WorldWideScience

Sample records for viral internal ribosome

  1. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

    Science.gov (United States)

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  2. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  3. Advancing viral RNA structure prediction: measuring the thermodynamics of pyrimidine-rich internal loops.

    Science.gov (United States)

    Phan, Andy; Mailey, Katherine; Saeki, Jessica; Gu, Xiaobo; Schroeder, Susan J

    2017-05-01

    Accurate thermodynamic parameters improve RNA structure predictions and thus accelerate understanding of RNA function and the identification of RNA drug binding sites. Many viral RNA structures, such as internal ribosome entry sites, have internal loops and bulges that are potential drug target sites. Current models used to predict internal loops are biased toward small, symmetric purine loops, and thus poorly predict asymmetric, pyrimidine-rich loops with >6 nucleotides (nt) that occur frequently in viral RNA. This article presents new thermodynamic data for 40 pyrimidine loops, many of which can form UU or protonated CC base pairs. Uracil and protonated cytosine base pairs stabilize asymmetric internal loops. Accurate prediction rules are presented that account for all thermodynamic measurements of RNA asymmetric internal loops. New loop initiation terms for loops with >6 nt are presented that do not follow previous assumptions that increasing asymmetry destabilizes loops. Since the last 2004 update, 126 new loops with asymmetry or sizes greater than 2 × 2 have been measured. These new measurements significantly deepen and diversify the thermodynamic database for RNA. These results will help better predict internal loops that are larger, pyrimidine-rich, and occur within viral structures such as internal ribosome entry sites. © 2017 Phan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    Science.gov (United States)

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  5. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  7. Nuclear Protein Sam68 Interacts with the Enterovirus 71 Internal Ribosome Entry Site and Positively Regulates Viral Protein Translation.

    Science.gov (United States)

    Zhang, Hua; Song, Lei; Cong, Haolong; Tien, Po

    2015-10-01

    Enterovirus 71 (EV71) recruits various cellular factors to assist in the replication and translation of its genome. Identification of the host factors involved in the EV71 life cycle not only will enable a better understanding of the infection mechanism but also has the potential to be of use in the development of antiviral therapeutics. In this study, we demonstrated that the cellular factor 68-kDa Src-associated protein in mitosis (Sam68) acts as an internal ribosome entry site (IRES) trans-acting factor (ITAF) that binds specifically to the EV71 5' untranslated region (5'UTR). Interaction sites in both the viral IRES (stem-loops IV and V) and the heterogeneous nuclear ribonucleoprotein K homology (KH) domain of Sam68 protein were further mapped using an electrophoretic mobility shift assay (EMSA) and biotin RNA pulldown assay. More importantly, dual-luciferase (firefly) reporter analysis suggested that overexpression of Sam68 positively regulated IRES-dependent translation of virus proteins. In contrast, both IRES activity and viral protein translation significantly decreased in Sam68 knockdown cells compared with the negative-control cells treated with short hairpin RNA (shRNA). However, downregulation of Sam68 did not have a significant inhibitory effect on the accumulation of the EV71 genome. Moreover, Sam68 was redistributed from the nucleus to the cytoplasm and interacts with cellular factors, such as poly(rC)-binding protein 2 (PCBP2) and poly(A)-binding protein (PABP), during EV71 infection. The cytoplasmic relocalization of Sam68 in EV71-infected cells may be involved in the enhancement of EV71 IRES-mediated translation. Since Sam68 is known to be a RNA-binding protein, these results provide direct evidence that Sam68 is a novel ITAF that interacts with EV71 IRES and positively regulates viral protein translation. The nuclear protein Sam68 is found as an additional new host factor that interacts with the EV71 IRES during infection and could potentially

  8. A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

    Science.gov (United States)

    May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

    2017-04-15

    To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

  9. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  10. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  11. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  12. Mode of transgene expression after fusion to early or late viral genes of a conditionally replicating adenovirus via an optimized internal ribosome entry site in vitro and in vivo

    International Nuclear Information System (INIS)

    Rivera, Angel A.; Wang Minghui; Suzuki, Kaori; Uil, Taco G.; Krasnykh, Victor; Curiel, David T.; Nettelbeck, Dirk M.

    2004-01-01

    The expression of therapeutic genes by oncolytic viruses is a promising strategy to improve viral oncolysis, to augment gene transfer compared with a nonreplicating adenoviral vector, or to combine virotherapy and gene therapy. Both the mode of transgene expression and the locale of transgene insertion into the virus genome critically determine the efficacy of this approach. We report here on the properties of oncolytic adenoviruses which contain the luciferase cDNA fused via an optimized internal ribosome entry site (IRES) to the immediate early adenoviral gene E1A (AdΔE1AIL), the early gene E2B (AdΔE2BIL), or the late fiber gene (AdΔfiberIL). These viruses showed distinct kinetics of transgene expression and luciferase activity. Early after infection, luciferase activities were lower for these viruses, especially for AdΔE2BIL, compared with nonreplicating AdTL, which contained the luciferase gene expressed from the strong CMV promoter. However, 6 days after infection, luciferase activities were approximately four (AdΔE1AIL) to six (AdΔfiberIL) orders of magnitude higher than for AdTL, reflecting virus replication and efficient transgene expression. Similar results were obtained in vivo after intratumoral injection of AdΔE2BIL, AdΔfiberIL, and AdTL. AdΔfiberIL and the parental virus, Ad5-Δ24, resulted in similar cytotoxicity, but AdΔE2BIL and AdΔE1AIL were slightly attenuated. Disruption of the expression of neighboring viral genes by insertion of the transgene was minimal for AdΔE2BIL and AdΔfiberIL, but substantial for AdΔE1AIL. Our observations suggest that insertion of IRES-transgene cassettes into viral transcription units is an attractive strategy for the development of armed oncolytic adenoviruses with defined kinetics and strength of transgene expression

  13. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  14. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  15. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  16. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  17. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  19. Shrimp viral diseases, import risk assessment and international trade.

    Science.gov (United States)

    Karunasagar, Iddya; Ababouch, Lahsen

    2012-09-01

    Shrimp is an important commodity in international trade accounting for 15 % in terms of value of internationally traded seafood products which reached $102.00 billion in 2008. Aquaculture contributes to over 50 % of global shrimp production. One of the major constraints faced by shrimp aquaculture is the loss due to viral diseases like white spot syndrome, yellow head disease, and Taura syndrome. There are several examples of global spread of shrimp diseases due to importation of live shrimp for aquaculture. Though millions of tonnes of frozen or processed shrimp have been traded internationally during the last two decades despite prevalence of viral diseases in shrimp producing areas in Asia and the Americas, there is no evidence of diseases having been transmitted through shrimp imported for human consumption. The guidelines developed by the World Animal Health Organisation for movement of live animals for aquaculture, frozen crustaceans for human consumption, and the regulations implemented by some shrimp importing regions in the world are reviewed.

