2017-02-01

Full Text Available The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132, which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation.

Rigid amphipathic fusion inhibitors demonstrate antiviral activity against African swine fever virus.

Science.gov (United States)

Hakobyan, Astghik; Galindo, Inmaculada; Nañez, Almudena; Arabyan, Erik; Karalyan, Zaven; Chistov, Alexey A; Streshnev, Philipp P; Korshun, Vladimir A; Alonso, Covadonga; Zakaryan, Hovakim

2018-01-01

Rigid amphipathic fusion inhibitors (RAFIs) are a family of nucleoside derivatives that inhibit the infectivity of several enveloped viruses by interacting with virion envelope lipids and inhibiting fusion between viral and cellular membranes. Here we tested the antiviral activity of two RAFIs, 5-(Perylen-3-ylethynyl)-arabino-uridine (aUY11) and 5-(Perylen-3-ylethynyl)uracil-1-acetic acid (cm1UY11) against African swine fever virus (ASFV), for which no effective vaccine is available. Both compounds displayed a potent, dose-dependent inhibitory effect on ASFV infection in Vero cells. The major antiviral effect was observed when aUY11 and cm1UY11 were added at early stages of infection and maintained during the complete viral cycle. Furthermore, virucidal assay revealed a significant extracellular anti-ASFV activity for both compounds. We also found decrease in the synthesis of early and late viral proteins in Vero cells treated with cm1UY11. Finally, the inhibitory effect of aUY11 and cm1UY11 on ASFV infection in porcine alveolar macrophages was confirmed. Overall, our study has identified novel anti-ASFV compounds with potential for future therapeutic developments.

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

Energy Technology Data Exchange (ETDEWEB)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-03-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.

Mechanisms for lymphocytic choriomeningitis virus glycoprotein cleavage, transport, and incorporation into virions

International Nuclear Information System (INIS)

Kunz, Stefan; Edelmann, Kurt H.; Torre, Juan-Carlos de la; Gorney, Robert; Oldstone, Michael B.A.

2003-01-01

The glycoprotein (GP) of lymphocytic choriomeningitis virus (LCMV) serves as virus attachment protein to its receptor on host cells and is a key determinant for cell tropism, pathogenesis, and epidemiology of the virus. The GP of LCMV is posttranslationally cleaved by the subtilase SKI-1/S1P into two subunits, the peripheral GP1, which is implicated in receptor binding, and the transmembrane GP2 that is structurally similar to the fusion active membrane proximal portions of the glycoproteins of other enveloped viruses. The present study shows that cleavage by SKI-1/S1P is not required for cell surface expression of LCMVGP on infected cells but is essential for its incorporation into virions and for the production of infectious virus particles. In absence of SKI-1/S1P cleavage, cell-to-cell propagation of the virus was markedly reduced. Further, proteolytic processing of LCMVGP depends on the presence of a cluster of basic amino acids at the C-terminus of the cytoplasmic domain of GP2, a structural motif that is conserved in Old World arenaviruses. The effect of the truncation of the cytoplasmic tail on cleavage suggests a structural interdependence between the cytoplasmic domain and the ectodomains of LCMVGP

Herpesvirus gB-induced fusion between the virion envelope and outer nuclear membrane during virus egress is regulated by the viral US3 kinase.

Science.gov (United States)

Wisner, Todd W; Wright, Catherine C; Kato, Akihisa; Kawaguchi, Yasushi; Mou, Fan; Baines, Joel D; Roller, Richard J; Johnson, David C

2009-04-01

Herpesvirus capsids collect along the inner surface of the nuclear envelope and bud into the perinuclear space. Enveloped virions then fuse with the outer nuclear membrane (NM). We previously showed that herpes simplex virus (HSV) glycoproteins gB and gH act in a redundant fashion to promote fusion between the virion envelope and the outer NM. HSV mutants lacking both gB and gH accumulate enveloped virions in herniations, vesicles that bulge into the nucleoplasm. Earlier studies had shown that HSV mutants lacking the viral serine/threonine kinase US3 also accumulate herniations. Here, we demonstrate that HSV gB is phosphorylated in a US3-dependent manner in HSV-infected cells, especially in a crude nuclear fraction. Moreover, US3 directly phosphorylated the gB cytoplasmic (CT) domain in in vitro assays. Deletion of gB in the context of a US3-null virus did not add substantially to defects in nuclear egress. The majority of the US3-dependent phosphorylation of gB involved the CT domain and amino acid T887, a residue present in a motif similar to that recognized by US3 in other proteins. HSV recombinants lacking gH and expressing either gB substitution mutation T887A or a gB truncated at residue 886 displayed substantial defects in nuclear egress. We concluded that phosphorylation of the gB CT domain is important for gB-mediated fusion with the outer NM. This suggested a model in which the US3 kinase is incorporated into the tegument layer (between the capsid and envelope) in HSV virions present in the perinuclear space. By this packaging, US3 might be brought close to the gB CT tail, leading to phosphorylation and triggering fusion between the virion envelope and the outer NM.

Purification and characterization of enterovirus 71 viral particles produced from vero cells grown in a serum-free microcarrier bioreactor system.

Directory of Open Access Journals (Sweden)

Chia-Chyi Liu

Full Text Available BACKGROUND: Enterovirus 71 (EV71 infections manifest most commonly as a childhood exanthema known as hand-foot-and-mouth disease (HFMD and can cause neurological disease during acute infection. PRINCIPAL FINDING: In this study, we describe the production, purification and characterization of EV71 virus produced from Vero cells grown in a five-liter serum-free bioreactor system containing 5 g/L Cytodex 1 microcarrier. The viral titer was >10(6 TCID(50/mL by 6 days post infection when a MOI of 10(-5 was used at the initial infection. Two EV71 virus fractions were separated and detected when the harvested EV71 virus concentrate was purified by sucrose gradient zonal ultracentrifugation. The EV71 viral particles detected in the 24-28% sucrose fractions had an icosahedral structure 30-31 nm in diameter and had low viral infectivity and RNA content. Three major viral proteins (VP0, VP1 and VP3 were observed by SDS-PAGE. The EV71 viral particles detected in the fractions containing 35-38% sucrose were 33-35 nm in size, had high viral infectivity and RNA content, and were composed of four viral proteins (VP1, VP2, VP3 and VP4, as shown by SDS-PAGE analyses. The two virus fractions were formalin-inactivated and induced high virus neutralizing antibody responses in mouse immunogenicity studies. Both mouse antisera recognized the immunodominant linear neutralization epitope of VP1 (residues 211-225. CONCLUSION: These results provide important information for cell-based EV71 vaccine development, particularly for the preparation of working standards for viral antigen quantification.

Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

Directory of Open Access Journals (Sweden)

Mary M Melia

Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

Energy Technology Data Exchange (ETDEWEB)

Conceição, R.A. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil); Ludovico, M.S. [Departamento de Microbiologia, Universidade Estadual de Londrina, Londrina, PR (Brazil); Andrade, C.G.T.J. [Departamento de Biologia Geral, Universidade Estadual de Londrina, Londrina, PR (Brazil); Yano, T. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil)

2012-04-13

The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 10{sup 7} CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.

Virology: The Next Generation from Digital PCR to Single Virion Genomics

Energy Technology Data Exchange (ETDEWEB)

White, Richard A.; Brazelton De Cardenas, Jessica N.; Hayden, Randall T.

2015-10-01

In the past 25 years, virology has had major technology breakthroughs stemming first from the introduction of nucleic acid amplification testing, but more recently from the use of next-generation sequencing, digital PCR, and the possibility of single virion genomics. These technologies have and will improve diagnosis and disease state monitoring in clinical settings, aid in environmental monitoring, and reveal the vast genetic potential of viruses. Using the principle of limiting dilution, digital PCR amplifies single molecules of DNA in highly partitioned endpoint reactions and reads each of those reactions as either positive or negative based on the presence or absence of target fluorophore. In this review, digital PCR will be highlighted along with current studies, advantages/disadvantages, and future perspectives with regard to digital PCR, viral load testing, and the possibility of single virion genomics.

Determination of avian influenza A (H9N2) virions by inductively coupled plasma mass spectrometry based magnetic immunoassay with gold nanoparticles labeling

Science.gov (United States)

Xiao, Guangyang; Chen, Beibei; He, Man; Shi, Kaiwen; Zhang, Xing; Li, Xiaoting; Wu, Qiumei; Pang, Daiwen; Hu, Bin

2017-12-01

Avian influenza viruses are the pathogens of global poultry epidemics, and may even cause the human infections. Here, we proposed a novel inductively coupled plasma mass spectrometry (ICP-MS) based immunoassay with gold nanoparticles (Au NPs) labeling for the determination of H9N2 virions. Magnetic-beads modified with anti-influenza A H9N2 hemagglutinin mono-antibody (mAb-HA) were utilized for the capture of H9N2 virions in complex matrix; and Au NPs conjugated with mAb-HA were employed for the specific labeling of H9N2 virions for subsequent ICP-MS detection. With a sandwich immunoassay strategy, this method exhibited a high specificity for H9N2 among other influenza A virions such as H1N1 and H3N2. Under the optimized conditions, this method could detect as low as 0.63 ng mL- 1 H9N2 virions with the linear range of 2-400 ng mL- 1, the relative standard deviation for seven replicate detections of H9N2 virions was 7.2% (c = 10 ng mL- 1). The developed method was applied for the detection of H9N2 virions in real-world chicken dung samples, and the recovery for the spiking samples was 91.4-116.9%. This method is simple, rapid, sensitive, selective, reliable and has a good application potential for virions detection in real-world samples.

Retroviral Gag protein-RNA interactions: Implications for specific genomic RNA packaging and virion assembly.

Science.gov (United States)

Olson, Erik D; Musier-Forsyth, Karin

2018-03-31

Retroviral Gag proteins are responsible for coordinating many aspects of virion assembly. Gag possesses two distinct nucleic acid binding domains, matrix (MA) and nucleocapsid (NC). One of the critical functions of Gag is to specifically recognize, bind, and package the retroviral genomic RNA (gRNA) into assembling virions. Gag interactions with cellular RNAs have also been shown to regulate aspects of assembly. Recent results have shed light on the role of MA and NC domain interactions with nucleic acids, and how they jointly function to ensure packaging of the retroviral gRNA. Here, we will review the literature regarding RNA interactions with NC, MA, as well as overall mechanisms employed by Gag to interact with RNA. The discussion focuses on human immunodeficiency virus type-1, but other retroviruses will also be discussed. A model is presented combining all of the available data summarizing the various factors and layers of selection Gag employs to ensure specific gRNA packaging and correct virion assembly. Copyright © 2018 Elsevier Ltd. All rights reserved.

Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms.

Science.gov (United States)

Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T

2016-02-21

The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to +6.0 Gy (CyberKnife: +0.5 Gy to +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to +0.2 mm /-0.8 mm to +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

Proteomic and Functional Analyses of the Virion Transmembrane Proteome of Cyprinid Herpesvirus 3.

Science.gov (United States)

Vancsok, Catherine; Peñaranda, M Michelle D; Raj, V Stalin; Leroy, Baptiste; Jazowiecka-Rakus, Joanna; Boutier, Maxime; Gao, Yuan; Wilkie, Gavin S; Suárez, Nicolás M; Wattiez, Ruddy; Gillet, Laurent; Davison, Andrew J; Vanderplasschen, Alain F C

2017-11-01

Virion transmembrane proteins (VTPs) mediate key functions in the herpesvirus infectious cycle. Cyprinid herpesvirus 3 (CyHV-3) is the archetype of fish alloherpesviruses. The present study was devoted to CyHV-3 VTPs. Using mass spectrometry approaches, we identified 16 VTPs of the CyHV-3 FL strain. Mutagenesis experiments demonstrated that eight of these proteins are essential for viral growth in vitro (open reading frame 32 [ORF32], ORF59, ORF81, ORF83, ORF99, ORF106, ORF115, and ORF131), and eight are nonessential (ORF25, ORF64, ORF65, ORF108, ORF132, ORF136, ORF148, and ORF149). Among the nonessential proteins, deletion of ORF25, ORF132, ORF136, ORF148, or ORF149 affects viral replication in vitro , and deletion of ORF25, ORF64, ORF108, ORF132, or ORF149 impacts plaque size. Lack of ORF148 or ORF25 causes attenuation in vivo to a minor or major extent, respectively. The safety and efficacy of a virus lacking ORF25 were compared to those of a previously described vaccine candidate deleted for ORF56 and ORF57 (Δ56-57). Using quantitative PCR, we demonstrated that the ORF25 deleted virus infects fish through skin infection and then spreads to internal organs as reported previously for the wild-type parental virus and the Δ56-57 virus. However, compared to the parental wild-type virus, the replication of the ORF25-deleted virus was reduced in intensity and duration to levels similar to those observed for the Δ56-57 virus. Vaccination of fish with a virus lacking ORF25 was safe but had low efficacy at the doses tested. This characterization of the virion transmembrane proteome of CyHV-3 provides a firm basis for further research on alloherpesvirus VTPs. IMPORTANCE Virion transmembrane proteins play key roles in the biology of herpesviruses. Cyprinid herpesvirus 3 (CyHV-3) is the archetype of fish alloherpesviruses and the causative agent of major economic losses in common and koi carp worldwide. In this study of the virion transmembrane proteome of CyHV-3, the

Selective incorporation of vRNP into influenza A virions determined by its specific interaction with M1 protein

Energy Technology Data Exchange (ETDEWEB)

Chaimayo, Chutikarn [Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, NY 14642 (United States); Department of Microbiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Hayashi, Tsuyoshi; Underwood, Andrew; Hodges, Erin [Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, NY 14642 (United States); Takimoto, Toru, E-mail: toru_takimoto@urmc.rochester.edu [Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, NY 14642 (United States)

2017-05-15

Influenza A viruses contain eight single-stranded, negative-sense RNA segments as viral genomes in the form of viral ribonucleoproteins (vRNPs). During genome replication in the nucleus, positive-sense complementary RNPs (cRNPs) are produced as replicative intermediates, which are not incorporated into progeny virions. To analyze the mechanism of selective vRNP incorporation into progeny virions, we quantified vRNPs and cRNPs in the nuclear and cytosolic fractions of infected cells, using a strand-specific qRT-PCR. Unexpectedly, we found that cRNPs were also exported to the cytoplasm. This export was chromosome region maintenance 1 (CRM1)-independent unlike that of vRNPs. Although both vRNPs and cRNPs were present in the cytosol, viral matrix (M1) protein, a key regulator for viral assembly, preferentially bound vRNPs over cRNPs. These results indicate that influenza A viruses selectively uptake cytosolic vRNPs through a specific interaction with M1 during viral assembly. - Highlights: •Influenza cRNPs are exported from the nucleus of an infected cell via a CRM1-independent pathway. •Influenza A viruses selectively incorporate cytosolic vRNPs through a specific interaction with M1 during viral assembly. •M1 dissociates from vRNP export complex after nuclear export, and is re-associated with vRNPs at the plasma membrane.

Selective incorporation of vRNP into influenza A virions determined by its specific interaction with M1 protein

International Nuclear Information System (INIS)

Chaimayo, Chutikarn; Hayashi, Tsuyoshi; Underwood, Andrew; Hodges, Erin; Takimoto, Toru

2017-01-01

Influenza A viruses contain eight single-stranded, negative-sense RNA segments as viral genomes in the form of viral ribonucleoproteins (vRNPs). During genome replication in the nucleus, positive-sense complementary RNPs (cRNPs) are produced as replicative intermediates, which are not incorporated into progeny virions. To analyze the mechanism of selective vRNP incorporation into progeny virions, we quantified vRNPs and cRNPs in the nuclear and cytosolic fractions of infected cells, using a strand-specific qRT-PCR. Unexpectedly, we found that cRNPs were also exported to the cytoplasm. This export was chromosome region maintenance 1 (CRM1)-independent unlike that of vRNPs. Although both vRNPs and cRNPs were present in the cytosol, viral matrix (M1) protein, a key regulator for viral assembly, preferentially bound vRNPs over cRNPs. These results indicate that influenza A viruses selectively uptake cytosolic vRNPs through a specific interaction with M1 during viral assembly. - Highlights: •Influenza cRNPs are exported from the nucleus of an infected cell via a CRM1-independent pathway. •Influenza A viruses selectively incorporate cytosolic vRNPs through a specific interaction with M1 during viral assembly. •M1 dissociates from vRNP export complex after nuclear export, and is re-associated with vRNPs at the plasma membrane.

Enterovirus 71 virion-associated galectin-1 facilitates viral replication and stability.

Directory of Open Access Journals (Sweden)

Pei-Huan Lee

Full Text Available Enterovirus 71 (EV71 infection causes a myriad of diseases from mild hand-foot-and-mouth disease or herpangina to fatal brain stem encephalitis complicated with pulmonary edema. Several severe EV71 endemics have occurred in Asia-Pacific region, including Taiwan, and have become a serious threat to children's health. EV71 infection is initiated by the attachment of the virion to the target cell surface. Although this process relies primarily upon interaction between viruses and cell surface receptors, soluble factors may also influence the binding of EV71 to host cells. Galectin-1 has been reported to participate in several virus infections, but is not addressed in EV71. In this study, we found that the serum levels of galectin-1 in EV71-infected children were higher than those in non-infected people. In EV71 infected cells, galectin-1 was found to be associated with the EV71 VP1 and VP3 via carbohydrate residues and subsequently released and bound to another cell surface along with the virus. EV71 propagated from galectin-1 knockdown SK-N-SH cells exhibited lower infectivity in cultured cells and less pathogenicity in mice than the virus propagated from parental cells. In addition, this galectin-1-free EV71 virus was sensitive to high temperature and lost its viability after long-term storage, which could be restored following supplement of recombinant galectin-1. Taken together, our findings uncover a new role of galectin-1 in facilitating EV71 virus infection.

Understanding the Process of Envelope Glycoprotein Incorporation into Virions in Simian and Feline Immunodeficiency Viruses

Directory of Open Access Journals (Sweden)

José L. Affranchino

2014-01-01

Full Text Available The lentiviral envelope glycoproteins (Env mediate virus entry by interacting with specific receptors present at the cell surface, thereby determining viral tropism and pathogenesis. Therefore, Env incorporation into the virions formed by assembly of the viral Gag polyprotein at the plasma membrane of the infected cells is a key step in the replication cycle of lentiviruses. Besides being useful models of human immunodeficiency virus (HIV infections in humans and valuable tools for developing AIDS therapies and vaccines, simian and feline immunodeficiency viruses (SIV and FIV, respectively are relevant animal retroviruses; the study of which provides important information on how lentiviral replication strategies have evolved. In this review, we discuss the molecular mechanisms underlying the incorporation of the SIV and FIV Env glycoproteins into viral particles.

Rational site-directed mutations of the LLP-1 and LLP-2 lentivirus lytic peptide domains in the intracytoplasmic tail of human immunodeficiency virus type 1 gp41 indicate common functions in cell-cell fusion but distinct roles in virion envelope incorporation.

Science.gov (United States)

Kalia, Vandana; Sarkar, Surojit; Gupta, Phalguni; Montelaro, Ronald C

2003-03-01

Two highly conserved cationic amphipathic alpha-helical motifs, designated lentivirus lytic peptides 1 and 2 (LLP-1 and LLP-2), have been characterized in the carboxyl terminus of the transmembrane (TM) envelope glycoprotein (Env) of lentiviruses. Although various properties have been attributed to these domains, their structural and functional significance is not clearly understood. To determine the specific contributions of the Env LLP domains to Env expression, processing, and incorporation and to viral replication and syncytium induction, site-directed LLP mutants of a primary dualtropic infectious human immunodeficiency virus type 1 (HIV-1) isolate (ME46) were examined. Substitutions were made for highly conserved arginine residues in either the LLP-1 or LLP-2 domain (MX1 or MX2, respectively) or in both domains (MX4). The HIV-1 mutants with altered LLP domains demonstrated distinct phenotypes. The LLP-1 mutants (MX1 and MX4) were replication defective and showed an average of 85% decrease in infectivity, which was associated with an evident decrease in gp41 incorporation into virions without a significant decrease in Env expression or processing in transfected 293T cells. In contrast, MX2 virus was replication competent and incorporated a full complement of Env into its virions, indicating a differential role for the LLP-1 domain in Env incorporation. Interestingly, the replication-competent MX2 virus was impaired in its ability to induce syncytia in T-cell lines. This defect in cell-cell fusion did not correlate with apparent defects in the levels of cell surface Env expression, oligomerization, or conformation. The lack of syncytium formation, however, correlated with a decrease of about 90% in MX2 Env fusogenicity compared to that of wild-type Env in quantitative luciferase-based cell-cell fusion assays. The LLP-1 mutant MX1 and MX4 Envs also exhibited an average of 80% decrease in fusogenicity. Altogether, these results demonstrate for the first time that

Empty virions in AAV8 vector preparations reduce transduction efficiency and may cause total viral particle dose-limiting side effects

Directory of Open Access Journals (Sweden)

Kai Gao

2014-01-01

Full Text Available Empty virions are inadvertent by-products of recombinant adeno-associated virus (rAAV packaging process, resulting in vector lots with mixtures of full and empty virions at variable ratios. Impact of empty virions on the efficiency and side effects of rAAV transduction has not been well characterized. Here, we generated partially and completely empty AAV8 virions, fully packaged rAAV8 lots, and mixtures of empty and fully packaged virions with variable ratios of empty virions. The aforementioned dosing formulations of rAAV8 expressing either cellular (EGFP (enhanced green fluorescent protein or nuclear-targeted (n LacZ or secreted (human α1-antitrypsin (hA1AT reporter genes were intravenously injected into two different mouse strains, followed by analyses of transgene expressions and serum alanine aminotransferase (ALT levels at different time points. We found that addition of empty particles to the fixed doses of rAAV8 preparations repressed liver transduction up to 64% (serum hA1AT and 44% (nLacZ in C57BL/6 mice, respectively. The similar trend in inhibiting EGFP expression together with concurrent elevations of serum ALT levels were observed in the BALB/c mice, indicating that empty particles may also exacerbate side effects of rAAV8 EGFP transduction. Our results suggest that removal of empty particles from rAAV preparations may improve efficacy and safety of AAV in clinical applications.

VP3 is crucial for the stability of Nora virus virions.

Science.gov (United States)

Sadanandan, Sajna Anand; Ekström, Jens-Ola; Jonna, Venkateswara Rao; Hofer, Anders; Hultmark, Dan

2016-09-02

Nora virus is an enteric virus that causes persistent, non-pathological infection in Drosophila melanogaster. It replicates in the fly gut and is transmitted via the fecal-oral route. Nora virus has a single-stranded positive-sense RNA genome, which is translated in four open reading frames. Reading frame three encodes the VP3 protein, the structure and function of which we have investigated in this work. We have shown that VP3 is a trimer that has an α-helical secondary structure, with a functionally important coiled-coil domain. In order to identify the role of VP3 in the Nora virus life cycle, we constructed VP3-mutants using the cDNA clone of the virus. Our results show that VP3 does not have a role in the actual assembly of the virus particles, but virions that lack VP3 or harbor VP3 with a disrupted coiled coil domain are incapable of transmission via the fecal-oral route. Removing the region downstream of the putative coiled coil appears to have an effect on the fitness of the virus but does not hamper its replication or transmission. We also found that the VP3 protein and particularly the coiled coil domain are crucial for the stability of Nora virus virions when exposed to heat or proteases. Hence, we propose that VP3 is imperative to Nora virus virions as it confers stability to the viral capsid. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Genetic mutation analysis of HBV covalently closed circular DNA in peripheral blood mononuclear cells from chronic hepatitis B patients with nucleos(tide analog-resistant mutations in serum virions

Directory of Open Access Journals (Sweden)

Zhong-bin LI

2012-06-01

Full Text Available Objective 　To analyze the characteristics of genetic mutations in reverse-transcriptase (RT domain of HBV covalently closed circular DNA (cccDNA in peripheral blood mononuclear cells (PBMCs obtained from chronic hepatitis B (CHB patients with drug-resistant mutations in serum virions during nucleoside/nucleotide analog (NA therapy. Methods 　A total of 30 CHB patients admitted to 302 Hospital of PLA from July 2010 to August 2011 were included in this study. All the patients were confirmed to harbor the drug-resistant mutations in serum virions during an NA therapy longer than 6 months. Total DNA was extracted from PBMCs isolated from 30 whole blood samples at the same time point as that of serum analysis. Plasmid-safe ATP-dependent DNase (PSAD digestion in combination with rolling circle amplification and gap-spanning semi-nested PCR were used to amplify the RT region of HBV cccDNA. NA-resistant-associated mutations were analyzed at nine sites. Results 　HBV cccDNA was efficiently amplified in 16 out of 30 (53.3% PBMC samples, and the detection rate was not correlated with HBeAg-positive rate, serum ALT level or HBV DNA load. Five of 16 (31.3% patients were sustained to have genotype B HBV infection, and 11 of 16 (68.8% were of genotype C HBV infection, and the result was consistent with the genotyping results using serum HBV. Different from drug-resistant mutations detected in the serum virions, the viruses detected in HBV cccDNA of 16 PBMC samples were all wild-type viruses without NA-resistant-associated mutations in RT region. Conclusions 　During NA antiviral treatment, if drug-resistant mutations occur in serum HBV DNA of CHB patients, the dominant species of HBV cccDNA in PBMCs from the same patient is still the original wild-type strains. It is speculated that PBMCs might be the potential "repository" of HBV wild-type strain in vivo.

The herpes simplex virus 1 UL51 protein interacts with the UL7 protein and plays a role in its recruitment into the virion.

Science.gov (United States)

Roller, Richard J; Fetters, Rachel

2015-03-01

The alphaherpesvirus UL51 protein is a tegument component that interacts with the viral glycoprotein E and functions at multiple steps in virus assembly and spread in epithelial cells. We show here that pUL51 forms a complex in infected cells with another conserved tegument protein, pUL7. This complex can form in the absence of other viral proteins and is largely responsible for recruitment of pUL7 to cytoplasmic membranes and into the virion tegument. Incomplete colocalization of pUL51 and pUL7 in infected cells, however, suggests that a significant fraction of the population of each protein is not complexed with the other and that they may accomplish independent functions. The ability of herpesviruses to spread from cell to cell in the face of an immune response is critical for disease and shedding following reactivation from latency. Cell-to-cell spread is a conserved ability of herpesviruses, and the identification of conserved viral genes that mediate this process will aid in the design of attenuated vaccines and of novel therapeutics. The conserved UL51 gene of herpes simplex virus 1 plays important roles in cell-to-cell spread and in virus assembly in the cytoplasm, both of which likely depend on specific interactions with other viral and cellular proteins. Here we identify one of those interactions with the product of another conserved herpesvirus gene, UL7, and show that formation of this complex mediates recruitment of UL7 to membranes and to the virion. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

International Nuclear Information System (INIS)

Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

2011-01-01

Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

International Nuclear Information System (INIS)

Nishiyama, Y.; Rapp, F.

1981-01-01

Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants

Chimeric rabies glycoprotein with a transmembrane domain and cytoplasmic tail from Newcastle disease virus fusion protein incorporates into the Newcastle disease virion at reduced levels.

Science.gov (United States)

Yu, Gui Mei; Zu, Shu Long; Zhou, Wei Wei; Wang, Xi Jun; Shuai, Lei; Wang, Xue Lian; Ge, Jin Ying; Bu, Zhi Gao

2017-08-31

Rabies remains an important worldwide health problem. Newcastle disease virus (NDV) was developed as a vaccine vector in animals by using a reverse genetics approach. Previously, our group generated a recombinant NDV (LaSota strain) expressing the complete rabies virus G protein (RVG), named rL-RVG. In this study, we constructed the variant rL-RVGTM, which expresses a chimeric rabies virus G protein (RVGTM) containing the ectodomain of RVG and the transmembrane domain (TM) and a cytoplasmic tail (CT) from the NDV fusion glycoprotein to study the function of RVG's TM and CT. The RVGTM did not detectably incorporate into NDV virions, though it was abundantly expressed at the surface of infected BHK-21 cells. Both rL-RVG and rL-RVGTM induced similar levels of NDV virus-neutralizing antibody (VNA) after initial and secondary vaccination in mice, whereas rabies VNA induction by rL-RVGTM was markedly lower than that induced by rL-RVG. Though rL-RVG could spread from cell to cell like that in rabies virus, rL-RVGTM lost this ability and spread in a manner similar to the parental NDV. Our data suggest that the TM and CT of RVG are essential for its incorporation into NDV virions and for spreading of the recombinant virus from the initially infected cells to surrounding cells.

Production of antibodies against measles virions by use of the mouse hybridoma technique

International Nuclear Information System (INIS)

Togashi, T.; Oervell, C.; Norrby, E.; Vartdal, F.

1981-01-01

Mouse hybridoma cell lines were produced by fusion of P3 x 63 Ag8 mycloma cells with spleen cells from BALB/c mice immunized with purified measles virions. About 60 per cent of single cell colonies in wells were found to produce measles antibodies as determined by a radioimmune assay. Selected measles antibody producing hybridoma cell lines were passaged intraperitoncally in mice and ascites fluids were collected. This material contained 20 - 200 times higher antibody titers than unconcentrated medium from hybridoma cell lines propagated in tissue culture. The ascites fluid antibody products of 23 hybridoma cell lines were characterized by different measles serological tests. Seventeen lines produced high titers of hemagglutination inhibiting (HI) and hemolysis-inhibition (HLI) antibodies. One hybridoma cell line produced Ig with low HI but high HLI activity and the remaining 5 hybridoma cell line products only carried HLI activity. Unexepctedly it was found in radioimmune precipitation assays that all hybridomas studied, including those showing HLI but no HI antibody activity, gave a selective precipitation of the 79 K measles hemagglutinin polypeptide. Radioimmune precipitation assays with sera from immunized animals showed that they contained high titers of antibodies precipitating the 79 K polypeptide but in addition also somewhat lower titers of antibodies precipitating the 60 K nucleoprotein, 40 K fusion and 36 K matrix polypeptides. Homogeneous Ig products carrying measles antibody activity were demonstrated by imprint immunoelectrophoresis of ascites materials. (Author)

Production of antibodies against measles virions by use of the mouse hybridoma technique

Energy Technology Data Exchange (ETDEWEB)

Togashi, T; Oervell, C; Norrby, E [Kungliga Karolinska Mediko-Kirurgiska Inst., Stockholm (Sweden); Vartdal, F [Rikshospitalet, Oslo (Norway)

1981-01-01

Mouse hybridoma cell lines were produced by fusion of P3 x 63 Ag8 mycloma cells with spleen cells from BALB/c mice immunized with purified measles virions. About 60 per cent of single cell colonies in wells were found to produce measles antibodies as determined by a radioimmune assay. Selected measles antibody producing hybridoma cell lines were passaged intraperitoncally in mice and ascites fluids were collected. This material contained 20 - 200 times higher antibody titers than unconcentrated medium from hybridoma cell lines propagated in tissue culture. The ascites fluid antibody products of 23 hybridoma cell lines were characterized by different measles serological tests. Seventeen lines produced high titers of hemagglutination inhibiting (HI) and hemolysis-inhibition (HLI) antibodies. One hybridoma cell line produced Ig with low HI but high HLI activity and the remaining 5 hybridoma cell line products only carried HLI activity. Unexepctedly it was found in radioimmune precipitation assays that all hybridomas studied, including those showing HLI but no HI antibody activity, gave a selective precipitation of the 79 K measles hemagglutinin polypeptide. Radioimmune precipitation assays with sera from immunized animals showed that they contained high titers of antibodies precipitating the 79 K polypeptide but in addition also somewhat lower titers of antibodies precipitating the 60 K nucleoprotein, 40 K fusion and 36 K matrix polypeptides. Homogeneous Ig products carrying measles antibody activity were demonstrated by imprint immunoelectrophoresis of ascites materials.

Palmitoylation of Sindbis Virus TF Protein Regulates Its Plasma Membrane Localization and Subsequent Incorporation into Virions.

Science.gov (United States)

Ramsey, Jolene; Renzi, Emily C; Arnold, Randy J; Trinidad, Jonathan C; Mukhopadhyay, Suchetana

2017-02-01

Palmitoylation is a reversible, posttranslational modification that helps target proteins to cellular membranes. The alphavirus small membrane proteins 6K and TF have been reported to be palmitoylated and to positively regulate budding. 6K and TF are isoforms that are identical in their N termini but unique in their C termini due to a -1 ribosomal frameshift during translation. In this study, we used cysteine (Cys) mutants to test differential palmitoylation of the Sindbis virus 6K and TF proteins. We modularly mutated the five Cys residues in the identical N termini of 6K and TF, the four additional Cys residues in TF's unique C terminus, or all nine Cys residues in TF. Using these mutants, we determined that TF palmitoylation occurs primarily in the N terminus. In contrast, 6K is not palmitoylated, even on these shared residues. In the C-terminal Cys mutant, TF protein levels increase both in the cell and in the released virion compared to the wild type. In viruses with the N-terminal Cys residues mutated, TF is much less efficiently localized to the plasma membrane, and it is not incorporated into the virion. The three Cys mutants have minor defects in cell culture growth but a high incidence of abnormal particle morphologies compared to the wild-type virus as determined by transmission electron microscopy. We propose a model where the C terminus of TF modulates the palmitoylation of TF at the N terminus, and palmitoylated TF is preferentially trafficked to the plasma membrane for virus budding. Alphaviruses are a reemerging viral cause of arthritogenic disease. Recently, the small 6K and TF proteins of alphaviruses were shown to contribute to virulence in vivo Nevertheless, a clear understanding of the molecular mechanisms by which either protein acts to promote virus infection is missing. The TF protein is a component of budded virions, and optimal levels of TF correlate positively with wild-type-like particle morphology. In this study, we show that the

HIV-1 replication in cell lines harboring INI1/hSNF5 mutations

Directory of Open Access Journals (Sweden)

Wu Xuhong

2006-08-01

Full Text Available Abstract Background INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN. It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. Results We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Conclusion Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that

HIV-1 replication in cell lines harboring INI1/hSNF5 mutations.

Science.gov (United States)

Sorin, Masha; Yung, Eric; Wu, Xuhong; Kalpana, Ganjam V

2006-08-31

INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN). It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that presence of INI1 or some other host factor in virions and

Conformational changes in Sindbis virions resulting from exposure to low pH and interactions with cells suggest that cell penetration may occur at the cell surface in the absence of membrane fusion

International Nuclear Information System (INIS)

Paredes, Angel M.; Ferreira, Davis; Horton, Michelle; Saad, Ali; Tsuruta, Hiro; Johnston, Robert; Klimstra, William; Ryman, Kate; Hernandez, Raquel; Chiu Wah; Brown, Dennis T.

2004-01-01

Alphaviruses have the ability to induce cell-cell fusion after exposure to acid pH. This observation has served as an article of proof that these membrane-containing viruses infect cells by fusion of the virus membrane with a host cell membrane upon exposure to acid pH after incorporation into a cell endosome. We have investigated the requirements for the induction of virus-mediated, low pH-induced cell-cell fusion and cell-virus fusion. We have correlated the pH requirements for this process to structural changes they produce in the virus by electron cryo-microscopy. We found that exposure to acid pH was required to establish conditions for membrane fusion but that membrane fusion did not occur until return to neutral pH. Electron cryo-microscopy revealed dramatic changes in the structure of the virion as it was moved to acid pH and then returned to neutral pH. None of these treatments resulted in the disassembly of the virus protein icosahedral shell that is a requisite for the process of virus membrane-cell membrane fusion. The appearance of a prominent protruding structure upon exposure to acid pH and its disappearance upon return to neutral pH suggested that the production of a 'pore'-like structure at the fivefold axis may facilitate cell penetration as has been proposed for polio (J. Virol. 74 (2000) 1342) and human rhino virus (Mol. Cell 10 (2002) 317). This transient structural change also provided an explanation for how membrane fusion occurs after return to neutral pH. Examination of virus-cell complexes at neutral pH supported the contention that infection occurs at the cell surface at neutral pH by the production of a virus structure that breaches the plasma membrane bilayer. These data suggest an alternative route of infection for Sindbis virus that occurs by a process that does not involve membrane fusion and does not require disassembly of the virus protein shell

Essential role of the unordered VP2 n-terminal domain of the parvovirus MVM capsid in nuclear assembly and endosomal enlargement of the virion fivefold channel for cell entry

Energy Technology Data Exchange (ETDEWEB)

Sanchez-Martinez, Cristina; Grueso, Esther [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Universidad Autonoma de Madrid, 28049 Cantoblanco, Madrid (Spain); Carroll, Miles [Health Protection Agency, Centre for Emergency Preparedness and Response, Porton Down, Salisbury SP4 OJG, Wilts (United Kingdom); Rommelaere, Jean [Deutsches Krebsforschungszentrum Division F010, Im Neuenheimer Feld 242, D-69120 Heidelberg (Germany); Almendral, Jose M., E-mail: jmalmendral@cbm.uam.es [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Universidad Autonoma de Madrid, 28049 Cantoblanco, Madrid (Spain)

2012-10-10

The unordered N-termini of parvovirus capsid proteins (Nt) are translocated through a channel at the icosahedral five-fold axis to serve for virus traffick. Heterologous peptides were genetically inserted at the Nt of MVM to study their functional tolerance to manipulations. Insertion of a 5T4-single-chain antibody at VP2-Nt (2Nt) yielded chimeric capsid subunits failing to enter the nucleus. The VEGFR2-binding peptide (V1) inserted at both 2Nt and VP1-Nt efficiently assembled in virions, but V1 disrupted VP1 and VP2 entry functions. The VP2 defect correlated with restricted externalization of V1-2Nt out of the coat. The specific infectivity of MVM and wtVP-pseudotyped mosaic MVM-V1 virions, upon heating and/or partial 2Nt cleavage, demonstrated that some 2Nt domains become intracellularly translocated out of the virus shell and cleaved to initiate entry. The V1 insertion defines a VP2-driven endosomal enlargement of the channel as an essential structural rearrangement performed by the MVM virion to infect.

Essential role of the unordered VP2 n-terminal domain of the parvovirus MVM capsid in nuclear assembly and endosomal enlargement of the virion fivefold channel for cell entry

International Nuclear Information System (INIS)

Sánchez-Martínez, Cristina; Grueso, Esther; Carroll, Miles; Rommelaere, Jean; Almendral, José M.

2012-01-01

The unordered N-termini of parvovirus capsid proteins (Nt) are translocated through a channel at the icosahedral five-fold axis to serve for virus traffick. Heterologous peptides were genetically inserted at the Nt of MVM to study their functional tolerance to manipulations. Insertion of a 5T4-single-chain antibody at VP2-Nt (2Nt) yielded chimeric capsid subunits failing to enter the nucleus. The VEGFR2-binding peptide (V1) inserted at both 2Nt and VP1-Nt efficiently assembled in virions, but V1 disrupted VP1 and VP2 entry functions. The VP2 defect correlated with restricted externalization of V1-2Nt out of the coat. The specific infectivity of MVM and wtVP-pseudotyped mosaic MVM-V1 virions, upon heating and/or partial 2Nt cleavage, demonstrated that some 2Nt domains become intracellularly translocated out of the virus shell and cleaved to initiate entry. The V1 insertion defines a VP2-driven endosomal enlargement of the channel as an essential structural rearrangement performed by the MVM virion to infect.

Interactions Between HIV-1 Gag and Viral RNA Genome Enhance Virion Assembly

DEFF Research Database (Denmark)

Dilley, Kari A; Nikolaitchik, Olga A; Galli, Andrea

2017-01-01

between Gag and viral RNA are required for the enhancement of particle production. Taken together, these studies are consistent with our previous hypothesis that specific dimeric viral RNA:Gag interactions are the nucleation event of infectious virion assembly, ensuring that one RNA dimer is packaged......Most HIV-1 virions contain two copies of full-length viral RNA, indicating that genome packaging is efficient and tightly regulated. However, the structural protein Gag is the only component required for the assembly of noninfectious virus-like particles and the viral RNA is dispensable...... in this process. The mechanism that allows HIV-1 to achieve such high efficiency of genome packaging when a packageable viral RNA is not required for virus assembly is currently unknown. In this report, we examined the role of HIV-1 RNA in virus assembly and found that packageable HIV-1 RNA enhances particle...

Parental influenza virion nucleocapsids are efficiently transported into the nuclei of murine cells expressing the nuclear interferon-induced Mx protein.

Science.gov (United States)

Broni, B; Julkunen, I; Condra, J H; Davies, M E; Berry, M J; Krug, R M

1990-12-01

The interferon-induced murine Mx1 protein, which is localized in the nucleus, most likely specifically blocks influenza virus replication by inhibiting nuclear viral mRNA synthesis, including the mRNA synthesis catalyzed by inoculum (parental) virion nucleocapsids (R. M. Krug, M. Shaw, B. Broni, G. Shapiro, and O. Haller, J. Virol. 56:201-206, 1985). We tested two possible mechanisms for this inhibition. First, we determined whether the transport of parental nucleocapsids into the nucleus was inhibited in murine cells expressing the nuclear Mx1 protein. To detect the Mx1 protein, we prepared rabbit antibodies against the Mx1 protein with a CheY-Mx fusion protein expressed in bacteria. The fate of parental nucleocapsids was monitored by immunofluorescence with an appropriate dilution of monoclonal antibody to the nucleocapsid protein. The protein synthesis inhibitor anisomycin was added to the cells 30 min prior to infection, so that the only nucleocapsids protein molecules in the cells were those associated with nucleocapsids of the parental virus. These nucleocapsids were efficiently transported into the nuclei of murine cells expressing the Mx1 protein, indicating that this protein most likely acts after the parental nucleocapsids enter the nucleus. The second possibility was that the murine Mx1 protein might act in the nucleus to inhibit viral mRNA synthesis indirectly via new cap-binding activities that sequestered cellular capped RNAs away from the viral RNA transcriptase. We show that the same array of nuclear cap-binding proteins was present in Mx-positive and Mx-negative cells treated with interferon. Interestingly, a large amount of a 43-kDa cap-binding activity appeared after interferon treatment of both Mx-positive and Mx-negative cells. Hence, the appearance of new cap-binding activities was unlikely to account for the Mx-specific inhibition of viral mRNA synthesis. These results are most consistent with the possibility that the Mx1 protein acts

Parental influenza virion nucleocapsids are efficiently transported into the nuclei of murine cells expressing the nuclear interferon-induced Mx protein.

OpenAIRE

Broni, B; Julkunen, I; Condra, J H; Davies, M E; Berry, M J; Krug, R M

1990-01-01

The interferon-induced murine Mx1 protein, which is localized in the nucleus, most likely specifically blocks influenza virus replication by inhibiting nuclear viral mRNA synthesis, including the mRNA synthesis catalyzed by inoculum (parental) virion nucleocapsids (R. M. Krug, M. Shaw, B. Broni, G. Shapiro, and O. Haller, J. Virol. 56:201-206, 1985). We tested two possible mechanisms for this inhibition. First, we determined whether the transport of parental nucleocapsids into the nucleus was...

Multi-faceted proteomic characterization of host protein complement of Rift Valley fever virus virions and identification of specific heat shock proteins, including HSP90, as important viral host factors.

Science.gov (United States)

Nuss, Jonathan E; Kehn-Hall, Kylene; Benedict, Ashwini; Costantino, Julie; Ward, Michael; Peyser, Brian D; Retterer, Cary J; Tressler, Lyal E; Wanner, Laura M; McGovern, Hugh F; Zaidi, Anum; Anthony, Scott M; Kota, Krishna P; Bavari, Sina; Hakami, Ramin M

2014-01-01

Rift Valley fever is a potentially fatal disease of humans and domestic animals caused by Rift Valley fever virus (RVFV). Infection with RVFV in ruminants can cause near 100% abortion rates and recent outbreaks in naïve human populations have suggested case fatality rates of greater than thirty percent. To elucidate the roles that host proteins play during RVFV infection, proteomic analysis of RVFV virions was conducted using complementary analytical approaches, followed by functional validation studies of select identified host factors. Coupling the more traditional Gel LC/MS/MS approach (SDS PAGE followed by liquid chromatography tandem mass spectrometry) with an alternative technique that preserves protein complexes allowed the protein complement of these viral particles to be thoroughly examined. In addition to viral proteins present within the virions and virion-associated host proteins, multiple macromolecular complexes were identified. Bioinformatic analysis showed that host chaperones were among over-represented protein families associated with virions, and functional experiments using siRNA gene silencing and small molecule inhibitors identified several of these heat shock proteins, including heat shock protein 90 (HSP90), as important viral host factors. Further analysis indicated that HSP inhibition effects occur during the replication/transcription phase of the virus life cycle, leading to significant lowering of viral titers without compromising the functional capacity of released virions. Overall, these studies provide much needed further insight into interactions between RVFV and host cells, increasing our understanding of the infection process and suggesting novel strategies for anti-viral development. In particular, considering that several HSP90 inhibitors have been advancing through clinical trials for cancer treatment, these results also highlight the exciting potential of repurposing HSP90 inhibitors to treat RVF.

Multi-faceted proteomic characterization of host protein complement of Rift Valley fever virus virions and identification of specific heat shock proteins, including HSP90, as important viral host factors.

Directory of Open Access Journals (Sweden)

Jonathan E Nuss

Full Text Available Rift Valley fever is a potentially fatal disease of humans and domestic animals caused by Rift Valley fever virus (RVFV. Infection with RVFV in ruminants can cause near 100% abortion rates and recent outbreaks in naïve human populations have suggested case fatality rates of greater than thirty percent. To elucidate the roles that host proteins play during RVFV infection, proteomic analysis of RVFV virions was conducted using complementary analytical approaches, followed by functional validation studies of select identified host factors. Coupling the more traditional Gel LC/MS/MS approach (SDS PAGE followed by liquid chromatography tandem mass spectrometry with an alternative technique that preserves protein complexes allowed the protein complement of these viral particles to be thoroughly examined. In addition to viral proteins present within the virions and virion-associated host proteins, multiple macromolecular complexes were identified. Bioinformatic analysis showed that host chaperones were among over-represented protein families associated with virions, and functional experiments using siRNA gene silencing and small molecule inhibitors identified several of these heat shock proteins, including heat shock protein 90 (HSP90, as important viral host factors. Further analysis indicated that HSP inhibition effects occur during the replication/transcription phase of the virus life cycle, leading to significant lowering of viral titers without compromising the functional capacity of released virions. Overall, these studies provide much needed further insight into interactions between RVFV and host cells, increasing our understanding of the infection process and suggesting novel strategies for anti-viral development. In particular, considering that several HSP90 inhibitors have been advancing through clinical trials for cancer treatment, these results also highlight the exciting potential of repurposing HSP90 inhibitors to treat RVF.

Proteasome-independent degradation of HIV-1 in naturally non-permissive human placental trophoblast cells

Directory of Open Access Journals (Sweden)

Barré-Sinoussi Françoise

2009-05-01

Full Text Available Abstract Background The human placenta-derived cell line BeWo has been demonstrated to be restrictive to cell-free HIV-1 infection. BeWo cells are however permissive to infection by VSV-G pseudotyped HIV-1, which enters cells by a receptor-independent mechanism, and to infection by HIV-1 via a cell-to-cell route. Results Here we analysed viral entry in wild type BeWo (CCR5+, CXCR4+ and BeWo-CD4+ (CD4+, CCR5+, CXCR4+ cells. We report that HIV-1 internalisation is not restricted in either cell line. Levels of internalised p24 antigen between VSV-G HIV-1 pseudotypes and R5 or X4 virions were comparable. We next analysed the fate of internalised virions; X4 and R5 HIV-1 virions were less stable over time in BeWo cells than VSV-G HIV-1 pseudotypes. We then investigated the role of the proteasome in restricting cell-free HIV-1 infection in BeWo cells using proteasome inhibitors. We observed an increase in the levels of VSV-G pseudotyped HIV-1 infection in proteasome-inhibitor treated cells, but the infection by R5-Env or X4-Env pseudotyped virions remains restricted. Conclusion Collectively these results suggest that cell-free HIV-1 infection encounters a surface block leading to a non-productive entry route, which either actively targets incoming virions for non-proteasomal degradation, and impedes their release into the cytoplasm, or causes the inactivation of mechanisms essential for viral replication.

Feline immunodeficiency virus envelope glycoproteins antagonize tetherin through a distinctive mechanism that requires virion incorporation.

Science.gov (United States)

Morrison, James H; Guevara, Rebekah B; Marcano, Adriana C; Saenz, Dyana T; Fadel, Hind J; Rogstad, Daniel K; Poeschla, Eric M

2014-03-01

BST2/tetherin inhibits the release of enveloped viruses from cells. Primate lentiviruses have evolved specific antagonists (Vpu, Nef, and Env). Here we characterized tetherin proteins of species representing both branches of the order Carnivora. Comparison of tiger and cat (Feliformia) to dog and ferret (Caniformia) genes demonstrated that the tiger and cat share a start codon mutation that truncated most of the tetherin cytoplasmic tail early in the Feliformia lineage (19 of 27 amino acids, including the dual tyrosine motif). Alpha interferon (IFN-α) induced tetherin and blocked feline immunodeficiency virus (FIV) replication in lymphoid and nonlymphoid feline cells. Budding of bald FIV and HIV particles was blocked by carnivore tetherins. However, infectious FIV particles were resistant, and spreading FIV replication was uninhibited. Antagonism mapped to the envelope glycoprotein (Env), which rescued FIV from carnivore tetherin restriction when expressed in trans but, in contrast to known antagonists, did not rescue noncognate particles. Also unlike the primate lentiviral antagonists, but similar to the Ebola virus glycoprotein, FIV Env did not reduce intracellular or cell surface tetherin levels. Furthermore, FIV-enveloped FIV particles actually required tetherin for optimal release from cells. The results show that FIV Envs mediate a distinctive tetherin evasion. Well adapted to a phylogenetically ancient tetherin tail truncation in the Felidae, it requires functional virion incorporation of Env, and it shields the budding particle without downregulating plasma membrane tetherin. Moreover, FIV has evolved dependence on this protein: particles containing FIV Env need tetherin for optimal release from the cell, while Env(-) particles do not. HIV-1 antagonizes the restriction factor tetherin with the accessory protein Vpu, while HIV-2 and the filovirus Ebola use their envelope (Env) glycoproteins for this purpose. It turns out that the FIV tetherin antagonist is

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

International Nuclear Information System (INIS)

Hayashi, N; Takada, Y; Mizuno, T; Nakae, H; Murai, T

2016-01-01

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

Energy Technology Data Exchange (ETDEWEB)

Hayashi, N [Graduate school of Health Sciences, Fujita Health University, Tayoake, Aichi (Japan); Takada, Y; Mizuno, T; Nakae, H [Department of Radiology, Ogaki Tokushukai Hospital, Ogaki, Gifu (Japan); Murai, T [Department of Radiation Oncology, Nagoya City University, Nagoya, Aichi (Japan)

2016-06-15

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

Antibody titers in animal bite victims after post exposure vaccination with intradermally administered purified vero cell rabies vaccine using modified thai red cross regimen

International Nuclear Information System (INIS)

Hafeez, S.; Tahir, Z.

2014-01-01

To determine the seroconversion following rabies vaccination by intradermal route in cases of animal bite attending Anti rabies center, Lahore for post exposure prophylaxis. Study Design: Cross sectional descriptive study. Place and Duration: Antirabies center, Birdwood road Lahore, Microbiology laboratory, office of Bacteriologist, Government of Punjab, Lahore. Patients and Methods: Victims of all ages and both sexes having exposure with suspected rabid animal within 24 - 72 hours were included, fulfilling inclusion and exclusion criteria, over 3 months period from February to April 20. Patients of Category II and III wounds were included. Purified vero cell vaccine (PVR V) with antigenic content> 2.5 ml was used for intradermal vaccination according to modified Thai Red Cross regimen (2-2-2-0-2). Each victim received 0.1 ml intradermal dose on each deltoid on day 0, 3, 7 and 28th day of bite. Blood samples from victims were taken on day 0, 14 and 35. Antibody titers were estimated by ELISA kit. Results: Fifty cases were studied including 20 children. Male female ratio was 4:1. Optimum serocon version (> 0.5 IU/ml) was achieved in all cases by day 14. Antibody levels increased further (> 4 IV/ml) in 92% cases on day 35. Geometric mean titers were 3.2 IU/ml and 6.2 IU/ml on day 14 and 35 respectively. Conclusion: Intradermal route for cell culture rabies vaccine for postexposure prophylaxis in animal bite victims was efficacious and safe. The smaller dosage of vaccine was economically affordable by patients in referral centers. (author)

Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication

Science.gov (United States)

Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man

2014-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

Directory of Open Access Journals (Sweden)

Shengniao Niu

Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

Autographa californica multiple nucleopolyhedrovirus ac66 is required for the efficient egress of nucleocapsids from the nucleus, general synthesis of preoccluded virions and occlusion body formation

International Nuclear Information System (INIS)

Ke Jianhao; Wang Jinwen; Deng Riqiang; Wang Xunzhang

2008-01-01

Although orf66 (ac66) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is conserved in all sequenced lepidopteran baculovirus genomes, its function is not known. This paper describes generation of an ac66 knockout AcMNPV bacmid mutant and analyses of the influence of ac66 deletion on the virus replication in Sf-9 cells so as to determine the role of ac66 in the viral life cycle. Results indicated that budded virus (BV) yields were reduced over 99% in ac66-null mutant infected cells in comparison to that in wild-type virus infected cells. Optical microscopy revealed that occlusion body synthesis was significantly reduced in the ac66 knockout bacmid-transfected cells. In addition, ac66 deletion interrupted preoccluded virion synthesis. The mutant phenotype was rescued by an ac66 repair bacmid. On the other hand, real-time PCR analysis indicated that ac66 deletion did not affect the levels of viral DNA replication. Electron microscopy revealed that ac66 is not essential for nucleocapsid assembly, but for the efficient transport of nucleocapsids from the nucleus to the cytoplasm. These results suggested that ac66 plays an important role for the efficient exit of nucleocapsids from the nucleus to the cytoplasm for BV synthesis as well as for preoccluded virion and occlusion synthesis

A complex of seven vaccinia virus proteins conserved in all chordopoxviruses is required for the association of membranes and viroplasm to form immature virions

International Nuclear Information System (INIS)

Szajner, Patricia; Jaffe, Howard; Weisberg, Andrea S.; Moss, Bernard

2004-01-01

Early events in vaccinia virus (VAC) morphogenesis, particularly the formation of viral membranes and their association with viroplasm, are poorly understood. Recently, we showed that repression of A30 or G7 expression results in the accumulation of normal viral membranes that form empty-looking immature virions (IV), which are separated from large masses of electron-dense viroplasm. In addition, A30 and G7 physically and functionally interact with each other and with the F10 protein kinase. To identify other proteins involved in early morphogenesis, proteins from cells that had been infected with vaccinia virus expressing an epitope-tagged copy of F10 were purified by immunoaffinity chromatography and analyzed by gel electrophoresis. In addition to F10, A30, and G7, viral proteins A15, D2, D3, and J1 were identified by mass spectrometry of tryptic peptides. Further evidence for the complex was obtained by immunopurification of proteins associated with epitope-tagged A15, D2, and D3. The previously unstudied A15, like other proteins in the complex, was expressed late in infection, associated with virus cores, and required for the stability and kinase activity of F10. Biochemical and electron microscopic analyses indicated that mutants in which A15 or D2 expression was regulated by the Escherichia coli lac operator system exhibited phenotypes characterized by the presence of large numbers of empty immature virions, similar to the results obtained with inducible A30 and G7 mutants. Empty immature virions were also seen by electron microscopy of cells infected with temperature-sensitive mutants of D2 or D3, though the numbers of membrane forms were reduced perhaps due to additional effects of high temperature

Structural evolution of the P22-like phages: Comparison of Sf6 and P22 procapsid and virion architectures

Energy Technology Data Exchange (ETDEWEB)

Parent, Kristin N. [University of California, San Diego, Department of Chemistry and Biochemistry, La Jolla, CA 92093 (United States); Gilcrease, Eddie B. [University of Utah School of Medicine, Division of Microbiology and Immunology, Department of Pathology, Salt Lake City, UT 84112 (United States); Casjens, Sherwood R., E-mail: sherwood.casjens@path.utah.edu [University of Utah School of Medicine, Division of Microbiology and Immunology, Department of Pathology, Salt Lake City, UT 84112 (United States); Baker, Timothy S., E-mail: tsb@ucsd.edu [University of California, San Diego, Department of Chemistry and Biochemistry, La Jolla, CA 92093 (United States); University of California, San Diego, Division of Biological Sciences, La Jolla, CA 92093 (United States)

2012-06-05

Coat proteins of tailed, dsDNA phages and in herpesviruses include a conserved core similar to the bacteriophage HK97 subunit. This core is often embellished with other domains such as the telokin Ig-like domain of phage P22. Eighty-six P22-like phages and prophages with sequenced genomes share a similar set of virion assembly genes and, based on comparisons of twelve viral assembly proteins (structural and assembly/packaging chaperones), these phages are classified into three groups (P22-like, Sf6-like, and CUS-3-like). We used cryo-electron microscopy and 3D image reconstruction to determine the structures of Sf6 procapsids and virions ({approx} 7 A resolution), and the structure of the entire, asymmetric Sf6 virion (16-A resolution). The Sf6 coat protein is similar to that of P22 yet it has differences in the telokin domain and in its overall quaternary organization. Thermal stability and agarose gel experiments show that Sf6 virions are slightly less stable than those of P22. Finally, bacterial host outer membrane proteins A and C were identified in lipid vesicles that co-purify with Sf6 particles, but are not components of the capsid.

Renal Epithelial Cell Injury Induced by Calcium Oxalate Monohydrate Depends on their Structural Features: Size, Surface, and Crystalline Structure.

Science.gov (United States)

Sun, Xin-Yuan; Ouyang, Jian-Ming; Gan, Qiong-Zhi; Liu, Ai-Jie

2016-11-01

Urinary crystals in normal and kidney stone patients often differ in crystal sizes and surface structures, but the effects of different crystal properties on renal tubular epithelial cells remain unclear. This study aimed to compare the cytotoxicity of micron/nano-calcium oxalate monohydrate (COM) crystals with sizes of 50 nm, 200 nm, 1 μm, 3 μm, and 10 μm to African green monkey renal epithelial (Vero) cells, to reveal the effect of crystal size and surface structure on cell injury, and to investigate the pathological mechanism of calcium oxalate kidney stones. Cell viability, cellular biochemical parameters, and internalized crystal amount in Vero cells were closely associated with the size of COM crystals. At the same concentration (200 μg/mL), COM-1 μm induced the most serious injury to Vero cells and caused the most significant change to cellular biochemical parameters, which were related to the specific porous structure and highest internalized amount in Vero cells. By contrast, COM-50 nm and COM-200 nm crystals lost their small size effect because of serious aggregation and weakened their toxicity to cells. COM-3 μm and COM-10 μm crystals were too large for cells to completely internalize; these crystals also exhibited a low specific surface area and thus weakened their toxicity. The excessive expression of intracellular ROS and reduction of the free-radical scavenger SOD were the main reasons for cell injury and eventually caused necrotic cell death. Crystal size, surface structure, aggregation, and internalization amount were closely related to the cytotoxicity of COM crystals.

Glycoprotein H of herpes simplex virus type 1 requires glycoprotein L for transport to the surfaces of insect cells

NARCIS (Netherlands)

Westra, DF; Glazenburg, KL; Harmsen, MC; Tiran, A; Scheffer, AJ; Welling, GW; The, TH; WellingWester, S

In mammalian cells, formation of heterooligomers consisting of the glycoproteins H and L (gH and gL) of herpes simplex virus type 1 is essential for the cell-to-cell spread of virions and for the penetration of virions into cells. We examined whether formation of gH1/gL1 heterooligomers and cell

The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

Directory of Open Access Journals (Sweden)

Nikki van Bel

Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

Science.gov (United States)

van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben

2014-01-01

The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

Antiviral Effects of Saffron and its Major Ingredients.

Science.gov (United States)

Soleymani, Sepehr; Zabihollahi, Rezvan; Shahbazi, Sepideh; Bolhassani, Azam

2018-01-01

The lack of an effective vaccine against viral infections, toxicity of the synthetic anti-viral drugs and the generation of resistant viral strains led to discover novel inhibitors. Recently, saffron and its compounds were used to treat different pathological conditions. In this study, we tested the anti-HSV-1 and anti-HIV-1 activities of Iranian saffron extract and its major ingredients including crocin and picrocrocin as well as cytotoxicity in vitro. The data showed that the aqueous saffron extract was not active against HIV-1 and HSV-1 virions at certain doses (i.e., a mild activity), but crocin and picrocrocin indicated significant anti-HSV-1 and also anti-HIV-1 activities. Crocin inhibited the HSV replication at before and after entry of virions into Vero cells. Indeed, crocin carotenoid suppressed HSV penetration in the target cells as well as disturbed virus replication after entry into the cells. Picrocrocin was also effective for inhibiting virus entry and also its replication. This monoterpen aldehyde showed higher anti-HSV effects after virus penetrating in the cells. Generally, these sugar-containing compounds extracted from saffron showed to be effective antiherpetic drug candidates. The recent study is the first report suggesting antiviral activities for saffron extract and its major ingredients. Crocin and picrocrocin could be a promising anti-HSV and anti-HIV agent for herbal therapy against viral infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Manipulating mammalian cell morphologies using chemical-mechanical polished integrated circuit chips

Science.gov (United States)

Moussa, Hassan I.; Logan, Megan; Siow, Geoffrey C.; Phann, Darron L.; Rao, Zheng; Aucoin, Marc G.; Tsui, Ting Y.

2017-12-01

Tungsten chemical-mechanical polished integrated circuits were used to study the alignment and immobilization of mammalian (Vero) cells. These devices consist of blanket silicon oxide thin films embedded with micro- and nano-meter scale tungsten metal line structures on the surface. The final surfaces are extremely flat and smooth across the entire substrate, with a roughness in the order of nanometers. Vero cells were deposited on the surface and allowed to adhere. Microscopy examinations revealed that cells have a strong preference to adhere to tungsten over silicon oxide surfaces with up to 99% of cells adhering to the tungsten portion of the surface. Cells self-aligned and elongated into long threads to maximize contact with isolated tungsten lines as thin as 180 nm. The orientation of the Vero cells showed sensitivity to the tungsten line geometric parameters, such as line width and spacing. Up to 93% of cells on 10 μm wide comb structures were aligned within ± 20° of the metal line axis. In contrast, only 22% of cells incubated on 0.18 μm comb patterned tungsten lines were oriented within the same angular interval. This phenomenon is explained using a simple model describing cellular geometry as a function of pattern width and spacing, which showed that cells will rearrange their morphology to maximize their contact to the embedded tungsten. Finally, it was discovered that the materials could be reused after cleaning the surfaces, while maintaining cell alignment capability.

Candidate Medical Countermeasures Targeting Ebola Virus Cell Entry

Science.gov (United States)

2017-04-03

Functionally, GP1,2 alone mediates virion 38 adsorption to host-cell surfaces, receptor binding, fusion of the virion envelope with host-cell 39...survived [60]. However, whether convalescent plasma directly led to recovery could never 123 be determined [61] because the treated individuals also...GP1,2 epitopes: the GP1-GP2 interface, 170 the GP1 glycan cap, and the GP1 mucin-like domain [76]. Administered to crab- eating macaques 171 (Macaca

Two-color fluorescence analysis of individual virions determines the distribution of the copy number of proteins in herpes simplex virus particles.

Science.gov (United States)

Clarke, Richard W; Monnier, Nilah; Li, Haitao; Zhou, Dejian; Browne, Helena; Klenerman, David

2007-08-15

We present a single virion method to determine absolute distributions of copy number in the protein composition of viruses and apply it to herpes simplex virus type 1. Using two-color coincidence fluorescence spectroscopy, we determine the virion-to-virion variability in copy numbers of fluorescently labeled tegument and envelope proteins relative to a capsid protein by analyzing fluorescence intensity ratios for ensembles of individual dual-labeled virions and fitting the resulting histogram of ratios. Using EYFP-tagged capsid protein VP26 as a reference for fluorescence intensity, we are able to calculate the mean and also, for the first time to our knowledge, the variation in numbers of gD, VP16, and VP22 tegument. The measurement of the number of glycoprotein D molecules was in good agreement with independent measurements of average numbers of these glycoproteins in bulk virus preparations, validating the method. The accuracy, straightforward data processing, and high throughput of this technique make it widely applicable to the analysis of the molecular composition of large complexes in general, and it is particularly suited to providing insights into virus structure, assembly, and infectivity.

Tetherin restricts productive HIV-1 cell-to-cell transmission.

Directory of Open Access Journals (Sweden)

Nicoletta Casartelli

2010-06-01

Full Text Available The IFN-inducible antiviral protein tetherin (or BST-2/CD317/HM1.24 impairs release of mature HIV-1 particles from infected cells. HIV-1 Vpu antagonizes the effect of tetherin. The fate of virions trapped at the cell surface remains poorly understood. Here, we asked whether tetherin impairs HIV cell-to-cell transmission, a major means of viral spread. Tetherin-positive or -negative cells, infected with wild-type or DeltaVpu HIV, were used as donor cells and cocultivated with target lymphocytes. We show that tetherin inhibits productive cell-to-cell transmission of DeltaVpu to targets and impairs that of WT HIV. Tetherin accumulates with Gag at the contact zone between infected and target cells, but does not prevent the formation of virological synapses. In the presence of tetherin, viruses are then mostly transferred to targets as abnormally large patches. These viral aggregates do not efficiently promote infection after transfer, because they accumulate at the surface of target cells and are impaired in their fusion capacities. Tetherin, by imprinting virions in donor cells, is the first example of a surface restriction factor limiting viral cell-to-cell spread.

Capillarity-induced disassembly of virions in carbon nanotubes

Energy Technology Data Exchange (ETDEWEB)

Fan Xiaobin; Peng Wenchao; Li Yang; Li Xianyu; Zhang Guoliang; Zhang Fengbao [School of Chemical Engineering and Technology, Tianjin University, Tianjin (China); Barclay, J Elaine; Evans, David J [Department of Biological Chemistry, John Innes Centre, Norwich Research Park, Norwich NR4 7UH (United Kingdom)], E-mail: fbzhang@tju.edu.cn

2008-04-23

Studying the transport and fate of viruses through nanochannels is of great importance. By using the nanochannel of a carbon nanotube (CNT) as an ideal model, we evaluated the possibility of capillarity-induced viral transport through a closely fitting nanochannel and explored the mechanisms involved. It is shown both experimentally and theoretically that Cowpea mosaic virus can enter CNTs by capillarity. However, when introduced into a nanotube the protein capsid may disassemble. During the initial capillary filling stage, anomalous needle-shaped high pressure exists in the centre of the nanotube's entrance. This high pressure, combining with the significant negative pressure within the nanotube, may account for the disassembly of the virions.

The central globular domain of the nucleocapsid protein of human immunodeficiency virus type 1 is critical for virion structure and infectivity.

Science.gov (United States)

Ottmann, M; Gabus, C; Darlix, J L

1995-03-01

The nucleocapsid protein NCp7 of human immunodeficiency virus type 1 (HIV-1) is a 72-amino-acid peptide containing two CCHC-type zinc fingers linked by a short basic sequence, 29RAPRKKG35, which is conserved in HIV-1 and simian immunodeficiency virus. The complete three-dimensional structure of NCp7 has been determined by 1H-nuclear magnetic resonance spectroscopy (N. Morellet, H. de Rocquigny, Y. Mely, N. Jullian, H. Demene, M. Ottmann, D. Gerard, J. L. Darlix, M. C. Fournié-Zaluski, and B. P. Roques, J. Mol. Biol. 235:287-301, 1994) and revealed a central globular domain where the two zinc fingers are brought in close proximity by the RAPRKKG linker. To examine the role of this globular structure and more precisely of the RAPRKKG linker in virion structure and infectivity, we generated HIV-1 DNA mutants in the RAPRKK sequence of NCp7 and analyzed the mutant virions produced by transfected cells. Mutations that probably alter the structure of NCp7 structure led to the formation of very poorly infectious virus (A30P) or noninfectious virus (P31L and R32G). In addition, the P31L mutant did not contain detectable amounts of reverse transcriptase and had an immature core morphology, as determined by electron microscopy. On the other hand, mutations changing the basic nature of NCp7 had poor effect. R29S had a wild-type phenotype, and the replacement of 32RKK34 by SSS (S3 mutant) resulted in a decrease by no more than 100-fold of the virus titer. These results clearly show that the RAPRKKG linker contains residues that are critical for virion structure and infectivity.

Inspirations on Virus Replication and Cell-to-Cell Movement from Studies Examining the Cytopathology Induced by Lettuce infectious yellows virus in Plant Cells

Directory of Open Access Journals (Sweden)

Wenjie Qiao

2017-09-01

Full Text Available Lettuce infectious yellows virus (LIYV is the type member of the genus Crinivirus in the family Closteroviridae. Like many other positive-strand RNA viruses, LIYV infections induce a number of cytopathic changes in plant cells, of which the two most characteristic are: Beet yellows virus-type inclusion bodies composed of vesicles derived from cytoplasmic membranes; and conical plasmalemma deposits (PLDs located at the plasmalemma over plasmodesmata pit fields. The former are not only found in various closterovirus infections, but similar structures are known as ‘viral factories’ or viroplasms in cells infected with diverse types of animal and plant viruses. These are generally sites of virus replication, virion assembly and in some cases are involved in cell-to-cell transport. By contrast, PLDs induced by the LIYV-encoded P26 non-virion protein are not involved in replication but are speculated to have roles in virus intercellular movement. These deposits often harbor LIYV virions arranged to be perpendicular to the plasma membrane over plasmodesmata, and our recent studies show that P26 is required for LIYV systemic plant infection. The functional mechanism of how LIYV P26 facilitates intercellular movement remains unclear, however, research on other plant viruses provides some insights on the possible ways of viral intercellular movement through targeting and modifying plasmodesmata via interactions between plant cellular components and viral-encoded factors. In summary, beginning with LIYV, we review the studies that have uncovered the biological determinants giving rise to these cytopathological effects and their importance in viral replication, virion assembly and intercellular movement during the plant infection by closteroviruses, and compare these findings with those for other positive-strand RNA viruses.

Generation of H9 T-cells stably expressing a membrane-bound form of the cytoplasmic tail of the Env-glycoprotein: lack of transcomplementation of defective HIV-1 virions encoding C-terminally truncated Env

Directory of Open Access Journals (Sweden)

Bosch Valerie

2006-05-01

Full Text Available Abstract H9-T-cells do not support the replication of mutant HIV-1 encoding Env protein lacking its long cytoplasmic C-terminal domain (Env-CT. Here we describe the generation of a H9-T-cell population constitutively expressing the HIV-1 Env-CT protein domain anchored in the cellular membrane by it homologous membrane-spanning domain (TMD. We confirmed that the Env-TMD-CT protein was associated with cellular membranes, that its expression did not have any obvious cytotoxic effects on the cells and that it did not affect wild-type HIV-1 replication. However, as measured in both a single-round assay as well as in spreading infections, replication competence of mutant pNL-Tr712, lacking the Env-CT, was not restored in this H9 T-cell population. This means that the Env-CT per se cannot transcomplement the replication block of HIV-1 virions encoding C-terminally truncated Env proteins and suggests that the Env-CT likely exerts its function only in the context of the complete Env protein.

Standardization and assessment of cell culture media quantities in roller poly ethylene terephthalate bottles employed in the industrial rabies viral vaccine production.

Science.gov (United States)

Jagannathan, S; Chaansha, S; Rajesh, K; Santhiya, T; Charles, C; Venkataramana, K N

2009-09-15

Vero cells are utilized for production of rabies vaccine. This study deals with the optimize quantity media require for the rabies vaccine production in the smooth roller surface. The rabies virus (Pasteur vaccine strain) is infected to monolayer of the various experimented bottles. To analyze the optimal quantity of media for the production of rabies viral harvest during the process of Vero cell derived rabies vaccine. The trials are started from 200 to 400 mL (PTARV-1, PTARV-2, PTARV-3, PTARV-4 and PTARV-5). The samples are taken in an appropriate time intervals for analysis of In Process Quality Control (IPQC) tests. The collected viral harvests are further processed to rabies vaccine in a pilot level and in addition to scale up an industrial level. Based on the evaluation the PTARV-2 (250 mL) show highly encouraging results for the Vero cell derived rabies vaccine production.

Intracellular Crosslinking of Filoviral Nucleoproteins with Xintrabodies Restricts Viral Packaging

Directory of Open Access Journals (Sweden)

Tamarand Lee Darling

2017-09-01

Full Text Available Viruses assemble large macromolecular repeat structures that become part of the infectious particles or virions. Ribonucleocapsids (RNCs of negative strand RNA viruses are a prime example where repetition of nucleoprotein (NP along the genome creates a core polymeric helical scaffold that accommodates other nucleocapsid proteins including viral polymerase. The RNCs are transported through the cytosol for packaging into virions through association with viral matrix proteins at cell membranes. We hypothesized that RNC would be ideal targets for crosslinkers engineered to promote aberrant protein–protein interactions, thereby blocking their orderly transport and packaging. Previously, we had generated single-domain antibodies (sdAbs against Filoviruses that have all targeted highly conserved C-terminal regions of NP known to be repetitively exposed along the length of the RNCs of Marburgvirus (MARV and Ebolavirus (EBOV. Our crosslinker design consisted of dimeric sdAb expressed intracellularly, which we call Xintrabodies (X- for crosslinking. Electron microscopy of purified NP polymers incubated with purified sdAb constructs showed NP aggregation occurred in a genus-specific manner with dimeric and not monomeric sdAb. A virus-like particle (VLP assay was used for initial evaluation where we found that dimeric sdAb inhibited NP incorporation into VP40-based VLPs whereas monomeric sdAb did not. Inhibition of NP packaging was genus specific. Confocal microscopy revealed dimeric sdAb was diffuse when expressed alone but focused on pools of NP when the two were coexpressed, while monomeric sdAb showed ambivalent partition. Infection of stable Vero cell lines expressing dimeric sdAb specific for either MARV or EBOV NP resulted in smaller plaques and reduced progeny of cognate virus relative to wild-type Vero cells. Though the impact was marginal at later time-points, the collective data suggest that viral replication can be reduced by crosslinking

Introducing a frameshift mutation to the POL sequence of HIV-1 provirus and evaluation of the immunogenic characteristics of the mutated virions (RINNL4-3).

Science.gov (United States)

Zabihollahi, Rezvan; Sadat, Seyed Mehdi; Vahabpour, Rouhollah; Salehi, Mansoor; Azadmanesh, Kayhan; Siadat, Seyed Davar; Saraji, Ali Reza Azizi; Pouriavali, Mohamamd Hassan; Momen, Seyed Bahman; Aghasadeghi, Mohamad Reza

2012-01-01

Inactivation of the reverse transcriptase (RT) and integrase (IN) enzymes can abolish the replication of the human immunodeficiency virus (HIV) and, thus, its infectivity. Here, inactivated HIV particles convenient for designing virus-like particle (VLP) based vaccines have been produced. Inactivated HIV-provirus was created by introducing a frame shift mutation. HIV provirus DNA was cut in the pol region by Age I restriction enzyme, followed by filling of sticky ends using the Klenow fragment before ligation. The resulting plasmid was named as pRINNL4-3. HEK-293T cells were used as producer, after being transfected with the modified plasmid. Viral particle production and biological activity were assayed by virus capsid protein (p24) quantification and syncytium formation in MT2 cells, respectively. The immunogenicity of the RINNL4-3 virions was investigated in a mouse model. The mutation was expected to inactivate the virus RT and IN enzymes. The results showed that the VLPs were assembled, as measured by the p24 load of the culture supernatant, and contained functional envelope proteins (Env) as monitored by the syncytium formation. However, these VLPs had no ability to infect target MT2 cells, as well as their VSVG (vesicular stomatitis virus-glycoprotein) pseudotyped counterparts infected HEK-293T cells. A high level of antibody response was observed in immunized mice. Since RINNL4-3 virions are replication incompetent, they are convenient for production and use in biomedical studies. Also, RINNL4-3 is a candidate for a vaccine development due to it contains envelope and structural virus proteins which are crucial for triggering neutralizing antibodies and the cellular immune response.