  20. 2′-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase

    Science.gov (United States)

    Dong, Hongping; Chang, David C.; Hua, Maggie Ho Chia; Lim, Siew Pheng; Chionh, Yok Hian; Hia, Fabian; Lee, Yie Hou; Kukkaro, Petra; Lok, Shee-Mei; Dedon, Peter C.; Shi, Pei-Yong

    2012-01-01

    RNA modification plays an important role in modulating host-pathogen interaction. Flavivirus NS5 protein encodes N-7 and 2′-O methyltransferase activities that are required for the formation of 5′ type I cap (m7GpppAm) of viral RNA genome. Here we reported, for the first time, that flavivirus NS5 has a novel internal RNA methylation activity. Recombinant NS5 proteins of West Nile virus and Dengue virus (serotype 4; DENV-4) specifically methylates polyA, but not polyG, polyC, or polyU, indicating that the methylation occurs at adenosine residue. RNAs with internal adenosines substituted with 2′-O-methyladenosines are not active substrates for internal methylation, whereas RNAs with adenosines substituted with N6-methyladenosines can be efficiently methylated, suggesting that the internal methylation occurs at the 2′-OH position of adenosine. Mass spectroscopic analysis further demonstrated that the internal methylation product is 2′-O-methyladenosine. Importantly, genomic RNA purified from DENV virion contains 2′-O-methyladenosine. The 2′-O methylation of internal adenosine does not require specific RNA sequence since recombinant methyltransferase of DENV-4 can efficiently methylate RNAs spanning different regions of viral genome, host ribosomal RNAs, and polyA. Structure-based mutagenesis results indicate that K61-D146-K181-E217 tetrad of DENV-4 methyltransferase forms the active site of internal methylation activity; in addition, distinct residues within the methyl donor (S-adenosyl-L-methionine) pocket, GTP pocket, and RNA-binding site are critical for the internal methylation activity. Functional analysis using flavivirus replicon and genome-length RNAs showed that internal methylation attenuated viral RNA translation and replication. Polymerase assay revealed that internal 2′-O-methyladenosine reduces the efficiency of RNA elongation. Collectively, our results demonstrate that flavivirus NS5 performs 2′-O methylation of internal adenosine of

  1. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  2. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  3. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  4. Establishment and Application of a High Throughput Screening System Targeting the Interaction between HCV Internal Ribosome Entry Site and Human Eukaryotic Translation Initiation Factor 3

    Directory of Open Access Journals (Sweden)

    Yuying Zhu

    2017-05-01

    Full Text Available Viruses are intracellular obligate parasites and the host cellular machinery is usually recruited for their replication. Human eukaryotic translation initiation factor 3 (eIF3 could be directly recruited by the hepatitis C virus (HCV internal ribosome entry site (IRES to promote the translation of viral proteins. In this study, we establish a fluorescence polarization (FP based high throughput screening (HTS system targeting the interaction between HCV IRES and eIF3. By screening a total of 894 compounds with this HTS system, two compounds (Mucl39526 and NP39 are found to disturb the interaction between HCV IRES and eIF3. And these two compounds are further demonstrated to inhibit the HCV IRES-dependent translation in vitro. Thus, this HTS system is functional to screen the potential HCV replication inhibitors targeting human eIF3, which is helpful to overcome the problem of viral resistance. Surprisingly, one compound HP-3, a kind of oxytocin antagonist, is discovered to significantly enhance the interaction between HCV IRES and eIF3 by this HTS system. HP-3 is demonstrated to directly interact with HCV IRES and promote the HCV IRES-dependent translation both in vitro and in vivo, which strongly suggests that HP-3 has potentials to promote HCV replication. Therefore, this HTS system is also useful to screen the potential HCV replication enhancers, which is meaningful for understanding the viral replication and screening novel antiviral drugs. To our knowledge, this is the first HTS system targeting the interaction between eIF3 and HCV IRES, which could be applied to screen both potential HCV replication inhibitors and enhancers.

  5. HuR and Ago2 Bind the Internal Ribosome Entry Site of Enterovirus 71 and Promote Virus Translation and Replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available EV71 (enterovirus 71 RNA contains an internal ribosomal entry site (IRES that directs cap-independent initiation of translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs. We reported recently that mRNA decay factor AUF1 is a negative-acting ITAF that binds IRES stem-loop II. We also reported that the small RNA-processing enzyme Dicer produces at least four small RNAs (vsRNAs from the EV71 IRES. One of these, vsRNA1, derived from IRES stem-loop II, reduces IRES activity and virus replication. Since its mechanism of action is unknown, we hypothesized that it might control association of ITAFs with the IRES. Here, we identified the mRNA stability factor HuR and the RISC subunit Argonaute 2 (Ago2 as two ITAFs that bind stem-loop II. In contrast to AUF1, HuR and Ago2 promote EV71 IRES activity and virus replication. In vitro RNA-binding assays revealed that vsRNA1 can alter association of Ago2, HuR, and AUF1 with stem-loop II. This presents a possible mechanism by which vsRNA1 could control viral translation and replication.

  6. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Tombusvirus-yeast interactions identify conserved cell-intrinsic viral restriction factors

    Directory of Open Access Journals (Sweden)

    Zsuzsanna eSasvari

    2014-08-01

    Full Text Available To combat viral infections, plants possess innate and adaptive immune pathways, such as RNA silencing, R gene and recessive gene-mediated resistance mechanisms. However, it is likely that additional cell-intrinsic restriction factors (CIRF are also involved in limiting plant virus replication. This review discusses novel CIRFs with antiviral functions, many of them RNA-binding proteins or affecting the RNA binding activities of viral replication proteins. The CIRFs against tombusviruses have been identified in yeast (Saccharomyces cerevisiae, which is developed as an advanced model organism. Grouping of the identified CIRFs based on their known cellular functions and subcellular localization in yeast reveals that TBSV replication is limited by a wide variety of host gene functions. Yeast proteins with the highest connectivity in the network map include the well-characterized Xrn1p 5’-3’ exoribonuclease, Act1p actin protein and Cse4p centromere protein. The protein network map also reveals an important interplay between the pro-viral Hsp70 cellular chaperone and the antiviral co-chaperones, and possibly key roles for the ribosomal or ribosome-associated factors. We discuss the antiviral functions of selected CIRFs, such as the RNA binding nucleolin, ribonucleases, WW-domain proteins, single- and multi-domain cyclophilins, TPR-domain co-chaperones and cellular ion pumps. These restriction factors frequently target the RNA-binding region in the viral replication proteins, thus interfering with the recruitment of the viral RNA for replication and the assembly of the membrane-bound viral replicase. Although many of the characterized CIRFs act directly against TBSV, we propose that the TPR-domain co-chaperones function as guardians of the cellular Hsp70 chaperone system, which is subverted efficiently by TBSV for viral replicase assembly in the absence of the TPR-domain co-chaperones.

  8. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  9. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  10. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  11. Apigenin Restricts FMDV Infection and Inhibits Viral IRES Driven Translational Activity

    Directory of Open Access Journals (Sweden)

    Suhong Qian

    2015-03-01

    Full Text Available Foot-and-mouth disease (FMD is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV. FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i apigenin inhibits FMDV infection at the viral post-entry stage; (ii apigenin does not exhibit direct extracellular virucidal activity; and (iii apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection.

  12. Apigenin restricts FMDV infection and inhibits viral IRES driven translational activity.

    Science.gov (United States)

    Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

    2015-03-31

    Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection.

  13. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  14. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  15. Internal ribosomal entry site-mediated translation is important for rhythmic PERIOD1 expression.

    Directory of Open Access Journals (Sweden)

    Kyung-Ha Lee

    Full Text Available The mouse PERIOD1 (mPER1 plays an important role in the maintenance of circadian rhythm. Translation of mPer1 is directed by both a cap-dependent process and cap-independent translation mediated by an internal ribosomal entry site (IRES in the 5' untranslated region (UTR. Here, we compared mPer1 IRES activity with other cellular IRESs. We also found critical region in mPer1 5'UTR for heterogeneous nuclear ribonucleoprotein Q (HNRNPQ binding. Deletion of HNRNPQ binding region markedly decreased IRES activity and disrupted rhythmicity. A mathematical model also suggests that rhythmic IRES-dependent translation is a key process in mPER1 oscillation. The IRES-mediated translation of mPer1 will help define the post-transcriptional regulation of the core clock genes.

  16. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  18. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  19. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  20. The NS1 Protein from Influenza Virus Stimulates Translation Initiation by Enhancing Ribosome Recruitment to mRNAs.

    Science.gov (United States)

    Panthu, Baptiste; Terrier, Olivier; Carron, Coralie; Traversier, Aurélien; Corbin, Antoine; Balvay, Laurent; Lina, Bruno; Rosa-Calatrava, Manuel; Ohlmann, Théophile

    2017-10-27

    The non-structural protein NS1 of influenza A viruses exerts pleiotropic functions during infection. Among these functions, NS1 was shown to be involved in the control of both viral and cellular translation; however, the mechanism by which this occurs remains to be determined. Thus, we have revisited the role of NS1 in translation by using a combination of influenza infection, mRNA reporter transfection, and in vitro functional and biochemical assays. Our data show that the NS1 protein is able to enhance the translation of virtually all tested mRNAs with the exception of constructs bearing the Dicistroviruses Internal ribosome entry segment (IRESes) (DCV and CrPV), suggesting a role at the level of translation initiation. The domain of NS1 required for translation stimulation was mapped to the RNA binding amino-terminal motif of the protein with residues R38 and K41 being critical for activity. Although we show that NS1 can bind directly to mRNAs, it does not correlate with its ability to stimulate translation. This activity rather relies on the property of NS1 to associate with ribosomes and to recruit them to target mRNAs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Enhancement of internal ribosome entry site-mediated translation and replication of hepatitis C virus by PD98059

    International Nuclear Information System (INIS)

    Murata, Takayuki; Hijikata, Makoto; Shimotohno, Kunitada

    2005-01-01

    Translation initiation of hepatitis C virus (HCV) occurs in an internal ribosome entry site (IRES)-dependent manner. We found that HCV IRES-dependent protein synthesis is enhanced by PD98059, an inhibitor of the extracellular signal-regulated kinase (ERK) signaling pathway, while cellular cap-dependent translation was relatively unaffected by the compound. Treatment of cells with PD98059 allowed for robust HCV replication following cellular incubation with HCV-positive serum. Though the molecular mechanism underlying IRES enhancement remains elusive, PD98059 is a potent accelerator of HCV RNA replication

  2. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  3. The eukaryotic translation initiation factor 3 subunit E binds to classical swine fever virus NS5A and facilitates viral replication.

    Science.gov (United States)

    Liu, Xiaofeng; Wang, Xiaoyu; Wang, Qian; Luo, Mingyang; Guo, Huancheng; Gong, Wenjie; Tu, Changchun; Sun, Jinfu

    2018-02-01

    Classical swine fever virus (CSFV) NS5A protein is a multifunctional protein, playing critical roles in viral RNA replication, translation and assembly. To further explore its functions in viral replication, interaction of NS5A with host factors was assayed using a his-tag "pull down" assay coupled with shotgun LC-MS/MS. Host protein translation initiation factor 3 subunit E was identified as a binding partner of NS5A, and confirmed by co-immunoprecipitation and co-localization analysis. Overexpression of eIF3E markedly enhanced CSFV genomic replication, viral protein expression and production of progeny virus, and downregulation of eIF3E by siRNA significantly decreased viral proliferation in PK-15 cells. Luciferase reporter assay showed an enhancement of translational activity of the internal ribosome entry site of CSFV by eIF3E and a decrease in cellular translation by NS5A. These data indicate that eIF3E plays an important role in CSFV replication, thereby identifying it as a potential target for inhibition of the virus. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Promotion of Viral IRES-Mediated Translation Initiation under Mild Hypothermia.

    Directory of Open Access Journals (Sweden)

    Maria Licursi

    Full Text Available Internal ribosome entry site (IRES-mediated translation is an essential replication step for certain viruses. As IRES-mediated translation is regulated differently from cap-dependent translation under various cellular conditions, we sought to investigate whether temperature influences efficiency of viral IRES-mediated translation initiation by using bicistronic reporter constructs containing an IRES element of encephalomyocarditis virus (EMCV, foot-and-mouth disease virus (FMDV, hepatitis C virus (HCV, human rhinovirus (HRV or poliovirus (PV. Under mild hypothermic conditions (30 and 35°C, we observed increases in the efficiency of translation initiation by HCV and HRV IRES elements compared to translation initiation at 37°C. The promotion of HRV IRES activity was observed as early as 2 hours after exposure to mild hypothermia. We also confirmed the promotion of translation initiation by HRV IRES under mild hypothermia in multiple cell lines. The expression levels and locations of polypyrimidine tract-binding protein (PTB and upstream of N-Ras (unr, the IRES trans-acting factors (ITAFs of HCV and HRV IRES elements, were not modulated by the temperature shift from 37°C to 30°C. Taken together, this study demonstrates that efficiency of translation initiation by some viral IRES elements is temperature dependent.

  5. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  6. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  7. Nonreplicative RNA Recombination of an Animal Plus-Strand RNA Virus in the Absence of Efficient Translation of Viral Proteins

    Science.gov (United States)

    Kleine Büning, Maximiliane; Meyer, Denise; Austermann-Busch, Sophia; Roman-Sosa, Gleyder; Rümenapf, Tillmann

    2017-01-01

    RNA recombination is a major driving force for the evolution of RNA viruses and is significantly implicated in the adaptation of viruses to new hosts, changes of virulence, as well as in the emergence of new viruses including drug-resistant and escape mutants. However, the molecular details of recombination in animal RNA viruses are only poorly understood. In order to determine whether viral RNA recombination depends on translation of viral proteins, a nonreplicative recombination system was established which is based on cotransfection of cells with synthetic bovine viral diarrhea virus (family Flaviviridae) RNA genome fragments either lacking the internal ribosome entry site required for cap-independent translation or lacking almost the complete polyprotein coding region. The emergence of a number of recombinant viruses demonstrated that IRES-mediated translation of viral proteins is dispensable for efficient recombination and suggests that RNA recombination can occur in the absence of viral proteins. Analyses of 58 independently emerged viruses led to the detection of recombinant genomes with duplications, deletions and insertions in the 5′ terminal region of the open reading frame, leading to enlarged core fusion proteins detectable by Western blot analysis. This demonstrates a remarkable flexibility of the pestivirus core protein. Further experiments with capped and uncapped genome fragments containing a luciferase gene for monitoring the level of protein translation revealed that even a ∼1,000-fold enhancement of translation of viral proteins did not increase the frequency of RNA recombination. Taken together, this study highlights that nonreplicative RNA recombination does not require translation of viral proteins. PMID:28338950

  8. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  9. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    Science.gov (United States)

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  10. Monocistronic mRNAs containing defective hepatitis C virus-like picornavirus internal ribosome entry site elements in their 5 ' untranslated regions are efficiently translated in cells by a cap-dependent mechanism

    DEFF Research Database (Denmark)

    Belsham, Graham; Nielsen, Inge; Normann, Preben

    2008-01-01

    The initiation of protein synthesis on mRNAs within eukaryotic cells is achieved either by a 5' cap-dependent mechanism or through internal initiation directed by an internal ribosome entry site (IRES). Picornavirus IRES elements, located in the 59 untranslated region (5'UTR), contain extensive s...

  11. Re-localization of Cellular Protein SRp20 during Poliovirus Infection: Bridging a Viral IRES to the Host Cell Translation Apparatus

    Science.gov (United States)

    Fitzgerald, Kerry D.; Semler, Bert L.

    2011-01-01

    Poliovirus IRES-mediated translation requires the functions of certain canonical as well as non-canonical factors for the recruitment of ribosomes to the viral RNA. The interaction of cellular proteins PCBP2 and SRp20 in extracts from poliovirus-infected cells has been previously described, and these two proteins were shown to function synergistically in viral translation. To further define the mechanism of ribosome recruitment for the initiation of poliovirus IRES-dependent translation, we focused on the role of the interaction between cellular proteins PCBP2 and SRp20. Work described here demonstrates that SRp20 dramatically re-localizes from the nucleus to the cytoplasm of poliovirus-infected neuroblastoma cells during the course of infection. Importantly, SRp20 partially co-localizes with PCBP2 in the cytoplasm of infected cells, corroborating our previous in vitro interaction data. In addition, the data presented implicate the presence of these two proteins in viral translation initiation complexes. We show that in extracts from poliovirus-infected cells, SRp20 is associated with PCBP2 bound to poliovirus RNA, indicating that this interaction occurs on the viral RNA. Finally, we generated a mutated version of SRp20 lacking the RNA recognition motif (SRp20ΔRRM) and found that this protein is localized similar to the full length SRp20, and also partially co-localizes with PCBP2 during poliovirus infection. Expression of this mutated version of SRp20 results in a ∼100 fold decrease in virus yield for poliovirus when compared to expression of wild type SRp20, possibly via a dominant negative effect. Taken together, these results are consistent with a model in which SRp20 interacts with PCBP2 bound to the viral RNA, and this interaction functions to recruit ribosomes to the viral RNA in a direct or indirect manner, with the participation of additional protein-protein or protein-RNA interactions. PMID:21779168