Immunogenicity, safety and antibody persistence of a purified vero cell cultured rabies vaccine (Speeda) administered by the Zagreb regimen or Essen regimen in post-exposure subjects.

Science.gov (United States)

Shi, Nianmin; Zhang, Yibin; Zheng, Huizhen; Zhu, Zhenggang; Wang, Dingming; Li, Sihai; Li, Yuhua; Yang, Liqing; Zhang, Junnan; Bai, Yunhua; Lu, Qiang; Zhang, Zheng; Luo, Fengji; Yu, Chun; Li, Li

2017-06-03

To compare the safety, immunogenicity and long-term effect of a purified vero cell cultured rabies vaccine in post-exposure subjects following 2 intramuscular regimens, Zagreb or Essen regimen. Serum samples were collected before vaccination and on days 7, 14, 42, 180 and 365 post vaccination. Solicited adverse events were recorded for 7 d following each vaccine dose, and unsolicited adverse events throughout the entire study period. This study was registered with ClinicalTrials.gov (NCT01821911 and NCT01827917). No serious adverse events were reported. Although Zagreb regimen had a higher incidence of adverse reactions than Essen regimen at the first and second injection, the incidence was similar at the third and fourth injection between these 2 groups as well. At day 42, 100% subjects developed adequate rabies virus neutralizing antibody concentrations (≥ 0.5IU/ml) for both regimens. At days 180 and 365, the antibody level decreased dramatically, however, the percentage of subjects with adequate antibody concentrations still remained high (above 75% and 50% respectively). None of confirmed rabies virus exposured subjects had rabies one year later, and percentage of subjects with adequate antibody concentrations reached 100% at days 14 and 42. Rabies post-exposure prophylaxis vaccination with PVRV following a Zagreb regimen had a similar safety, immunogenicity and long-term effect to the Essen regimen in China.

Susceptibility of various cell lines to Neospora caninum tachyzoites cultivation

Directory of Open Access Journals (Sweden)

Khordadmehr, M.,

2014-05-01

Full Text Available Neospora caninum is a coccidian protozoan parasite which is a major cause of bovine abortions and neonatal mortality in cattle, sheep, goat and horse. Occasionally, cultured cells are used for isolation and multiplication of the agent in vitro with several purposes. In this study the tachyzoite yields of N. caninum were compared in various cell cultures as the host cell lines. Among the cell cultures tested, two presented good susceptibility to the agent: cell lines Vero and MA-104. SW742 and TLI (in vitro suspension culture of lymphoid cells infected with Theileria lestoquardi showed moderate sensitivity. No viable tachyzoite were detected in the culture of MDCK and McCoy cell lines. These results demonstrate that MA-104 and SW742 cells present adequate susceptibility to N. caninum compared to Vero cells, which have been largely used to multiply the parasite in vitro. Moreover, these have easy manipulation, fast multiplication and relatively low nutritional requirements. In addition, the result of this study showed that TLI cell line as a suspension cell culture is susceptible to Nc-1 tachyzoites infection and could be used as an alternative host cell line for tachyzoites culture in vitro studies.

An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.

LENUS (Irish Health Repository)

McDonnell, R J

1997-12-12

An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.

[The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

Science.gov (United States)

Zuffa, T

1987-10-01

The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

International Nuclear Information System (INIS)

Das, Subhendu; Pellett, Philip E.

2007-01-01

The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress

The 5’cap of Tobacco Mosaic Virus (TMV) is required for virion attachment to the actin/ER network during early infection

DEFF Research Database (Denmark)

Christensen, Nynne Meyn; Tilsner, Jens; Bell, Karen

to the motile cortical actin/ER network within minutes of injection. Granule movement on actin/ER was arrested by actin inhibitors indicating actindependent RNA movement. The 5’ methylguanosine TMV cap was shown to be required for vRNA anchoring to the ER. TMV vRNA lacking the 5’cap failed to form granules...... the fluorescent vRNA pool nor co-injected GFP left the injected trichome, indicating that the synthesis of unlabelled progeny viral (v)RNA is required to initiate cell-cell movement, and that virus movement is not accompanied by passive plasmodesmatal gating. Cy3-vRNA formed granules that became anchored...... on the same ER-bound granules, indicating that TMV virions may become attached to the ER prior to uncoating of the viral genome....

Properties of virion transactivator proteins encoded by primate cytomegaloviruses

Directory of Open Access Journals (Sweden)

Barry Peter A

2009-05-01

Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All

[Cytotoxic effect of physalis peruviana in cell culture of colorectal and prostate cancer and chronic myeloid leukemia].

Science.gov (United States)

Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham

2009-01-01

The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.

A plasma membrane localization signal in the HIV-1 envelope cytoplasmic domain prevents localization at sites of vesicular stomatitis virus budding and incorporation into VSV virions.

Science.gov (United States)

Johnson, J E; Rodgers, W; Rose, J K

1998-11-25

Previous studies showed that the HIV-1 envelope (Env) protein was not incorporated into vesicular stomatitis virus (VSV) virions unless its cytoplasmic tail was replaced with that of the VSV glycoprotein (G). To determine whether the G tail provided a positive incorporation signal for Env, or if sequences in the Env tail prevented incorporation, we generated mutants of Env with its 150-amino-acid tail shortened to 29, 10, or 3 amino acids (Envtr mutants). Cells infected with VSV recombinants expressing these proteins or an Env-G tail hybrid showed similar amounts of Env protein at the surface. The Env-G tail hybrid or the Envtr3 mutant were incorporated at the highest levels into budding VSV virions. In contrast, the Envtr29 or Envtr10 mutants were incorporated poorly. These results defined a signal preventing incorporation within the 10 membrane-proximal amino acids of the Env tail. Confocal microscopy revealed that this signal functioned by causing localization of human immunodeficiency virus type 1 Env to plasma membrane domains distinct from the VSV budding sites, where VSV proteins were concentrated. Copyright 1998 Academic Press.

A single intranasal administration of virus-like particle vaccine induces an efficient protection for mice against human respiratory syncytial virus.

Science.gov (United States)

Jiao, Yue-Ying; Fu, Yuan-Hui; Yan, Yi-Fei; Hua, Ying; Ma, Yao; Zhang, Xiu-Juan; Song, Jing-Dong; Peng, Xiang-Lei; Huang, Jiaqiang; Hong, Tao; He, Jin-Sheng

2017-08-01

Human respiratory syncytial virus (RSV) is an important pediatric pathogen causing acute viral respiratory disease in infants and young children. However, no licensed vaccines are currently available. Virus-like particles (VLPs) may bring new hope to producing RSV VLP vaccine with high immunogenicity and safety. Here, we constructed the recombinants of matrix protein (M) and fusion glycoprotein (F) of RSV, respectively into a replication-deficient first-generation adenoviral vector (FGAd), which were used to co-infect Vero cells to assemble RSV VLPs successfully. The resulting VLPs showed similar immunoreactivity and function to RSV virion in vitro. Moreover, Th1 polarized response, and effective mucosal virus-neutralizing antibody and CD8 + T-cell responses were induced by a single intranasal (i.n.) administration of RSV VLPs rather than intramuscular (i.m.) inoculation, although the comparable RSV F-specific serum IgG and long-lasting RSV-specific neutralizing antibody were detected in the mice immunized by both routes. Upon RSV challenge, VLP-immunized mice showed increased viral clearance but decreased signs of enhanced lung pathology and fewer eosinophils compared to mice immunized with formalin-inactivated RSV (FI-RSV). In addition, a single i.n. RSV VLP vaccine has the capability to induce RSV-specific long-lasting neutralizing antibody responses observable up to 15 months. Our results demonstrate that the long-term and memory immune responses in mice against RSV were induced by a single i.n. administration of RSV VLP vaccine, suggesting a successful approach of RSV VLPs as an effective and safe mucosal vaccine against RSV infection, and an applicable and qualified platform of FGAd-infected Vero cells for VLP production. Copyright © 2017. Published by Elsevier B.V.

The herpes simplex virus receptor nectin-1 is down-regulated after trans-interaction with glycoprotein D

International Nuclear Information System (INIS)

Stiles, Katie M.; Milne, Richard S.B.; Cohen, Gary H.; Eisenberg, Roselyn J.; Krummenacher, Claude

2008-01-01

During herpes simplex virus (HSV) entry, membrane fusion occurs either on the cell surface or after virus endocytosis. In both cases, binding of glycoprotein D (gD) to a receptor such as nectin-1 or HVEM is required. In this study, we co-cultured cells expressing gD with nectin-1 expressing cells to investigate the effects of gD on nectin-1 at cell contacts. After overnight co-cultures with gD expressing cells, there was a down-regulation of nectin-1 in B78H1-C10, SY5Y, A431 and HeLa cells, which HSV enters by endocytosis. In contrast, on Vero cells, which HSV enters at the plasma membrane, nectin-1 was not down-regulated. Further analysis of B78H1-derived cells showed that nectin-1 down-regulation corresponds to the ability of gD to bind nectin-1 and is achieved by internalization and low-pH-dependent degradation of nectin-1. Moreover, gD is necessary for virion internalization in B78H1 cells expressing nectin-1. These data suggest that the determinants of gD-mediated internalization of nectin-1 may direct HSV to an endocytic pathway during entry

Enhanced staphylolytic activity of the Staphylococcus aureus bacteriophage vB_SauS-phiIPLA88 HydH5 virion associated peptidoglycan hydrolase: fusions, deletions and synergy with LysH5

Science.gov (United States)

Virion-associated peptidoglycan hydrolases have a potential as antimicrobial agents due to their ability to lyse Gram positive bacteria on contact. In this work, our aim was to improve the lytic activity of HydH5, a virion associated peptidoglycan hydrolase from the Staphylococcus aureus bacteriopha...

PVP-SVM: Sequence-Based Prediction of Phage Virion Proteins Using a Support Vector Machine.

Science.gov (United States)

Manavalan, Balachandran; Shin, Tae H; Lee, Gwang

2018-01-01

Accurately identifying bacteriophage virion proteins from uncharacterized sequences is important to understand interactions between the phage and its host bacteria in order to develop new antibacterial drugs. However, identification of such proteins using experimental techniques is expensive and often time consuming; hence, development of an efficient computational algorithm for the prediction of phage virion proteins (PVPs) prior to in vitro experimentation is needed. Here, we describe a support vector machine (SVM)-based PVP predictor, called PVP-SVM, which was trained with 136 optimal features. A feature selection protocol was employed to identify the optimal features from a large set that included amino acid composition, dipeptide composition, atomic composition, physicochemical properties, and chain-transition-distribution. PVP-SVM achieved an accuracy of 0.870 during leave-one-out cross-validation, which was 6% higher than control SVM predictors trained with all features, indicating the efficiency of the feature selection method. Furthermore, PVP-SVM displayed superior performance compared to the currently available method, PVPred, and two other machine-learning methods developed in this study when objectively evaluated with an independent dataset. For the convenience of the scientific community, a user-friendly and publicly accessible web server has been established at www.thegleelab.org/PVP-SVM/PVP-SVM.html.

PVP-SVM: Sequence-Based Prediction of Phage Virion Proteins Using a Support Vector Machine

Directory of Open Access Journals (Sweden)

Balachandran Manavalan

2018-03-01

Full Text Available Accurately identifying bacteriophage virion proteins from uncharacterized sequences is important to understand interactions between the phage and its host bacteria in order to develop new antibacterial drugs. However, identification of such proteins using experimental techniques is expensive and often time consuming; hence, development of an efficient computational algorithm for the prediction of phage virion proteins (PVPs prior to in vitro experimentation is needed. Here, we describe a support vector machine (SVM-based PVP predictor, called PVP-SVM, which was trained with 136 optimal features. A feature selection protocol was employed to identify the optimal features from a large set that included amino acid composition, dipeptide composition, atomic composition, physicochemical properties, and chain-transition-distribution. PVP-SVM achieved an accuracy of 0.870 during leave-one-out cross-validation, which was 6% higher than control SVM predictors trained with all features, indicating the efficiency of the feature selection method. Furthermore, PVP-SVM displayed superior performance compared to the currently available method, PVPred, and two other machine-learning methods developed in this study when objectively evaluated with an independent dataset. For the convenience of the scientific community, a user-friendly and publicly accessible web server has been established at www.thegleelab.org/PVP-SVM/PVP-SVM.html.

Deletion of the AcMNPV core gene ac109 results in budded virions that are non-infectious

International Nuclear Information System (INIS)

Fang Minggang; Nie, Yingchao; Theilmann, David A.

2009-01-01

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) ac109 is a core gene and its function in the virus life cycle is unknown. To determine its role in the baculovirus life cycle, we used the AcMNPV bacmid system to generate an ac109 deletion virus (vAc 109KO ). Fluorescence and light microscopy showed that transfection of vAc 109KO results in a single-cell infection phenotype. Viral DNA replication is unaffected and the development of occlusion bodies in vAc 109KO -transfected cells evidenced progression to the very late phases of viral infection. Western blot and confocal immunofluorescence analysis showed that AC109 is expressed in the cytoplasm and nucleus throughout infection. In addition, AC109 is a structural protein as it was detected in both budded virus (BV) and occlusion derived virus in both the envelope and nucleocapsid fractions. Titration assays by qPCR and TCID 50 showed that vAc 109KO produced BV but the virions are non-infectious. The vAc 109KO BV were indistinguishable from the BV of repaired and wild type control viruses as determined by negative staining and electron microscopy.

Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

Energy Technology Data Exchange (ETDEWEB)

Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

2014-02-15

Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication

Directory of Open Access Journals (Sweden)

Heinrich Jochen

2009-04-01

Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.

Identification of Contaminated Cells with Viruses, Bacteria, or Fungi by Fourier Transform Infrared Microspectroscopy

Directory of Open Access Journals (Sweden)

V. Erukhimovitch

2013-01-01

Full Text Available Fourier transform infrared microspectroscopy (FTIR-M can detect small molecular changes in cells and therefore was previously applied for the identification of different biological samples. In the present study, FTIR spectroscopy was used for the identification and discrimination of Vero cells infected with herpes viruses or contaminated with bacteria or fungi in cell culture. Vero cells in culture were infected herpes simplex virus type 1 (HSV-1 or contaminated with E. coli bacteria or Candida albicans fungi and analyzed by FTIR microscopy at 24 h postinfection/contamination. Specific different spectral changes were observed according to the infecting or contaminating agent. For instance, both pure fungi and cell culture contaminated with this fungi showed specific peaks at 1030 cm−1 and at 1373 cm−1 regions, while pure E. coli and cell culture contaminated with this bacteria showed a specific and unique peak at 1657 cm−1. These results support the potential of developing FTIR microspectroscopy as a simple, reagent free method for identification and discrimination between different tissue infection or contamination with various pathogens.

Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

Directory of Open Access Journals (Sweden)

Yamaguchi Ryoji

2009-10-01

Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Extensive in silico analysis of Mimivirus coded Rab GTPase homolog suggests a possible role in virion membrane biogenesis

Directory of Open Access Journals (Sweden)

Amrutraj eZade

2015-09-01

Full Text Available Rab GTPases are the key regulators of intracellular membrane trafficking in eukaryotes. Many viruses and intracellular bacterial pathogens have evolved to hijack the host Rab GTPase functions, mainly through activators and effector proteins, for their benefit. Acanthamoeba polyphaga mimivirus (APMV is one of the largest viruses and belongs to the monophyletic clade of nucleo-cytoplasmic large DNA viruses (NCLDV. The inner membrane lining is integral to the APMV virion structure. APMV assembly involves extensive host membrane modifications, like vesicle budding and fusion, leading to the formation of a membrane sheet that is incorporated into the virion. Intriguingly, APMV and all group I members of the Mimiviridae family code for a putative Rab GTPase protein. APMV is the first reported virus to code for a Rab GTPase (encoded by R214 gene. Our thorough in silico analysis of the subfamily specific (SF region of Mimiviridae Rab GTPase sequences suggests that they are related to Rab5, a member of the group II Rab GTPases, of lower eukaryotes. Because of their high divergence from the existing three isoforms, A, B and C of the Rab5-family, we suggest that Mimiviridae Rabs constitute a new isoform, Rab5D. Phylogenetic analysis indicated probable horizontal acquisition from a lower eukaryotic ancestor followed by selection and divergence. Furthermore, interaction network analysis suggests that vps34 (a Class III P13K homolog, coded by APMV L615, Atg-8 and dynamin (host proteins are recruited by APMV Rab GTPase during capsid assembly. Based on these observations, we hypothesize that APMV Rab plays a role in the acquisition of inner membrane during virion assembly.

Site-directed mutagenesis of HIV-1 vpu gene demonstrates two clusters of replication-defective mutants with distinct ability to down-modulate cell surface CD4 and tetherin

Directory of Open Access Journals (Sweden)

Masako Nomaguchi

2010-11-01

Full Text Available HIV-1 Vpu acts positively on viral infectivity by mediating CD4 degradation in endoplasmic reticulum and enhances virion release by counteracting a virion release restriction factor, tetherin. In order to define the impact of Vpu activity on HIV-1 replication, we have generated a series of site-specific proviral vpu mutants. Of fifteen mutants examined, seven exhibited a replication-defect similar to that of a vpu-deletion mutant in a lymphocyte cell line H9. These mutations clustered in narrow regions within transmembrane domain (TMD and cytoplasmic domain (CTD. Replication-defective mutants displayed the reduced ability to enhance virion release from a monolayer cell line HEp2 without exception. Upon transfection with Vpu expression vectors, neither TMD mutants nor CTD mutants blocked CD4 expression at the cell surface in another monolayer cell line MAGI. While TMD mutants were unable to down-modulate cell surface tetherin in HEp2 cells, CTD mutants did quite efficiently. Confocal microscopy analysis revealed the difference of intracellular localization between TMD and CTD mutants. In total, replication capability of HIV-1 carrying vpu mutations correlates well with the ability of Vpu to enhance virion release and to impede the cell surface expression of CD4 but not with the ability to down-modulate cell surface tetherin. Our results here suggest that efficient viral replication requires not only down-regulation of cell surface tetherin but also its degradation.

Interaction of Sendai virus (HVJ) with chicken red blood cells, 2

International Nuclear Information System (INIS)

Hosokawa, Yasushi

1976-01-01

The centrifugally purified virions which were labeled with 3 H-Glucosamine and 14 C-Leucine were adsorbed and eluted onto red blood cells (RBC), and their 3 H/ 14 C ratio in each steps of procedure were determined. The result showed that the excess glucosamine containing substances (GS) were removed from virions during adsorption-elution onto RBC, and remained attached on the RBC without dispersing into the medium. A similar result was obtained by using the glutaraldehyde treated RBC. (auth.)

Probing the HIV-1 genomic RNA trafficking pathway and dimerization by genetic recombination and single virion analyses.

Directory of Open Access Journals (Sweden)

Michael D Moore

2009-10-01

Full Text Available Once transcribed, the nascent full-length RNA of HIV-1 must travel to the appropriate host cell sites to be translated or to find a partner RNA for copackaging to form newly generated viruses. In this report, we sought to delineate the location where HIV-1 RNA initiates dimerization and the influence of the RNA transport pathway used by the virus on downstream events essential to viral replication. Using a cell-fusion-dependent recombination assay, we demonstrate that the two RNAs destined for copackaging into the same virion select each other mostly within the cytoplasm. Moreover, by manipulating the RNA export element in the viral genome, we show that the export pathway taken is important for the ability of RNA molecules derived from two viruses to interact and be copackaged. These results further illustrate that at the point of dimerization the two main cellular export pathways are partially distinct. Lastly, by providing Gag in trans, we have demonstrated that Gag is able to package RNA from either export pathway, irrespective of the transport pathway used by the gag mRNA. These findings provide unique insights into the process of RNA export in general, and more specifically, of HIV-1 genomic RNA trafficking.

Viruses transfer the antiviral second messenger cGAMP between cells.

Science.gov (United States)

Bridgeman, A; Maelfait, J; Davenne, T; Partridge, T; Peng, Y; Mayer, A; Dong, T; Kaever, V; Borrow, P; Rehwinkel, J

2015-09-11

Cyclic GMP-AMP synthase (cGAS) detects cytosolic DNA during virus infection and induces an antiviral state. cGAS signals by synthesis of a second messenger, cyclic GMP-AMP (cGAMP), which activates stimulator of interferon genes (STING). We show that cGAMP is incorporated into viral particles, including lentivirus and herpesvirus virions, when these are produced in cGAS-expressing cells. Virions transferred cGAMP to newly infected cells and triggered a STING-dependent antiviral program. These effects were independent of exosomes and viral nucleic acids. Our results reveal a way by which a signal for innate immunity is transferred between cells, potentially accelerating and broadening antiviral responses. Moreover, infection of dendritic cells with cGAMP-loaded lentiviruses enhanced their activation. Loading viral vectors with cGAMP therefore holds promise for vaccine development. Copyright © 2015, American Association for the Advancement of Science.

Role of dendritic cells infected with human herpesvirus 6 in virus transmission to CD4+ T cells

International Nuclear Information System (INIS)

Takemoto, Masaya; Imasawa, Takayoshi; Yamanishi, Koichi; Mori, Yasuko

2009-01-01

Human herpesvirus 6 (HHV-6) is a ubiquitous betaherpesvirus that predominantly infects and replicates in CD4 + T lymphocytes. However, the mechanism of HHV-6 transmission to T cells from the peripheral mucosa is unknown. Here we found that dendritic cells (DCs) can transmit HHV-6 to T cells, resulting in productive infection. In immature monocyte-derived DCs (MDDCs) infected with HHV-6, viral early and late antigens were expressed, and nucleocapsids containing a DNA core were observed, although few virions were detected in the cytoplasm by electron microscopy, indicating that the maturation of HHV-6 virions may be incomplete in MDDCs. However, HHV-6 transmission from MDDCs to stimulated CD4 + T cells occurred efficiently in coculture of these cells, but not from MDDCs culture supernatants. This transmission was partially inhibited by treating the DCs with a viral DNA synthesis blocker, indicating that viral replication in MDDCs is required for this transmission. Furthermore, myeloid DCs and plasmacytoid DCs infected with HHV-6 could also transmit the virus to stimulated T cells. Thus, DCs may be the first cell population targeted by HHV-6 and could play an important role in the virus' transmission to T cells for their further propagation

Host DNA synthesis-suppressing factor in culture fluid of tissue cultures infected with measles virus

International Nuclear Information System (INIS)

Minagawa, T.; Nakaya, C.; Iida, H.

1974-01-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)

The structures of bovine herpesvirus 1 virion and concatemeric DNA: implications for cleavage and packaging of herpesvirus genomes

International Nuclear Information System (INIS)

Schynts, Frederic; McVoy, Michael A.; Meurens, Francois; Detry, Bruno; Epstein, Alberto L.; Thiry, Etienne

2003-01-01

Herpesvirus genomes are often characterized by the presence of direct and inverted repeats that delineate their grouping into six structural classes. Class D genomes consist of a long (L) segment and a short (S) segment. The latter is flanked by large inverted repeats. DNA replication produces concatemers of head-to-tail linked genomes that are cleaved into unit genomes during the process of packaging DNA into capsids. Packaged class D genomes are an equimolar mixture of two isomers in which S is in either of two orientations, presumably a consequence of homologous recombination between the inverted repeats. The L segment remains predominantly fixed in a prototype (P) orientation; however, low levels of genomes having inverted L (I L ) segments have been reported for some class D herpesviruses. Inefficient formation of class D I L genomes has been attributed to infrequent L segment inversion, but recent detection of frequent inverted L segments in equine herpesvirus 1 concatemers [Virology 229 (1997) 415-420] suggests that the defect may be at the level of cleavage and packaging rather than inversion. In this study, the structures of virion and concatemeric DNA of another class D herpesvirus, bovine herpesvirus 1, were determined. Virion DNA contained low levels of I L genomes, whereas concatemeric DNA contained significant amounts of L segments in both P and I L orientations. However, concatemeric termini exhibited a preponderance of L termini derived from P isomers which was comparable to the preponderance of P genomes found in virion DNA. Thus, the defect in formation of I L genomes appears to lie at the level of concatemer cleavage. These results have important implications for the mechanisms by which herpesvirus DNA cleavage and packaging occur

SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients

International Nuclear Information System (INIS)

Su, Z; Li, Z; Mamalui, M

2016-01-01

Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative

SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients

Energy Technology Data Exchange (ETDEWEB)

Su, Z; Li, Z [University of Florida, Jacksonville, FL (United States); Mamalui, M [University of Florida/Radiation Oncology, Jacksonville, FL (United States)

2016-06-15

Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative

Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion.

Directory of Open Access Journals (Sweden)

Naveen Kumar

Full Text Available Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV and foot-and-mouth disease virus (FMDV mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP. PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of

Immunogenicity Studies of Bivalent Inactivated Virions of EV71/CVA16 Formulated with Submicron Emulsion Systems

Directory of Open Access Journals (Sweden)

Chih-Wei Lin

2014-01-01

Full Text Available We assessed two strategies for preparing candidate vaccines against hand, foot, and mouth disease (HFMD caused mainly by infections of enterovirus (EV 71 and coxsackievirus (CV A16. We firstly design and optimize the potency of adjuvant combinations of emulsion-based delivery systems, using EV71 candidate vaccine as a model. We then perform immunogenicity studies in mice of EV71/CVA16 antigen combinations formulated with PELC/CpG. A single dose of inactivated EV71 virion (0.2 μg emulsified in submicron particles was found (i to induce potent antigen-specific neutralizing antibody responses and (ii consistently to elicit broad antibody responses against EV71 neutralization epitopes. A single dose immunogenicity study of bivalent activated EV71/CVA16 virion formulated with either Alum or PELC/CpG adjuvant showed that CVA16 antigen failed to elicit CVA16 neutralizing antibody responses and did not affect EV71-specific neutralizing antibody responses. A boosting dose of emulsified EV71/CVA16 bivalent vaccine candidate was found to be necessary to achieve high seroconversion of CVA16-specific neutralizing antibody responses. The current results are important for the design and development of prophylactic vaccines against HFMD and other emerging infectious diseases.

Differential Effect of Medium on the Ratio of ICM/TE of Bovine Embryos in a Co-culture System

Directory of Open Access Journals (Sweden)

Mohsen Forouzanfar

2010-01-01

Full Text Available Background: This study was undertaken to investigate the efficiency of two differentembryo somatic cell co-culture conditions, tissue culture medium 199 (TCM199–vero cellsand Menezo B2 (B2-vero cells, for the in vitro developmental quantity and quality of bovineembryos.Materials and Methods: Bovine oocytes were allowed to mature and subsequently undergofertilization in vitro. Their presumptive zygotes were cultured in either TCM199 or B2 culturemedia in conjunction with vero cells for up to nine days. The culture media were refreshedevery two days and the proportion of embryos that cleaved and further developed to themorula and blastocyst (early, expand and hatched stages were recorded. Hatched blastocystsunderwent differential staining in order to determine the numbers of inner cell mass (ICMand tropho ectoderm (TE and total cell number (TCN.Results: Of the two groups, no significant difference was seen between the proportions ofthe presumptive zygotes cleaved, those which developed to 8-16 cells, morula and reacheddays 7or 8 blastocyst stage or hatched. However, the values for TCN and TE of the TCM199-vero embryos were significantly greater than those of B2-vero embryos. The values for ICM/TCN and ICM/TE were significantly greater in the B2-vero group versus the TCM199-verogroup.Conclusion: Both TCM199 and B2 culture media in conjunction with vero cells were ofthe same efficiency when used for in vitro development of bovine presumptive zygotes.However, TCM199 was superior in providing embryos with more embryo cell numbers,whereas B2 medium was superior in providing embryos with greater ICM/TE and ICM/TCN ratios.

Hypothiocyanite produced by human and rat respiratory epithelial cells inactivates extracellular H1N2 influenza A virus.

Science.gov (United States)

Gingerich, Aaron; Pang, Lan; Hanson, Jarod; Dlugolenski, Daniel; Streich, Rebecca; Lafontaine, Eric R; Nagy, Tamás; Tripp, Ralph A; Rada, Balázs

2016-01-01

Our aim was to study whether an extracellular, oxidative antimicrobial mechanism inherent to tracheal epithelial cells is capable of inactivating influenza H1N2 virus. Epithelial cells were isolated from tracheas of male Sprague-Dawley rats. Both primary human and rat tracheobronchial epithelial cells were differentiated in air-liquid interface cultures. A/swine/Illinois/02860/09 (swH1N2) influenza A virions were added to the apical side of airway cells for 1 h in the presence or absence of lactoperoxidase or thiocyanate. Characterization of rat epithelial cells (morphology, Duox expression) occurred via western blotting, PCR, hydrogen peroxide production measurement and histology. The number of viable virions was determined by plaque assays. Statistical difference of the results was analyzed by ANOVA and Tukey's test. Our data show that rat tracheobronchial epithelial cells develop a differentiated, polarized monolayer with high transepithelial electrical resistance, mucin production and expression of dual oxidases. Influenza A virions are inactivated by human and rat epithelial cells via a dual oxidase-, lactoperoxidase- and thiocyanate-dependent mechanism. Differentiated air-liquid interface cultures of rat tracheal epithelial cells provide a novel model to study airway epithelium-influenza interactions. The dual oxidase/lactoperoxidase/thiocyanate extracellular oxidative system producing hypothiocyanite is a fast and potent anti-influenza mechanism inactivating H1N2 viruses prior to infection of the epithelium.

The Lettuce infectious yellows virus (LIYV)-encoded P26 is associated with plasmalemma deposits within LIYV-infected cells

International Nuclear Information System (INIS)

Medina, V.; Sudarshana, M.R.; Tian, T.; Ralston, K.S.; Yeh, H.-H.; Falk, B.W.

2005-01-01

Cytological, immunological, and mutagenesis approaches were used to identify the viral factors associated with the formation of plasmalemma deposits (PLDs) in whole plants and protoplasts infected by Lettuce infectious yellows virus (LIYV). Transmission electron microscopy and immunogold labeling using polyclonal antibodies to four of the five LIYV RNA 2-encoded large proteins, capsid protein (CP), minor capsid protein (CPm), HSP70 homolog (HSP70h), and P59, showed specific labeling of LIYV virions or virion aggregates around the vesiculated membranous inclusions, but not PLDs in LIYV-infected Nicotiana benthamiana, Nicotiana clevelandii, Lactuca sativa, and Chenopodium murale plants, and Nicotiana tabacum protoplasts. In contrast, antibodies to the RNA 2-encoded P26 showed specific labeling of PLDs but not virions in both LIYV-infected plants and protoplasts. Virion-like particles (VLPs) were seen in protoplasts infected by all LIYV RNA 2 mutants except for the CP (major capsid protein) mutant. PLDs were more difficult to find in protoplasts, but were seen in protoplasts infected by the CP and CPm mutants, but not in protoplasts infected by the P26, HSP70h, or P59 mutants. Interestingly, although the CPm mutant showed VLPs and PLDs, the PLDs did not show associated virions/virion-like particles as was always observed for PLDs seen in protoplasts infected by wild-type LIYV. Immunoblot analyses performed on purified LIYV virions showed that P26 was not detected with purified virions, but was detected in the cell wall, 1000 g and 30,000 g pellet fractions of LIYV-infected plants. These data suggest that P26 is associated with the LIYV-induced PLDs, and in contrast to the other RNA 2-encoded large proteins, P26 is not a virion protein

Infection and Proliferation of Giant Viruses in Amoeba Cells.

Science.gov (United States)

Takemura, Masaharu

2016-01-01

Acanthamoeba polyphaga mimivirus, the first discovered giant virus with genome size and particle size much larger than previously discovered viruses, possesses several genes for translation and CRISPER Cas system-like defense mechanism against virophages, which co-infect amoeba cells with the giant virus and which inhibit giant virus proliferation. Mimiviruses infect amoeba cells by phagocytosis and release their DNA into amoeba cytoplasm through their stargate structure. After infection, giant virion factories (VFs) form in amoeba cytoplasm, followed by DNA replication and particle formation at peripheral regions of VF. Marseilleviruses, the smallest giant viruses, infect amoeba cells by phagocytosis or endocytosis, form larger VF than Mimivirus's VF in amoeba cytoplasm, and replicate their particles. Pandoraviruses found in 2013 have the largest genome size and particle size among all viruses ever found. Pandoraviruses infect amoeba cells by phagocytosis and release their DNA into amoeba cytoplasm through their mouth-like apical pores. The proliferation of Pandoraviruses occurs along with nucleus disruption. New virions form at the periphery of the region formerly occupied by the amoeba cell nucleus.

The p2 domain of human immunodeficiency virus type 1 Gag regulates sequential proteolytic processing and is required to produce fully infectious virions.

Science.gov (United States)

Pettit, S C; Moody, M D; Wehbie, R S; Kaplan, A H; Nantermet, P V; Klein, C A; Swanstrom, R

1994-12-01

The proteolytic processing sites of the human immunodeficiency virus type 1 (HIV-1) Gag precursor are cleaved in a sequential manner by the viral protease. We investigated the factors that regulate sequential processing. When full-length Gag protein was digested with recombinant HIV-1 protease in vitro, four of the five major processing sites in Gag were cleaved at rates that differ by as much as 400-fold. Three of these four processing sites were cleaved independently of the others. The CA/p2 site, however, was cleaved approximately 20-fold faster when the adjacent downstream p2/NC site was blocked from cleavage or when the p2 domain of Gag was deleted. These results suggest that the presence of a C-terminal p2 tail on processing intermediates slows cleavage at the upstream CA/p2 site. We also found that lower pH selectively accelerated cleavage of the CA/p2 processing site in the full-length precursor and as a peptide primarily by a sequence-based mechanism rather than by a change in protein conformation. Deletion of the p2 domain of Gag results in released virions that are less infectious despite the presence of the processed final products of Gag. These findings suggest that the p2 domain of HIV-1 Gag regulates the rate of cleavage at the CA/p2 processing site during sequential processing in vitro and in infected cells and that p2 may function in the proper assembly of virions.

Ex vivo activation of CD4+ T-cells from donors on suppressive ART can lead to sustained production of infectious HIV-1 from a subset of infected cells.

Directory of Open Access Journals (Sweden)

John K Bui

2017-02-01

Full Text Available The fate of HIV-infected cells after reversal of proviral latency is not well characterized. Simonetti, et al. recently showed that CD4+ T-cells containing intact proviruses can clonally expand in vivo and produce low-level infectious viremia. We hypothesized that reversal of HIV latency by activation of CD4+ T-cells can lead to the expansion of a subset of virus-producing cells rather than their elimination. We established an ex vivo cell culture system involving stimulation of CD4+ T-cells from donors on suppressive antiretroviral therapy (ART with PMA/ionomycin (day 1-7, followed by rest (day 7-21, and then repeat stimulation (day 21-28, always in the presence of high concentrations of raltegravir and efavirenz to effectively block new cycles of viral replication. HIV DNA and virion RNA in the supernatant were quantified by qPCR. Single genome sequencing (SGS of p6-PR-RT was performed to genetically characterize proviruses and virion-associated genomic RNA. The replication-competence of the virions produced was determined by the viral outgrowth assay (VOA and SGS of co-culture supernatants from multiple time points. Experiments were performed with purified CD4+ T-cells from five consecutively recruited donors who had been on suppressive ART for > 2 years. In all experiments, HIV RNA levels in supernatant increased following initial stimulation, decreased or remained stable during the rest period, and increased again with repeat stimulation. HIV DNA levels did not show a consistent pattern of change. SGS of proviruses revealed diverse outcomes of infected cell populations, ranging from their apparent elimination to persistence and expansion. Importantly, a subset of infected cells expanded and produced infectious virus continuously after stimulation. These findings underscore the complexity of eliminating reservoirs of HIV-infected cells and highlight the need for new strategies to kill HIV-infected cells before they can proliferate.

General outbreaks of vero cytotoxin producing Escherichia coli O157 in England and Wales from 1992 to 1994.

LENUS (Irish Health Repository)

Wall, P G

1996-02-02

We have reviewed all general outbreaks of infection due to Vero cytotoxin producing Escherichia coli (VTEC) O157 reported in England and Wales from 1992 to 1994. One hundred and seventy-three people were affected in 18 outbreaks, compared with 76 people in seven outbreaks in the preceding three years (1989 to 1991). Outbreaks occurred throughout England and Wales. Thirty-eight per cent of cases were admitted to hospital, 21% developed haemolytic uraemic syndrome, and 3% died. VTEC O157 infection causes particular concern because of its serious complications--haemorrhagic colitis and haemolytic uraemic syndrome, its capacity to spread from person to person as well as by food and water, and its reservoir in dairy and beef cattle.

Comparative analysis of different cell systems for Zika virus (ZIKV) propagation and evaluation of anti-ZIKV compounds in vitro.

Science.gov (United States)

Vicenti, Ilaria; Boccuto, Adele; Giannini, Alessia; Dragoni, Filippo; Saladini, Francesco; Zazzi, Maurizio

2018-01-15

A strong correlation between Zika virus (ZIKV) infection and severe neurological disease in newborns and occasionally adults has emerged in the Brazilian outbreak. Efficient human cell-based assays are required to test candidate inhibitors of ZIKV replication. The aim of this work was to investigate ZIKV propagation and quantification in different cell lines. The human (U87, A549, Huh7), mosquito (C6/36) and monkey (VERO E6) cell lines tested were all permissive to ZIKV infection. When assessed by plaque forming units (PFU) in three different target cell lines, the maximal production of ZIKV was achieved in Huh7 at day 3 post-infection (6.38±0.44 log 10 PFU/ml). The C6/36 cell line showed a low and slow production of virus when compared with other cell lines. A549 readout cells generated a larger number of plaques compared to Huh7 but not to VERO E6 cells. ZIKV PFU and RNA titers showed the highest correlation when Huh7 and A549 were used as the producer and readout cells, respectively. Also, U87 cells produced ZIKV RNA titers which were highly correlated with PFU independently from the readout cell line. Using the best virus-cell system, sofosbuvir and ribavirin EC 50 were 1.2μM and 1.1μM when measured through plaque assay, and 4.2μM and 5.2μM when measured by quantitative real time PCR (qRT-PCR), respectively. In summary, ZIKV can efficiently infect different human cell lines and rapidly reach peak viral titers. Overall, A549 cells appear to be as efficient as the VERO E6 gold standard for plaque assay allowing the use of human, rather than simian, cells for evaluating candidate anti-ZIKV compounds by the reference assay. The possibility to replace the labor-intensive plaque assay with the more rapid and easy-to-perform qRT-PCR is appealing and warrants further investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

Improved protection conferred by vaccination with a recombinant vaccinia virus that incorporates a foreign antigen into the extracellular enveloped virion

International Nuclear Information System (INIS)

Kwak, Heesun; Mustafa, Waleed; Speirs, Kendra; Abdool, Asha J.; Paterson, Yvonne; Isaacs, Stuart N.