  12. Hepatitis B and hepatitis C viruses: a review of viral genomes, viral induced host immune responses, genotypic distributions and worldwide epidemiology

    Directory of Open Access Journals (Sweden)

    Umar Saeed

    2014-04-01

    Full Text Available Hepatitis B and hepatitis C viruses (HCV are frequently propagating blood borne pathogens in global community. Viral hepatitis is primarily associated with severe health complications, such as liver cirrhosis, hepatocellular carcinoma, hepatic fibrosis and steatosis. A literature review was conducted on hepatitis B virus (HBV, HBV genome, genotypic distribution and global epidemiology of HBV, HCV, HCV genome, HCV and host immune responses, HCV genotypic distribution and global epidemiology. The valued information was subjected for review. HBV has strict tissue tropism to liver. The virus infecting hepatocytes produces large amount of hepatitis B surface antigen particles which lack the DNA. It has capability to integrate into host genome. It has been found that genotype C is most emerging genotype associated with more severe liver diseases (cirrhosis. The approximate prevalence rate of genotype C is 27.7% which represents a major threat to future generations. Approximately 8% of population is chronic carrier of HBV in developing countries. The chronic carrier rate of HBV is 2%-7% in Middle East, Eastern and Southern Europe, South America and Japan. Among HCV infected individuals, 15% usually have natural tendency to overcome acute viral infection, where as 85% of individuals were unable to control HCV infection. The internal ribosomal entry site contains highly conserved structures important for binding and appropriate positioning of viral genome inside the host cell. HCV infects only in 1%-10% of hepatocytes, but production of tumor necrosis factor alpha (from CD8+ cells and interferon-gamma cause destruction of both infected cells and non-infected surrounding cells. Almost 11 genotypes and above 100 subtypes of HCV exists worldwide with different geographical distribution. Many efforts are still needed to minimize global burden of these infections. For the complete eradication of HBV (just like small pox and polio via vaccination strategies

  13. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  14. Ribosome Shunting, Polycistronic Translation, and Evasion of Antiviral Defenses in Plant Pararetroviruses and Beyond

    Directory of Open Access Journals (Sweden)

    Mikhail M. Pooggin

    2018-04-01

    Full Text Available Viruses have compact genomes and usually translate more than one protein from polycistronic RNAs using leaky scanning, frameshifting, stop codon suppression or reinitiation mechanisms. Viral (pre-genomic RNAs often contain long 5′-leader sequences with short upstream open reading frames (uORFs and secondary structure elements, which control both translation initiation and replication. In plants, viral RNA and DNA are targeted by RNA interference (RNAi generating small RNAs that silence viral gene expression, while viral proteins are recognized by innate immunity and autophagy that restrict viral infection. In this review we focus on plant pararetroviruses of the family Caulimoviridae and describe the mechanisms of uORF- and secondary structure-driven ribosome shunting, leaky scanning and reinitiation after translation of short and long uORFs. We discuss conservation of these mechanisms in different genera of Caulimoviridae, including host genome-integrated endogenous viral elements, as well as in other viral families, and highlight a multipurpose use of the highly-structured leader sequence of plant pararetroviruses in regulation of translation, splicing, packaging, and reverse transcription of pregenomic RNA (pgRNA, and in evasion of RNAi. Furthermore, we illustrate how targeting of several host factors by a pararetroviral effector protein can lead to transactivation of viral polycistronic translation and concomitant suppression of antiviral defenses. Thus, activation of the plant protein kinase target of rapamycin (TOR by the Cauliflower mosaic virus transactivator/viroplasmin (TAV promotes reinitiation of translation after long ORFs on viral pgRNA and blocks antiviral autophagy and innate immunity responses, while interaction of TAV with the plant RNAi machinery interferes with antiviral silencing.

  15. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  16. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  17. Nonreplicative RNA Recombination of an Animal Plus-Strand RNA Virus in the Absence of Efficient Translation of Viral Proteins.

    Science.gov (United States)

    Kleine Büning, Maximiliane; Meyer, Denise; Austermann-Busch, Sophia; Roman-Sosa, Gleyder; Rümenapf, Tillmann; Becher, Paul

    2017-04-01

    RNA recombination is a major driving force for the evolution of RNA viruses and is significantly implicated in the adaptation of viruses to new hosts, changes of virulence, as well as in the emergence of new viruses including drug-resistant and escape mutants. However, the molecular details of recombination in animal RNA viruses are only poorly understood. In order to determine whether viral RNA recombination depends on translation of viral proteins, a nonreplicative recombination system was established which is based on cotransfection of cells with synthetic bovine viral diarrhea virus (family Flaviviridae) RNA genome fragments either lacking the internal ribosome entry site required for cap-independent translation or lacking almost the complete polyprotein coding region. The emergence of a number of recombinant viruses demonstrated that IRES-mediated translation of viral proteins is dispensable for efficient recombination and suggests that RNA recombination can occur in the absence of viral proteins. Analyses of 58 independently emerged viruses led to the detection of recombinant genomes with duplications, deletions and insertions in the 5' terminal region of the open reading frame, leading to enlarged core fusion proteins detectable by Western blot analysis. This demonstrates a remarkable flexibility of the pestivirus core protein. Further experiments with capped and uncapped genome fragments containing a luciferase gene for monitoring the level of protein translation revealed that even a ∼1,000-fold enhancement of translation of viral proteins did not increase the frequency of RNA recombination. Taken together, this study highlights that nonreplicative RNA recombination does not require translation of viral proteins. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  19. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  20. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  1. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation

    Science.gov (United States)

    Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A

    2011-01-01

    The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

  3. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  4. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  5. A Next-Generation Sequencing Approach Uncovers Viral Transcripts Incorporated in Poxvirus Virions

    Directory of Open Access Journals (Sweden)

    Marica Grossegesse

    2017-10-01

    Full Text Available Transcripts are known to be incorporated in particles of DNA viruses belonging to the families of Herpesviridae and Mimiviridae, but the presence of transcripts in other DNA viruses, such as poxviruses, has not been analyzed yet. Therefore, we first established a next-generation-sequencing (NGS-based protocol, enabling the unbiased identification of transcripts in virus particles. Subsequently, we applied our protocol to analyze RNA in an emerging zoonotic member of the Poxviridae family, namely Cowpox virus. Our results revealed the incorporation of 19 viral transcripts, while host identifications were restricted to ribosomal and mitochondrial RNA. Most viral transcripts had an unknown and immunomodulatory function, suggesting that transcript incorporation may be beneficial for poxvirus immune evasion. Notably, the most abundant transcript originated from the D5L/I1R gene that encodes a viral inhibitor of the host cytoplasmic DNA sensing machinery.

  6. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  7. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  8. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  9. Structural Features of the Seneca Valley Virus Internal Ribosome Entry Site (IRES) Element: a Picornavirus with a Pestivirus-Like IRES

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Locker, Nicolas; Gomwalk, Zarmwa

    2011-01-01

    The RNA genome of Seneca Valley virus (SVV), a recently identified picornavirus, contains an internal ribosome entry site (IRES) element which has structural and functional similarity to that from classical swine fever virus (CSFV) and hepatitis C virus, members of the FLAVIVIRIDAE: The SVV IRES...... has an absolute requirement for the presence of a short region of virus-coding sequence to allow it to function either in cells or in rabbit reticulocyte lysate. The IRES activity does not require the translation initiation factor eIF4A or intact eIF4G. The predicted secondary structure indicates...