2004-01-01

Recombinant poxviruses have shown promise as vaccine vectors. We hypothesized that improved cellular immune responses could be developed to a foreign antigen by incorporating it as part of the extracellular enveloped virion (EEV). We therefore constructed a recombinant vaccinia virus that replaced the cytoplasmic domain of the B5R protein with a test antigen, HIV-1 Gag. Mice immunized with the virus expressing Gag fused to B5R had significantly better primary CD4 T-cell responses than recombinant virus expressing HIV-Gag from the TK-locus. The CD8 T-cell responses were less different between the two groups. Importantly, although we saw differences in the immune response to the test antigen, the vaccinia virus-specific immune responses were similar with both constructs. When groups of vaccinated mice were challenged 30 days later with a recombinant Listeria monocytogenes that expresses HIV-Gag, mice inoculated with the virus that expresses the B5R-Gag fusion protein had lower colony counts of Listeria in the liver and spleen than mice vaccinated with the standard recombinant. Thus, vaccinia virus expressing foreign antigen incorporated into EEV may be a better vaccine strategy than standard recombinant vaccinia virus

Direct and dynamic detection of HIV-1 in living cells.

Directory of Open Access Journals (Sweden)

Jonas Helma

Full Text Available In basic and applied HIV research, reliable detection of viral components is crucial to monitor progression of infection. While it is routine to detect structural viral proteins in vitro for diagnostic purposes, it previously remained impossible to directly and dynamically visualize HIV in living cells without genetic modification of the virus. Here, we describe a novel fluorescent biosensor to dynamically trace HIV-1 morphogenesis in living cells. We generated a camelid single domain antibody that specifically binds the HIV-1 capsid protein (CA at subnanomolar affinity and fused it to fluorescent proteins. The resulting fluorescent chromobody specifically recognizes the CA-harbouring HIV-1 Gag precursor protein in living cells and is applicable in various advanced light microscopy systems. Confocal live cell microscopy and super-resolution microscopy allowed detection and dynamic tracing of individual virion assemblies at the plasma membrane. The analysis of subcellular binding kinetics showed cytoplasmic antigen recognition and incorporation into virion assembly sites. Finally, we demonstrate the use of this new reporter in automated image analysis, providing a robust tool for cell-based HIV research.

A Functional Link between RNA Replication and Virion Assembly in the Potyvirus Plum Pox Virus.

Science.gov (United States)

Gallo, Araiz; Valli, Adrian; Calvo, María; García, Juan Antonio

2018-05-01

Accurate assembly of viral particles in the potyvirus Plum pox virus (PPV) has been shown to depend on the contribution of the multifunctional viral protein HCPro. In this study, we show that other viral factors, in addition to the capsid protein (CP) and HCPro, are necessary for the formation of stable PPV virions. The CP produced in Nicotiana benthamiana leaves from a subviral RNA termed LONG, which expresses a truncated polyprotein that lacks P1 and HCPro, together with HCPro supplied in trans , was assembled into virus-like particles and remained stable after in vitro incubation. In contrast, deletions in multiple regions of the LONG coding sequence prevented the CP stabilization mediated by HCPro. In particular, we demonstrated that the first 178 amino acids of P3, but not a specific nucleotide sequence coding for them, are required for CP stability and proper assembly of PPV particles. Using a sequential coagroinfiltration assay, we observed that the subviral LONG RNA replicates and locally spreads in N. benthamiana leaves expressing an RNA silencing suppressor. The analysis of the effect of both point and deletion mutations affecting RNA replication in LONG and full-length PPV demonstrated that this process is essential for the assembly of stable viral particles. Interestingly, in spite of this requirement, the CP produced by a nonreplicating viral RNA can be stably assembled into virions as long as it is coexpressed with a replication-proficient RNA. Altogether, these results highlight the importance of coupling encapsidation to other viral processes to secure a successful infection. IMPORTANCE Viruses of the family Potyviridae are among the most dangerous threats for basically every important crop, and such socioeconomical relevance has made them a subject of many research studies. In spite of this, very little is currently known about proteins and processes controlling viral genome encapsidation by the coat protein. In the case of Plum pox virus (genus

Estimation of extremely small field radiation dose for brain stereotactic radiotherapy using the Vero4DRT system.

Science.gov (United States)

Nakayama, Shinichi; Monzen, Hajime; Onishi, Yuichi; Kaneshige, Soichiro; Kanno, Ikuo

2018-06-01

The purpose of this study was a dosimetric validation of the Vero4DRT for brain stereotactic radiotherapy (SRT) with extremely small fields calculated by the treatment planning system (TPS) iPlan (Ver.4.5.1; algorithm XVMC). Measured and calculated data (e.g. percentage depth dose [PDD], dose profile, and point dose) were compared for small square fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 using ionization chambers of 0.01 or 0.04 cm 3 and a diamond detector. Dose verifications were performed using an ionization chamber and radiochromic film (EBT3; the equivalent field sizes used were 8.2, 8.7, 8.9, 9.5, and 12.9 mm 2 ) for five brain SRT cases irradiated with dynamic conformal arcs. The PDDs and dose profiles for the measured and calculated data were in good agreement for fields larger than or equal to 10 × 10 mm 2 when an appropriate detector was chosen. The dose differences for point doses in fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 were +0.48%, +0.56%, -0.52%, and +11.2% respectively. In the dose verifications for the brain SRT plans, the mean dose difference between the calculated and measured doses were -0.35% (range, -0.94% to +0.47%), with the average pass rates for the gamma index under the 3%/2 mm criterion being 96.71%, 93.37%, and 97.58% for coronal, sagittal, and axial planes respectively. The Vero4DRT system provides accurate delivery of radiation dose for small fields larger than or equal to 10 × 10 mm 2 . Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

Cell lines that support replication of a novel herpes simplex virus 1 UL31 deletion mutant can properly target UL34 protein to the nuclear rim in the absence of UL31

International Nuclear Information System (INIS)

Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D.

2004-01-01

Previous results indicated that the herpes simplex virus 1 (HSV-1) U L 31 gene is necessary and sufficient for localization of the U L 34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U L 31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U L 31 gene. The replication of the U L 31 deletion virus was restored on U L 31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U L 34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U L 34 protein localized at the nuclear membrane in rabbit skin cells, and U L 31 complementing CV1 cells infected with the U L 31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U L 34 protein to the nuclear membrane. We speculate that this function partially complements that of U L 31 and may explain why U L 31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells

Establishment of fruit bat cells (Rousettus aegyptiacus as a model system for the investigation of filoviral infection.

Directory of Open Access Journals (Sweden)

Verena Krähling

Full Text Available BACKGROUND: The fruit bat species Rousettus aegyptiacus was identified as a potential reservoir for the highly pathogenic filovirus Marburg virus. To establish a basis for a molecular understanding of the biology of filoviruses in the reservoir host, we have adapted a set of molecular tools for investigation of filovirus replication in a recently developed cell line, R06E, derived from the species Rousettus aegyptiacus. METHODOLOGY/PRINCIPAL FINDINGS: Upon infection with Ebola or Marburg viruses, R06E cells produced viral titers comparable to VeroE6 cells, as shown by TCID(50 analysis. Electron microscopic analysis of infected cells revealed morphological signs of filovirus infection as described for human- and monkey-derived cell lines. Using R06E cells, we detected an unusually high amount of intracellular viral proteins, which correlated with the accumulation of high numbers of filoviral nucleocapsids in the cytoplasm. We established protocols to produce Marburg infectious virus-like particles from R06E cells, which were then used to infect naïve target cells to investigate primary transcription. This was not possible with other cell lines previously tested. Moreover, we established protocols to reliably rescue recombinant Marburg viruses from R06E cells. CONCLUSION/SIGNIFICANCE: These data indicated that R06E cells are highly suitable to investigate the biology of filoviruses in cells derived from their presumed reservoir.

Development of a Novel, Ultra-rapid Biosensor for the Qualitative Detection of Hepatitis B Virus-associated Antigens and Anti-HBV, Based on “Membrane-engineered” Fibroblast Cells with Virus-Specific Antibodies and Antigens

Directory of Open Access Journals (Sweden)

Antonios Perdikaris

2009-03-01

Full Text Available A novel miniature cell biosensor detection system for the detection of Hepatis B virus (HBV-associated antigens and anti-HBV is described. The biosensor is based on “membrane-engineered” Vero fibroblast cells immobilized in an alginate matrix. The membrane-engineering process involved the electroinsertion of anti-HBV specific antibodies (anti-HBs, anti-HBe or antigens (HBsAg in the membranes of the Vero cells. The attachment of a homologous antigen to the electroinserted antibody (or, respectively, of the antibody to the electroinserted antigen triggered specific changes to the cell membrane potential that were measured by appropriate microelectrodes, according to the principle of the Bioelectric Recognition Assay (BERA. The sensor was used for screening 133 clinical blood serum samples according to a double-blind protocol. Considerably higher sensor responses were observed against HBV-positive samples, compared with responses against negative samples or samples positive for heterologous hepatitis viruses such as Hepatitis C (HCV virus. Detection of anti-HBs antibodies was made possible by using a biosensor based on immobilized Vero cells bearing the respective antigen (HBsAg. The observed response was rapid (45 sec and quite reproducible. Fluorescence microscopy observations showed that attachment of HBV particles to cells membrane-engineered with anti-HBs was associated with a decrease of [Ca2+]cyt. The perspectives for using the novel biosensor as a qualitative, rapid screening, high throughput assay for HBV antigens and anti-HBs in clinical samples is discussed.

Viral kinetics of Enterovirus 71 in human abdomyosarcoma cells

Science.gov (United States)

Lu, Jing; He, Ya-Qing; Yi, Li-Na; Zan, Hong; Kung, Hsiang-Fu; He, Ming-Liang

2011-01-01

AIM: To characterise the viral kinetics of enterovirus 71 (EV71). METHODS: In this study, human rhabdomyosarcoma (RD) cells were infected with EV71 at different multiplicity of infection (MOI). After infection, the cytopathic effect (CPE) was monitored and recorded using a phase contrast microscope associated with a CCD camera at different time points post viral infection (0, 6, 12, 24 h post infection). Cell growth and viability were measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay in both EV71 infected and mock infected cells at each time point. EV71 replication kinetics in RD cells was determined by measuring the total intracellular viral RNA with real-time reverse-transcription polymerase chain reaction (qRT-PCR). Also, the intracellular and extracellular virion RNA was isolated and quantified at different time points to analyze the viral package and secretion. The expression of viral protein was determined by analyze the levels of viral structure protein VP1 with Western blotting. RESULTS: EV71 infection induced a significant CPE as early as 6 h post infection (p.i.) in both RD cells infected with high ratio of virus (MOI 10) and low ratio of virus (MOI 1). In EV71 infected cells, the cell growth was inhibited and the number of viable cells was rapidly decreased in the later phase of infection. EV71 virions were uncoated immediately after entry. The intracellular viral RNA began to increase at as early as 3 h p.i. and the exponential increase was found between 3 h to 6 h p.i. in both infected groups. For viral structure protein synthesis, results from western-blot showed that intracellular viral protein VP1 could not be detected until 6 h p.i. in the cells infected at either MOI 1 or MOI 10; and reached the peak at 9 h p.i. in the cells infected with EV71 at both MOI 1 and MOI 10. Simultaneously, the viral package and secretion were also actively processed as the virus underwent rapid replication. The viral package kinetics

A cell-based fluorescent assay to detect the activity of AB toxins that inhibit protein synthesis

Science.gov (United States)

AB-type protein toxins, produced by numerous bacterial pathogens and some plants, elicit a cytotoxic effect involving the inhibition of protein synthesis. To develop an improved method to detect the inhibition of protein synthesis by AB-type toxins, the present study characterized a Vero cell line t...

SU-E-J-70: Feasibility Study of Dynamic Arc and IMRT Treatment Plans Utilizing Vero Treatment Unit and IPlan Planning Computer for SRS/FSRT Brain Cancer Patients

International Nuclear Information System (INIS)

Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z

2014-01-01

Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ∼ 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/−0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/−1.1 is better than cone-based plan (5.32+/−1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets

Cellular Cholesterol Facilitates the Postentry Replication Cycle of Herpes Simplex Virus 1.

Science.gov (United States)

Wudiri, George A; Nicola, Anthony V

2017-07-15

Cholesterol is an essential component of cell membranes and is required for herpes simplex virus 1 (HSV-1) entry (1-3). Treatment of HSV-1-infected Vero cells with methyl beta-cyclodextrin from 2 to 9 h postentry reduced plaque numbers. Transport of incoming viral capsids to the nuclear periphery was unaffected by the cholesterol reduction, suggesting that cell cholesterol is important for the HSV-1 replicative cycle at a stage(s) beyond entry, after the arrival of capsids at the nucleus. The synthesis and release of infectious HSV-1 and cell-to-cell spread of infection were all impaired in cholesterol-reduced cells. Propagation of HSV-1 on DHCR24 -/- fibroblasts, which lack the desmosterol-to-cholesterol conversion enzyme, resulted in the generation of infectious extracellular virions (HSV des ) that lack cholesterol and likely contain desmosterol. The specific infectivities (PFU per viral genome) of HSV chol and HSV des were similar, suggesting cholesterol and desmosterol in the HSV envelope support similar levels of infectivity. However, infected DHCR24 -/- fibroblasts released ∼1 log less infectious HSV des and ∼1.5 log fewer particles than release of cholesterol-containing particles (HSV chol ) from parental fibroblasts, suggesting that the hydrocarbon tail of cholesterol facilitates viral synthesis. Together, the results suggest multiple roles for cholesterol in the HSV-1 replicative cycle. IMPORTANCE HSV-1 infections are associated with a wide range of clinical manifestations that are of public health importance. Cholesterol is a key player in the complex interaction between viral and cellular factors that allows HSV-1 to enter host cells and establish infection. Previous reports have demonstrated a role for cellular cholesterol in the entry of HSV-1 into target cells. Here, we employed both chemical treatment and cells that were genetically defined to synthesize only desmosterol to demonstrate that cholesterol is important at stages following the

CD147/EMMPRIN acts as a functional entry receptor for measles virus on epithelial cells.

Science.gov (United States)

Watanabe, Akira; Yoneda, Misako; Ikeda, Fusako; Terao-Muto, Yuri; Sato, Hiroki; Kai, Chieko

2010-05-01

Measles is a highly contagious human disease caused by measles virus (MeV) and remains the leading cause of death in children, particularly in developing countries. Wild-type MeV preferentially infects lymphocytes by using signaling lymphocytic activation molecule (SLAM), whose expression is restricted to hematopoietic cells, as a receptor. MeV also infects other epithelial and neuronal cells that do not express SLAM and causes pneumonia and diarrhea and, sometimes, serious symptoms such as measles encephalitis and subacute sclerosing panencephalitis. The discrepancy between the tissue tropism of MeV and the distribution of SLAM-positive cells suggests that there are unknown receptors other than SLAM for MeV. Here we identified CD147/EMMPRIN (extracellular matrix metalloproteinase inducer), a transmembrane glycoprotein, which acts as a receptor for MeV on epithelial cells. Furthermore, we found the incorporation of cyclophilin B (CypB), a cellular ligand for CD147, in MeV virions, and showed that inhibition of CypB incorporation significantly attenuated SLAM-independent infection on epithelial cells, while it had no effect on SLAM-dependent infection. To date, MeV infection was considered to be triggered by binding of its hemagglutinin (H) protein and cellular receptors. Our present study, however, indicates that MeV infection also occurs via CD147 and virion-associated CypB, independently of MeV H. Since CD147 is expressed in a variety of cells, including epithelial and neuronal cells, this molecule possibly functions as an entry receptor for MeV in SLAM-negative cells. This is the first report among members of the Mononegavirales that CD147 is used as a virus entry receptor via incorporated CypB in the virions.

The host outer membrane proteins OmpA and OmpC are associated with the Shigella phage Sf6 virion

International Nuclear Information System (INIS)

Zhao Haiyan; Sequeira, Reuben D.; Galeva, Nadezhda A.; Tang Liang

2011-01-01

Assembly of dsDNA bacteriophage is a precisely programmed process. Potential roles of host cell components in phage assembly haven't been well understood. It was previously reported that two unidentified proteins were present in bacteriophage Sf6 virion (Casjens et al, 2004, J.Mol.Biol. 339, 379-394, Fig. 2A). Using tandem mass spectrometry, we have identified the two proteins as outer membrane proteins (OMPs) OmpA and OmpC from its host Shigella flexneri. The transmission electron cryo-microscopy structure of Sf6 shows significant density at specific sites at the phage capsid inner surface. This density fit well with the characteristic beta-barrel domains of OMPs, thus may be due to the two host proteins. Locations of this density suggest a role in Sf6 morphogenesis reminiscent of phage-encoded cementing proteins. These data indicate a new, OMP-related phage:host linkage, adding to previous knowledge that some lambdoid bacteriophage genomes contain OmpC-like genes that express phage-encoded porins in the lysogenic state.

Cytotoxicity of extracts of spices to cultured cells.

Science.gov (United States)

Unnikrishnan, M C; Kuttan, R

1988-01-01

The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

Identification of a major non-structural protein in the nuclei of Rift Valley fever virus-infected cells.

Science.gov (United States)

Struthers, J K; Swanepoel, R

1982-06-01

A non-structural protein of mol. wt. 34 X 10(3) was demonstrated in the nuclei of Rift Valley fever virus-infected Vero cells by SDS-polyacrylamide gel electro-phoresis. The protein appears to correspond to the virus-induced antigen demonstrated by indirect immunofluorescence in intranuclear inclusions.

Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production

Science.gov (United States)

Slaine, Patrick D.; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M.; Hatchette, Todd

2018-01-01

Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation. PMID:29783694

Structural Characterization of H-1 Parvovirus: Comparison of Infectious Virions to Empty Capsids

Science.gov (United States)

Halder, Sujata; Nam, Hyun-Joo; Govindasamy, Lakshmanan; Vogel, Michèle; Dinsart, Christiane; Salomé, Nathalie; McKenna, Robert

2013-01-01

The structure of single-stranded DNA (ssDNA) packaging H-1 parvovirus (H-1PV), which is being developed as an antitumor gene delivery vector, has been determined for wild-type (wt) virions and noninfectious (empty) capsids to 2.7- and 3.2-Å resolution, respectively, using X-ray crystallography. The capsid viral protein (VP) structure consists of an α-helix and an eight-stranded anti-parallel β-barrel with large loop regions between the strands. The β-barrel and loops form the capsid core and surface, respectively. In the wt structure, 600 nucleotides are ordered in an interior DNA binding pocket of the capsid. This accounts for ∼12% of the H-1PV genome. The wt structure is identical to the empty capsid structure, except for side chain conformation variations at the nucleotide binding pocket. Comparison of the H-1PV nucleotides to those observed in canine parvovirus and minute virus of mice, two members of the genus Parvovirus, showed both similarity in structure and analogous interactions. This observation suggests a functional role, such as in capsid stability and/or ssDNA genome recognition for encapsulation. The VP structure differs from those of other parvoviruses in surface loop regions that control receptor binding, tissue tropism, pathogenicity, and antibody recognition, including VP sequences reported to determine tumor cell tropism for oncotropic rodent parvoviruses. These structures of H-1PV provide insight into structural features that dictate capsid stabilization following genome packaging and three-dimensional information applicable for rational design of tumor-targeted recombinant gene delivery vectors. PMID:23449783

IN VITRO CYTOTOXICITY STUDY OF AGAVE AMERICANA, STRYCHNOS NUX-VOMICA AND ARECA CATECHU EXTRACTS USING MCF-7 CELL LINE

Directory of Open Access Journals (Sweden)

Anajwala Chetan C.

2010-06-01

Full Text Available Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nux-vomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC50 value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 µg/ml by SRB assay and 775.1 & 1461µg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic.

Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

Directory of Open Access Journals (Sweden)

Clement A Meseda

Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

Mapping in vitro local material properties of intact and disrupted virions at high resolution using multi-harmonic atomic force microscopy.

Science.gov (United States)

Cartagena, Alexander; Hernando-Pérez, Mercedes; Carrascosa, José L; de Pablo, Pedro J; Raman, Arvind

2013-06-07

Understanding the relationships between viral material properties (stiffness, strength, charge density, adhesion, hydration, viscosity, etc.), structure (protein sub-units, genome, surface receptors, appendages), and functions (self-assembly, stability, disassembly, infection) is of significant importance in physical virology and nanomedicine. Conventional Atomic Force Microscopy (AFM) methods have measured a single physical property such as the stiffness of the entire virus from nano-indentation at a few points which severely limits the study of structure-property-function relationships. We present an in vitro dynamic AFM technique operating in the intermittent contact regime which synthesizes anharmonic Lorentz-force excited AFM cantilevers to map quantitatively at nanometer resolution the local electro-mechanical force gradient, adhesion, and hydration layer viscosity within individual φ29 virions. Furthermore, the changes in material properties over the entire φ29 virion provoked by the local disruption of its shell are studied, providing evidence of bacteriophage depressurization. The technique significantly generalizes recent multi-harmonic theory (A. Raman, et al., Nat. Nanotechnol., 2011, 6, 809-814) and enables high-resolution in vitro quantitative mapping of multiple material properties within weakly bonded viruses and nanoparticles with complex structure that otherwise cannot be observed using standard AFM techniques.

CD4- and dynamin-dependent endocytosis of HIV-1 into plasmacytoid dendritic cells

Energy Technology Data Exchange (ETDEWEB)

Pritschet, Kathrin; Donhauser, Norbert; Schuster, Philipp; Ries, Moritz; Haupt, Sabrina; Kittan, Nicolai A.; Korn, Klaus [Institute of Clinical and Molecular Virology, National Reference Centre for Retroviruses, Friedrich-Alexander-Universitaet Erlangen-Nuernberg, 91054 Erlangen (Germany); Poehlmann, Stefan [Institute of Virology, Hannover Medical School, 30625 Hannover (Germany); Holland, Gudrun; Bannert, Norbert [Robert Koch-Institute, Center for Biological Security 4, 13353 Berlin (Germany); Bogner, Elke [Institute of Virology, Charite University Hospital, 10117 Berlin (Germany); Schmidt, Barbara, E-mail: baschmid@viro.med.uni-erlangen.de [Institute of Clinical and Molecular Virology, National Reference Centre for Retroviruses, Friedrich-Alexander-Universitaet Erlangen-Nuernberg, 91054 Erlangen (Germany)

2012-02-20

Chronic immune activation, triggered by plasmacytoid dendritic cell (PDC) interferon (IFN)-alpha production, plays an important role in HIV-1 pathogenesis. As the entry of HIV-1 seems to be important for the activation of PDC, we directly characterized the viral entry into these cells using immuno-electron microscopy, cellular fractionation, confocal imaging, and functional experiments. After attachment to PDC, viruses were taken up in an energy-dependent manner. The virions were located in compartments positive for caveolin; early endosomal antigen 1; Rab GTPases 5, 7 and 9; lysosomal-associated membrane protein 1. PDC harbored more virus in endocytic vesicles than CD4+ T cells (p < 0.05). Blocking CD4 inhibited the uptake of virions into cytosolic and endosomal compartments. Dynasore, an inhibitor of dynamin-dependent endocytosis, not the fusion inhibitor T-20, reduced the HIV-1 induced IFN-alpha production. Altogether, our morphological and functional data support the role of endocytosis for the entry and IFN-alpha induction of HIV-1 in PDC.

Small-Molecule Inhibitor Leads of Ribosome-Inactivating Proteins Developed Using the Doorstop Approach

Science.gov (United States)

2011-03-01

Medical Systems, Fort Detrick, Maryland, United States of America Introduction Shiga toxin (Stx) produced by the bacteria Shigella dysenteriae and Shiga...the exception that Vero cells (ATCC CCL-81) (green African monkey ) replaced Sp2/0-Ag14 [73]. Vero cells were maintained in EMEM medium (Eagle’s minimum

Isolamento de Rickettsia em cultura de células vero

Directory of Open Access Journals (Sweden)

Melles Heloisa Helena Barbosa

1999-01-01

Full Text Available Embora o diagnóstico da febre maculosa baseie-se em sinais e sintomas característicos, o mesmo requer confirmação laboratorial, pois existem alguns diagnósticos diferenciais possíveis como meningococcemia, leptospirose, infecção por enterovírus e febre tifóide. A confirmação laboratorial pode ser feita através da pesquisa de anticorpos específicos, possível somente alguns dias após o aparecimento da doença, através do isolamento do agente em amostras de sangue e/ou biópsia de pele, e ainda, de amostras de carrapatos coletados do paciente ou de animais reservatório. O isolamento a partir de sangue ou biópsia de pele resulta em diagnóstico precoce da doença, pois na fase de rickettsemia ainda não há anticorpos detectáveis no sangue. Assim, com o objetivo de facilitar o diagnóstico precoce da febre maculosa, estabelecemos um método de isolamento de rickettsia em cultura de células vero. Para a padronização foi inoculada amostra padrão de Rickettsia rickettsii, cepa Sheyla Smith, cedida pelo CDC. A identificação foi feita através da reação de imunofluorescência indireta. A presença de microrganismos verdes fluorescentes visualizados no interior do citoplasma das células caracterizou o crescimento do agente. Posteriormente, a metodologia foi confirmada pelo isolamento do agente da febre maculosa em amostras de biópsia de pele de paciente proveniente de área endêmica no Estado de São Paulo, bem como, de amostras de carrapato do gênero Amblyomma, considerado o reservatório e transmissor da doença no Brasil.

Metabolism of the carbocyclic analogue of (E)-5-(2-iodovinyl)-2'-deoxyuridine in herpes simplex virus-infected cells. Incorporation of C-IVDU into DNA

International Nuclear Information System (INIS)

De Clercq, E.; Bernaerts, R.; Balzarini, J.; Herdewijn, P.; Verbruggen, A.

1985-01-01

The carbocyclic analogues of (E)-5-(2-bromovinyl)-2'-deoxyuridine (BVDU) and (E)-5-(2-iodovinyl)-2'-deoxyuridine (IVDU), in which the sugar moiety is replaced by a cyclopentane ring and which have been designated as C-BVDU and C-IVDU, respectively, are, like their parent compounds BVDU and IVDU, potent and selective inhibitors of herpes simplex virus type 1 (HSV-1) and, to a lesser extent, herpes simplex virus type 2 (HSV-2) replication. The authors have now synthesized the radiolabeled C-IVDU analogue, C-[ 125 I]IVDU, and determined its metabolism by HSV-infected and mock-infected Vero cells. C-[ 125 I]IVDU was effectively phosphorylated by HSV-1-infected cells and, to a lesser extent, HSV-2-infected cells. C-[ 125 I]IVDU was not phosphorylated to an appreciable extent by either mock-infected cells or cells that had been infected with a thymidine kinase-deficient mutant of HSV-1. Furthermore, C-[ 125 I]IVDU was incorporated into both viral and cellular DNA of HSV-1-infected Vero cells. This finding represents the first demonstration of the incorporation of a cyclopentylpyrimidine into DNA

Accumulation of a soluble form of human nectin-2 is required for exerting the resistance against herpes simplex virus type 2 infection in transfected cells.

Science.gov (United States)

Fujimoto, Y; Ozaki, K; Iwamori, N; Takakuwa, H; Ono, E

2016-03-01

Cell entry of herpes simplex virus type 2 (HSV-2) requires the interaction of viral glycoprotein D (gD) with the receptor nectin-1 and herpesvirus entry mediator (HVEM). In addition, it is known that nectin-2 is also functional as a receptor for HSV-2, although the binding to the gD is weak. To examine an antiviral potential of a soluble form of human nectin-2 (hNectin-2Ig), transfected Vero cells expressing the entire ectodomain of nectin-2 fused to the Fc portion of human IgG were established. Specific binding of hNectin-2Ig to HSV-2 gD was confirmed by ELISA. Competitive ELISA demonstrated that accumulation of hNectin-2Ig in transfected cells increased significantly in a cell culture time dependent manner. Viral growth of several HSV-2 strains was significantly inhibited in the transfected cells that were cultured for 72 hr compared with control Vero cells, but not in cells that were cultured for 24 hr. These results indicate that accumulation of a soluble form of nectin-2 is required for exerting the resistance against HSV-2 infection.

types sat 1 and sat 2 in bhk, bk, vero and lk cell

African Journals Online (AJOL)

BSN

i\\IATERIALS AND i\\IETllODS. Viruses: 1\\ total or 14 F~~[) ,·1rus isolates \\\\l'l"L' used. I hesc include. :\\ig I 9..J ..... CELLS LOG TCI. DR50. 3.24. 119 ... 3.4 1. 4.25. 4.56. 5.25. 4.38. ·---. --I. I. TABLE IV: TITRE OF SOME SAT 2 STRAINS OF F\\1D IN BTY urns AND BHK - 21. CELLS. VIRUS STRAINS TITRE IN BTY. 1 l"IRE 11 IBRS ...

Electron tomography of the contact between T cells and SIV/HIV-1: implications for viral entry.

Directory of Open Access Journals (Sweden)

Rachid Sougrat

2007-05-01

Full Text Available The envelope glycoproteins of primate lentiviruses, including human and simian immunodeficiency viruses (HIV and SIV, are heterodimers of a transmembrane glycoprotein (usually gp41, and a surface glycoprotein (gp120, which binds CD4 on target cells to initiate viral entry. We have used electron tomography to determine the three-dimensional architectures of purified SIV virions in isolation and in contact with CD4+ target cells. The trimeric viral envelope glycoprotein surface spikes are heterogeneous in appearance and typically approximately 120 A long and approximately 120 A wide at the distal end. Docking of SIV or HIV-1 on the T cell surface occurs via a neck-shaped contact region that is approximately 400 A wide and consistently consists of a closely spaced cluster of five to seven rod-shaped features, each approximately 100 A long and approximately 100 A wide. This distinctive structure is not observed when viruses are incubated with T lymphocytes in the presence of anti-CD4 antibodies, the CCR5 antagonist TAK779, or the peptide entry inhibitor SIVmac251 C34. For virions bound to cells, few trimers were observed away from this cluster at the virion-cell interface, even in cases where virus preparations showing as many as 70 envelope glycoprotein trimers per virus particle were used. This contact zone, which we term the "entry claw", provides a spatial context to understand the molecular mechanisms of viral entry. Determination of the molecular composition and structure of the entry claw may facilitate the identification of improved drugs for the inhibition of HIV-1 entry.

Suboptimal inhibition of protease activity in human immunodeficiency virus type 1: Effects on virion morphogenesis and RNA maturation

International Nuclear Information System (INIS)

Moore, Michael D.; Fu, William; Soheilian, Ferri; Nagashima, Kunio; Ptak, Roger G.; Pathak, Vinay K.; Hu, Wei-Shau

2008-01-01

Protease activity within nascently released human immunodeficiency virus type 1 (HIV-1) particles is responsible for the cleavage of the viral polyproteins Gag and Gag-Pol into their constituent parts, which results in the subsequent condensation of the mature conical core surrounding the viral genomic RNA. Concomitant with viral maturation is a conformational change in the packaged viral RNA from a loosely associated dimer into a more thermodynamically stable form. In this study we used suboptimal concentrations of two protease inhibitors, lopinavir and atazanavir, to study their effects on Gag polyprotein processing and on the properties of the RNA in treated virions. Analysis of the treated virions demonstrated that even with high levels of inhibition of viral infectivity (IC 90 ), most of the Gag and Gag-Pol polyproteins were processed, although slight but significant increases in processing intermediates of Gag were detected. Drug treatments also caused a significant increase in the proportion of viruses displaying either immature or aberrant mature morphologies. The aberrant mature particles were characterized by an electron-dense region at the viral periphery and an electron-lucent core structure in the viral center, possibly indicating exclusion of the genomic RNA from these viral cores. Intriguingly, drug treatments caused only a slight decrease in overall thermodynamic stability of the viral RNA dimer, suggesting that the dimeric viral RNA was able to mature in the absence of correct core condensation

Los aureus y denarius emitidos por Lucio Vero entre los años 160 al 169: propaganda, Historia y documentación

Directory of Open Access Journals (Sweden)

José Antonio GARZÓN BLANCO

2010-02-01

Full Text Available RESUMEN: Lucio Vero, hijo de Elio, un oscuro y tempranamente fallecido primer sucesor de Adriano, parece destinado, desde un primer momento, a ocupar un papel secundario en el gobierno conjunto con Marco Aurelio. La Historia Augusta lo presenta como un personaje despreocupado, con una vida relajada y placentera, frente a la severidad y austeridad de Marco Aurelio; actualmente, parece que los hechos no se ajustan a esta descripción como han demostrado P. Lambrechts y otros autores modernos. Sus acuñaciones numismáticas, más cortas que las de su colega en el Imperio al haber muerto prematuramente, presentan en general los patrones de las emisiones de Marco Aurelio, y también ciertas originalidades entre las que destacarían algunos rasgos de la personalidad y de las actuaciones de Lucio Vero, por lo cual merece la pena su estudio, aunque solo sea por aclarar aspectos poco nítidos de la política general de finales del siglo II.ABSTRACT: This word es trying to investigate in important aspects the imperial roman propaganda through numismatics. The second century D.C. has been called with every right «The Golden Age of the Antoninos»; indeed, during this century a unique class emerges in Universal History: That of Philosopher emperors or friends of the philosophers, their activities during their mandates were always governed by the principle of philosophical humanism. Apart from the classical sources, this study of coins is the best source which fells us about these concepts; all taken from the II century A.D. from governement of Lucius Verus.

Development of a video image-based QA system for the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system

Energy Technology Data Exchange (ETDEWEB)

Ebe, Kazuyu, E-mail: nrr24490@nifty.com; Tokuyama, Katsuichi; Baba, Ryuta; Ogihara, Yoshisada; Ichikawa, Kosuke; Toyama, Joji [Joetsu General Hospital, 616 Daido-Fukuda, Joetsu-shi, Niigata 943-8507 (Japan); Sugimoto, Satoru [Juntendo University Graduate School of Medicine, Bunkyo-ku, Tokyo 113-8421 (Japan); Utsunomiya, Satoru; Kagamu, Hiroshi; Aoyama, Hidefumi [Graduate School of Medical and Dental Sciences, Niigata University, Niigata 951-8510 (Japan); Court, Laurence [The University of Texas MD Anderson Cancer Center, Houston, Texas 77030-4009 (United States)

2015-08-15

Purpose: To develop and evaluate a new video image-based QA system, including in-house software, that can display a tracking state visually and quantify the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system. Methods: Sixteen trajectories in six patients with pulmonary cancer were obtained with the ExacTrac in the Vero4DRT system. Motion data in the cranio–caudal direction (Y direction) were used as the input for a programmable motion table (Quasar). A target phantom was placed on the motion table, which was placed on the 2D ionization chamber array (MatriXX). Then, the 4D modeling procedure was performed on the target phantom during a reproduction of the patient’s tumor motion. A substitute target with the patient’s tumor motion was irradiated with 6-MV x-rays under the surrogate infrared system. The 2D dose images obtained from the MatriXX (33 frames/s; 40 s) were exported to in-house video-image analyzing software. The absolute differences in the Y direction between the center of the exposed target and the center of the exposed field were calculated. Positional errors were observed. The authors’ QA results were compared to 4D modeling function errors and gimbal motion errors obtained from log analyses in the ExacTrac to verify the accuracy of their QA system. The patients’ tumor motions were evaluated in the wave forms, and the peak-to-peak distances were also measured to verify their reproducibility. Results: Thirteen of sixteen trajectories (81.3%) were successfully reproduced with Quasar. The peak-to-peak distances ranged from 2.7 to 29.0 mm. Three trajectories (18.7%) were not successfully reproduced due to the limited motions of the Quasar. Thus, 13 of 16 trajectories were summarized. The mean number of video images used for analysis was 1156. The positional errors (absolute mean difference + 2 standard deviation) ranged from 0.54 to 1.55 mm. The error values differed by less than 1 mm from 4D modeling function errors

Development of a video image-based QA system for the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system

International Nuclear Information System (INIS)

Ebe, Kazuyu; Tokuyama, Katsuichi; Baba, Ryuta; Ogihara, Yoshisada; Ichikawa, Kosuke; Toyama, Joji; Sugimoto, Satoru; Utsunomiya, Satoru; Kagamu, Hiroshi; Aoyama, Hidefumi; Court, Laurence

2015-01-01

Purpose: To develop and evaluate a new video image-based QA system, including in-house software, that can display a tracking state visually and quantify the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system. Methods: Sixteen trajectories in six patients with pulmonary cancer were obtained with the ExacTrac in the Vero4DRT system. Motion data in the cranio–caudal direction (Y direction) were used as the input for a programmable motion table (Quasar). A target phantom was placed on the motion table, which was placed on the 2D ionization chamber array (MatriXX). Then, the 4D modeling procedure was performed on the target phantom during a reproduction of the patient’s tumor motion. A substitute target with the patient’s tumor motion was irradiated with 6-MV x-rays under the surrogate infrared system. The 2D dose images obtained from the MatriXX (33 frames/s; 40 s) were exported to in-house video-image analyzing software. The absolute differences in the Y direction between the center of the exposed target and the center of the exposed field were calculated. Positional errors were observed. The authors’ QA results were compared to 4D modeling function errors and gimbal motion errors obtained from log analyses in the ExacTrac to verify the accuracy of their QA system. The patients’ tumor motions were evaluated in the wave forms, and the peak-to-peak distances were also measured to verify their reproducibility. Results: Thirteen of sixteen trajectories (81.3%) were successfully reproduced with Quasar. The peak-to-peak distances ranged from 2.7 to 29.0 mm. Three trajectories (18.7%) were not successfully reproduced due to the limited motions of the Quasar. Thus, 13 of 16 trajectories were summarized. The mean number of video images used for analysis was 1156. The positional errors (absolute mean difference + 2 standard deviation) ranged from 0.54 to 1.55 mm. The error values differed by less than 1 mm from 4D modeling function errors

Characterization of Mason--Pfizer monkey virus-induced cell fusion

International Nuclear Information System (INIS)

Chatterjee, S.; Hunter, E.

1979-01-01

The characteristics and requirements of multinucleate cell (syncytium) induction by Mason--Pfizer monkey virus (M-PMV) on human and non-human primate cells have been investigated. Multinucleate cell induction by this D-type retrovirus shows single-hit kinetics on human foreskin and rhesus monkey fetal lung cells. The peak of syncytium-forming activity in an isopycnic sucrose gradient coincides with the peak of M-PMV virions as assessed by electron microscopy and analysis of viral polypeptides. Unlike the paramyxoviruses, M-PMV does not induce early cell fusion when added in high concentrations to the target cells. Furthermore, multinucleate cell formation is maximal 48 hr postinfection and the size of the syncytia remains constant after this time. Ultraviolet irradiation of M-PMV reduces its ability to form syncytia and to replicate with single-hit kinetics, suggesting that a functional viral genome is required for syncytium formation. Proviral DNA synthesis and assembly of virions are not necessary for cell fusion since the addition of cytosine arabinoside at concentrations which block virus replication has little effect on multinucleate cell formation. Moreover both multinucleate cells lacking detectable intracellular virus polypeptides, and groups of individual, nonfused but brightly staining cells can be observed in immunofluorescence assays at times when multinucleate cell formation is maximal. Cell fusion is inhibited by the addition of cycloheximide during the first 12 hr of infection, suggesting that de novo protein synthesis is required for multinucleate cell formation. The possibility that the translation of genomic RNA yields a fusion-inducing product is discussed

Radioimmunoassay of measles virus hemagglutinin protein G

International Nuclear Information System (INIS)

Lund, G.A.; Salmi, A.A.

1982-01-01

Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 μg of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells. (Auth.)

Radioimmunoassay of measles virus hemagglutinin protein G

Energy Technology Data Exchange (ETDEWEB)

Lund, G A; Salmi, A A [Turku Univ. (Finland)

1982-08-01

Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 ..mu..g of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells.

Electron tomography of HIV-1 infection in gut-associated lymphoid tissue.

Science.gov (United States)

Ladinsky, Mark S; Kieffer, Collin; Olson, Gregory; Deruaz, Maud; Vrbanac, Vladimir; Tager, Andrew M; Kwon, Douglas S; Bjorkman, Pamela J

2014-01-01

Critical aspects of HIV-1 infection occur in mucosal tissues, particularly in the gut, which contains large numbers of HIV-1 target cells that are depleted early in infection. We used electron tomography (ET) to image HIV-1 in gut-associated lymphoid tissue (GALT) of HIV-1-infected humanized mice, the first three-dimensional ultrastructural examination of HIV-1 infection in vivo. Human immune cells were successfully engrafted in the mice, and following infection with HIV-1, human T cells were reduced in GALT. Virions were found by ET at all stages of egress, including budding immature virions and free mature and immature viruses. Immuno-electron microscopy verified the virions were HIV-1 and showed CD4 sequestration in the endoplasmic reticulum of infected cells. Observation of HIV-1 in infected GALT tissue revealed that most HIV-1-infected cells, identified by immunolabeling and/or the presence of budding virions, were localized to intestinal crypts with pools of free virions concentrated in spaces between cells. Fewer infected cells were found in mucosal regions and the lamina propria. The preservation quality of reconstructed tissue volumes allowed details of budding virions, including structures interpreted as host-encoded scission machinery, to be resolved. Although HIV-1 virions released from infected cultured cells have been described as exclusively mature, we found pools of both immature and mature free virions within infected tissue. The pools could be classified as containing either mostly mature or mostly immature particles, and analyses of their proximities to the cell of origin supported a model of semi-synchronous waves of virion release. In addition to HIV-1 transmission by pools of free virus, we found evidence of transmission via virological synapses. Three-dimensional EM imaging of an active infection within tissue revealed important differences between cultured cell and tissue infection models and furthered the ultrastructural understanding of

Electron tomography of HIV-1 infection in gut-associated lymphoid tissue.

Directory of Open Access Journals (Sweden)

Mark S Ladinsky

2014-01-01

Full Text Available Critical aspects of HIV-1 infection occur in mucosal tissues, particularly in the gut, which contains large numbers of HIV-1 target cells that are depleted early in infection. We used electron tomography (ET to image HIV-1 in gut-associated lymphoid tissue (GALT of HIV-1-infected humanized mice, the first three-dimensional ultrastructural examination of HIV-1 infection in vivo. Human immune cells were successfully engrafted in the mice, and following infection with HIV-1, human T cells were reduced in GALT. Virions were found by ET at all stages of egress, including budding immature virions and free mature and immature viruses. Immuno-electron microscopy verified the virions were HIV-1 and showed CD4 sequestration in the endoplasmic reticulum of infected cells. Observation of HIV-1 in infected GALT tissue revealed that most HIV-1-infected cells, identified by immunolabeling and/or the presence of budding virions, were localized to intestinal crypts with pools of free virions concentrated in spaces between cells. Fewer infected cells were found in mucosal regions and the lamina propria. The preservation quality of reconstructed tissue volumes allowed details of budding virions, including structures interpreted as host-encoded scission machinery, to be resolved. Although HIV-1 virions released from infected cultured cells have been described as exclusively mature, we found pools of both immature and mature free virions within infected tissue. The pools could be classified as containing either mostly mature or mostly immature particles, and analyses of their proximities to the cell of origin supported a model of semi-synchronous waves of virion release. In addition to HIV-1 transmission by pools of free virus, we found evidence of transmission via virological synapses. Three-dimensional EM imaging of an active infection within tissue revealed important differences between cultured cell and tissue infection models and furthered the ultrastructural

Estimating the fraction of progeny virions that must incorporate APOBEC3G for suppression of productive HIV-1 infection

International Nuclear Information System (INIS)

Thangavelu, Pulari U.; Gupta, Vipul; Dixit, Narendra M.

2014-01-01

The contest between the host factor APOBEC3G (A3G) and the HIV-1 protein Vif presents an attractive target of intervention. The extent to which the A3G–Vif interaction must be suppressed to tilt the balance in favor of A3G remains unknown. We employed stochastic simulations and mathematical modeling of the within-host dynamics and evolution of HIV-1 to estimate the fraction of progeny virions that must incorporate A3G to render productive infection unsustainable. Using three different approaches, we found consistently that a transition from sustained infection to suppression of productive infection occurred when the latter fraction exceeded ∼0.8. The transition was triggered by A3G-induced hypermutations that led to premature stop codons compromising viral production and was consistent with driving the basic reproductive number, R 0 , below unity. The fraction identified may serve as a quantitative guideline for strategies targeting the A3G–Vif axis. - Highlights: • We perform simulations and mathematical modeling of the role of APOBEC3G in suppressing HIV-1 infection. • In three distinct ways, we estimate that when over 80% of progeny virions carry APOBEC3G, productive HIV-1 infection would be suppressed. • Our estimate of this critical fraction presents quantitative guidelines for strategies targeting the APOBEC3G–Vif axis

Antiviral activity of Aloe vera against herpes simplex virus type 2: An ...

African Journals Online (AJOL)

SERVER

2007-08-06

Aug 6, 2007 ... In this study we tested the antiviral activity of a crude hot glycerine extract of Aloe vera gel which was grown in Bushehr (Southwest of Iran) against HSV-2 replication in Vero cell line. The extract showed antiviral activity against HSV-2 not only before attachment and entry of virus to the Vero cells but also.

Intracellular Transport of Vaccinia Virus in HeLa Cells Requires WASH-VPEF/FAM21-Retromer Complexes and Recycling Molecules Rab11 and Rab22

Science.gov (United States)

Hsiao, Jye-Chian; Chu, Li-Wei; Lo, Yung-Tsun; Lee, Sue-Ping; Chen, Tzu-Jung; Huang, Cheng-Yen

2015-01-01

ABSTRACT Vaccinia virus, the prototype of the Orthopoxvirus genus in the family Poxviridae, infects a wide range of cell lines and animals. Vaccinia mature virus particles of the WR strain reportedly enter HeLa cells through fluid-phase endocytosis. However, the intracellular trafficking process of the vaccinia mature virus between cellular uptake and membrane fusion remains unknown. We used live imaging of single virus particles with a combination of various cellular vesicle markers, to track fluorescent vaccinia mature virus particle movement in cells. Furthermore, we performed functional interference assays to perturb distinct vesicle trafficking processes in order to delineate the specific route undertaken by vaccinia mature virus prior to membrane fusion and virus core uncoating in cells. Our results showed that vaccinia virus traffics to early endosomes, where recycling endosome markers Rab11 and Rab22 are recruited to participate in subsequent virus trafficking prior to virus core uncoating in the cytoplasm. Furthermore, we identified WASH-VPEF/FAM21-retromer complexes that mediate endosome fission and sorting of virus-containing vesicles prior to virus core uncoating in the cytoplasm. IMPORTANCE Vaccinia mature virions of the WR strain enter HeLa cells through fluid phase endocytosis. We previously demonstrated that virus-containing vesicles are internalized into phosphatidylinositol 3-phosphate positive macropinosomes, which are then fused with Rab5-positive early endosomes. However, the subsequent process of sorting the virion-containing vesicles prior to membrane fusion remains unclear. We dissected the intracellular trafficking pathway of vaccinia mature virions in cells up to virus core uncoating in cytoplasm. We show that vaccinia mature virions first travel to early endosomes. Subsequent trafficking events require the important endosome-tethered protein VPEF/FAM21, which recruits WASH and retromer protein complexes to the endosome. There, the complex

Visualization of HIV-1 interactions with penile and foreskin epithelia: clues for female-to-male HIV transmission.

Directory of Open Access Journals (Sweden)

Minh H Dinh

2015-03-01

Full Text Available To gain insight into female-to-male HIV sexual transmission and how male circumcision protects against this mode of transmission, we visualized HIV-1 interactions with foreskin and penile tissues in ex vivo tissue culture and in vivo rhesus macaque models utilizing epifluorescent microscopy. 12 foreskin and 14 cadaveric penile specimens were cultured with R5-tropic photoactivatable (PA-GFP HIV-1 for 4 or 24 hours. Tissue cryosections were immunofluorescently imaged for epithelial and immune cell markers. Images were analyzed for total virions, proportion of penetrators, depth of virion penetration, as well as immune cell counts and depths in the tissue. We visualized individual PA virions breaching penile epithelial surfaces in the explant and macaque model. Using kernel density estimated probabilities of localizing a virion or immune cell at certain tissue depths revealed that interactions between virions and cells were more likely to occur in the inner foreskin or glans penis (from local or cadaveric donors, respectively. Using statistical models to account for repeated measures and zero-inflated datasets, we found no difference in total virions visualized at 4 hours between inner and outer foreskins from local donors. At 24 hours, there were more virions in inner as compared to outer foreskin (0.0495 +/- 0.0154 and 0.0171 +/- 0.0038 virions/image, p = 0.001. In the cadaveric specimens, we observed more virions in inner foreskin (0.0507 +/- 0.0079 virions/image than glans tissue (0.0167 +/- 0.0033 virions/image, p<0.001, but a greater proportion was seen penetrating uncircumcised glans tissue (0.0458 +/- 0.0188 vs. 0.0151 +/- 0.0100 virions/image, p = 0.099 and to significantly greater mean depths (29.162 +/- 3.908 vs. 12.466 +/- 2.985 μm. Our in vivo macaque model confirmed that virions can breach penile squamous epithelia in a living model. In summary, these results suggest that the inner foreskin and glans epithelia may be important sites

Porcine epidemic diarrhea virus through p53-dependent pathway causes cell cycle arrest in the G0/G1 phase.

Science.gov (United States)

Sun, Pei; Wu, Haoyang; Huang, Jiali; Xu, Ying; Yang, Feng; Zhang, Qi; Xu, Xingang

2018-05-22

Porcine epidemic diarrhea virus (PEDV), an enteropathogenic Alphacoronavirus, has caused enormous economic losses in the swine industry. p53 protein exists in a wide variety of animal cells, which is involved in cell cycle regulation, apoptosis, cell differentiation and other biological functions. In this study, we investigated the effects of PEDV infection on the cell cycle of Vero cells and p53 activation. The results demonstrated that PEDV infection induces cell cycle arrest at G0/G1 phase in Vero cells, while UV-inactivated PEDV does not cause cell cycle arrest. PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein. Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above. In addition, PEDV infection of the cells synchronized in various stages of cell cycle showed that viral subgenomic RNA and virus titer were higher in the cells released from G0/G1 phase synchronized cells than that in the cells released from the G1/S phase and G2/M phase synchronized or asynchronous cells after 18 h p.i.. This is the first report to demonstrate that the p53-dependent pathway plays an important role in PEDV induced cell cycle arrest and beneficially contributes to viral infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Biliary Secretion of Quasi-Enveloped Human Hepatitis A Virus

Directory of Open Access Journals (Sweden)

Asuka Hirai-Yuki

2016-12-01

Full Text Available Hepatitis A virus (HAV is an unusual picornavirus that is released from cells cloaked in host-derived membranes. These quasi-enveloped virions (eHAV are the only particle type circulating in blood during infection, whereas only nonenveloped virions are shed in feces. The reason for this is uncertain. Hepatocytes, the only cell type known to support HAV replication in vivo, are highly polarized epithelial cells with basolateral membranes facing onto hepatic (blood sinusoids and apical membranes abutting biliary canaliculi from which bile is secreted to the gut. To assess whether eHAV and nonenveloped virus egress from cells via vectorially distinct pathways, we studied infected polarized cultures of Caco-2 and HepG2-N6 cells. Most (>99% progeny virions were released apically from Caco-2 cells, whereas basolateral (64% versus apical (36% release was more balanced with HepG2-N6 cells. Both apically and basolaterally released virions were predominantly enveloped, with no suggestion of differential vectorial release of eHAV versus naked virions. Basolateral to apical transcytosis of either particle type was minimal (<0.02%/h in HepG2-N6 cells, arguing against this as a mechanism for differences in membrane envelopment of serum versus fecal virus. High concentrations of human bile acids converted eHAV to nonenveloped virions, whereas virus present in bile from HAV-infected Ifnar1−/−Ifngr1−/− and Mavs−/− mice banded over a range of densities extending from that of eHAV to that of nonenveloped virions. We conclude that nonenveloped virions shed in feces are derived from eHAV released across the canalicular membrane and stripped of membranes by the detergent action of bile acids within the proximal biliary canaliculus.

A universal mammalian vaccine cell line substrate.

Directory of Open Access Journals (Sweden)

Jackelyn Murray

Full Text Available Using genome-wide small interfering RNA (siRNA screens for poliovirus, influenza A virus and rotavirus, we validated the top 6 gene hits PV, RV or IAV to search for host genes that when knocked-down (KD enhanced virus permissiveness and replication over wild type Vero cells or HEp-2 cells. The enhanced virus replication was tested for 12 viruses and ranged from 2-fold to >1000-fold. There were variations in virus-specific replication (strain differences across the cell lines examined. Some host genes (CNTD2, COQ9, GCGR, NDUFA9, NEU2, PYCR1, SEC16G, SVOPL, ZFYVE9, and ZNF205 showed that KD resulted in enhanced virus replication. These findings advance platform-enabling vaccine technology, the creation of diagnostic cells substrates, and are informative about the host mechanisms that affect virus replication in mammalian cells.

The morphogenesis of herpes simplex virus type 1 in infected parental mouse L fibroblasts and mutant gro29 cells

DEFF Research Database (Denmark)

Jensen, Helle Lone; Norrild, Bodil

2003-01-01

Mutants of cell lines and viruses are important biological tools. The pathway of herpesvirus particle maturation and egress are contentious issues. The mutant gro29 line of mouse L cells is defective for egress of herpes simplex virus type 1 (HSV-1) virions, and a candidate for studies of virus...

(EPEC) from pig

African Journals Online (AJOL)

SAM

2014-03-26

Mar 26, 2014 ... 16 belonged to O60 (94.1%) and 1(5.88%) was untypeable. Virulence genes ..... Figure 4. a) Confluent monolayer of healthy vero cells; b) CPE in verocells after 12 h of incubation with filtrate extracts .... about 5 to 10 pigs near their residence and share the ... of Stx to vero cells remains the 'gold standard' for.

Characterization of a Mutant Diphtheria Toxin that is Defective in Binding to Cell Membrane Receptors on Vero Cells

Science.gov (United States)

1982-08-13

pinocytlc activity was demonstrated by the Increase in lysosomal vesicles ( acid phosphatase -positive vesicles) (4, 13). Poly-L-ornithine increased... wheat germ agglutinin and the protection was reversed by a-methly- mannoslde and N-acetylglucosamlne, respectively. These studies suggested that the...on the cell surface were involved in the initial binding of toxin to cell surface receptors. Concanavalin A and wheat germ agglutinin Inhibited the

Transcriptome analysis of the Spodoptera frugiperda ascovirus in vivo provides insights into how its apoptosis inhibitors and caspase promote increased synthesis of viral vesicles and virion progeny.

Science.gov (United States)

Zaghloul, Heba; Hice, Robert; Arensburger, Peter; Federici, Brian A

2017-09-27

that continue to produce virions. Our transcriptome analysis of genome expression in vivo by the Spodoptera frugiperda ascovirus shows that inhibitors of apoptosis are expressed first enabling viral replication to proceed, after which the SfAV-1a caspase is synthesized, leading to viral vesicle synthesis and subsequent extensive production of progeny virions. Moreover, we detected numerous bicistronic and tricistronic mRNA messages in the ascovirus transcriptome, implying ascoviruses use other non-canonical translational mechanisms such as Internal Ribosome Entry Site (IRES). These results provide the first insights into the molecular biology of a unique coordinated gene expression pattern in which cell architecture is markedly modified, more than in any other known eukaryotic virus, to promote viral reproduction and transmission. Copyright © 2017 American Society for Microbiology.

Vpx overcomes a SAMHD1-independent block to HIV reverse transcription that is specific to resting CD4 T cells.

Science.gov (United States)

Baldauf, Hanna-Mari; Stegmann, Lena; Schwarz, Sarah-Marie; Ambiel, Ina; Trotard, Maud; Martin, Margarethe; Burggraf, Manja; Lenzi, Gina M; Lejk, Helena; Pan, Xiaoyu; Fregoso, Oliver I; Lim, Efrem S; Abraham, Libin; Nguyen, Laura A; Rutsch, Frank; König, Renate; Kim, Baek; Emerman, Michael; Fackler, Oliver T; Keppler, Oliver T

2017-03-07

Early after entry into monocytes, macrophages, dendritic cells, and resting CD4 T cells, HIV encounters a block, limiting reverse transcription (RT) of the incoming viral RNA genome. In this context, dNTP triphosphohydrolase SAM domain and HD domain-containing protein 1 (SAMHD1) has been identified as a restriction factor, lowering the concentration of dNTP substrates to limit RT. The accessory lentiviral protein X (Vpx) proteins from the major simian immunodeficiency virus of rhesus macaque, sooty mangabey, and HIV-2 (SIVsmm/SIVmac/HIV-2) lineage packaged into virions target SAMHD1 for proteasomal degradation, increase intracellular dNTP pools, and facilitate HIV cDNA synthesis. We find that virion-packaged Vpx proteins from a second SIV lineage, SIV of red-capped mangabeys or mandrills (SIVrcm/mnd-2), increased HIV infection in resting CD4 T cells, but not in macrophages, and, unexpectedly, acted in the absence of SAMHD1 degradation, dNTP pool elevation, or changes in SAMHD1 phosphorylation. Vpx rcm/mnd-2 virion incorporation resulted in a dramatic increase of HIV-1 RT intermediates and viral cDNA in infected resting CD4 T cells. These analyses also revealed a barrier limiting HIV-1 infection of resting CD4 T cells at the level of nuclear import. Single amino acid changes in the SAMHD1-degrading Vpx mac239 allowed it to enhance early postentry steps in a Vpx rcm/mnd-2-like fashion. Moreover, Vpx enhanced HIV-1 infection of SAMHD1-deficient resting CD4 T cells of a patient with Aicardi-Goutières syndrome. These results indicate that Vpx, in addition to SAMHD1, overcomes a previously unappreciated restriction for lentiviruses at the level of RT that acts independently of dNTP concentrations and is specific to resting CD4 T cells.

Functional analysis of virion host shutoff protein of pseudorabies virus

International Nuclear Information System (INIS)

Lin, H.-W.; Chang, Y.-Y.; Wong, M.-L.; Lin, J.-W.; Chang, T.-J.

2004-01-01

During lytic infection, the virion host shutoff (vhs) protein of alphaherpesviruses causes the degradation of mRNAs nonspecifically. In this work, we cloned the vhs gene (UL41 open reading frame) of pseudorabies virus (PRV; TNL strain) by PCR, and its nucleotide sequences were determined. The PCR product of vhs gene was subcloned into the prokaryotic pET32b expression vector, and production of the recombinant vhs protein was examined by SDS-PAGE. Result of Western blotting demonstrated that our recombinant vhs protein reacted with antiserum against a synthetic peptide of 17 amino acids of the vhs protein. After purification with nickel-chelate affinity chromatography, the purified recombinant vhs protein exhibited in vitro ribonuclease activity as expected. We further cloned the vhs gene into eukaryotic expression vectors and investigated the intracellular function of vhs protein by DNA transfection. By transient trasfection and CAT assay, we found the CAT activity was reduced in the presence of vhs, indicating that degradation of mRNA of the CAT gene was caused by the vhs. Furthermore, our results showed that the plaque formation of pseudorabies virus was blocked by exogenous vhs. Taken together, we have cloned the vhs gene of pseudorabies virus (TNL strain) and conducted functional analysis of the recombinant vhs protein in vitro as well as in vivo

Titanium-hydroxyapatite composites sintered at low temperature for tissue engineering: in vitro cell support and biocompatibility.

Science.gov (United States)

Comín, Romina; Cid, Mariana P; Grinschpun, Luciano; Oldani, Carlos; Salvatierra, Nancy A

2017-04-26

In clinical orthopedics, a critical problem is the bone tissue loss produced by a disease or injury. The use of composites from titanium and hydroxyapatite for biomedical applications has increased due to the resulting advantageous combination of hydroxyapatite bioactivity and favorable mechanical properties of titanium. Powder metallurgy is a simple and lower-cost method that uses powder from titanium and hydroxyapatite to obtain composites having hydroxyapatite phases in a metallic matrix. However, this method has certain limitations arising from thermal decomposition of hydroxyapatite in the titanium-hydroxyapatite system above 800°C. We obtained a composite from titanium and bovine hydroxyapatite powders sintered at 800°C and evaluated its bioactivity and cytocompatibility according to the ISO 10993 standard. Surface analysis and bioactivity of the composite was evaluated by X-ray diffraction and SEM. MTT assay was carried out to assess cytotoxicity on Vero and NIH3T3 cells. Cell morphology and cell adhesion on the composite surface were analyzed using fluorescence and SEM. We obtained a porous composite with hydroxyapatite particles well integrated in titanium matrix which presented excellent bioactivity. Our data did not reveal any toxicity of titanium-hydroxyapatite composite on Vero or NIH3T3 cells. Moreover, extracts from composite did not affect cell morphology or density. Finally, NIH3T3 cells were capable of adhering to and proliferating on the composite surface. The composite obtained displayed promising biomedical applications through the simple method of powder metallurgy. Additionally, these findings provide an in vitro proof for adequate biocompatibility of titanium-hydroxyapatite composite sintered at 800°C.

Cell-Free, De Nova Synthesis of Poliovirus

Science.gov (United States)

Molla, Akhteruzzaman; Paul, Aniko V.; Wimmer, Eckard

1991-12-01

Cell-free translation of poliovirus RNA in an extract of uninfected human (HeLa) cells yielded viral proteins through proteolysis of the polyprotein. In the extract, newly synthesized proteins catalyzed poliovirus-specific RNA synthesis, and formed infectious poliovirus de novo. Newly formed virions were neutralized by type-specific antiserum, and infection of human cells with them was prevented by poliovirus receptor-specific antibodies. Poliovirus synthesis was increased nearly 70-fold when nucleoside triphosphates were added, but it was abolished in the presence of inhibitors of translation or viral genome replication. The ability to conduct cell-free synthesis of poliovirus will aid in the study of picornavirus proliferation and in the search for the control of picornaviral disease.

Growth of the parvovirus minute virus of mice MVMp3 in EL4 lymphocytes is restricted after cell entry and before viral DNA amplification: cell-specific differences in virus uncoating in vitro.

Science.gov (United States)

Previsani, N; Fontana, S; Hirt, B; Beard, P

1997-10-01

Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.

Stable cytotoxic T cell escape mutation in hepatitis C virus is linked to maintenance of viral fitness.

Directory of Open Access Journals (Sweden)

Luke Uebelhoer

2008-09-01

Full Text Available Mechanisms by which hepatitis C virus (HCV evades cellular immunity to establish persistence in chronically infected individuals are not clear. Mutations in human leukocyte antigen (HLA class I-restricted epitopes targeted by CD8(+ T cells are associated with persistence, but the extent to which these mutations affect viral fitness is not fully understood. Previous work showed that the HCV quasispecies in a persistently infected chimpanzee accumulated multiple mutations in numerous class I epitopes over a period of 7 years. During the acute phase of infection, one representative epitope in the C-terminal region of the NS3/4A helicase, NS3(1629-1637, displayed multiple serial amino acid substitutions in major histocompatibility complex (MHC anchor and T cell receptor (TCR contact residues. Only one of these amino acid substitutions at position 9 (P9 of the epitope was stable in the quasispecies. We therefore assessed the effect of each mutation observed during in vivo infection on viral fitness and T cell responses using an HCV subgenomic replicon system and a recently developed in vitro infectious virus cell culture model. Mutation of a position 7 (P7 TCR-contact residue, I1635T, expectedly ablated the T cell response without affecting viral RNA replication or virion production. In contrast, two mutations at the P9 MHC-anchor residue abrogated antigen-specific T cell responses, but additionally decreased viral RNA replication and virion production. The first escape mutation, L1637P, detected in vivo only transiently at 3 mo after infection, decreased viral production, and reverted to the parental sequence in vitro. The second P9 variant, L1637S, which was stable in vivo through 7 years of follow-up, evaded the antigen-specific T cell response and did not revert in vitro despite being less optimal in virion production compared to the parental virus. These studies suggest that HCV escape mutants emerging early in infection are not necessarily

Dengue virus infection induces broadly cross-reactive human IgM antibodies that recognize intact virions in humanized BLT-NSG mice.

Science.gov (United States)

Jaiswal, Smita; Smith, Kenneth; Ramirez, Alejandro; Woda, Marcia; Pazoles, Pamela; Shultz, Leonard D; Greiner, Dale L; Brehm, Michael A; Mathew, Anuja

2015-01-01

The development of small animal models that elicit human immune responses to dengue virus (DENV) is important since prior immunity is a major risk factor for developing severe dengue disease. This study evaluated anti-DENV human antibody (hAb) responses generated from immortalized B cells after DENV-2 infection in NOD-scid IL2rγ(null) mice that were co-transplanted with human fetal thymus and liver tissues (BLT-NSG mice). DENV-specific human antibodies predominantly of the IgM isotype were isolated during acute infection and in convalescence. We found that while a few hAbs recognized the envelope protein produced as a soluble recombinant, a number of hAbs only recognized epitopes on intact virions. The majority of the hAbs isolated during acute infection and in immune mice were serotype-cross-reactive and poorly neutralizing. Viral titers in immune BLT-NSG mice were significantly decreased after challenge with a clinical strain of dengue. DENV-specific hAbs generated in BLT-NSG mice share some of the characteristics of Abs isolated in humans with natural infection. Humanized BLT-NSG mice provide an attractive preclinical platform to assess the immunogenicity of candidate dengue vaccines. © 2014 by the Society for Experimental Biology and Medicine.

Preferential replication of FIV in activated CD4+CD25+T cells independent of cellular proliferation

International Nuclear Information System (INIS)

Joshi, Anjali; Vahlenkamp, Thomas W.; Garg, Himanshu; Tompkins, Wayne A.F.; Tompkins, Mary B.

2004-01-01

Studies attempting to identify reservoirs of HIV-1 latency have documented that the virus persists as both a latent and productive infection in subsets of CD4 + cells. Reports regarding establishment of a stable HIV-1 infection in quiescent T cells in vitro, however, are controversial. In the present study, we investigated the susceptibility of naive and activated CD4 + cell subsets (distinguished by differential expression of CD25) to feline immunodeficiency virus (FIV) infection, their ability to replicate the virus, and potentially act as a reservoir for virus persistence in infected animals. While both CD4 + CD25 + and CD4 + CD25 - cells are susceptible to FIV infection in vitro and in vivo, only CD4 + CD25 + cells produce infectious virions when cultured with interleukin-2 (IL-2). Latently infected CD4 + CD25 - cells produce infectious virions following ConcanvalinA (ConA) stimulation, which correlates with upregulated surface expression of CD25. In contrast to CD4 + CD25 - cells, CD4 + CD25 + cells remain unresponsive to mitogen stimulation and are relatively resistant to apoptosis whether or not infected with FIV. The ability of CD4 + CD25 + cells to replicate FIV efficiently in the presence of IL-2 but remain anergic and unresponsive to apoptotic signaling suggests that these cells may provide a reservoir of productive FIV infection. On the contrary, CD4 + CD25 - cells seem to establish as latent viral reservoirs capable of being reactivated after stimulation

A polymorphism of the TIM-1 IgV domain: implications for the susceptibility to filovirus infection.

Science.gov (United States)

Kuroda, Makoto; Fujikura, Daisuke; Noyori, Osamu; Kajihara, Masahiro; Maruyama, Junki; Miyamoto, Hiroko; Yoshida, Reiko; Takada, Ayato

2014-12-12

Filoviruses, including Ebola and Marburg viruses, cause severe hemorrhagic fever in humans and nonhuman primates with mortality rates of up to 90%. Human T-cell immunoglobulin and mucin domain 1 (TIM-1) is one of the host proteins that have been shown to promote filovirus entry into cells. In this study, we cloned TIM-1 genes from three different African green monkey kidney cell lines (Vero E6, COS-1, and BSC-1) and found that TIM-1 of Vero E6 had a 23-amino acid deletion and 6 amino acid substitutions compared with those of COS-1 and BSC-1. Interestingly, Vero E6 TIM-1 had a greater ability to promote the infectivity of vesicular stomatitis viruses pseudotyped with filovirus glycoproteins than COS-1-derived TIM-1. We further found that the increased ability of Vero E6 TIM-1 to promote virus infectivity was most likely due to a single amino acid difference between these TIM-1s. These results suggest that a polymorphism of the TIM-1 molecules is one of the factors that influence cell susceptibility to filovirus infection, providing a new insight into the molecular basis for the filovirus host range. Copyright © 2014 Elsevier Inc. All rights reserved.

Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2

Science.gov (United States)

2010-01-01

Background Platelets are associated with HIV in the blood of infected individuals and might modulate viral dissemination, particularly if the virus is directly transmitted into the bloodstream. The C-type lectin DC-SIGN and the novel HIV attachment factor CLEC-2 are expressed by platelets and facilitate HIV transmission from platelets to T-cells. Here, we studied the molecular mechanisms behind CLEC-2-mediated HIV-1 transmission. Results Binding studies with soluble proteins indicated that CLEC-2, in contrast to DC-SIGN, does not recognize the viral envelope protein, but a cellular factor expressed on kidney-derived 293T cells. Subsequent analyses revealed that the cellular mucin-like membranous glycoprotein podoplanin, a CLEC-2 ligand, was expressed on 293T cells and incorporated into virions released from these cells. Knock-down of podoplanin in 293T cells by shRNA showed that virion incorporation of podoplanin was required for efficient CLEC-2-dependent HIV-1 interactions with cell lines and platelets. Flow cytometry revealed no evidence for podoplanin expression on viable T-cells and peripheral blood mononuclear cells (PBMC). Podoplanin was also not detected on HIV-1 infected T-cells. However, apoptotic bystander cells in HIV-1 infected cultures reacted with anti-podoplanin antibodies, and similar results were obtained upon induction of apoptosis in a cell line and in PBMCs suggesting an unexpected link between apoptosis and podoplanin expression. Despite the absence of detectable podoplanin expression, HIV-1 produced in PBMC was transmitted to T-cells in a CLEC-2-dependent manner, indicating that T-cells might express an as yet unidentified CLEC-2 ligand. Conclusions Virion incorporation of podoplanin mediates CLEC-2 interactions of HIV-1 derived from 293T cells, while incorporation of a different cellular factor seems to be responsible for CLEC-2-dependent capture of PBMC-derived viruses. Furthermore, evidence was obtained that podoplanin expression is

Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2

Directory of Open Access Journals (Sweden)

Münch Jan

2010-05-01

Full Text Available Abstract Background Platelets are associated with HIV in the blood of infected individuals and might modulate viral dissemination, particularly if the virus is directly transmitted into the bloodstream. The C-type lectin DC-SIGN and the novel HIV attachment factor CLEC-2 are expressed by platelets and facilitate HIV transmission from platelets to T-cells. Here, we studied the molecular mechanisms behind CLEC-2-mediated HIV-1 transmission. Results Binding studies with soluble proteins indicated that CLEC-2, in contrast to DC-SIGN, does not recognize the viral envelope protein, but a cellular factor expressed on kidney-derived 293T cells. Subsequent analyses revealed that the cellular mucin-like membranous glycoprotein podoplanin, a CLEC-2 ligand, was expressed on 293T cells and incorporated into virions released from these cells. Knock-down of podoplanin in 293T cells by shRNA showed that virion incorporation of podoplanin was required for efficient CLEC-2-dependent HIV-1 interactions with cell lines and platelets. Flow cytometry revealed no evidence for podoplanin expression on viable T-cells and peripheral blood mononuclear cells (PBMC. Podoplanin was also not detected on HIV-1 infected T-cells. However, apoptotic bystander cells in HIV-1 infected cultures reacted with anti-podoplanin antibodies, and similar results were obtained upon induction of apoptosis in a cell line and in PBMCs suggesting an unexpected link between apoptosis and podoplanin expression. Despite the absence of detectable podoplanin expression, HIV-1 produced in PBMC was transmitted to T-cells in a CLEC-2-dependent manner, indicating that T-cells might express an as yet unidentified CLEC-2 ligand. Conclusions Virion incorporation of podoplanin mediates CLEC-2 interactions of HIV-1 derived from 293T cells, while incorporation of a different cellular factor seems to be responsible for CLEC-2-dependent capture of PBMC-derived viruses. Furthermore, evidence was obtained that

Unraveling a three-step spatiotemporal mechanism of triggering of receptor-induced Nipah virus fusion and cell entry.

Directory of Open Access Journals (Sweden)

Qian Liu

Full Text Available Membrane fusion is essential for entry of the biomedically-important paramyxoviruses into their host cells (viral-cell fusion, and for syncytia formation (cell-cell fusion, often induced by paramyxoviral infections [e.g. those of the deadly Nipah virus (NiV]. For most paramyxoviruses, membrane fusion requires two viral glycoproteins. Upon receptor binding, the attachment glycoprotein (HN/H/G triggers the fusion glycoprotein (F to undergo conformational changes that merge viral and/or cell membranes. However, a significant knowledge gap remains on how HN/H/G couples cell receptor binding to F-triggering. Via interdisciplinary approaches we report the first comprehensive mechanism of NiV membrane fusion triggering, involving three spatiotemporally sequential cell receptor-induced conformational steps in NiV-G: two in the head and one in the stalk. Interestingly, a headless NiV-G mutant was able to trigger NiV-F, and the two head conformational steps were required for the exposure of the stalk domain. Moreover, the headless NiV-G prematurely triggered NiV-F on virions, indicating that the NiV-G head prevents premature triggering of NiV-F on virions by concealing a F-triggering stalk domain until the correct time and place: receptor-binding. Based on these and recent paramyxovirus findings, we present a comprehensive and fundamentally conserved mechanistic model of paramyxovirus membrane fusion triggering and cell entry.

Biologically-directed modeling reflects cytolytic clearance of SIV-infected cells in vivo in macaques.

Directory of Open Access Journals (Sweden)

W David Wick

Full Text Available The disappointing outcomes of cellular immune-based vaccines against HIV-1 despite strong evidence for the protective role of CD8⁺ T lymphocytes (CTLs has prompted revisiting the mechanisms of cellular immunity. Prior data from experiments examining the kinetics of Simian Immunodeficiency Virus (SIV clearance in infected macaques with or without in vivo CD8 depletion were interpreted as refuting the concept that CTLs suppress SIV/HIV by direct killing of infected cells. Here we briefly review the biological evidence for CTL cytolytic activity in viral infections, and utilize biologically-directed modeling to assess the possibility of a killing mechanism for the antiviral effect of CTLs, taking into account the generation, proliferation, and survival of activated CD4⁺ and CD8⁺ T lymphocytes, as well as the life cycle of the virus. Our analyses of the published macaque data using these models support a killing mechanism, when one considers T lymphocyte and HIV-1 lifecycles, and factors such as the eclipse period before release of virions by infected cells, an exponential pattern of virion production by infected cells, and a variable lifespan for acutely infected cells. We conclude that for SIV/HIV pathogenesis, CTLs deserve their reputation as being cytolytic.

Picornavirus RNA is protected from cleavage by ribonuclease during virion uncoating and transfer across cellular and model membranes.