  10. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  12. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  13. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  14. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  15. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  16. Replacement of Murine Leukemia Virus Readthrough Mechanism by Human Immunodeficiency Virus Frameshift Allows Synthesis of Viral Proteins and Virus Replication

    Science.gov (United States)

    Brunelle, Marie-Noëlle; Brakier-Gingras, Léa; Lemay, Guy

    2003-01-01

    Retroviruses use unusual recoding strategies to synthesize the Gag-Pol polyprotein precursor of viral enzymes. In human immunodeficiency virus, ribosomes translating full-length viral RNA can shift back by 1 nucleotide at a specific site defined by the presence of both a slippery sequence and a downstream stimulatory element made of an extensive secondary structure. This so-called frameshift mechanism could become a target for the development of novel antiviral strategies. A different recoding strategy is used by other retroviruses, such as murine leukemia viruses, to synthesize the Gag-Pol precursor; in this case, a stop codon is suppressed in a readthrough process, again due to the presence of a specific structure adopted by the mRNA. Development of antiframeshift agents will greatly benefit from the availability of a simple animal and virus model. For this purpose, the murine leukemia virus readthrough region was rendered inactive by mutagenesis and the frameshift region of human immunodeficiency virus was inserted to generate a chimeric provirus. This substitution of readthrough by frameshift allows the synthesis of viral proteins, and the chimeric provirus sequence was found to generate infectious viruses. This system could be a most interesting alternative to study ribosomal frameshift in the context of a virus amenable to the use of a simple animal model. PMID:12584361

  17. Viral-bacterial associations in acute apical abscesses.

    Science.gov (United States)

    Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F

    2011-08-01

    Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.

  18. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  19. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  20. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  1. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  2. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2004-03-01

    Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

  3. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  4. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  5. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  6. 1st International Symposium on Stress-Associated RNA Granules in Human Disease and Viral Infection

    Directory of Open Access Journals (Sweden)

    Bruce W. Banfield

    2014-09-01

    Full Text Available In recent years, important linkages have been made between RNA granules and human disease processes. On June 8-10 of this year, we hosted a new symposium, dubbed the 1st International Symposium on Stress-Associated RNA Granules in Human Disease and Viral Infection. This symposium brought together experts from diverse research disciplines ranging from cancer and neuroscience to infectious disease. This report summarizes speaker presentations and highlights current challenges in the field.

  7. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  8. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  9. De novo design and engineering of non-ribosomal peptide synthetases

    Science.gov (United States)

    Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.

    2018-03-01

    Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.

  10. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  11. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  12. Induction of viral, 7-methyl-guanosine cap-independent translation and oncolysis by mitogen-activated protein kinase-interacting kinase-mediated effects on the serine/arginine-rich protein kinase.

    Science.gov (United States)

    Brown, Michael C; Bryant, Jeffrey D; Dobrikova, Elena Y; Shveygert, Mayya; Bradrick, Shelton S; Chandramohan, Vidyalakshmi; Bigner, Darell D; Gromeier, Matthias

    2014-11-01

    Protein synthesis, the most energy-consuming process in cells, responds to changing physiologic priorities, e.g., upon mitogen- or stress-induced adaptations signaled through the mitogen-activated protein kinases (MAPKs). The prevailing status of protein synthesis machinery is a viral pathogenesis factor, particularly for plus-strand RNA viruses, where immediate translation of incoming viral RNAs shapes host-virus interactions. In this study, we unraveled signaling pathways centered on the ERK1/2 and p38α MAPK-interacting kinases MNK1/2 and their role in controlling 7-methyl-guanosine (m(7)G) "cap"-independent translation at enterovirus type 1 internal ribosomal entry sites (IRESs). Activation of Raf-MEK-ERK1/2 signals induced viral IRES-mediated translation in a manner dependent on MNK1/2. This effect was not due to MNK's known functions as eukaryotic initiation factor (eIF) 4G binding partner or eIF4E(S209) kinase. Rather, MNK catalytic activity enabled viral IRES-mediated translation/host cell cytotoxicity through negative regulation of the Ser/Arg (SR)-rich protein kinase (SRPK). Our investigations suggest that SRPK activity is a major determinant of type 1 IRES competency, host cell cytotoxicity, and viral proliferation in infected cells. We are targeting unfettered enterovirus IRES activity in cancer with PVSRIPO, the type 1 live-attenuated poliovirus (PV) (Sabin) vaccine containing a human rhinovirus type 2 (HRV2) IRES. A phase I clinical trial of PVSRIPO with intratumoral inoculation in patients with recurrent glioblastoma (GBM) is showing early promise. Viral translation proficiency in infected GBM cells is a core requirement for the antineoplastic efficacy of PVSRIPO. Therefore, it is critically important to understand the mechanisms controlling viral cap-independent translation in infected host cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  14. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  15. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  16. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  17. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  18. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  19. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  20. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  1. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  2. Community-driven demand creation for the use of routine viral load testing: a model to scale up routine viral load testing.

    Science.gov (United States)

    Killingo, Bactrin M; Taro, Trisa B; Mosime, Wame N

    2017-11-01

    HIV treatment outcomes are dependent on the use of viral load measurement. Despite global and national guidelines recommending the use of routine viral load testing, these policies alone have not translated into widespread implementation or sufficiently increased access for people living with HIV (PLHIV). Civil society and communities of PLHIV recognize the need to close this gap and to enable the scale up of routine viral load testing. The International Treatment Preparedness Coalition (ITPC) developed an approach to community-led demand creation for the use of routine viral load testing. Using this Community Demand Creation Model, implementers follow a step-wise process to capacitate and empower communities to address their most pressing needs. This includes utlizing a specific toolkit that includes conducting a baseline assessment, developing a treatment education toolkit, organizing mobilization workshops for knowledge building, provision of small grants to support advocacy work and conducting benchmark evaluations. The Community Demand Creation Model to increase demand for routine viral load testing services by PLHIV has been delivered in diverse contexts including in the sub-Saharan African, Asian, Latin American and the Caribbean regions. Between December 2015 and December 2016, ITPC trained more than 240 PLHIV activists, and disbursed US$90,000 to network partners in support of their national advocacy work. The latter efforts informed a regional, community-driven campaign calling for domestic investment in the expeditious implementation of national viral load testing guidelines. HIV treatment education and community mobilization are critical components of demand creation for access to optimal HIV treatment, especially for the use of routine viral load testing. ITPC's Community Demand Creation Model offers a novel approach to achieving this goal. © 2017 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of

  3. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  4. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  5. The internal initiation of translation in bovine viral diarrhea virus RNA depends on the presence of an RNA pseudoknot upstream of the initiation codon.

    Science.gov (United States)

    Moes, Lorin; Wirth, Manfred

    2007-11-22

    Bovine viral diarrhea virus (BVDV) is the prototype representative of the pestivirus genus in the Flaviviridae family. It has been shown that the initiation of translation of BVDV RNA occurs by an internal ribosome entry mechanism mediated by the 5' untranslated region of the viral RNA 1. The 5' and 3' boundaries of the IRES of the cytopathic BVDV NADL have been mapped and it has been suggested that the IRES extends into the coding of the BVDV polyprotein 2. A putative pseudoknot structure has been recognized in the BVDV 5'UTR in close proximity to the AUG start codon. A pseudoknot structure is characteristic for flavivirus IRESes and in the case of the closely related classical swine fever virus (CSFV) and the more distantly related Hepatitis C virus (HCV) pseudoknot function in translation has been demonstrated. To characterize the BVDV IRESes in detail, we studied the BVDV translational initiation by transfection of dicistronic expression plasmids into mammalian cells. A region coding for the amino terminus of the BVDV SD-1 polyprotein contributes considerably to efficient initiation of translation. The translation efficiency mediated by the IRES of BVDV strains NADL and SD-1 approximates the poliovirus type I IRES directed translation in BHK cells. Compared to the poliovirus IRES increased expression levels are mediated by the BVDV IRES of strain SD-1 in murine cell lines, while lower levels are observed in human cell lines. Site directed mutagenesis revealed that a RNA pseudoknot upstream of the initiator AUG is an important structural element for IRES function. Mutants with impaired ability to base pair in stem I or II lost their translational activity. In mutants with repaired base pairing either in stem 1 or in stem 2 full translational activity was restored. Thus, the BVDV IRES translation is dependent on the pseudoknot integrity. These features of the pestivirus IRES are reminiscent of those of the classical swine fever virus, a pestivirus, and the

  6. The internal initiation of translation in bovine viral diarrhea virus RNA depends on the presence of an RNA pseudoknot upstream of the initiation codon

    Directory of Open Access Journals (Sweden)

    Moes Lorin

    2007-11-01

    Full Text Available Abstract Background Bovine viral diarrhea virus (BVDV is the prototype representative of the pestivirus genus in the Flaviviridae family. It has been shown that the initiation of translation of BVDV RNA occurs by an internal ribosome entry mechanism mediated by the 5' untranslated region of the viral RNA 1. The 5' and 3' boundaries of the IRES of the cytopathic BVDV NADL have been mapped and it has been suggested that the IRES extends into the coding of the BVDV polyprotein 2. A putative pseudoknot structure has been recognized in the BVDV 5'UTR in close proximity to the AUG start codon. A pseudoknot structure is characteristic for flavivirus IRESes and in the case of the closely related classical swine fever virus (CSFV and the more distantly related Hepatitis C virus (HCV pseudoknot function in translation has been demonstrated. Results To characterize the BVDV IRESes in detail, we studied the BVDV translational initiation by transfection of dicistronic expression plasmids into mammalian cells. A region coding for the amino terminus of the BVDV SD-1 polyprotein contributes considerably to efficient initiation of translation. The translation efficiency mediated by the IRES of BVDV strains NADL and SD-1 approximates the poliovirus type I IRES directed translation in BHK cells. Compared to the poliovirus IRES increased expression levels are mediated by the BVDV IRES of strain SD-1 in murine cell lines, while lower levels are observed in human cell lines. Site directed mutagenesis revealed that a RNA pseudoknot upstream of the initiator AUG is an important structural element for IRES function. Mutants with impaired ability to base pair in stem I or II lost their translational activity. In mutants with repaired base pairing either in stem 1 or in stem 2 full translational activity was restored. Thus, the BVDV IRES translation is dependent on the pseudoknot integrity. These features of the pestivirus IRES are reminiscent of those of the classical

  7. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  8. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  9. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  10. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  11. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Science.gov (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  12. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  13. Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA.

    Science.gov (United States)

    Kusaba, M; Tsuge, T

    1995-10-01

    The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.

  14. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  15. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  16. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  17. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  18. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  19. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  20. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

    1982-01-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  1. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  2. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  3. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  4. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  5. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  6. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  7. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  8. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  9. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  10. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  11. The multi-targeted kinase inhibitor sorafenib inhibits enterovirus 71 replication by regulating IRES-dependent translation of viral proteins.

    Science.gov (United States)

    Gao, Meng; Duan, Hao; Liu, Jing; Zhang, Hao; Wang, Xin; Zhu, Meng; Guo, Jitao; Zhao, Zhenlong; Meng, Lirong; Peng, Yihong

    2014-06-01

    The activation of ERK and p38 signal cascade in host cells has been demonstrated to be essential for picornavirus enterovirus 71 (EV71) replication and up-regulation of virus-induced cyclooxygenase-2 (COX-2)/prostaglandins E2 (PGE2) expression. The aim of this study was to examine the effects of sorafenib, a clinically approved anti-cancer multi-targeted kinase inhibitor, on the propagation and pathogenesis of EV71, with a view to its possible mechanism and potential use in the design of therapy regimes for Hand foot and mouth disease (HFMD) patients with life threatening neurological complications. In this study, non-toxic concentrations of sorafenib were shown to inhibit the yield of infectious progeny EV71 (clinical BC08 strain) by about 90% in three different cell types. A similar inhibitory effect of sorafenib was observed on the synthesis of both viral genomic RNA and the VP1 protein. Interestingly, sorafenib exerted obvious inhibition of the EV71 internal ribosomal entry site (IRES)-mediated translation, the first step in picornavirus replication, by linking it to a firefly luciferase reporter gene. Sorafenib was also able to prevent both EV71-induced CPE and the activation of ERK and p38, which contributes to up-regulation COX-2/PGE2 expression induced by the virus. Overall, this study shows that sorafenib strongly inhibits EV71 replication at least in part by regulating viral IRES-dependent translation of viral proteins, indicating a novel potential strategy for the treatment of HFMD patients with severe neurological complications. To our knowledge, this is the first report that investigates the mechanism by which sorafenib inhibits EV71 replication. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  13. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  14. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  15. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  17. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. [Viral hepatitis in travellers].

    Science.gov (United States)

    Abreu, Cândida

    2007-01-01

    Considering the geographical asymmetric distribution of viral hepatitis A, B and E, having a much higher prevalence in the less developed world, travellers from developed countries are exposed to a considerable and often underestimated risk of hepatitis infection. In fact a significant percentage of viral hepatitis occurring in developed countries is travel related. This results from globalization and increased mobility from tourism, international work, humanitarian and religious missions or other travel related activities. Several studies published in Europe and North America shown that more than 50% of reported cases of hepatitis A are travel related. On the other hand frequent outbreaks of hepatitis A and E in specific geographic areas raise the risk of infection in these restricted zones and that should be clearly identified. Selected aspects related with the distribution of hepatitis A, B and E are reviewed, particularly the situation in Portugal according to the published studies, as well as relevant clinical manifestations and differential diagnosis of viral hepatitis. Basic prevention rules considering enteric transmitted hepatitis (hepatitis A and hepatitis E) and parenteral transmitted (hepatitis B) are reviewed as well as hepatitis A and B immunoprophylaxis. Common clinical situations and daily practice "pre travel" advice issues are discussed according to WHO/CDC recommendations and the Portuguese National Vaccination Program. Implications from near future availability of a hepatitis E vaccine, a currently in phase 2 trial, are highlighted. Potential indications for travellers to endemic countries like India, Nepal and some regions of China, where up to 30% of sporadic cases of acute viral hepatitis are caused by hepatitis E virus, are considered. Continued epidemiological surveillance for viral hepatitis is essential to recognize and control possible outbreaks, but also to identify new viral hepatitis agents that may emerge as important global health

  19. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  20. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  1. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  2. Evidence that viral RNAs have evolved for efficient, two-stage packaging.

    Science.gov (United States)

    Borodavka, Alexander; Tuma, Roman; Stockley, Peter G

    2012-09-25

    Genome packaging is an essential step in virus replication and a potential drug target. Single-stranded RNA viruses have been thought to encapsidate their genomes by gradual co-assembly with capsid subunits. In contrast, using a single molecule fluorescence assay to monitor RNA conformation and virus assembly in real time, with two viruses from differing structural families, we have discovered that packaging is a two-stage process. Initially, the genomic RNAs undergo rapid and dramatic (approximately 20-30%) collapse of their solution conformations upon addition of cognate coat proteins. The collapse occurs with a substoichiometric ratio of coat protein subunits and is followed by a gradual increase in particle size, consistent with the recruitment of additional subunits to complete a growing capsid. Equivalently sized nonviral RNAs, including high copy potential in vivo competitor mRNAs, do not collapse. They do support particle assembly, however, but yield many aberrant structures in contrast to viral RNAs that make only capsids of the correct size. The collapse is specific to viral RNA fragments, implying that it depends on a series of specific RNA-protein interactions. For bacteriophage MS2, we have shown that collapse is driven by subsequent protein-protein interactions, consistent with the RNA-protein contacts occurring in defined spatial locations. Conformational collapse appears to be a distinct feature of viral RNA that has evolved to facilitate assembly. Aspects of this process mimic those seen in ribosome assembly.