Science.gov (United States)

Groppelli, Elisabetta; Levy, Hazel C; Sun, Eileen; Strauss, Mike; Nicol, Clare; Gold, Sarah; Zhuang, Xiaowei; Tuthill, Tobias J; Hogle, James M; Rowlands, David J

2017-02-01

Picornaviruses are non-enveloped RNA viruses that enter cells via receptor-mediated endocytosis. Because they lack an envelope, picornaviruses face the challenge of delivering their RNA genomes across the membrane of the endocytic vesicle into the cytoplasm to initiate infection. Currently, the mechanism of genome release and translocation across membranes remains poorly understood. Within the enterovirus genus, poliovirus, rhinovirus 2, and rhinovirus 16 have been proposed to release their genomes across intact endosomal membranes through virally induced pores, whereas one study has proposed that rhinovirus 14 releases its RNA following disruption of endosomal membranes. For the more distantly related aphthovirus genus (e.g. foot-and-mouth disease viruses and equine rhinitis A virus) acidification of endosomes results in the disassembly of the virion into pentamers and in the release of the viral RNA into the lumen of the endosome, but no details have been elucidated as how the RNA crosses the vesicle membrane. However, more recent studies suggest aphthovirus RNA is released from intact particles and the dissociation to pentamers may be a late event. In this study we have investigated the RNase A sensitivity of genome translocation of poliovirus using a receptor-decorated-liposome model and the sensitivity of infection of poliovirus and equine-rhinitis A virus to co-internalized RNase A. We show that poliovirus genome translocation is insensitive to RNase A and results in little or no release into the medium in the liposome model. We also show that infectivity is not reduced by co-internalized RNase A for poliovirus and equine rhinitis A virus. Additionally, we show that all poliovirus genomes that are internalized into cells, not just those resulting in infection, are protected from RNase A. These results support a finely coordinated, directional model of viral RNA delivery that involves viral proteins and cellular membranes.

Picornavirus RNA is protected from cleavage by ribonuclease during virion uncoating and transfer across cellular and model membranes.

Directory of Open Access Journals (Sweden)

Elisabetta Groppelli

2017-02-01

Full Text Available Picornaviruses are non-enveloped RNA viruses that enter cells via receptor-mediated endocytosis. Because they lack an envelope, picornaviruses face the challenge of delivering their RNA genomes across the membrane of the endocytic vesicle into the cytoplasm to initiate infection. Currently, the mechanism of genome release and translocation across membranes remains poorly understood. Within the enterovirus genus, poliovirus, rhinovirus 2, and rhinovirus 16 have been proposed to release their genomes across intact endosomal membranes through virally induced pores, whereas one study has proposed that rhinovirus 14 releases its RNA following disruption of endosomal membranes. For the more distantly related aphthovirus genus (e.g. foot-and-mouth disease viruses and equine rhinitis A virus acidification of endosomes results in the disassembly of the virion into pentamers and in the release of the viral RNA into the lumen of the endosome, but no details have been elucidated as how the RNA crosses the vesicle membrane. However, more recent studies suggest aphthovirus RNA is released from intact particles and the dissociation to pentamers may be a late event. In this study we have investigated the RNase A sensitivity of genome translocation of poliovirus using a receptor-decorated-liposome model and the sensitivity of infection of poliovirus and equine-rhinitis A virus to co-internalized RNase A. We show that poliovirus genome translocation is insensitive to RNase A and results in little or no release into the medium in the liposome model. We also show that infectivity is not reduced by co-internalized RNase A for poliovirus and equine rhinitis A virus. Additionally, we show that all poliovirus genomes that are internalized into cells, not just those resulting in infection, are protected from RNase A. These results support a finely coordinated, directional model of viral RNA delivery that involves viral proteins and cellular membranes.

Fusion protein is the main determinant of metapneumovirus host tropism.

Science.gov (United States)

de Graaf, Miranda; Schrauwen, Eefje J A; Herfst, Sander; van Amerongen, Geert; Osterhaus, Albert D M E; Fouchier, Ron A M

2009-06-01

Human metapneumovirus (HMPV) and avian metapneumovirus subgroup C (AMPV-C) infect humans and birds, respectively. This study confirmed the difference in host range in turkey poults, and analysed the contribution of the individual metapneumovirus genes to host range in an in vitro cell-culture model. Mammalian Vero-118 cells supported replication of both HMPV and AMPV-C in contrast to avian quail fibroblast (QT6) cells in which only AMPV-C replicated to high titres. Inoculation of Vero-118 and QT6 cells with recombinant HMPV in which genes were exchanged with those of AMPV-C revealed that the metapneumovirus fusion (F) protein is the main determinant for host tropism. Chimeric viruses in which polymerase complex proteins were exchanged between HMPV and AMPV-C replicated less efficiently compared with HMPV in QT6 cells. Using mini-genome systems, it was shown that exchanging these polymerase proteins resulted in reduced replication and transcription efficiency in QT6 cells. Examination of infected Vero-118 and QT6 cells revealed that viruses containing the F protein of AMPV-C yielded larger syncytia compared with viruses containing the HMPV F protein. Cell-content mixing assays revealed that the F protein of AMPV-C was more fusogenic compared with the F protein of HMPV, and that the F2 region is responsible for the difference observed between AMPV-C and HMPV F-promoted fusion in QT6 and Vero-118 cells. This study provides insight into the determinants of host tropism and membrane fusion of metapneumoviruses.

Cytotoxic of Ganoderma lucidum in Colon Cancer through Cyclooxygenase 2 (COX-2 as Its Molecular Target

Directory of Open Access Journals (Sweden)

Agustina Setiawati

2017-05-01

Full Text Available Many studies were designed explore chemopreventive activity of natural products on colon cancer especially addressing COX-2 as molecular target. Another promising source of natural product that potentially exhibit anticancer activity on colon cancer is Ganoderma lucidum. This study assessed selectivity of cytotoxic effect of G. lucidum extract on WiDr to Vero cells and investigated molecular mechanism on COX-2. G. lucidum ex-tract was prepared by reflux extraction method; in vitro anticancer was assayed by MTT method on WiDr and Vero cell line. This study applied apoptosis induction assay to observe cell death mechanism using double staining method; further COX-2 expression was stained by immunocytochemistry method. G. lucidum extract has cytotoxic effect on WiDr cells with IC50 135 µg/mL. However, the cytotoxic effect had low selectivity to-wards Vero cells with Selectivity Index (SI 3.66. The extract induced apoptosis and suppressed COX-2 ex-pression in WiDr cells. G. lucidum extract was potential to be developed as anticancer agent towards colon cancer.

Generation and characterization of APOBEC3G-positive 293T cells for HIV-1 Vif study

OpenAIRE

Piroozmand, Ahmad; Yamamoto, Yoshihiko; Khamsri, Boonruang; Fujita, Mikako; Uchiyama, Tsuneo; Adachi, Akio

2007-01-01

We have established a number of 293T cell lines that express a human anti HIV-1 factor APOBEC3G. Out of seven cell clones examined, four were readily demonstrated to express APOBEC3G by immunoblotting analysis. In particular, two clones (A3G-C1 and -C4) were found to produce a much higher level of functional APOBEC3G relative to that by pooled cell clones. The transfection efficiency of all these cell clones were similar to that of the parental cells, producing a comparable level of virions u...

The virion-associated open reading frame 49 of murine gammaherpesvirus 68 promotes viral replication both in vitro and in vivo as a derepressor of RTA.

Science.gov (United States)

Noh, Cheol-Woo; Cho, Hye-Jeong; Kang, Hye-Ri; Jin, Hyun Yong; Lee, Shaoying; Deng, Hongyu; Wu, Ting-Ting; Arumugaswami, Vaithilingaraja; Sun, Ren; Song, Moon Jung

2012-01-01

Replication and transcription activator (RTA), an immediate-early gene, is a key molecular switch to evoke lytic replication of gammaherpesviruses. Open reading frame 49 (ORF49) is conserved among gammaherpesviruses and shown to cooperate with RTA in regulating virus lytic replication. Here we show a molecular mechanism and in vivo functions of murine gammaherpesvirus 68 (MHV-68 or γHV-68) ORF49. MHV-68 ORF49 was transcribed and translated as a late gene. The ORF49 protein was associated with a virion, interacting with the ORF64 large tegument protein and the ORF25 capsid protein. Moreover, ORF49 directly bound to RTA and its negative cellular regulator, poly(ADP-ribose) polymerase-1 (PARP-1), and disrupted the interactions of RTA and PARP-1. Productive replication of an ORF49-deficient mutant virus (49S) was attenuated in vivo as well as in vitro. Likewise, latent infection was also impaired in the spleen of 49S-infected mice. Taken together, our results suggest that the virion-associated ORF49 protein may promote virus replication both in vitro and in vivo by providing an optimal environment in the early phase of virus infection as a derepressor of RTA.

Stability of the glycoprotein gene of avian metapneumovirus (Canada goose isolate 15a/01) after serial passages in cell cultures.

Science.gov (United States)

Chockalingam, Ashok K; Chander, Yogesh; Halvorson, David A; Goyal, Sagar M

2010-06-01

The glycoprotein (G) gene sequences of avian metapneumovirus (aMPV) subtypes A, B, C, and D are variable in size and number of nucleotides. The G gene of early U.S. turkey isolates of aMPV-C have been reported to be 1798 nucleotides (nt) (585 aa) in length, whereas the G genes of more recent turkey isolates have been reported to be 783 nucleotides. In some studies, the G gene of aMPV-C turkey isolates was found to be truncated to a smaller G gene of 783 nt (261 aa) upon serial passages in Vero cells. This is believed to be due to the deletion of 1015 nt near the end of the open reading frame. The purpose of this study was to determine variation, if any, in the G gene of an aMPV-C isolated from a wild bird (Canada goose [Branta canadensis]) following serial passages in Vero cells. No size variation was observed for up to 50 passages, except for a few amino acid changes in the extracellular domain at the 50th passage level. The G gene of this wild bird isolate appears to be unique from subtype C metapneumoviruses of turkeys.

Porcine platelet lysate as a supplement for animal cell culture

Science.gov (United States)

Aldén, Anna; Gonzalez, Lorena; Persson, Anna; Christensson, Kerstin; Holmqvist, Olov

2007-01-01

A novel supplementation of cell growth media based on a porcine platelet lysate was developed for culture of animal-derived cells. The platelet lysate was produced from porcine blood and contained lysate of platelets and plasma components. It showed satisfactory microbiological integrity and it carried only low amount of endotoxins (platelet lysate supported well proliferation of Vero (African green monkey transformed kidney epithelial cells), Chinese hamster ovary (CHO) and hybridoma cells comparable to fetal bovine serum (FBS). Platelet lysate shows promise as a viable choice over FBS as it can be produced in large quantities, high lot-to-lot consistency and with an attractive price structure. Furthermore it is a strong alternative to FBS for ethical reasons. It is expected that it can be used as a general supplementation for most animal cells for research studies on the proliferation of cells and their expression of products. PMID:19002989

Recovery of Epstein--Barr virus from nonproducer neonatal human lymphoid cell transformants

International Nuclear Information System (INIS)

Wilson, G.; Miller, G.

1979-01-01

Lymphoid cell lines (LCL) were established by infection of two batches of human umbilical cord lymphocytes with low multiplicities of the B95-8 strain of Epstein--Barr virus. Three of the 17 lines released minute mounts of transforming virus. The rest did not, nor did they make capsid antigen. However virus could be regularly recovered by lethal x-irradiation of transformed cells followed by cocultivation with primary human umbilical cord leukocytes. By this technique transforming activity could be identified in 15 of the 17 lines. These data indicate that these nonproducer human neonatal cell transformants established by EBV infection in vitro possess sufficient genetic information to code for production of biologically active mature virions. X rays alone failed to cause a detectable increase in the number of cells with capsid antigen or to enhance extracellular virus production. EBV-positive human serum blocked rescue if it was added during the first 2 to 4 hr after cocultivation, but not thereafter. Transforming virus could be recovered from x-rayed cells which were immediately thereafter lysed by freezing and thawing. These results suggest that recovery of virus following x-ray and cocultivation is not due to activation of the intracellular virus genome. Rather, it is likely that the method detects small numbers of virions which are cell associated. While transforming virus could regularly be rescued from lymphoblastoid cell lines resulting from in vitro transformation, attempts to rescue virus from Raji or EBV-converted BJAB cells were unsuccessful. This discrepancy suggests differences in genome complexity or in genome-cell interactions in different types of EBV-transformed cells

Herpes simplex virus types 1 and 2 induce shutoff of host protein synthesis by different mechanisms in Friend erythroleukemia cells

International Nuclear Information System (INIS)

Hill, T.M.; Sinden, R.R.; Sadler, J.R.

1983-01-01

Herpes simplex virus type 1 (HSV-1) and HSV-2 disrupt host protein synthesis after viral infection. We have treated both viral types with agents which prevent transcription of the viral genome and used these treated viruses to infect induced Friend erythroleukemia cells. By measuring the changes in globin synthesis after infection, we have determined whether expression of the viral genome precedes the shutoff of host protein synthesis or whether the inhibitor molecule enters the cells as part of the virion. HSV-2-induced shutoff of host protein synthesis was insensitive to the effects of shortwave (254-nm) UV light and actinomycin D. Both of the treatments inhibited HSV-1-induced host protein shutoff. Likewise, treatment of HSV-1 with the cross-linking agent 4,5',8-trimethylpsoralen and longwave (360-nm) UV light prevented HSV-1 from inhibiting cellular protein synthesis. Treatment of HSV-2 with 4,5',8-trimethylpsoralen did not affect the ability of the virus to interfere with host protein synthesis, except at the highest doses of longwave UV light. It was determined that the highest longwave UV dosage damaged the HSV-2 virion as well as cross-linking the viral DNA. The results suggest that HSV-2 uses a virion-associated component to inhibit host protein synthesis and that HSV-1 requires the expression of the viral genome to cause cellular protein synthesis shutoff

The conserved structures of the 5' nontranslated region of Citrus tristeza virus are involved in replication and virion assembly

International Nuclear Information System (INIS)

Gowda, Siddarame; Satyanarayana, Tatineni; Ayllon, Maria A.; Moreno, Pedro; Flores, Ricardo; Dawson, William O.

2003-01-01

The genomic RNA of different isolates of Citrus tristeza virus (CTV) reveals an unusual pattern of sequence diversity: the 3' halves are highly conserved (homology >90%), while the 5' halves show much more dissimilarity, with the 5' nontranslated region (NTR) containing the highest diversity (homology as low as 42%). Yet, positive-sense sequences of the 5' NTR were predicted to fold into nearly identical structures consisting of two stem-loops (SL1 and SL2) separated by a short spacer region. The predicted most stable secondary structures of the negative-sense sequences were more variable. We introduced mutations into the 5' NTR of a CTV replicon to alter the sequence and/or the predicted secondary structures with or without additional compensatory changes designed to restore predicted secondary structures, and examined their effect on replication in transfected protoplasts. The results suggested that the predicted secondary structures of the 5' NTR were more important for replication than the primary structure. Most mutations that were predicted to disrupt the secondary structures fail to replicate, while compensatory mutations were allowed replication to resume. The 5' NTR mutations that were tolerated by the CTV replicon were examined in the full-length virus for effects on replication and production of the multiple subgenomic RNAs. Additionally, the ability of these mutants to produce virions was monitored by electron microscopy and by passaging the progeny nucleocapsids to another batch of protoplasts. Some of the mutants with compensatory sequence alterations predicted to rebuild similar secondary structures allowed replication at near wild-type levels but failed to passage, suggesting that the 5' NTR contains sequences required for both replication and virion assembly

Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence.

Science.gov (United States)

Freimuth, P; Anderson, C W

1993-03-01

The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.

Heat shock proteins (Hsp 70) response is not systematic to cell stress

International Nuclear Information System (INIS)

Hassen, Wafa; Ayed-Boussema, Imen; Bouslimi, Amel; Bacha, Hassen

2007-01-01

Ochratoxin A (OTA) is a mycotoxin routinely detected in improperly stored animal and human food supplies as well as in human sera worldwide. OTA has multiple toxic effects; however, the most prominent is nephrotoxicity. Thus, OTA is involved in the pathogenesis of human nephropathy in Balkan areas. In this study, we address the question of the appropriate functioning of the basal cellular defense mechanisms, after exposure to OTA, which, up to now, has not been investigated satisfactorily. In this context, we have monitored the effect of OTA on (i) the inhibition of cell viability, (ii) the oxidative damage using the GSH depletion, (iii) the inhibition of protein synthesis through the incorporation of [ 3 H] Leucine and (iv) the induction of Hsp 70 gene expression as a parameter of cytotoxicity, oxidative damage and particularly as a protective and adaptative response. This study was conducted using the Human Hep G2 hepatocytes and monkey kidney Vero cells under exposure conditions ranging from non-cytotoxic to sub-lethal. Our results clearly showed that OTA inhibits cell proliferation, strongly reduces protein synthesis and induces the decrease of GSH in concentration-dependent manner in both Hep G2 and Vero cells. However, although cytotoxicity and oxidative damage (main inducers of Hsp expression) occur, no change was observed in Hsp 70 level under the multiple tested conditions. Inhibition of protein synthesis could not explain the absence of Hsp 70 response since concentrations, which did not influence protein synthesis, also failed to display the expected Hsp 70 response. Our data are consistent with recently published reports where considerable differences were noticed in the ability of relevant toxicants to induce Hsp. These results raised doubt about the universal character of Hsp induction which seems to be more complex than originally envisioned. It could be concluded that Hsp 70 induction is not systematic to cell stress

Potent inhibition of late stages of hepadnavirus replication by a modified cell penetrating peptide

DEFF Research Database (Denmark)

Abdul, Fabien; Ndeboko, Bénédicte; Buronfosse, Thierry

2012-01-01

Cationic cell-penetrating peptides (CPPs) and their lipid domain-conjugates (CatLip) are agents for the delivery of (uncharged) biologically active molecules into the cell. Using infection and transfection assays we surprisingly discovered that CatLip peptides were able to inhibit replication...... by confocal laser scanning microscopy indicating severe structural changes of preS/S. Sucrose gradient analysis of supernatants from Deca-(Arg)8-treated cells showed unaffected naked viral nucleocapsids release, which was concomitant with a complete arrest of virion and surface protein-containing subviral...

Biliary Secretion of Quasi-Enveloped Human Hepatitis A Virus.

Science.gov (United States)

Hirai-Yuki, Asuka; Hensley, Lucinda; Whitmire, Jason K; Lemon, Stanley M

2016-12-06

Hepatitis A virus (HAV) is an unusual picornavirus that is released from cells cloaked in host-derived membranes. These quasi-enveloped virions (eHAV) are the only particle type circulating in blood during infection, whereas only nonenveloped virions are shed in feces. The reason for this is uncertain. Hepatocytes, the only cell type known to support HAV replication in vivo, are highly polarized epithelial cells with basolateral membranes facing onto hepatic (blood) sinusoids and apical membranes abutting biliary canaliculi from which bile is secreted to the gut. To assess whether eHAV and nonenveloped virus egress from cells via vectorially distinct pathways, we studied infected polarized cultures of Caco-2 and HepG2-N6 cells. Most (>99%) progeny virions were released apically from Caco-2 cells, whereas basolateral (64%) versus apical (36%) release was more balanced with HepG2-N6 cells. Both apically and basolaterally released virions were predominantly enveloped, with no suggestion of differential vectorial release of eHAV versus naked virions. Basolateral to apical transcytosis of either particle type was minimal (work reveals that it has an unusual life cycle. Virus is found in cell culture supernatant fluids in two mature, infectious forms: one wrapped in membranes (quasi-enveloped) and another that is nonenveloped. Membrane-wrapped virions circulate in blood during acute infection and are resistant to neutralizing antibodies, likely facilitating HAV dissemination within the liver. On the other hand, virus shed in feces is nonenveloped and highly stable, facilitating epidemic spread and transmission to naive hosts. Factors controlling the biogenesis of these two distinct forms of the virus in infected humans are not understood. Here we characterize vectorial release of quasi-enveloped virions from polarized epithelial cell cultures and provide evidence that bile acids strip membranes from eHAV following its secretion into the biliary tract. These results

Gp120 stability on HIV-1 virions and Gag-Env pseudovirions is enhanced by an uncleaved Gag core

International Nuclear Information System (INIS)

Hammonds, Jason; Chen Xuemin; Ding Lingmei; Fouts, Timothy; De Vico, Anthony; Megede, Jan zur; Barnett, Susan; Spearman, Paul

2003-01-01

Human immunodeficiency virus type-1 (HIV-1) particles incorporate a trimeric envelope complex (Env) made of gp120 (SU) and gp41 (TM) heterodimers. It has been previously established that soluble CD4 (sCD4) interaction leads to shedding of gp120 from viral particles, and that gp120 may also be easily lost from virions during incubation or particle purification procedures. In the design of HIV particle or pseudovirion-based HIV vaccines, it may be important to develop strategies to maximize the gp120 content of particles. We analyzed the gp120 retention of HIV-1 laboratory-adapted isolates and primary isolates following incubation with sCD4 and variations in temperature. NL4-3 shed gp120 readily in a temperature- and sCD4-dependent manner. Surprisingly, inactivation of the viral protease led to markedly reduced shedding of gp120. Gp120 shedding was shown to vary markedly between HIV-1 strains, and was not strictly determined by whether the isolate was adapted to growth on immortalized T cell lines or was a primary isolate. Pseudovirions produced by expression of codon-optimized gag and env genes also demonstrated enhanced gp120 retention when an immature core structure was maintained. Pseudovirions of optimal stability were produced through a combination of an immature Gag protein core and a primary isolate Env. These results support the feasibility of utilizing pseudovirion particles as immunogens for the induction of humoral responses directed against native envelope structures

Genome and infection characteristics of human parechovirus type 1: the interplay between viral infection and type I interferon antiviral system.

Directory of Open Access Journals (Sweden)

Jenn-Tzong Chang

Full Text Available Human parechoviruses (HPeVs, members of the family Picornaviridae, are associated with severe human clinical conditions such as gastrointestinal disease, encephalitis, meningitis, respiratory disease and neonatal sepsis. A new contemporary strain of HPeV1, KVP6 (accession no. KC769584, was isolated from a clinical specimen. Full-genome alignment revealed that HPeV1 KVP6 shares high genome homology with the German strain of HPeV1, 7555312 (accession no. FM178558 and could be classified in the clade 1B group. An intertypic recombination was shown within the P2-P3 genome regions of HPeV1. Cell-type tropism test showed that T84 cells (colon carcinoma cells, A549 cells (lung carcinoma cells and DBTRG-5MG cells (glioblastoma cells were susceptible to HPeV1 infection, which might be relevant clinically. A facilitated cytopathic effect and increased viral titers were reached after serial viral passages in Vero cells, with viral genome mutation found in later passages. HPeV1 is sensitive to elevated temperature because 39C incubation impaired virion production. HPeV1 induced innate immunity with phosphorylation of interferon (IFN regulatory transcription factor 3 and production of type I IFN in A549 but not T84 cells. Furthermore, type I IFN inhibited HPeV1 production in A549 cells but not T84 cells; T84 cells may be less responsive to type I IFN stimulation. Moreover, HPeV1-infected cells showed downregulated type I IFN activation, which indicated a type I IFN evasion mechanism. The characterization of the complete genome and infection features of HPeV1 provide comprehensive information about this newly isolated HPeV1 for further diagnosis, prevention or treatment strategies.

Chloroquine, an Endocytosis Blocking Agent, Inhibits Zika Virus Infection in Different Cell Models.

Science.gov (United States)

Delvecchio, Rodrigo; Higa, Luiza M; Pezzuto, Paula; Valadão, Ana Luiza; Garcez, Patrícia P; Monteiro, Fábio L; Loiola, Erick C; Dias, André A; Silva, Fábio J M; Aliota, Matthew T; Caine, Elizabeth A; Osorio, Jorge E; Bellio, Maria; O'Connor, David H; Rehen, Stevens; de Aguiar, Renato Santana; Savarino, Andrea; Campanati, Loraine; Tanuri, Amilcar

2016-11-29

Zika virus (ZIKV) infection in utero might lead to microcephaly and other congenital defects. Since no specific therapy is available thus far, there is an urgent need for the discovery of agents capable of inhibiting its viral replication and deleterious effects. Chloroquine is widely used as an antimalarial drug, anti-inflammatory agent, and it also shows antiviral activity against several viruses. Here we show that chloroquine exhibits antiviral activity against ZIKV in Vero cells, human brain microvascular endothelial cells, human neural stem cells, and mouse neurospheres. We demonstrate that chloroquine reduces the number of ZIKV-infected cells in vitro, and inhibits virus production and cell death promoted by ZIKV infection without cytotoxic effects. In addition, chloroquine treatment partially reveres morphological changes induced by ZIKV infection in mouse neurospheres.

Chloroquine, an Endocytosis Blocking Agent, Inhibits Zika Virus Infection in Different Cell Models

Directory of Open Access Journals (Sweden)

Rodrigo Delvecchio

2016-11-01

Full Text Available Zika virus (ZIKV infection in utero might lead to microcephaly and other congenital defects. Since no specific therapy is available thus far, there is an urgent need for the discovery of agents capable of inhibiting its viral replication and deleterious effects. Chloroquine is widely used as an antimalarial drug, anti-inflammatory agent, and it also shows antiviral activity against several viruses. Here we show that chloroquine exhibits antiviral activity against ZIKV in Vero cells, human brain microvascular endothelial cells, human neural stem cells, and mouse neurospheres. We demonstrate that chloroquine reduces the number of ZIKV-infected cells in vitro, and inhibits virus production and cell death promoted by ZIKV infection without cytotoxic effects. In addition, chloroquine treatment partially reveres morphological changes induced by ZIKV infection in mouse neurospheres.

Chloroquine, an Endocytosis Blocking Agent, Inhibits Zika Virus Infection in Different Cell Models

Science.gov (United States)

Delvecchio, Rodrigo; Higa, Luiza M.; Pezzuto, Paula; Valadão, Ana Luiza; Garcez, Patrícia P.; Monteiro, Fábio L.; Loiola, Erick C.; Dias, André A.; Silva, Fábio J. M.; Aliota, Matthew T.; Caine, Elizabeth A.; Osorio, Jorge E.; Bellio, Maria; O’Connor, David H.; Rehen, Stevens; de Aguiar, Renato Santana; Savarino, Andrea; Campanati, Loraine; Tanuri, Amilcar

2016-01-01

Zika virus (ZIKV) infection in utero might lead to microcephaly and other congenital defects. Since no specific therapy is available thus far, there is an urgent need for the discovery of agents capable of inhibiting its viral replication and deleterious effects. Chloroquine is widely used as an antimalarial drug, anti-inflammatory agent, and it also shows antiviral activity against several viruses. Here we show that chloroquine exhibits antiviral activity against ZIKV in Vero cells, human brain microvascular endothelial cells, human neural stem cells, and mouse neurospheres. We demonstrate that chloroquine reduces the number of ZIKV-infected cells in vitro, and inhibits virus production and cell death promoted by ZIKV infection without cytotoxic effects. In addition, chloroquine treatment partially reveres morphological changes induced by ZIKV infection in mouse neurospheres. PMID:27916837

Lithium as a prooxidant? A possible protective role of selenium – in vitro study

Directory of Open Access Journals (Sweden)

Irena Musik

2017-09-01

In Vero cells lithium decreased all studied parameters, particularly GPx. Selenium co-treatment showed a distinct protective effect. In FaDu cells the similar effect was observed only in case of GSH. The results point to differences in action of lithium and selenium in physiological and pathological state. As long-term lithium therapy is applied in psychiatric patients the results regarding Vero line let suggest that selenium might be considered as an adjuvant alleviating side effects of Li-treatment.

Characterization of cell lines stably transfected with rubella virus replicons

International Nuclear Information System (INIS)

Tzeng, Wen-Pin; Xu, Jie; Frey, Teryl K.

2012-01-01

Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was ∼9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.

Characterization of cell lines stably transfected with rubella virus replicons

Energy Technology Data Exchange (ETDEWEB)

Tzeng, Wen-Pin; Xu, Jie [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States); Frey, Teryl K., E-mail: tfrey@gsu.edu [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States)

2012-07-20

Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was {approx}9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.

The impact of meteorology on the occurrence of waterborne outbreaks of vero cytotoxin-producing Escherichia coli (VTEC): a logistic regression approach.

Science.gov (United States)

O'Dwyer, Jean; Morris Downes, Margaret; Adley, Catherine C

2016-02-01

This study analyses the relationship between meteorological phenomena and outbreaks of waterborne-transmitted vero cytotoxin-producing Escherichia coli (VTEC) in the Republic of Ireland over an 8-year period (2005-2012). Data pertaining to the notification of waterborne VTEC outbreaks were extracted from the Computerised Infectious Disease Reporting system, which is administered through the national Health Protection Surveillance Centre as part of the Health Service Executive. Rainfall and temperature data were obtained from the national meteorological office and categorised as cumulative rainfall, heavy rainfall events in the previous 7 days, and mean temperature. Regression analysis was performed using logistic regression (LR) analysis. The LR model was significant (p < 0.001), with all independent variables: cumulative rainfall, heavy rainfall and mean temperature making a statistically significant contribution to the model. The study has found that rainfall, particularly heavy rainfall in the preceding 7 days of an outbreak, is a strong statistical indicator of a waterborne outbreak and that temperature also impacts waterborne VTEC outbreak occurrence.

Cell Adhesion to Plasma-Coated PVC

Directory of Open Access Journals (Sweden)

Elidiane C. Rangel

2014-01-01

Full Text Available To produce environments suitable for cell culture, thin polymer films were deposited onto commercial PVC plates from radiofrequency acetylene-argon plasmas. The proportion of argon in the plasmas, PAr, was varied from 5.3 to 65.8%. The adhesion and growth of Vero cells on the coated surfaces were examined for different incubation times. Cytotoxicity tests were performed using spectroscopic methods. Carbon, O, and N were detected in all the samples using XPS. Roughness remained almost unchanged in the samples prepared with 5.3 and 28.9% but tended to increase for the films deposited with PAr between 28.9 and 55.3%. Surface free energy increased with increasing PAr, except for the sample prepared at 28.9% of Ar, which presented the least reactive surface. Cells proliferated on all the samples, including the bare PVC. Independently of the deposition condition there was no evidence of cytotoxicity, indicating the viability of such coatings for designing biocompatible devices.

Anti-HSV-1 activity in vitro of extracellular polysaccharides purification of Paecilomyces lilacinus on isolated from Hainan mangrove

Directory of Open Access Journals (Sweden)

Yong-Xia Wang

2016-10-01

Full Text Available Objective: To explore the antiviral activity on HSV-1 of the extracellular polysaccharides (EPS purification of Paecilomyces lilacinus (P. lilacinus isolated from mangrove in Hainan province. Methods: The toxicity of the EPS purification on Vero cells and its anti-HSV-1 activity were assessed by cytopathic effect(CPE and MTT assay. The Vero cells survival rates, HSV-1 inhibition rates by the purification and virus titer were calculated. Results: The purification showed little cytotoxic effect on Vero with a CC50 value of 735.49 µg/mL. It could inhibit HSV-1 absorption on Vero cells, and there was a significant difference (P<0.01 compared with control group (virus group, and the highest inhibition ratio was 35.0% at dose of 400 µg/mL; The biosynthesis of HSV-1 could be inhibited by the extract with dose-dependent manner, and the IC50 value to the viruses was 387.26 µg/mL, and the highest inhibition ratio was 61.3% at dose of 400 µg/mL; but the purification couldn’t inactivate HSV-1 directly. Conclusion: The EPS purification had certain antiviral effect, it could inhibit HSV-1 absorption and biosynthesis with a dose effect relationship.

Beet yellow stunt virus in cells of Sonchus oleraceus L. and its relation to host mitochondria.

Science.gov (United States)

Esau, K

1979-10-15

In Sonchus oleraceus L. (Asteraceae) infected with the beet yellow stunt virus (BYSV) the virions are found in phloem cells, including the sieve elements. In parenchymatous phloem cells, the virus is present mainly in the cytoplasm. In some parenchymatous cells, containing massive accumulations of virus, the flexuous rodlike virus particles are found partly inserted into mitochondrial cristae. The mitochondrial envelope is absent where virus is present in the cristae. A similar relation between virus and host mitochondria apparently has not been recorded for any other plant virus.

Cell entry of hepatitis C virus

International Nuclear Information System (INIS)

Bartosch, Birke; Cosset, Francois-Loic

2006-01-01

Hepatitis C virus (HCV), an important human pathogen, is an enveloped, positive-stranded RNA virus classified in the hepacivirus genus of the Flaviviridae family. Cell attachment of flaviviruses generally leads to endocytosis of bound virions. Systems that support HCV replication and particle formation in vitro are emerging only now, 16 years after the discovery of the virus. Albeit this limitation, the route of HCV cell entry as well as 'capture' molecules involved in low-affinity interactions for the initial contact of HCV with target cells and potential high-affinity receptor candidates that may mediate HCV trafficking and fusion has been described. The objective of this review is to summarize the contribution of different HCV model systems to our current knowledge about structure of the HCV GPs E1 and E2 and their roles in cell entry comprising cell attachment, interactions with cellular receptors, endocytosis, and fusion

pH-induced conformational change of the rotavirus VP4 spike: implications for cell entry and antibody neutralization.

Science.gov (United States)

Pesavento, Joseph B; Crawford, Sue E; Roberts, Ed; Estes, Mary K; Prasad, B V Venkataram

2005-07-01

The rotavirus spike protein, VP4, is a major determinant of infectivity and neutralization. Previously, we have shown that trypsin-enhanced infectivity of rotavirus involves a transformation of the VP4 spike from a flexible to a rigid bilobed structure. Here we show that at elevated pH the spike undergoes a drastic, irreversible conformational change and becomes stunted, with a pronounced trilobed appearance. These particles with altered spikes, at a normal pH of 7.5, despite the loss of infectivity and the ability to hemagglutinate, surprisingly exhibit sialic acid (SA)-independent cell binding in contrast to the SA-dependent cell binding exhibited by native virions. Remarkably, a neutralizing monoclonal antibody that remains bound to spikes throughout the pH changes (pH 7 to 11 and back to pH 7) completely prevents this conformational change, preserving the SA-dependent cell binding and hemagglutinating functions of the virion. A hypothesis that emerges from the present study is that high-pH treatment triggers a conformational change that mimics a post-SA-attachment step to expose an epitope recognized by a downstream receptor in the rotavirus cell entry process. This process involves sequential interactions with multiple receptors, and the mechanism by which the antibody neutralizes is by preventing this conformational change.

Measles virus-specified polypeptides in infected cells

International Nuclear Information System (INIS)

Vainionpaepae, R.

1979-01-01

The synthesis of wild-type measles virus-specified polypeptides in Vero cells in pulse-chase experiments, in cells with synchronized protein synthesis by high salt concentration, and in the presence of proteolytic enzyme inhibitors was analyzed by polyacrylamide slab-gel electrophoresis. Six major (L, G, 2, NP, 5 and M) structural polypeptides were identified in infected cells. The results of pulse-chase experiments suggested that most of the structural polypeptides were synthesized at their final length. Polypeptide M was found to be sensitive to trypsin. In TLCK-treated cells its molecular weight was about 1000-2000 daltons higher than in untreated cells. A minor virus-specific polypeptide with a molecular weight of about 23,000 was found as a very faint and diffuse band. In addition, three nonstructural polypeptides with molecular weights of 65,000, 38,000 and 18,000 were also detected. The experiments with proteolytic enzyme inhibitors and with synchronized protein synthesis suggested that the polypeptide with a molecular weight of 65,000 might be a precursor of the structural polypeptide 5. (author)

Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry.

Science.gov (United States)

Rhein, Bethany A; Brouillette, Rachel B; Schaack, Grace A; Chiorini, John A; Maury, Wendy

2016-07-01

Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion-TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses

Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells

Science.gov (United States)

Tiwari, Vaibhav; Oh, Myung-Jin; Kovacs, Maria; Shukla, Shripaad Y.; Valyi-Nagy, Tibor; Shukla, Deepak

2009-01-01

Herpes simplex virus 1 (HSV-1) demonstrates a unique ability to infect a variety of host cell types. Retinal pigment epithelial (RPE) cells form the outermost layer of the retina and provide a potential target for viral invasion and permanent vision impairment. Here we examine the initial cellular and molecular mechanisms that facilitate HSV-1 invasion of human RPE cells. High-resolution confocal microscopy demonstrated initial interaction of green fluorescent protein (GFP)-tagged virions with filopodia-like structures present on cell surfaces. Unidirectional movement of the virions on filopodia to the cell body was detected by live cell imaging of RPE cells, which demonstrated susceptibility to pH-dependent HSV-1 entry and replication. Use of RT-PCR indicated expression of nectin-1, herpes virus entry mediator (HVEM) and 3-O-sulfotransferase-3 (as a surrogate marker for 3-O-sulfated heparan sulfate). HVEM and nectin-1 expression was subsequently verified by flow cytometry. Nectin-1 expression in murine retinal tissue was also demonstrated by immunohistochemistry. Antibodies against nectin-1, but not HVEM, were able to block HSV-1 infection. Similar blocking effects were seen with a small interfering RNA construct specifically directed against nectin-1, which also blocked RPE cell fusion with HSV-1 glycoprotein-expressing Chinese hamster ovary (CHO-K1) cells. Anti-nectin-1 antibodies and F-actin depolymerizers were also successful in blocking the cytoskeletal changes that occur upon HSV-1 entry into cells. Our findings shed new light on the cellular and molecular mechanisms that help the virus to enter the cells of the inner eye. PMID:18803666

In vitro evaluation of poly(ethylene glycol)-block-poly(ε-caprolactone) methyl ether copolymer coating effects on cells adhesion and proliferation

Energy Technology Data Exchange (ETDEWEB)

Rusen, Laurentiu [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Neacsu, Patricia; Cimpean, Anisoara [University of Bucharest, Department of Biochemistry and Molecular Biology, Bucharest (Romania); Valentin, Ion; Brajnicov, Simona; Dumitrescu, L.N. [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Banita, Janina [University of Bucharest, Faculty of Chemistry, Bucharest (Romania); IBAR, Institute of Biochemistry of the Romanian Academy, 296 Splaiul Independentei, RO-060031 Bucharest (Romania); Dinca, Valentina, E-mail: valentina.dinca@inflpr.ro [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Dinescu, Maria [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania)

2016-06-30

Understanding and controlling natural and synthetic biointerfaces is known to be the key to a wide variety of application within cell culture and tissue engineering field. As both material characteristics and methods are important in tailoring biointerfaces characteristics, in this work we explore the feasibility of using Matrix Assisted Pulsed Laser Evaporation technique for obtaining synthetic copolymeric biocoatings (i.e. poly(ethylene glycol)-block-poly(ε-caprolactone) methyl ether) for evaluating in vitro Vero and MC3T3-E1 pre-osteoblasts cell response. Characterization and evaluation of the coated substrates were carried out using different techniques. The Fourier transform infrared spectroscopy data demonstrated that the main functional groups in the MAPLE-deposited films remained intact. Atomic Force Microscopy images showed the coatings to be continuous, with the surface roughness depending on the deposition parameters. Moreover, the behaviour of the coatings in medium mimicking the pH and temperature of the human body was studied and corelated to degradation. Spectro-ellipsometry (SE) and AFM measurements revealed the degradation trend during immersion time by the changes in coating thickness and roughness. In vitro biocompatibility was studied by indirect contact tests on Vero cells in accordance with ISO 10993-5/2009. The results obtained in terms of cell morphology (phase contrast microscopy) and cytotoxicity (LDH and MTT assays) proved biocompatibility. Furthermore, direct contact assays on MC3T3-E1 pre-osteoblasts demonstrated the capacity of all analyzed specimens to support cell adhesion, normal cellular morphology and growth.