  3. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  4. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  5. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  6. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  7. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  8. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  9. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  10. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  12. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  13. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  14. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  15. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  16. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  17. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  18. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  19. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  20. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  2. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  3. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  4. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  5. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  6. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  7. Use of the viral 2A peptide for bicistronic expression in transgenic mice

    Directory of Open Access Journals (Sweden)

    Trichas Georgios

    2008-09-01

    Full Text Available Abstract Background Transgenic animals are widely used in biomedical research and biotechnology. Multicistronic constructs, in which several proteins are encoded by a single messenger RNA, are commonly used in genetically engineered animals. This is currently done by using an internal ribosomal entry site to separate the different coding regions. 2A peptides result in the co-translational 'cleavage' of proteins and are an attractive alternative to the internal ribosomal entry site. They are more reliable than the internal ribosomal entry site and lead to expression of multiple cistrons at equimolar levels. They work in a wide variety of eukaryotic cells, but to date have not been demonstrated to function in transgenic mice in an inheritable manner. Results To test 2A function in transgenic mice and uncover any possible toxicity of widespread expression of the 2A peptide, we made a bicistronic reporter construct containing the coding sequence for a membrane localised red fluorescent protein (Myr-TdTomato and a nuclear localised green fluorescent protein (H2B-GFP, separated by a 2A sequence. When this reporter is transfected into HeLa cells, the two fluorescent proteins correctly localise to mutually exclusive cellular compartments, demonstrating that the bicistronic construct is a reliable readout of 2A function. The two fluorescent proteins also correctly localise when the reporter is electroporated into chick neural tube cells. We made two independent transgenic mouse lines that express the bicistronic reporter ubiquitously. For both lines, transgenic mice are born in Mendelian frequencies and are found to be healthy and fertile. Myr-TdTomato and H2B-GFP segregate to mutually exclusive cellular compartments in all tissues examined from a broad range of developmental stages, ranging from embryo to adult. One transgenic line shows X-linked inheritance of the transgene and mosaic expression in females but uniform expression in males, indicating

  8. Nucleocapsid-Independent Specific Viral RNA Packaging via Viral Envelope Protein and Viral RNA Signal

    OpenAIRE

    Narayanan, Krishna; Chen, Chun-Jen; Maeda, Junko; Makino, Shinji

    2003-01-01

    For any of the enveloped RNA viruses studied to date, recognition of a specific RNA packaging signal by the virus's nucleocapsid (N) protein is the first step described in the process of viral RNA packaging. In the murine coronavirus a selective interaction between the viral transmembrane envelope protein M and the viral ribonucleoprotein complex, composed of N protein and viral RNA containing a short cis-acting RNA element, the packaging signal, determines the selective RNA packaging into vi...

  9. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  10. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  11. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  12. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  13. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  14. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  15. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  16. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  17. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  18. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  19. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  20. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  1. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  2. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  3. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  4. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  5. Viral Hepatitis

    Science.gov (United States)

    ... Home A-Z Health Topics Viral hepatitis Viral hepatitis > A-Z Health Topics Viral hepatitis (PDF, 90 ... liver. Source: National Cancer Institute Learn more about hepatitis Watch a video. Learn who is at risk ...

  6. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  7. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  8. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  9. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  10. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  11. Mechanism of membranous tunnelling nanotube formation in viral genome delivery.

    Directory of Open Access Journals (Sweden)

    Bibiana Peralta

    2013-09-01

    Full Text Available In internal membrane-containing viruses, a lipid vesicle enclosed by the icosahedral capsid protects the genome. It has been postulated that this internal membrane is the genome delivery device of the virus. Viruses built with this architectural principle infect hosts in all three domains of cellular life. Here, using a combination of electron microscopy techniques, we investigate bacteriophage PRD1, the best understood model for such viruses, to unveil the mechanism behind the genome translocation across the cell envelope. To deliver its double-stranded DNA, the icosahedral protein-rich virus membrane transforms into a tubular structure protruding from one of the 12 vertices of the capsid. We suggest that this viral nanotube exits from the same vertex used for DNA packaging, which is biochemically distinct from the other 11. The tube crosses the capsid through an aperture corresponding to the loss of the peripentonal P3 major capsid protein trimers, penton protein P31 and membrane protein P16. The remodeling of the internal viral membrane is nucleated by changes in osmolarity and loss of capsid-membrane interactions as consequence of the de-capping of the vertices. This engages the polymerization of the tail tube, which is structured by membrane-associated proteins. We have observed that the proteo-lipidic tube in vivo can pierce the gram-negative bacterial cell envelope allowing the viral genome to be shuttled to the host cell. The internal diameter of the tube allows one double-stranded DNA chain to be translocated. We conclude that the assembly principles of the viral tunneling nanotube take advantage of proteo-lipid interactions that confer to the tail tube elastic, mechanical and functional properties employed also in other protein-membrane systems.

  12. Identification of forensically important Chrysomya (Diptera: Calliphoridae) species using the second ribosomal internal transcribed spacer (ITS2).

    Science.gov (United States)

    Nelson, Leigh A; Wallman, James F; Dowton, Mark

    2008-05-20

    The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.

  13. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  14. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  15. Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

    Science.gov (United States)

    Tosto, D S; Hopp, H E

    1996-01-01

    The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

  16. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  17. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  18. Selection of antigenic markers on a GFP-Cκ fusion scaffold with high sensitivity by eukaryotic ribosome display

    International Nuclear Information System (INIS)

    Yang Yongmin; Barankiewicz, Teresa J.; He Mingyue; Taussig, Michael J.; Chen, Swey-Shen

    2007-01-01

    Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (Cκ) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or Cκ (3') were selected by anti-GFP or anti-Cκ antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins

  19. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  20. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  1. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  2. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  3. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  4. Viral entry pathways: the example of common cold viruses.

    Science.gov (United States)

    Blaas, Dieter

    2016-05-01

    For infection, viruses deliver their genomes into the host cell. These nucleic acids are usually tightly packed within the viral capsid, which, in turn, is often further enveloped within a lipid membrane. Both protect them against the hostile environment. Proteins and/or lipids on the viral particle promote attachment to the cell surface and internalization. They are likewise often involved in release of the genome inside the cell for its use as a blueprint for production of new viruses. In the following, I shall cursorily discuss the early more general steps of viral infection that include receptor recognition, uptake into the cell, and uncoating of the viral genome. The later sections will concentrate on human rhinoviruses, the main cause of the common cold, with respect to the above processes. Much of what is known on the underlying mechanisms has been worked out by Renate Fuchs at the Medical University of Vienna.

  5. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  6. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  7. Regulatory RNPs: a novel class of ribonucleoproteins that potentially contribute to ribosome heterogeneity

    Directory of Open Access Journals (Sweden)

    Aaron R. Poole

    2017-09-01

    Full Text Available Many ribonucleoproteins (RNPs, which are comprised of noncoding RNA and associated proteins, are involved in essential cellular processes such as translation and pre-mRNA splicing. One class of RNP is the small Cajal body-specific RNP (scaRNP, which contributes to the biogenesis of small nuclear RNPs (snRNPs that are central components of the spliceosome. Three scaRNAs are internally processed, generating stable nucleolus-enriched RNAs of unknown function. Here, we provide data that show that these RNAs become part of RNPs we term regulatory RNPs (regRNPs. Most modifications within rRNA (predominantly pseudouridylation and ribose 2′-O-methylation are conducted by small nucleolar RNPs (snoRNPs, and we provide evidence that the activity of at least some of these snoRNPs is under the control of regRNPs. Because modifications within rRNA can vary in different physiological or pathological situations, rRNA modifications are thought to be the major source of ribosome heterogeneity. Our identification of regRNPs thus provides a potential mechanism for how ribosome heterogeneity may be accomplished. This work also provides additional functional connections between the Cajal body and the nucleolus.