In vitro evaluation of poly(ethylene glycol)-block-poly(ɛ-caprolactone) methyl ether copolymer coating effects on cells adhesion and proliferation

Science.gov (United States)

Rusen, Laurentiu; Neacsu, Patricia; Cimpean, Anisoara; Valentin, Ion; Brajnicov, Simona; Dumitrescu, L. N.; Banita, Janina; Dinca, Valentina; Dinescu, Maria

2016-06-01

Understanding and controlling natural and synthetic biointerfaces is known to be the key to a wide variety of application within cell culture and tissue engineering field. As both material characteristics and methods are important in tailoring biointerfaces characteristics, in this work we explore the feasibility of using Matrix Assisted Pulsed Laser Evaporation technique for obtaining synthetic copolymeric biocoatings (i.e. poly(ethylene glycol)-block-poly(ɛ-caprolactone) methyl ether) for evaluating in vitro Vero and MC3T3-E1 pre-osteoblasts cell response. Characterization and evaluation of the coated substrates were carried out using different techniques. The Fourier transform infrared spectroscopy data demonstrated that the main functional groups in the MAPLE-deposited films remained intact. Atomic Force Microscopy images showed the coatings to be continuous, with the surface roughness depending on the deposition parameters. Moreover, the behaviour of the coatings in medium mimicking the pH and temperature of the human body was studied and corelated to degradation. Spectro-ellipsometry (SE) and AFM measurements revealed the degradation trend during immersion time by the changes in coating thickness and roughness. In vitro biocompatibility was studied by indirect contact tests on Vero cells in accordance with ISO 10993-5/2009. The results obtained in terms of cell morphology (phase contrast microscopy) and cytotoxicity (LDH and MTT assays) proved biocompatibility. Furthermore, direct contact assays on MC3T3-E1 pre-osteoblasts demonstrated the capacity of all analyzed specimens to support cell adhesion, normal cellular morphology and growth.

Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone

International Nuclear Information System (INIS)

Adachi, A.; Gendelman, H.E.; Koenig, S.; Folks, T.; Willey, R.; Rabson, A.; Martin, M.A.

1986-01-01

The authors considered an infectious molecular clone of acquired immunodeficiency syndrome-associated retrovirus. Upon transfection, this clone directed the production of infectious virus particles in a wide variety of cells in addition to human T4 cells. The progeny, infectious virions, were synthesized in mouse, mink, monkey, and several human non-T cell lines, indicating the absence of any intracellular obstacle to viral RNA or protein production or assembly. During the course of these studies, a human colon carcinoma cell line, exquisitely sensitive to DNA transfection, was identified

Capture of cell culture-derived influenza virus by lectins: strain independent, but host cell dependent.

Science.gov (United States)

Opitz, Lars; Zimmermann, Anke; Lehmann, Sylvia; Genzel, Yvonne; Lübben, Holger; Reichl, Udo; Wolff, Michael W

2008-12-01

Strategies to control influenza outbreaks are focused mainly on prophylactic vaccination. Human influenza vaccines are trivalent blends of different virus subtypes. Therefore and due to frequent antigenic drifts, strain independent manufacturing processes are required for vaccine production. This study verifies the strain independency of a capture method based on Euonymus europaeus lectin-affinity chromatography (EEL-AC) for downstream processing of influenza viruses under various culture conditions propagated in MDCK cells. A comprehensive lectin binding screening was conducted for two influenza virus types from the season 2007/2008 (A/Wisconsin/67/2005, B/Malaysia/2506/2004) including a comparison of virus-lectin interaction by surface plasmon resonance technology. EEL-AC resulted in a reproducible high product recovery rate and a high degree of contaminant removal in the case of both MDCK cell-derived influenza virus types demonstrating clearly the general applicability of EEL-AC. In addition, host cell dependency of EEL-AC was studied with two industrial relevant cell lines: Vero and MDCK cells. However, the choice of the host cell lines is known to lead to different product glycosylation profiles. Hence, altered lectin specificities have been observed between the two cell lines, requiring process adaptations between different influenza vaccine production systems.

HCMV Displays a Unique Transcriptome of Immunomodulatory Genes in Primary Monocyte-Derived Cell Types.

Directory of Open Access Journals (Sweden)

Ellen Van Damme

Full Text Available Human cytomegalovirus (HCMV is a betaherpesvirus which rarely presents problems in healthy individuals, yet may result in severe morbidity in immunocompromised patients and in immune-naïve neonates. HCMV has a large 235 kb genome with a coding capacity of at least 165 open reading frames (ORFs. This large genome allows complex gene regulation resulting in different sets of transcripts during lytic and latent infection. While latent virus mainly resides within monocytes and CD34+ progenitor cells, reactivation to lytic infection is driven by differentiation towards terminally differentiated myeloid dendritic cells and macrophages. Consequently, it has been suggested that macrophages and dendritic cells contribute to viral spread in vivo. Thus far only limited knowledge is available on the expression of HCMV genes in terminally differentiated myeloid primary cells and whether or not the virus exhibits a different set of lytic genes in primary cells compared with lytic infection in NHDF fibroblasts. To address these questions, we used Illumina next generation sequencing to determine the HCMV transcriptome in macrophages and dendritic cells during lytic infection and compared it to the transcriptome in NHDF fibroblasts. Here, we demonstrate unique expression profiles in macrophages and dendritic cells which significantly differ from the transcriptome in fibroblasts mainly by modulating the expression of viral transcripts involved in immune modulation, cell tropism and viral spread. In a head to head comparison between macrophages and dendritic cells, we observed that factors involved in viral spread and virion composition are differentially regulated suggesting that the plasticity of the virion facilitates the infection of surrounding cells. Taken together, this study provides the full transcript expression analysis of lytic HCMV genes in monocyte-derived type 1 and type 2 macrophages as well as in monocyte-derived dendritic cells. Thereby

Stable Human Hepatoma Cell Lines for Efficient Regulated Expression of Nucleoside/Nucleotide Analog Resistant and Vaccine Escape Hepatitis B Virus Variants and Woolly Monkey Hepatitis B Virus.

Directory of Open Access Journals (Sweden)

Xin Cheng

Full Text Available Hepatitis B virus (HBV causes acute and chronic hepatitis B (CHB. Due to its error-prone replication via reverse transcription, HBV can rapidly evolve variants that escape vaccination and/or become resistant to CHB treatment with nucleoside/nucleotide analogs (NAs. This is particularly problematic for the first generation NAs lamivudine and adefovir. Though now superseded by more potent NAs, both are still widely used. Furthermore, resistance against the older NAs can contribute to cross-resistance against more advanced NAs. For lack of feasible HBV infection systems, the biology of such variants is not well understood. From the recent discovery of Na+-taurocholate cotransporting polypeptide (NTCP as an HBV receptor new in vitro infection systems are emerging, yet access to the required large amounts of virions, in particular variants, remains a limiting factor. Stably HBV producing cell lines address both issues by allowing to study intracellular viral replication and as a permanent source of defined virions. Accordingly, we generated a panel of new tetracycline regulated TetOFF HepG2 hepatoma cell lines which produce six lamivudine and adefovir resistance-associated and two vaccine escape variants of HBV as well as the model virus woolly monkey HBV (WMHBV. The cell line-borne viruses reproduced the expected NA resistance profiles and all were equally sensitive against a non-NA drug. The new cell lines should be valuable to investigate under standardized conditions HBV resistance and cross-resistance. With titers of secreted virions reaching >3 x 10(7 viral genome equivalents per ml they should also facilitate exploitation of the new in vitro infection systems.

Depletion of Alveolar Macrophages Does Not Prevent Hantavirus Disease Pathogenesis in Golden Syrian Hamsters

Science.gov (United States)

2016-05-20

ANDV strain Chile -9717869 (27) was propagated in Vero E6 cells 122 (Vero C1008, ATCC CRL 1586). Preparation of twice-plaque-purified ANDV stock has...Research and Material Command, Military 537 Infectious Disease Research Program , Program Area T. Research reported in this publication 538 was also...prior to kidney, involvement, and diagnosed by viral 684 inclusions in lung macrophages. European journal of clinical microbiology & infectious

Engineering Enhanced Vaccine Cell Lines To Eradicate Vaccine-Preventable Diseases: the Polio End Game.

Science.gov (United States)

van der Sanden, Sabine M G; Wu, Weilin; Dybdahl-Sissoko, Naomi; Weldon, William C; Brooks, Paula; O'Donnell, Jason; Jones, Les P; Brown, Cedric; Tompkins, S Mark; Oberste, M Steven; Karpilow, Jon; Tripp, Ralph A

2016-02-15

Vaccine manufacturing costs prevent a significant portion of the world's population from accessing protection from vaccine-preventable diseases. To enhance vaccine production at reduced costs, a genome-wide RNA interference (RNAi) screen was performed to identify gene knockdown events that enhanced poliovirus replication. Primary screen hits were validated in a Vero vaccine manufacturing cell line using attenuated and wild-type poliovirus strains. Multiple single and dual gene silencing events increased poliovirus titers >20-fold and >50-fold, respectively. Host gene knockdown events did not affect virus antigenicity, and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9-mediated knockout of the top candidates dramatically improved viral vaccine strain production. Interestingly, silencing of several genes that enhanced poliovirus replication also enhanced replication of enterovirus 71, a clinically relevant virus to which vaccines are being targeted. The discovery that host gene modulation can markedly increase virus vaccine production dramatically alters mammalian cell-based vaccine manufacturing possibilities and should facilitate polio eradication using the inactivated poliovirus vaccine. Using a genome-wide RNAi screen, a collection of host virus resistance genes was identified that, upon silencing, increased poliovirus and enterovirus 71 production by from 10-fold to >50-fold in a Vero vaccine manufacturing cell line. This report provides novel insights into enterovirus-host interactions and describes an approach to developing the next generation of vaccine manufacturing through engineered vaccine cell lines. The results show that specific gene silencing and knockout events can enhance viral titers of both attenuated (Sabin strain) and wild-type polioviruses, a finding that should greatly facilitate global implementation of inactivated polio vaccine as well as further reduce costs for live-attenuated oral polio vaccines. This work

Cytotoxic activity of water extracts of Trichilia hirta leaves on human tumor cells

International Nuclear Information System (INIS)

Hernandez Sosa, Edgar; Mora Gonzalez, Nestor; Morris Quevedo, Humberto J

2013-01-01

Trichilia hirta L. (Meliaceae) is traditionally used by patients suffering from cancer as an antitumoral resource. Therefore, the objectives of this study were to evaluate the cytotoxic activity of water extracts of Trichilia hirta leaves on tumour cells and identify through a phytochemical screening the principal families of phytocomponents contained in these extracts. The cytotoxic activity of these extracts was also evaluated on human melanoma cells (SK-mel-3) and human breast carcinoma (T-47D). The African green monkey kidney (AGMK) cells Cercopithecus aethiops (Vero) were used as a non-tumour cells control. The results showed the presence of triterpenes/steroids, saponins, coumarins, reductor sugars, phenols and tannins, flavonoids and carbohydrates/glycosides in the extracts. The water leaf extracts showed cytotoxic activity mainly on tumour cells, which contributes to explain the referred recovery by patients suffering form cancer that traditionally consume these extracts

In vitro cytotoxicity of zinc oxide, iron oxide and copper nanopowders prepared by green synthesis

Directory of Open Access Journals (Sweden)

Saranya S.

Full Text Available In vitro cytotoxic effects of ZnO, FeO and Cu metallic nanopowders (NPs on Vero (African green monkey kidney cell line, PK 15 (Pig kidney cell line and Madin Darby Bovine Kidney (MDBK cell lines were investigated at different time intervals (24 and 48 h. MTT (3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay was used to determine the cytotoxic effects of green synthesized (plant based nanopowders. The comparative effects of exposure period and concentration of nanopowders on cell viability were studied. Green synthesized nanopowders showed varying activity on different type of cells and the effect was generally based on the concentration and exposure time. In MDBK cells, only ZnO nanopowder (NP showed significant effect on cell viability. The ZnO NP showed improved cell viability at lower concentration (10 μg/100 μl in all type of cells (Vero, PK 15 and MDBK cells. In contrast, FeO NP showed better activity at the concentration of 10 μg/100 μl, 50 μg/100 μl and 40 μg/100 μl after 24 h exposure time in Vero, PK 15 and MDBK cells respectively. However better cell viability was observed in Cu NP treated Vero, PK 15 and MDBK cells at 40 μg/100 μl, 20 μg/100 μl and 10 μg/100 μl correspondingly. These studies suggested that the activity of green synthesized NPs were highly dependent on concentration, exposure time and type of cells. Keywords: ZnO, FeO, Cu, Nanopowders, MTT, in vitro cytotoxicity

HIV Cell-to-Cell Spread Results in Earlier Onset of Viral Gene Expression by Multiple Infections per Cell.

Directory of Open Access Journals (Sweden)

Mikaël Boullé

2016-11-01

Full Text Available Cell-to-cell spread of HIV, a directed mode of viral transmission, has been observed to be more rapid than cell-free infection. However, a mechanism for earlier onset of viral gene expression in cell-to-cell spread was previously uncharacterized. Here we used time-lapse microscopy combined with automated image analysis to quantify the timing of the onset of HIV gene expression in a fluorescent reporter cell line, as well as single cell staining for infection over time in primary cells. We compared cell-to-cell spread of HIV to cell-free infection, and limited both types of transmission to a two-hour window to minimize differences due to virus transit time to the cell. The mean time to detectable onset of viral gene expression in cell-to-cell spread was accelerated by 19% in the reporter cell line and by 35% in peripheral blood mononuclear cells relative to cell-free HIV infection. Neither factors secreted by infected cells, nor contact with infected cells in the absence of transmission, detectably changed onset. We recapitulated the earlier onset by infecting with multiple cell-free viruses per cell. Surprisingly, the acceleration in onset of viral gene expression was not explained by cooperativity between infecting virions. Instead, more rapid onset was consistent with a model where the fastest expressing virus out of the infecting virus pool sets the time for infection independently of the other co-infecting viruses.

Metabolic studies of 2'-fluoro-5-iodo-1-β-D-arabinofuranosylcytosine (FIAC)

International Nuclear Information System (INIS)

Van Nostrand, M.; Oshana, S.; Speelman, D.J.; McLaren, C.; Chen, M.S.

1986-01-01

Metabolic studies of FIAC were carried out in herpes simplex virus type 1 and mock infected Vero cells using HPLC purified [2- 14 C]FIAC. HSV-1 infected and mock infected Vero cells were incubated with 2 μM [2- 14 C]FIAC for 24 hrs. DNA purified from both viral and mock infected cells was hydrolyzed with DNAase 1 and venom phosphodiesterase. The resulting deoxynucleoside monophosphate derivatives were analyzed by HPLC (Whatman SAX column). Only FIAU, the deamination product of FIAC, was found in DNA from both HSV-1 infected and mock infected Vero cells, while FAC, FMAU and FIAC were not detected. Whereas 0.112% of Tdr in DNA from mock infected cells was substituted by FIAU 1.056% of the Tdr in viral DNA from HSV-1 infected cells was substituted by FIAU. HPLC analysis (Whatman SAX column) of medium from HSV-1 infected cell cultures showed that all [2- 14 C] FIAC had been metabolized to [2- 14 C]FIAU, while no [2- 14 C]FIAU could be detected in the medium of mock infected cells. HPLC analysis of HC10 4 extracts of HSV-1 infected cells showed that the percentages of various phosphorylated derivatives were 10% FIAU, 76% FIAU monophosphate, 9% FIAU diphosphate and 5% FIAU triphosphate. These data showed conclusively that FIAU is the active antiviral metabolite of FIAC

Absence of E protein arrests transmissible gastroenteritis coronavirus maturation in the secretory pathway

International Nuclear Information System (INIS)

Ortego, Javier; Ceriani, Juan E.; Patino, Cristina; Plana, Juan; Enjuanes, Luis

2007-01-01

A recombinant transmissible gastroenteritis coronavirus (rTGEV) in which E gene was deleted (rTGEV-ΔE) has been engineered. This deletion mutant only grows in cells expressing E protein (E + cells) indicating that E was an essential gene for TGEV replication. Electron microscopy studies of rTGEV-ΔE infected BHK-pAPN-E - cells showed that only immature intracellular virions were assembled. These virions were non-infectious and not secreted to the extracellular medium in BHK-pAPN-E - cells. RNA and protein composition analysis by RNase-gold and immunoelectron microscopy showed that rTGEV-ΔE virions contained RNA and also all the structural TGEV proteins, except the deleted E protein. Nevertheless, full virion maturation was blocked. Studies of the rTGEV-ΔE subcellular localization by confocal and immunoelectron microscopy in infected E - cells showed that in the absence of E protein virus trafficking was arrested in the intermediate compartment. Therefore, the absence of E protein in TGEV resulted in two actions, a blockade of virus trafficking in the membranes of the secretory pathway, and prevention of full virus maturation

Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry

OpenAIRE

Rhein, Bethany A.; Brouillette, Rachel B.; Schaack, Grace A.; Chiorini, John A.; Maury, Wendy

2016-01-01

Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amin...

The B-Cell Follicle in HIV Infection: Barrier to a Cure.

Science.gov (United States)

Bronnimann, Matthew P; Skinner, Pamela J; Connick, Elizabeth

2018-01-01

The majority of HIV replication occurs in secondary lymphoid organs (SLOs) such as the spleen, lymph nodes, and gut-associated lymphoid tissue. Within SLOs, HIV RNA + cells are concentrated in the B-cell follicle during chronic untreated infection, and emerging data suggest that they are a major source of replication in treated disease as well. The concentration of HIV RNA + cells in the B-cell follicle is mediated by several factors. Follicular CD4 + T-cell subsets including T-follicular helper cells and T-follicular regulatory cells are significantly more permissive to HIV than extrafollicular subsets. The B cell follicle also contains a large reservoir of extracellular HIV virions, which accumulate on the surface of follicular dendritic cells (FDCs) in germinal centers. FDC-bound HIV virions remain infectious even in the presence of neutralizing antibodies and can persist for months or even years. Moreover, the B-cell follicle is semi-immune privileged from CTL control. Frequencies of HIV- and SIV-specific CTL are lower in B-cell follicles compared to extrafollicular regions as the majority of CTL do not express the follicular homing receptor CXCR5. Additionally, CTL in the B-cell follicle may be less functional than extrafollicular CTL as many exhibit the recently described CD8 T follicular regulatory phenotype. Other factors may also contribute to the follicular concentration of HIV RNA + cells. Notably, the contribution of NK cells and γδ T cells to control and/or persistence of HIV RNA + cells in secondary lymphoid tissue remains poorly characterized. As HIV research moves increasingly toward the development of cure strategies, a greater understanding of the barriers to control of HIV infection in B-cell follicles is critical. Although no strategy has as of yet proven to be effective, a range of novel therapies to address these barriers are currently being investigated including genetically engineered CTL or chimeric antigen receptor T cells that express

The B-Cell Follicle in HIV Infection: Barrier to a Cure

Directory of Open Access Journals (Sweden)

Matthew P. Bronnimann

2018-01-01

Full Text Available The majority of HIV replication occurs in secondary lymphoid organs (SLOs such as the spleen, lymph nodes, and gut-associated lymphoid tissue. Within SLOs, HIV RNA+ cells are concentrated in the B-cell follicle during chronic untreated infection, and emerging data suggest that they are a major source of replication in treated disease as well. The concentration of HIV RNA+ cells in the B-cell follicle is mediated by several factors. Follicular CD4+ T-cell subsets including T-follicular helper cells and T-follicular regulatory cells are significantly more permissive to HIV than extrafollicular subsets. The B cell follicle also contains a large reservoir of extracellular HIV virions, which accumulate on the surface of follicular dendritic cells (FDCs in germinal centers. FDC-bound HIV virions remain infectious even in the presence of neutralizing antibodies and can persist for months or even years. Moreover, the B-cell follicle is semi-immune privileged from CTL control. Frequencies of HIV- and SIV-specific CTL are lower in B-cell follicles compared to extrafollicular regions as the majority of CTL do not express the follicular homing receptor CXCR5. Additionally, CTL in the B-cell follicle may be less functional than extrafollicular CTL as many exhibit the recently described CD8 T follicular regulatory phenotype. Other factors may also contribute to the follicular concentration of HIV RNA+ cells. Notably, the contribution of NK cells and γδ T cells to control and/or persistence of HIV RNA+ cells in secondary lymphoid tissue remains poorly characterized. As HIV research moves increasingly toward the development of cure strategies, a greater understanding of the barriers to control of HIV infection in B-cell follicles is critical. Although no strategy has as of yet proven to be effective, a range of novel therapies to address these barriers are currently being investigated including genetically engineered CTL or chimeric antigen receptor T cells

A novel mosquito ubiquitin targets viral envelope protein for degradation and reduces virion production during dengue virus infection.

Science.gov (United States)

Troupin, Andrea; Londono-Renteria, Berlin; Conway, Michael J; Cloherty, Erin; Jameson, Samuel; Higgs, Stephen; Vanlandingham, Dana L; Fikrig, Erol; Colpitts, Tonya M

2016-09-01

Dengue virus (DENV) is a mosquito-borne flavivirus that causes significant human disease and mortality in the tropics and subtropics. By examining the effects of virus infection on gene expression, and interactions between virus and vector, new targets for prevention of infection and novel treatments may be identified in mosquitoes. We previously performed a microarray analysis of the Aedes aegypti transcriptome during infection with DENV and found that mosquito ubiquitin protein Ub3881 (AAEL003881) was specifically and highly down-regulated. Ubiquitin proteins have multiple functions in insects, including marking proteins for proteasomal degradation, regulating apoptosis and mediating innate immune signaling. We used qRT-PCR to quantify gene expression and infection, and RNAi to reduce Ub3881 expression. Mosquitoes were infected with DENV through blood feeding. We transfected DENV protein expression constructs to examine the effect of Ub3881 on protein degradation. We used site-directed mutagenesis and transfection to determine what amino acids are involved in Ub3881-mediated protein degradation. Immunofluorescence, Co-immunoprecipitation and Western blotting were used to examine protein interactions and co-localization. The overexpression of Ub3881, but not related ubiquitin proteins, decreased DENV infection in mosquito cells and live Ae. aegypti. The Ub3881 protein was demonstrated to be involved in DENV envelope protein degradation and reduce the number of infectious virions released. We conclude that Ub3881 has several antiviral functions in the mosquito, including specific viral protein degradation. Our data highlights Ub3881 as a target for future DENV prevention strategies in the mosquito transmission vector. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Identification and production of mouse scFv to specific epitope of enterovirus-71 virion protein-2 (VP2).

Science.gov (United States)

Thanongsaksrikul, Jeeraphong; Srimanote, Potjanee; Tongtawe, Pongsri; Glab-Ampai, Kittirat; Malik, Aijaz Ahmad; Supasorn, Oratai; Chiawwit, Phatcharaporn; Poovorawan, Yong; Chaicumpa, Wanpen

2018-05-01

Enterovirus-71 (EV71) and coxsackievirus-A16 (CA16) frequently cause hand-foot-mouth disease (HFMD) epidemics among infants and young children. CA16 infections are usually mild, while EV71 disease may be fatal due to neurologic complications. As such, the ability to rapidly and specifically recognize EV71 is needed to facilitate proper case management and epidemic control. Accordingly, the aim of this study was to generate antibodies to EV71-virion protein-2 (VP2) by phage display technology for further use in specific detection of EV71. A recombinant peptide sequence of EV71-VP2, carrying a predicted conserved B cell epitope fused to glutathione-S-transferase (GST) (designated GST-EV71-VP2/131-160), was produced. The fusion protein was used as bait in in-solution biopanning to separate protein-bound phages from a murine scFv (MuscFv) phage display library constructed from an immunoglobulin gene repertoire from naïve ICR mice. Three phage-transformed E. coli clones (clones 63, 82, and 83) produced MuscFvs that bound to the GST-EV71-VP2/131-160 peptide. The MuscFv of clone 83 (MuscFv83), which produced the highest ELISA signal to the target antigen, was further tested. MuscFv83 also bound to full-length EV71-VP2 and EV71 particles, but did not bind to GST, full-length EV71-VP1, or the antigenically related CA16. MuscFv83 could be a suitable reagent for rapid antigen-based immunoassay, such as immunochromatography (ICT), for the specific detection and/or diagnosis of EV71 infection as well as epidemic surveillance.

Extracellular ATP reduces HIV-1 transfer from immature dendritic cells to CD4+ T lymphocytes

Directory of Open Access Journals (Sweden)

Barat Corinne

2008-03-01

Full Text Available Abstract Background Dendritic cells (DCs are considered as key mediators of the early events in human immunodeficiency virus type 1 (HIV-1 infection at mucosal sites. Previous studies have shown that surface-bound virions and/or internalized viruses found in endocytic vacuoles of DCs are efficiently transferred to CD4+ T cells. Extracellular adenosine triphosphate (ATP either secreted or released from necrotic cells induces a distorted maturation of DCs, transiently increases their endocytic capacity and affects their migratory capacity. Knowing that high extracellular ATP concentrations are present in situations of tissue injury and inflammation, we investigated the effect of ATP on HIV-1 transmission from DCs to CD4+ T lymphocytes. Results In this study, we show that extracellular ATP reduces HIV-1 transfer from immature monocyte-derived DCs (iDCs to autologous CD4+ T cells. This observed decrease in viral replication was related to a lower proportion of infected CD4+ T cells following transfer, and was seen with both X4- and R5-tropic isolates of HIV-1. Extracellular ATP had no effect on direct CD4+ T cell infection as well as on productive HIV-1 infection of iDCs. These observations indicate that extracellular ATP affects HIV-1 infection of CD4+ T cells in trans with no effect on de novo virus production by iDCs. Additional experiments suggest that extracellular ATP might modulate the trafficking pathway of internalized virions within iDCs leading to an increased lysosomal degradation, which could be partly responsible for the decreased HIV-1 transmission. Conclusion These results suggest that extracellular ATP can act as a factor controlling HIV-1 propagation.

Morphogenesis of Pestiviruses: New Insights from Ultrastructural Studies of Strain Giraffe-1

Science.gov (United States)

Mast, Jan; Thiel, Heinz-Jürgen; König, Matthias

2014-01-01

Knowledge on the morphogenesis of pestiviruses is limited due to low virus production in infected cells. In order to localize virion morphogenesis and replication sites of pestiviruses and to examine intracellular virion transport, a cell culture model was established to facilitate ultrastructural studies. Based on results of virus growth kinetic analysis and quantification of viral RNA, pestivirus strain Giraffe-1 turned out to be a suitable candidate for studies on virion generation and export from culture cells. Using conventional transmission electron microscopy and single-tilt electron tomography, we found virions located predominately in the lumen of the endoplasmic reticulum (ER) in infected cells and were able to depict the budding process of virions at ER membranes. Colocalization of the viral core protein and the envelope glycoprotein E2 with the ER marker protein disulfide isomerase (PDI) was demonstrated by immunogold labeling of cryosections. Moreover, pestivirions could be shown in transport vesicles and the Golgi complex and during exocytosis. Interestingly, viral capsid protein and double-stranded RNA (dsRNA) were detected in multivesicular bodies (MVBs), which implies that the endosomal compartment plays a role in pestiviral replication. Significant cellular membrane alterations such as those described for members of the Flavivirus and Hepacivirus genera were not found. Based on the gained morphological data, we present a consistent model of pestivirus morphogenesis. PMID:24352462

Processing, fusogenicity, virion incorporation and CXCR4-binding activity of a feline immunodeficiency virus envelope glycoprotein lacking the two conserved N-glycosylation sites at the C-terminus of the V3 domain.

Science.gov (United States)

González, Silvia A; Affranchino, José L

2016-07-01

The process of feline immunodeficiency virus (FIV) entry into its target cells is initiated by the association of the surface (SU) subunit of the viral envelope glycoprotein (Env) with the cellular receptors CD134 and CXCR4. This event is followed by the fusion of the viral and cellular membranes, which is mediated by the transmembrane (TM) subunit of Env. We and others have previously demonstrated that the V3 domain of the SU subunit of Env is essential for CXCR4 binding. Of note, there are two contiguous and highly conserved potential N-glycosylation sites ((418)NST(420) and (422)NLT(424)) located at the C-terminal side of the V3 domain. We therefore decided to study the relevance for Env functions of these N-glycosylation motifs and found that disruption of both of them by introducing the N418Q/N422Q double amino acid substitution drastically impairs Env processing into the SU and TM subunits. Moreover, the simultaneous mutation of these N-glycosylation sites prevents Env incorporation into virions and Env-mediated cell-to-cell fusion. Notably, a recombinant soluble version of the SU glycoprotein carrying the double amino acid replacement N418Q/N422Q at the V3 C-terminal side binds to CXCR4 with an efficiency similar to that of wild-type SU.

Infection of epithelial cells with dengue virus promotes the expression of proteins favoring the replication of certain viral strains.

Science.gov (United States)

Martínez-Betancur, Viviana; Marín-Villa, Marcel; Martínez-Gutierrez, Marlén

2014-08-01

Dengue virus (DENV) is the causative agent of dengue and severe dengue. To understand better the dengue virus-host interaction, it is important to determine how the expression of cellular proteins is modified due to infection. Therefore, a comparison of protein expression was conducted in Vero cells infected with two different DENV strains, both serotype 2: DENV-2/NG (associated with dengue) and DENV-2/16681 (associated with severe dengue). The viability of the infected cells was determined, and neither strain induced cell death at 48 hr. In addition, the viral genomes and infectious viral particles were quantified, and the genome of the DENV-2/16681 strain was determined to have a higher replication rate compared with the DENV-2/NG strain. Finally, the proteins from infected and uninfected cultures were separated using two-dimensional gel electrophoresis, and the differentially expressed proteins were identified by mass spectrometry. Compared with the uninfected controls, the DENV-2/NG- and DENV-2/16681-infected cultures had five and six differentially expressed proteins, respectively. The most important results were observed when the infected cultures were compared to each other (DENV-2/NG vs. DENV-2/16681), and 18 differentially expressed proteins were identified. Based on their cellular functions, many of these proteins were linked to the increase in the replication efficiency of DENV. Among the proteins were calreticulin, acetyl coenzyme A, acetyl transferase, and fatty acid-binding protein. It was concluded that the infection of Vero cells with DENV-2/NG or DENV-2/16681 differentially modifies the expression of certain proteins, which can, in turn, facilitate infection. © 2013 Wiley Periodicals, Inc.

Sesamol induced apoptotic effect in lung adenocarcinoma cells through both intrinsic and extrinsic pathways.

Science.gov (United States)

Siriwarin, Boondaree; Weerapreeyakul, Natthida

2016-07-25

Sesamol is a phenolic lignan found in sesame seeds (Sesamum indicum L.) and sesame oil. The anticancer effects and molecular mechanisms underlying its apoptosis-inducing effect were investigated in human lung adenocarcinoma (SK-LU-1) cells. Sesamol inhibited SK-LU-1 cell growth with an IC50 value of 2.7 mM and exhibited less toxicity toward normal Vero cells after 48 h of treatment (Selective index = 3). Apoptotic bodies-the hallmark of apoptosis-were observed in sesamol-treated SK-LU-1 cells, stained with DAPI. Sesamol increased the activity of caspase 8, 9, and 3/7, indicating that apoptotic cell death occurred through both extrinsic and intrinsic pathways. Sesamol caused the loss of mitochondrial transmembrane potential signifying intrinsic apoptosis induction. Decreasing Bid expression revealed crosstalk between the intrinsic and extrinsic apoptotic pathways; demonstrating clearly that sesamol induces apoptosis through both pathways in human lung adenocarcinoma (SK-LU-1) cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

KSHV cell attachment sites revealed by ultra sensitive tyramide signal amplification (TSA) localize to membrane microdomains that are up-regulated on mitotic cells.

Science.gov (United States)

Garrigues, H Jacques; Rubinchikova, Yelena E; Rose, Timothy M

2014-03-01

Cell surface structures initiating attachment of Kaposi's sarcoma-associated herpesvirus (KSHV) were characterized using purified hapten-labeled virions visualized by confocal microscopy with a sensitive fluorescent enhancement using tyramide signal amplification (TSA). KSHV attachment sites were present in specific cellular domains, including actin-based filopodia, lamellipodia, ruffled membranes, microvilli and intercellular junctions. Isolated microdomains were identified on the dorsal surface, which were heterogeneous in size with a variable distribution that depended on cellular confluence and cell cycle stage. KSHV binding domains ranged from scarce on interphase cells to dense and continuous on mitotic cells, and quantitation of bound virus revealed a significant increase on mitotic compared to interphase cells. KSHV also bound to a supranuclear domain that was distinct from microdomains in confluent and interphase cells. These results suggest that rearrangement of the cellular membrane during mitosis induces changes in cell surface receptors implicated in the initial attachment stage of KSHV entry. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparison of indirect immunofluorescence and electron microscopy for the diagnosis of some haemorrhagic viruses in cell cultures.

Science.gov (United States)

El Mekki, A A; van der Groen, G

1981-09-01

Yellow fever, dengue (types 1, 2 and 4), Chikungunya, Rift Valley fever, Ebola, Marburg, and Lassa viruses were inoculated into susceptible cell cultures and daily investigated by indirect immunofluorescence (IFA) and electron microscopy (EM) with a view to achieve an early detection-identification of these agents. Compared to the other cell lines tested (Vero, BHK-21 and Aedes albopictus), CV-1 cells were found to be more sensitive. Viral antigens were detected by IFA from a few hours post inoculation (CHIK and RVF) to a maximum of 3 days (YF and EBO). For most of the viruses studied, the cytopathic effect (CPE) commenced 2-3 days after the detection of viral antigens. Virus particles were detected by EM only in the case of EBO, MBG and LAS, before any CPE was observed in cell cultures.

Demonstration of a novel HIV-1 restriction phenotype from a human T cell line.

Directory of Open Access Journals (Sweden)

Yanxing Han

2008-07-01

Full Text Available Although retroviruses may invade host cells, a productive infection can be established only after the virus counteracts inhibition from different types of host restriction factors. Fv1, APOBEC3G/F, TRIM5alpha, ZAP, and CD317 inhibit the replication of different retroviruses by interfering with viral uncoating, reverse transcription, nuclear import, RNA stability, and release. In humans, although APOBEC3G/3F and CD317 block HIV-1 replication, their antiviral activities are neutralized by viral proteins Vif and Vpu. So far, no human gene has been found to effectively block wild type HIV-1 replication under natural condition. Thus, identification of such a gene product would be of great medical importance for the development of HIV therapies.In this study, we discovered a new type of host restriction against the wild type HIV-1 from a CD4/CXCR4 double-positive human T cell line. We identified a CEM-derived cell line (CEM.NKR that is highly resistant to productive HIV-1 infection. Viral production was reduced by at least 1000-fold when compared to the other permissive human T cell lines such as H9, A3.01, and CEM-T4. Importantly, this resistance was evident at extremely high multiplicity of infection. Further analyses demonstrated that HIV-1 could finish the first round of replication in CEM.NKR cells, but the released virions were poorly infectious. These virions could enter the target cells, but failed to initiate reverse transcription. Notably, this restriction phenotype was also present in CEM.NKR and 293T heterokaryons.These results clearly indicate that CEM.NKR cells express a HIV inhibitory gene(s. Further characterization of this novel gene product(s will reveal a new antiretroviral mechanism that directly inactivates wild type HIV-1.

Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

Science.gov (United States)

Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

2017-08-15

Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

Measles virus C protein suppresses gamma-activated factor formation and virus-induced cell growth arrest

International Nuclear Information System (INIS)

Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro

2011-01-01

Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression of C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-γ signaling pathway via inhibition of phosphorylated STAT1 dimerization.

Two potential recombinant rabies vaccines expressing canine parvovirus virion protein 2 induce immunogenicity to canine parvovirus and rabies virus.

Science.gov (United States)

Luo, Jun; Shi, Hehe; Tan, Yeping; Niu, Xuefeng; Long, Teng; Zhao, Jing; Tian, Qin; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-08-17

Both rabies virus (RABV) and canine parvovirus (CPV) cause lethal diseases in dogs. In this study, both high egg passage Flury (HEP-Flury) strains of RABV and recombinant RABV carrying double RABV glycoprotein (G) gene were used to express the CPV virion protein 2 (VP2) gene, and were designated rHEP-VP2 and, rHEP-dG-VP2 respectively. The two recombinant RABVs maintained optimal virus titration according to their viral growth kinetics assay compared with the parental strain HEP-Flury. Western blotting indicated that G protein and VP2 were expressed in vitro. The expression of VP2 in Crandell feline kidney cells post-infection by rHEP-VP2 and rHEP-dG-VP2 was confirmed by indirect immunofluorescence assay with antibody against VP2. Immunogenicity of recombinant rabies viruses was tested in Kunming mice. Both rHEP-VP2 and rHEP-dG-VP2 induced high levels of rabies antibody compared with HEP-Flury. Mice immunized with rHEP-VP2 and rHEP-dG-VP2 both had a high level of antibodies against VP2, which can protect against CPV infection. A challenge experiment indicated that more than 80% mice immunized with recombinant RABVs survived after infection of challenge virus standard 24 (CVS-24). Together, this study showed that recombinant RABVs expressing VP2 induced protective immune responses to RABV and CPV. Therefore, rHEP-VP2 and rHEP-dG-VP2 might be potential combined vaccines for RABV and CPV. Copyright © 2016 Elsevier Ltd. All rights reserved.

Role of Gag and lipids during HIV-1 assembly in CD4 T cells and Macrophages

Directory of Open Access Journals (Sweden)

Charlotte eMariani

2014-06-01

Full Text Available HIV-1 is an RNA enveloped virus that preferentiallyinfects CD4+ T lymphocytes andalso macrophages. In CD4+ T cells, HIV-1mainly buds from the host cell plasma membrane.The viral Gag polyprotein targets theplasma membrane and is the orchestrator ofthe HIV assembly as its expression is sufficientto promote the formation of virus-likeparticles particles carrying a lipidic envelopederiving from the host cell membrane. Certainlipids are enriched in the viral membraneand are thought to play a key role in theassembly process and the envelop composition.A large body of work performed oninfected CD4+ T cells has provided importantknowledge about the assembly process andthe membrane virus lipid composition. WhileHIV assembly and budding in macrophages isthought to follow the same general Gag-drivenmechanism as in T-lymphocytes, the HIV cyclein macrophage exhibits specific features.In these cells, new virions bud from the limitingmembrane of seemingly intracellular compartments,where they accumulate while remaininginfectious. These structures are now oftenreferred to as Virus Containing Compartments(VCCs. Recent studies suggest that VCCsrepresent intracellularly sequestered regionsof the plasma membrane, but their precisenature remains elusive. The proteomic andlipidomic characterization of virions producedby T cells or macrophages has highlightedthe similarity between their composition andthat of the plasma membrane of producercells, as well as their enrichment in acidiclipids, some components of raft lipids andin tetraspanin-enriched microdomains. Greatchances are that Gag promotes the coalescenceof these components into an assemblyplatform from which viral budding takesplace. How Gag exactly interacts with membranelipids and what are the mechanisms involvedin the interaction between the differentmembrane nanodomains within the assemblyplatform remains unclear. Here we review recentliterature regarding the role of Gag andlipids

Agnoprotein Is an Essential Egress Factor during BK Polyomavirus Infection

Directory of Open Access Journals (Sweden)

Margarita-Maria Panou

2018-03-01

Full Text Available BK polyomavirus (BKPyV; hereafter referred to as BK causes a lifelong chronic infection and is associated with debilitating disease in kidney transplant recipients. Despite its importance, aspects of the virus life cycle remain poorly understood. In addition to the structural proteins, the late region of the BK genome encodes for an auxiliary protein called agnoprotein. Studies on other polyomavirus agnoproteins have suggested that the protein may contribute to virion infectivity. Here, we demonstrate an essential role for agnoprotein in BK virus release. Viruses lacking agnoprotein fail to release from host cells and do not propagate to wild-type levels. Despite this, agnoprotein is not essential for virion infectivity or morphogenesis. Instead, agnoprotein expression correlates with nuclear egress of BK virions. We demonstrate that the agnoprotein binding partner α-soluble N-ethylmaleimide sensitive fusion (NSF attachment protein (α-SNAP is necessary for BK virion release, and siRNA knockdown of α-SNAP prevents nuclear release of wild-type BK virions. These data highlight a novel role for agnoprotein and begin to reveal the mechanism by which polyomaviruses leave an infected cell.

Live Cell Imaging of Alphaherpes Virus Anterograde Transport and Spread

Science.gov (United States)

Taylor, Matthew P.; Kratchmarov, Radomir; Enquist, Lynn W.

2013-01-01

Advances in live cell fluorescence microscopy techniques, as well as the construction of recombinant viral strains that express fluorescent fusion proteins have enabled real-time visualization of transport and spread of alphaherpes virus infection of neurons. The utility of novel fluorescent fusion proteins to viral membrane, tegument, and capsids, in conjunction with live cell imaging, identified viral particle assemblies undergoing transport within axons. Similar tools have been successfully employed for analyses of cell-cell spread of viral particles to quantify the number and diversity of virions transmitted between cells. Importantly, the techniques of live cell imaging of anterograde transport and spread produce a wealth of information including particle transport velocities, distributions of particles, and temporal analyses of protein localization. Alongside classical viral genetic techniques, these methodologies have provided critical insights into important mechanistic questions. In this article we describe in detail the imaging methods that were developed to answer basic questions of alphaherpes virus transport and spread. PMID:23978901

Characterization of a 105-kDa plasma membrane associated glycoprotein that is involved in West Nile virus binding and infection

International Nuclear Information System (INIS)

Chu, J.J.H.; Ng, M.L.

2003-01-01

This study attempts to isolate and characterize West Nile virus-binding molecules on the plasma membrane of Vero and murine neuroblastoma cells that is responsible for virus entry. Pretreatment of Vero cells with proteases, glycosidases (endoglycosidase H, α-mannosidase), and sodium periodate strongly inhibited West Nile virus infection, whereas treatments with phospholipases and heparinases had no effect. The virus overlay protein blot detected a 105-kDa molecule on the plasma membrane extract of Vero and murine neuroblastoma cells that bind to WN virus. Treatment of the 105-kDa molecules with β-mercaptoethanol resulted in the virus binding to a series of lower molecular weight bands ranging from 30 to 40 kDa. The disruption of disulfide-linked subunits did not affect virus binding. N-linked sugars with mannose residues on the 105-kDa membrane proteins were found to be important in virus binding. Specific antibodies against the 105-kDa glycoprotein were highly effective in blocking virus entry. These results strongly supported the possibility that the 105-kDa protease-sensitive glycoprotein with complex N-linked sugars could be the putative receptor for WN virus

CARACTERIZAÇÃO E AVALIAÇÃO IN VITRO DE NANOCOMPÓSITOS DE POLI (L-ÁCIDO LÁTICO E NANOTUBOS DE CARBONO DE PAREDES MÚLTIPLAS PURIFICADOS

Directory of Open Access Journals (Sweden)

Claudenete Vieira Leal

2015-11-01

Full Text Available Carbon nanotubes (CNT have been studied for biomedical applications due to their unique properties. However, pristine CNT have structural features and impurities that can cause toxicity to biological systems. In this work, we describe a method to purify multiwalled carbon nanotubes (MWCNT by chemical modification and subsequent attachment of hydroxyl and carboxyl groups to improve dispersion and to decrease toxic effects. Nanocomposites from poly (L-lactic acid (PLLA and nanotubes were produced by the solvent casting method and characterized and evaluated for cytocompatibility with Vero cells. The nanocomposite interactions with Vero cells demonstrated that the cells were able to adhere and sustain proliferation and showed favorable cytocompatibility. In vitro studies also revealed an increase in fibroblast cell viability in the nanocomposites, compared with neat PLLA.

A bursal pentapeptide (BPP-I), a novel bursal-derived peptide, exhibits antiproliferation of tumor cell and immunomodulator activity.

Science.gov (United States)

Feng, Xiu L; Liu, Qing T; Cao, Rui B; Zhou, Bin; Wang, Fang Q; Deng, Wen L; Qiu, Ya F; Zhang, Yu; Ishag, Hassan; Ma, Zhi Y; Zheng, Qi S; Chen, Pu Y

2012-06-01

The bursa of Fabricius (BF) is the central humoral immune organ unique to birds. Here, we isolated a novel bursal pentapeptide I (BPP-I), LGPGP, from BF. BPP-I could play inhibition effect on MCF-7 but not on CEF or Vero cell proliferation in vitro, and enhance antitumor factor p53 protein expression. Also, BPP-I stimulated antibody production in a dose-dependent manner in hybridoma cell. Furthermore, BPP-I could induce various immune responses in mice immunization experiments, including increase antibody production and cytokines IL-4 and IFN-γ level, and induce T-cell immunophenotyping. These results suggest that BPP-I is a potential immunomodulator of antitumor and immunity. The study could provide some novel insights on the probable candidate reagent for the antitumor and immune improvement.

Double-labelled HIV-1 particles for study of virus-cell interaction

International Nuclear Information System (INIS)

Lampe, Marko; Briggs, John A.G.; Endress, Thomas; Glass, Baerbel; Riegelsberger, Stefan; Kraeusslich, Hans-Georg; Lamb, Don C.; Braeuchle, Christoph; Mueller, Barbara

2007-01-01

Human immunodeficiency virus (HIV) delivers its genome to a host cell through fusion of the viral envelope with a cellular membrane. While the viral and cellular proteins involved in entry have been analyzed in detail, the dynamics of virus-cell fusion are largely unknown. Single virus tracing (SVT) provides the unique opportunity to visualize viral particles in real time allowing direct observation of the dynamics of this stochastic process. For this purpose, we developed a double-coloured HIV derivative carrying a green fluorescent label attached to the viral matrix protein combined with a red label fused to the viral Vpr protein designed to distinguish between complete virions and subviral particles lacking MA after membrane fusion. We present here a detailed characterization of this novel tool together with exemplary live cell imaging studies, demonstrating its suitability for real-time analyses of HIV-cell interaction

Potensi Kurkumin dan Pentagamavunon-0 sebagai Anti Viral Dengue - 2

Directory of Open Access Journals (Sweden)

Dewi Marbawati

2015-07-01

Full Text Available AbstractMore than 40% of the world's population who live in tropical and subtropical regions at risk for dengue infection. Specific and effective antiviral therapies to treat dengue infection has not been found yet. Many researches proved that curcumin has preventive activity againts viruses, such as vasicular stomatis (VSV, HSV 1 and 2, parainfluenza-3, reovirus-1, feline corona virus, feline herpes virus. Curcumin also known to perform the inhibition of ubiquitin - proteasome system that decreasethe production of Japanese encephalitis in neuroblastoma cells. Pentagamavunon-0 (PGV-0 is expected to have better activity than curcumin. This study aims to determine the cytotoxic effect andthe potential of curcumin and PGV-0 as antiviral Dengue-2 on vero cells. Including experimental study. Cytotoxic test performed to obtain a safe concentration of curcumin and PGV-0 on vero cells followed by antiviral test using immunocytochemistry SBPC (Streptavidin Biotin Peroxidase Complex. The results showed that the safe concentrations for curcumin is 6.25 ppm and PGV-0 is 1.5625 ppm based on cytotoxic test to vero cell. The positive rate from Immunocytochemistry test showed that no significant difference between curcumin and PGV-0 treatment. However, when compared with the positive control results are significantly different. We concluded both curcumin and PGV-0 can reduce the positive rate caused Dengue-2 infection at one day incubation.Keywords : Dengue-2, curcumin, pentagamavunon-0 (PGV-0, ImmunocytochemistryAbstrakLebih dari 40 % populasi dunia yang tinggal di daerah tropis dan subtropis mempunyai risiko untuk terjangkit infeksi Dengue. Terapi yang spesifik dan efektif untuk mengobati infeksi Dengue belum ditemukan. Kurkumin terbukti memiliki aktivitas preventif terhadap beberapa virus, antara lain:vasicular stomatis (VSV, HSV 1 dan 2, parainfluenza-3, reovirus-1, feline corona virus, feline herpes virus. Kurkumin juga diketahui mampu melakukan

In vitro cytotoxic activity of medicinal plants from Nigeria ethnomedicine on Rhabdomyosarcoma cancer cell line and HPLC analysis of active extracts.

Science.gov (United States)

Ogbole, Omonike O; Segun, Peter A; Adeniji, Adekunle J

2017-11-22

Cancer is a leading cause of death world-wide, with approximately 17.5 million new cases and 8.7 million cancer related deaths in 2015. The problems of poor selectivity and severe side effects of the available anticancer drugs, have demanded the need for the development of safer and more effective chemotherapeutic agents. The present study was aimed at determining the cytotoxicities of 31 medicinal plants extracts, used in Nigerian ethnomedicine for the treatment of cancer. The plant extracts were screened for cytotoxicity, using the brine shrimp lethality assay (BSLA) and MTT cytotoxicity assay. Rhabdomyosarcoma (RD) cell line, normal Vero cell line and the normal prostate (PNT2) cell line were used for the MTT assay, while Artemia salina nauplii was used for the BSLA. The phytochemical composition of the active plant extracts was determined by high performance liquid chromatography (HPLC) analysis. The extract of Eluesine indica (L.) Gaertn (Poaceae), with a LC 50 value of 76.3 μg/mL, had the highest cytotoxicity on the brine shrimp larvae compared to cyclophosphamide (LC 50  = 101.3 μg/mL). Two plants extracts, Macaranga barteri Mull. Arg. (Euphorbiaceae) and Calliandra portoricensis (Jacq.) Benth (Leguminosae) exhibited significant cytotoxic activity against the RD cell line and had comparable lethal activity on the brine shrimps. Further cytotoxic investigation showed that the dichloromethane fraction of Macaranga barteri (DMB) and the ethyl acetate fraction of Calliandra portoricensis (ECP), exhibited approximately 6-fold and 4-fold activity, respectively, compared to cyclophosphamide on RD cell line. Determination of selective index (SI) using Vero and PNT2 cell line indicated that DMB and ECP displayed a high degree of selectivity against the cancer cell under investigation. HPLC analysis showed that 3,5dicaffeoylquinic acid, acteoside, kampferol-7-O-glucoside and bastadin 11 were the major components of DMB while the major components of ECP were

The complex subcellular distribution of satellite panicum mosaic virus capsid protein reflects its multifunctional role during infection

International Nuclear Information System (INIS)

Qi Dong; Omarov, Rustem T.; Scholthof, Karen-Beth G.

2008-01-01

Satellite panicum mosaic virus (SPMV) depends on its helper Panicum mosaic virus for replication and movement in host plants. The positive-sense single-stranded genomic RNA of SPMV encodes a 17-kDa capsid protein (CP) to form 16-nm virions. We determined that SPMV CP accumulates in both cytosolic and non-cytosolic fractions, but cytosolic accumulation of SPMV CP is exclusively associated with virions. An N-terminal arginine-rich motif (N-ARM) on SPMV CP is used to bind its cognate RNA and to form virus particles. Intriguingly, virion formation is dispensable for successful systemic SPMV RNA accumulation, yet this process still depends on an intact N-ARM. In addition, a C-terminal domain on the SPMV CP is necessary for self-interaction. Biochemical fractionation and fluorescent microscopy of green fluorescent protein-tagged SPMV CP demonstrated that the non-cytosolic SPMV CP is associated with the cell wall, the nucleus and other membranous organelles. To our knowledge, this is the first report that a satellite virus CP not only accumulates exclusively as virions in the cytosol but also is directed to the nucleolus and membranes. That SPMV CP is found both in the nucleus and the cell wall suggests its involvement in viral nuclear import and cell-to-cell transport

A flavonoid isolated from Streptomyces sp. (ERINLG-4) induces apoptosis in human lung cancer A549 cells through p53 and cytochrome c release caspase dependant pathway.

Science.gov (United States)

Balachandran, C; Sangeetha, B; Duraipandiyan, V; Raj, M Karunai; Ignacimuthu, S; Al-Dhabi, N A; Balakrishna, K; Parthasarathy, K; Arulmozhi, N M; Arasu, M Valan

2014-12-05

The aim of this study was to investigate the anticancer activity of a flavonoid type of compound isolated from soil derived filamentous bacterium Streptomyces sp. (ERINLG-4) and to explore the molecular mechanisms of action. Cytotoxic properties of ethyl acetate extract was carried out against A549 lung cancer cell line using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Cytotoxic properties of isolated compound were investigated in A549 lung cancer cell line, COLO320DM cancer cell line and Vero cells. The compound showed potent cytotoxic properties against A549 lung cancer cell line and moderate cytotoxic properties against COLO320DM cancer cell line. Isolated compound showed no toxicity up to 2000 μg/mL in Vero cells. So we have chosen the A549 lung cancer cell line for further anticancer studies. Intracellular visualization was done by using a laser scanning confocal microscope. Apoptosis was measured using DNA fragmentation technique. Treatment of the A549 cancer cells with isolated compound significantly reduced cell proliferation, increased formation of fragmented DNA and apoptotic body. Activation of caspase-9 and caspase-3 indicated that compound may be inducing intrinsic and extrinsic apoptosis pathways. Bcl-2, p53, pro-caspases, caspase-3, caspase-9 and cytochrome c release were detected by western blotting analysis after compound treatment (123 and 164 μM). The activities of pro-caspases-3, caspase-9 cleaved to caspase-3 and caspase-9 gradually increased after the addition of isolated compound. But Bcl-2 protein was down regulated after treatment with isolated compound. Molecular docking studies showed that the compound bound stably to the active sites of caspase-3 and caspase-9. These results strongly suggest that the isolated compound induces apoptosis in A549 cancer cells via caspase activation through cytochrome c release from mitochondria. The present results might provide helpful suggestions for the design of

Mechanism of lymphocytic choriomeningitis virus entry into cells.

Science.gov (United States)

Borrow, P; Oldstone, M B

1994-01-01

The path that the arenavirus lymphocytic choriomeningitis virus (LCMV) uses to enter rodent fibroblastic cell lines was dissected by infectivity and inhibition studies and immunoelectron microscopy. Lysosomotropic weak bases (chloroquine and ammonium chloride) and carboxylic ionophores (monensin and nigericin) inhibited virus entry, assessed as virus nucleoprotein expression at early times post-infection, indicating that the entry process involved a pH-dependent fusion step in intracellular vesicles. That entry occurred in vesicles rather than by direct fusion of virions with the plasma membrane was confirmed by immunoelectron microscopy. The vesicles involved were large (150-300 nm diameter), smooth-walled, and not associated with clathrin. Unlike classical phagocytosis, virus uptake in these vesicles was a microfilament-independent process, as it was not blocked by cytochalasins. LCMV entry into rodent fibroblast cell lines thus involves viropexis in large smooth-walled vesicles, followed by a pH-dependent fusion event inside the cell.

A low-cost method to test cytotoxic effects of Crotalus vegrandis (Serpentes: Viperidae venom on kidney cell cultures Un método de bajo costo para probar los efectos citotóxicos del veneno de Crotalus vegrandis (Serpentes: Viperidae en cultivos de células renales

Directory of Open Access Journals (Sweden)

María E. Girón

2005-06-01

Full Text Available The pathogenesis of the renal lesion upon envenomation by snakebite has been related to myolysis, hemolysis, hypotension and/or direct venom nephrotoxicity caused by the venom. Both primary and continuous cell culture systems provide an in vitro alternative for quantitative evaluation of the toxicity of snake venoms. Crude Crotalus vegrandis venom was fractionated by molecular exclusion chromatography. The toxicity of C. vegrandis crude venom, hemorrhagic, and neurotoxic fractions were evaluated on mouse primary renal cells and a continuous cell line of Vero cells maintained in vitro. Cells were isolated from murine renal cortex and were grown in 96 well plates with Dulbecco's Modified Essential Medium (DMEM and challenged with crude and venom fractions. The murine renal cortex cells exhibited epithelial morphology and the majority showed smooth muscle actin determined by immune-staining. The cytotoxicity was evaluated by the tetrazolium colorimetric method. Cell viability was less for crude venom, followed by the hemorrhagic and neurotoxic fractions with a CT50 of 4.93, 18.41 and 50.22 µg/mL, respectively. The Vero cell cultures seemed to be more sensitive with a CT50 of 2.9 and 1.4 µg/mL for crude venom and the hemorrhagic peak, respectively. The results of this study show the potential of using cell culture system to evaluate venom toxicity.La patogénesis de la lesion renal ha sido relacionada a la miolisis, hemólisis, hipotensión y/o el efecto directo del veneno. Tanto el cultivo primario o el cultivo celular continuo proveen una alternativa in vitro para la evaluación cuantitativa de la toxicidad de venenos de serpiente. El veneno crudo de Crotalus vegrandis fue fraccionado por una cromatografía de exclusión molecular. La toxicidad del veneno crudo de C. vegrandis, sus fracciones hemorrágicas y neurotóxicas fueron evaluadas en células renales primarias de ratón y una línea continua de células Vero mantenidas in vitro. Las c

Effect of ultrasound on herpes simplex virus infection in cell culture

Directory of Open Access Journals (Sweden)

Iwai Soichi

2011-09-01

Full Text Available Abstract Background Ultrasound has been shown to increase the efficiency of gene expression from retroviruses, adenoviruses and adeno-associated viruses. The effect of ultrasound to stimulate cell membrane permeabilization on infection with an oncolytic herpes simplex virus type 1 (HSV-1 was examined. Results Vero monkey kidney cells were infected with HSV-1 and exposed to 1 MHz ultrasound after an adsorption period. The number of plaques was significantly greater than that of the untreated control. A combination of ultrasound and microbubbles further increased the plaque number. Similar results were obtained using a different type of HSV-1 and oral squamous cell carcinoma (SCC cells. The appropriate intensity, duty cycle and time of ultrasound to increase the plaque number were 0.5 W/cm2, 20% duty cycle and 10 sec, respectively. Ultrasound with microbubbles at an intensity of 2.0 W/cm2, at 50% duty cycle, or for 40 sec reduced cell viability. Conclusion These results indicate that ultrasound promotes the entry of oncolytic HSV-1 into cells. It may be useful to enhance the efficiency of HSV-1 infection in oncolytic virotherapy.

Molecular characterization of canine distemper vi- rus circulating in ...

African Journals Online (AJOL)

2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

Detergent-Resistant Membrane Microdomains Facilitate Ib Oligomer Formation and Biological Activity of Clostridium perfringens Iota-Toxin

National Research Council Canada - National Science Library

Hale, Martha

2004-01-01

...) were extracted with cold Triton X-100. Western blotting revealed that Ib oligomers localized in DRMs extracted from Vero, but not MRC-5, cells while monomeric Ib was detected in the detergent-soluble fractions of both cell types...

Palmitoylation of the feline immunodeficiency virus envelope glycoprotein and its effect on fusion activity and envelope incorporation into virions

Energy Technology Data Exchange (ETDEWEB)

Gonzalez, Silvia A.; Paladino, Monica G. [Laboratorio de Virologia, CONICET-Universidad de Belgrano (UB), Villanueva 1324 (C1426BMJ), Buenos Aires (Argentina); Affranchino, Jose L., E-mail: jose.affranchino@comunidad.ub.edu.ar [Laboratorio de Virologia, CONICET-Universidad de Belgrano (UB), Villanueva 1324 (C1426BMJ), Buenos Aires (Argentina)

2012-06-20

The feline immunodeficiency virus (FIV) envelope glycoprotein (Env) possesses a short cytoplasmic domain of 53 amino acids containing four highly conserved cysteines at Env positions 804, 811, 815 and 848. Since palmitoylation of transmembrane proteins occurs at or near the membrane anchor, we investigated whether cysteines 804, 811 and 815 are acylated and analyzed the relevance of these residues for Env functions. Replacement of cysteines 804, 811 and 815 individually or in combination by serine residues resulted in Env glycoproteins that were efficiently expressed and processed. However, mutations C804S and C811S reduced Env fusogenicity by 93% and 84%, respectively, compared with wild-type Env. By contrast, mutant C815S exhibited a fusogenic capacity representing 50% of the wild-type value. Remarkably, the double mutation C804S/C811S abrogated both Env fusion activity and Env incorporation into virions. Finally, by means of Click chemistry assays we demonstrated that the four FIV Env cytoplasmic cysteines are palmitoylated.

Palmitoylation of the feline immunodeficiency virus envelope glycoprotein and its effect on fusion activity and envelope incorporation into virions

International Nuclear Information System (INIS)

González, Silvia A.; Paladino, Mónica G.; Affranchino, José L.

2012-01-01

The feline immunodeficiency virus (FIV) envelope glycoprotein (Env) possesses a short cytoplasmic domain of 53 amino acids containing four highly conserved cysteines at Env positions 804, 811, 815 and 848. Since palmitoylation of transmembrane proteins occurs at or near the membrane anchor, we investigated whether cysteines 804, 811 and 815 are acylated and analyzed the relevance of these residues for Env functions. Replacement of cysteines 804, 811 and 815 individually or in combination by serine residues resulted in Env glycoproteins that were efficiently expressed and processed. However, mutations C804S and C811S reduced Env fusogenicity by 93% and 84%, respectively, compared with wild-type Env. By contrast, mutant C815S exhibited a fusogenic capacity representing 50% of the wild-type value. Remarkably, the double mutation C804S/C811S abrogated both Env fusion activity and Env incorporation into virions. Finally, by means of Click chemistry assays we demonstrated that the four FIV Env cytoplasmic cysteines are palmitoylated.

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Science.gov (United States)

Alvarez, Rene; Seal, Bruce S

2005-01-01

Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Directory of Open Access Journals (Sweden)

Alvarez Rene

2005-04-01

Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

Structure-Based Mutagenesis of Sulfolobus Turreted Icosahedral Virus B204 Reveals Essential Residues in the Virion-Associated DNA-Packaging ATPase.

Science.gov (United States)

Dellas, Nikki; Snyder, Jamie C; Dills, Michael; Nicolay, Sheena J; Kerchner, Keshia M; Brumfield, Susan K; Lawrence, C Martin; Young, Mark J

2015-12-23

the virion during infection. The experiments described here highlight the elements of this enzyme that are essential for proper function and also provide supporting evidence that B204 is present in the mature STIV virion. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Herpes Simplex Virus 1 Us3 Deletion Mutant is Infective Despite Impaired Capsid Translocation to the Cytoplasm

Directory of Open Access Journals (Sweden)

Peter Wild

2015-01-01

Full Text Available Herpes simplex virus 1 (HSV-1 capsids are assembled in the nucleus bud at the inner nuclear membrane into the perinuclear space, acquiring envelope and tegument. In theory, these virions are de-enveloped by fusion of the envelope with the outer nuclear membrane and re-enveloped by Golgi membranes to become infective. Us3 enables the nucleus to cytoplasm capsid translocation. Nevertheless, Us3 is not essential for the production of infective progeny viruses. Determination of phenotype distribution by quantitative electron microscopy, and calculation per mean nuclear or cell volume revealed the following: (i The number of R7041(∆US3 capsids budding at the inner nuclear membrane was significantly higher than that of wild type HSV-1; (ii The mean number of R7041(∆US3 virions per mean cell volume was 2726, that of HSV-1 virions 1460 by 24 h post inoculation; (iii 98% of R7041(∆US3 virions were in the perinuclear space; (iv The number of R7041(∆US3 capsids in the cytoplasm, including those budding at Golgi membranes, was significantly reduced. Cell associated R7041(∆US3 yields were 2.37 × 108 and HSV-1 yields 1.57 × 108 PFU/mL by 24 h post inoculation. We thus conclude that R7041(∆US3 virions, which acquire envelope and tegument by budding at the inner nuclear membrane into the perinuclear space, are infective.

A SNAP-tagged derivative of HIV-1--a versatile tool to study virus-cell interactions.

Directory of Open Access Journals (Sweden)

Manon Eckhardt

Full Text Available Fluorescently labeled human immunodeficiency virus (HIV derivatives, combined with the use of advanced fluorescence microscopy techniques, allow the direct visualization of dynamic events and individual steps in the viral life cycle. HIV proteins tagged with fluorescent proteins (FPs have been successfully used for live-cell imaging analyses of HIV-cell interactions. However, FPs display limitations with respect to their physicochemical properties, and their maturation kinetics. Furthermore, several independent FP-tagged constructs have to be cloned and characterized in order to obtain spectral variations suitable for multi-color imaging setups. In contrast, the so-called SNAP-tag represents a genetically encoded non-fluorescent tag which mediates specific covalent coupling to fluorescent substrate molecules in a self-labeling reaction. Fusion of the SNAP-tag to the protein of interest allows specific labeling of the fusion protein with a variety of synthetic dyes, thereby offering enhanced flexibility for fluorescence imaging approaches.Here we describe the construction and characterization of the HIV derivative HIV(SNAP, which carries the SNAP-tag as an additional domain within the viral structural polyprotein Gag. Introduction of the tag close to the C-terminus of the matrix domain of Gag did not interfere with particle assembly, release or proteolytic virus maturation. The modified virions were infectious and could be propagated in tissue culture, albeit with reduced replication capacity. Insertion of the SNAP domain within Gag allowed specific staining of the viral polyprotein in the context of virus producing cells using a SNAP reactive dye as well as the visualization of individual virions and viral budding sites by stochastic optical reconstruction microscopy. Thus, HIV(SNAP represents a versatile tool which expands the possibilities for the analysis of HIV-cell interactions using live cell imaging and sub-diffraction fluorescence

Production of high titer attenuated poliovirus strains on the serum-free PER.C6(®) cell culture platform for the generation of safe and affordable next generation IPV.

Science.gov (United States)

Sanders, Barbara P; Oakes, Isabel de los Rios; van Hoek, Vladimir; Liu, Ying; Marissen, Wilfred; Minor, Philip D; Wimmer, Eckard; Schuitemaker, Hanneke; Custers, Jerome H H V; Macadam, Andrew; Cello, Jeronimo; Edo-Matas, Diana

2015-11-27

As poliovirus eradication draws closer, alternative Inactivated Poliovirus Vaccines (IPV) are needed to overcome the risks associated with continued use of the Oral Poliovirus Vaccine and of neurovirulent strains used during manufacture of conventional (c) IPV. We have previously demonstrated the susceptibility of the PER.C6(®) cell line to cIPV strains; here we investigated the suspension cell culture platform for growth of attenuated poliovirus strains. We examined attenuated Sabin strain productivity on the PER.C6(®) cell platform compared to the conventional Vero cell platform. The suitability of the suspension cell platform for propagation of rationally-attenuated poliovirus strains (stabilized Sabin type 3 S19 derivatives and genetically attenuated and stabilized MonoCre(X) strains), was also assessed. Yields were quantified by infectious titer determination and D-antigen ELISA using either serotype-specific polyclonal rabbit sera for Sabin strains or monoclonal cIPV-strain-specific antibodies for cIPV, S19 and MonoCre(X) strains. PER.C6(®) cells supported the replication of Sabin strains to yields of infectious titers that were in the range of cIPV strains at 32.5°C. Sabin strains achieved 30-fold higher yields (pSabin strain productivity on the PER.C6(®) cell platform was maintained at 10l scale. Yields of infectious titers of S19 and MonoCre(X) strains were 0.5-1 log10 lower than seen for cIPV strains, whereas D-antigen yield and productivities in doses/ml using rationally-attenuated strains were in line with yields reported for cIPV strains. Sabin and rationally-attenuated polioviruses can be grown to high infectious titers and D-antigen yields. Sabin strain infection shows increased productivity on the PER.C6(®) cell platform as compared to the conventional Vero cell platform. Novel cell platforms with the potential for higher yields could contribute to increased affordability of a next generation of IPV vaccines needed for achieving and

Development of an Immunoperoxidase Monolayer Assay for the Detection of Antibodies against Peste des Petits Ruminants Virus Based on BHK-21 Cell Line Stably Expressing the Goat Signaling Lymphocyte Activation Molecule.

Directory of Open Access Journals (Sweden)

Jialin Zhang

Full Text Available From 2013 to 2015, peste des petits ruminants (PPR broke out in more than half of the provinces of China; thus, the application and development of diagnostic methods are very important for the control of PPR. Here, an immunoperoxidase monolayer assay (IPMA was developed to detect antibodies against PPR. However, during IPMA development, we found that Vero cells were not the appropriate choice because staining results were not easily observed. Therefore, we first established a baby hamster kidney-goat signaling lymphocyte activation molecule (BHK-SLAM cell line that could stably express goat SLAM for at least 20 generations. Compared with Vero cells, the PPR-mediated cytopathic effect occurred earlier in BHK-SLAM cells, and large syncytia appeared after virus infection. Based on this cell line and recombinant PPR virus expressing the green fluorescent protein (GFP (rPPRV-GFP, an IPMA for PPR diagnosis was developed. One hundred and ninety-eight PPR serum samples from goats or sheep were tested by the IPMA and virus neutralization test (VNT. Compared with the VNT, the sensitivity and specificity of the IPMA were 91% and 100%, respectively, and the coincidence rate of the two methods was 95.5%. The IPMA assay could be completed in 4 h, compared with more than 6 d for the VNT using rPPRV-GFP, and it is easily performed, as the staining results can be observed under a microscope. Additionally, unlike the VNT, the IPMA does not require antigen purification, which will reduce its cost. In conclusion, the established IPMA will be an alternative method that replaces the VNT for detecting antibodies against PPRV in the field.

Prediction of anticancer peptides against MCF-7 breast cancer cells from the peptidomes of Achatina fulica mucus fractions.

Science.gov (United States)

E-Kobon, Teerasak; Thongararm, Pennapa; Roytrakul, Sittiruk; Meesuk, Ladda; Chumnanpuen, Pramote

2016-01-01

Several reports have shown antimicrobial and anticancer activities of mucous glycoproteins extracted from the giant African snail Achatina fulica. Anticancer properties of the snail mucous peptides remain incompletely revealed. The aim of this study was to predict anticancer peptides from A. fulica mucus. Two of HPLC-separated mucous fractions (F2 and F5) showed in vitro cytotoxicity against the breast cancer cell line (MCF-7) and normal epithelium cell line (Vero). According to the mass spectrometric analysis, 404 and 424 peptides from the F2 and F5 fractions were identified. Our comprehensive bioinformatics workflow predicted 16 putative cationic and amphipathic anticancer peptides with diverse structures from these two peptidome data. These peptides would be promising molecules for new anti-breast cancer drug development.

Differences in Env and Gag protein expression patterns and epitope availability in feline immunodeficiency virus infected PBMC compared to infected and transfected feline model cell lines.

Science.gov (United States)

Roukaerts, Inge D M; Grant, Chris K; Theuns, Sebastiaan; Christiaens, Isaura; Acar, Delphine D; Van Bockstael, Sebastiaan; Desmarets, Lowiese M B; Nauwynck, Hans J

2017-01-02

Env and Gag are key components of the FIV virion that are targeted to the plasma membrane for virion assembly. They are both important stimulators and targets of anti-FIV immunity. To investigate and compare the expression pattern and antigenic changes of Gag and Env in various research models, infected PBMC (the natural FIV host cells) and GFox, and transfected CrFK were stained over time with various Env and Gag specific MAbs. In FIV infected GFox and PBMC, Env showed changes in epitope availability for antibody binding during processing and trafficking, which was not seen in transfected CrFK. Interestingly, epitopes exposed on intracellular Env and Env present on the plasma membrane of CrFK and GFox seem to be hidden on plasma membrane expressed Env of FIV infected PBMC. A kinetic follow up of Gag and Env expression showed a polarization of both Gag and Env expression to specific sites at the plasma membrane of PBMC, but not in other cell lines. In conclusion, mature trimeric cell surface expressed Env might be antigenically distinct from intracellular monomeric Env in PBMC and might possibly be unrecognizable by feline humoral immunity. In addition, Env expression is restricted to a small area on the plasma membrane and co-localizes with a large moiety of Gag, which may represent a preferred FIV budding site, or initiation of virological synapses with direct cell-to-cell virus transmission. Copyright © 2016. Published by Elsevier B.V.

Actividad contra Trypanosoma cruzi, Leishmania chagasi y células de mamífero de nuevas N-bencil (2-furilmetil cinamamidas Activity against Trypanosoma cruzi, Leishmania chagasi and mammalian cells of new N-benzyl (2-furylmethyl cinnamamides

Directory of Open Access Journals (Sweden)

Sandra Milena Leal Pinto

2009-12-01

Full Text Available Introducción: La quimioterapia contra la leishmaniasis y la enfermedad de Chagas es inefectiva, condición que agrava el problema de salud pública que estas enfermedades tropicales representan. Objetivo: Determinar la actividad de nuevas N-bencil (2-furilmetil cinamamidas en las formas libres e intracelulares de Leismania chagasi y Trypanosoma cruzi y en células Vero y THP-1. Materiales y métodos: Los parásitos y las células fueron tratados con diferentes concentraciones de los compuestos y su actividad fue determinada microscópicamente y por la prueba colorimétrica de MTT en el caso de los parásitos y células de mamífero, respectivamente. Los resultados de actividad fueron expresados como la concentración que inhibe o destruye 50% o 90% de los parásitos o células. Resultados: Las N-arilalquilamidas 1, 2 y 5 fueron activos en epimastigotes de T. cruzi con actividades entre IC50 3,71-38,81 μM y IC90 entre 50,87-59,87 μM. El compuesto 2 presentó actividad en amastigotes intracelulares de L. chagasi con IC50 77,76 μM. Las amidas preparadas no presentaron toxicidad en células THP-1 y solo el compuesto 4 fue parcialmente tóxico en células Vero (CC50 65,90 ± 5,71 μM. Conclusiones: La baja toxicidad presentada por los compuestos 1, 2 y 5 y la actividad antiparasitaria mostrada soportan el diseño de nuevas moléculas relacionadas para ser evaluadas en sistemas in vitro e in vivo contra estas enfermedades parasitarias. Salud UIS 2009; 41: 275-279Introduction: The chemotherapy against leishmaniasis and Chagas disease is ineffective, a condition that is aggravating the public health problem caused by these tropical diseases. Objective: To determine the activity of new N-benzyl(2-furylmethyl cinnamamides in the free and intracellular forms of Leishmania chagasi and Trypanosoma cruzi and Vero and THP-1 cells. Materials and methods: The parasites and cells were treated with different concentrations of the compounds and the activity was

Initial cytotoxicity assays of media for sulfate-reducing bacteria: An endodontic biopharmaceutical product under development.

Science.gov (United States)

Heggendorn, Fabiano Luiz; Silva, Gabriela Cristina de Carvalho; Cardoso, Elisama Azevedo; Castro, Helena Carla; Gonçalves, Lúcio Souza; Dias, Eliane Pedra; Lione, Viviane de Oliveira Freitas; Lutterbach, Márcia Teresa Soares

2016-01-01

This study assessed the cell viability of the inoculation vehicle of BACCOR (a combination of sulfate-reducing bacteria plus a culture media for bacteria), a biopharmaceutical product under development for dental use as aid in fractured endodontic file removal from the root canal. Different culture media for bacteria were evaluated: modified Postgate E (MCP-E mod), Modified Postgate E without Agar-agar (MCP-E w/Ag), Postgate C with Agar-agar (MCP-C Ag) and Postgate C without Agar-agar (MCP-C w/Ag). Cytotoxicity was quantified by the MTT test, exposing L929 and Vero cell lines to the vehicles over 24 h. The exposure of L929 cell line to MCP-E w/Ag resulted in biocompatibility (52% cell viability), while the exposure of the Vero kidney line revealed only MCP-E mod as cytotoxic. When diluted, all the vehicles showed biocompatibility with both cell lines. MCP-E w/Ag was the vehicle chosen for BACCOR, because of its biocompatibility with the cells used.