  8. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  9. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  10. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  11. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  12. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  13. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  14. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  15. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  16. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  18. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Selection of antigenic markers on a GFP-C{kappa} fusion scaffold with high sensitivity by eukaryotic ribosome display

    Energy Technology Data Exchange (ETDEWEB)

    Yongmin, Yang [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Barankiewicz, Teresa J [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Mingyue, He [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Taussig, Michael J [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Chen, Swey-Shen [Institute of Genetics, San Diego, CA 92121-2233 (United States) and IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States)

    2007-07-27

    Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.

  1. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  2. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.

    2011-01-01

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  3. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  4. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  5. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  6. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  7. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  8. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  10. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  11. Viral IRES prediction system - a web server for prediction of the IRES secondary structure in silico.

    Directory of Open Access Journals (Sweden)

    Jun-Jie Hong

    Full Text Available The internal ribosomal entry site (IRES functions as cap-independent translation initiation sites in eukaryotic cells. IRES elements have been applied as useful tools for bi-cistronic expression vectors. Current RNA structure prediction programs are unable to predict precisely the potential IRES element. We have designed a viral IRES prediction system (VIPS to perform the IRES secondary structure prediction. In order to obtain better results for the IRES prediction, the VIPS can evaluate and predict for all four different groups of IRESs with a higher accuracy. RNA secondary structure prediction, comparison, and pseudoknot prediction programs were implemented to form the three-stage procedure for the VIPS. The backbone of VIPS includes: the RNAL fold program, aimed to predict local RNA secondary structures by minimum free energy method; the RNA Align program, intended to compare predicted structures; and pknotsRG program, used to calculate the pseudoknot structure. VIPS was evaluated by using UTR database, IRES database and Virus database, and the accuracy rate of VIPS was assessed as 98.53%, 90.80%, 82.36% and 80.41% for IRES groups 1, 2, 3, and 4, respectively. This advance useful search approach for IRES structures will facilitate IRES related studies. The VIPS on-line website service is available at http://140.135.61.250/vips/.

  12. Experimental Analysis of Mimivirus Translation Initiation Factor 4a Reveals Its Importance in Viral Protein Translation during Infection of Acanthamoeba polyphaga.

    Science.gov (United States)

    Bekliz, Meriem; Azza, Said; Seligmann, Hervé; Decloquement, Philippe; Raoult, Didier; La Scola, Bernard

    2018-05-15

    The Acanthamoeba polyphaga mimivirus is the first giant virus ever described, with a 1.2-Mb genome which encodes 979 proteins, including central components of the translation apparatus. One of these proteins, R458, was predicted to initiate translation, although its specific role remains unknown. We silenced the R458 gene using small interfering RNA (siRNA) and compared levels of viral fitness and protein expression in silenced versus wild-type mimivirus. Silencing decreased the growth rate, but viral particle production at the end of the viral cycle was unaffected. A comparative proteomic approach using two-dimensional difference-in-gel electrophoresis (2D-DIGE) revealed deregulation of the expression of 32 proteins in silenced mimivirus, which were defined as up- or downregulated. Besides revealing proteins with unknown functions, silencing R458 also revealed deregulation in proteins associated with viral particle structures, transcriptional machinery, oxidative pathways, modification of proteins/lipids, and DNA topology/repair. Most of these proteins belong to genes transcribed at the end of the viral cycle. Overall, our data suggest that the R458 protein regulates the expression of mimivirus proteins and, thus, that mimivirus translational proteins may not be strictly redundant in relation to those from the amoeba host. As is the case for eukaryotic initiation factor 4a (eIF4a), the R458 protein is the prototypical member of the ATP-dependent DEAD box RNA helicase mechanism. We suggest that the R458 protein is required to unwind the secondary structures at the 5' ends of mRNAs and to bind the mRNA to the ribosome, making it possible to scan for the start codon. These data are the first experimental evidence of mimivirus translation-related genes, predicted to initiate protein biosynthesis. IMPORTANCE The presence in the genome of a mimivirus of genes coding for many translational processes, with the exception of ribosome constituents, has been the subject of

  13. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  14. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. IRESite - a Tool for The Examination of Viral and Cellular Internal Ribosome Entry Sites

    Czech Academy of Sciences Publication Activity Database

    Mokrejš, M.; Mašek, T.; Vopálenský, V.; Hlubuček, P.; Delbos, P.; Pospíšek, Martin

    2010-01-01

    Roč. 38, DB Issue (2010), D131-D136 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) 1M06014 Grant - others:GA MŠk(CZ) LC06066; GA ČR(CZ) GA301/07/0607 Program:LC Keywords : IRESite * IRES * translation * virus * database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.836, year: 2010

  16. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  17. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  18. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  19. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  20. Characterization of viral proteins of Oryctes baculovirus and comparison between two geographical isolates.

    Science.gov (United States)

    Mohan, K S; Gopinathan, K P

    1989-01-01

    Bacilliform Oryctes baculovirus particles have been visualized in electron micrographs of midgut sections from virus infected Oryctes rhinoceros beetles. Morphologically the Indian isolate (Oryctes baculovirus, KI) resembled the previously reported Oryctes baculovirus, isolate PV505. The constituent proteins of baculovirus KI have been analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and by Western blots using polyclonal antibodies raised against the complete viral particles, as probes. A total of forty eight viral proteins have been identified. Fourteen viral proteins were located on the viral envelope. Among the proteins constituting the nucleocapsid, three were located internally within the capsid. A 23.5 kDa protein was tightly associated with viral DNA in the nucleocapsid core. Two envelope and seven capsid proteins of KI and PV505 revealed differences in SDS-PAGE profiles and glycosylation patterns. Immunoblotting of KI and PV505 proteins with anti KI antiserum demonstrated antigenic differences between the two viral isolates.

  1. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  2. Late presentation of chronic viral hepatitis for medical care

    DEFF Research Database (Denmark)

    Mauss, Stefan; Pol, Stanislas; Buti, Maria

    2017-01-01

    , and relevant stakeholders including patient advocacy groups, health policy-makers, international health organisations and surveillance experts, met in 2014 and 2015 to develop a draft consensus definition of late presentation with viral hepatitis for medical care. This was refined through subsequent...... consultations among the group. RESULTS: Two definitions were agreed upon. Presentation with advanced liver disease caused by chronic viral hepatitis for medical care is defined as a patient with chronic hepatitis B and C and significant fibrosis (≥ F3 assessed by either APRI score > 1.5, FIB-4 > 3.25, Fibrotest...

  3. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  4. Construction of an internal amplification control for Mycobacterium ...

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... million and 10 bacteria and the most suitable internal control concentration for the mix was ... But the risk of contamination is unavoidable in normal ..... Contamination Management: Implication for Broad-Range Ribosomal.

  5. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  6. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  7. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  8. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  9. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  10. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  11. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  12. Pharyngitis - viral

    Science.gov (United States)

    ... throat is due to a viral infection. The antibiotics will not help. Using them to treat viral infections helps bacteria become resistant to antibiotics. With some sore throats (such as those caused ...

  13. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  14. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  15. Viral Meningitis

    Science.gov (United States)

    ... better from treatment such as an antiviral medicine. Antibiotics do not help viral infections, so they are not useful in the treatment of viral meningitis. However, antibiotics do fight bacteria, so they are very important ...

  16. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  17. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  18. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  19. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  20. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  1. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  2. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  3. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  4. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  5. Transcriptome analysis of the Spodoptera frugiperda ascovirus in vivo provides insights into how its apoptosis inhibitors and caspase promote increased synthesis of viral vesicles and virion progeny.

    Science.gov (United States)

    Zaghloul, Heba; Hice, Robert; Arensburger, Peter; Federici, Brian A

    2017-09-27

    that continue to produce virions. Our transcriptome analysis of genome expression in vivo by the Spodoptera frugiperda ascovirus shows that inhibitors of apoptosis are expressed first enabling viral replication to proceed, after which the SfAV-1a caspase is synthesized, leading to viral vesicle synthesis and subsequent extensive production of progeny virions. Moreover, we detected numerous bicistronic and tricistronic mRNA messages in the ascovirus transcriptome, implying ascoviruses use other non-canonical translational mechanisms such as Internal Ribosome Entry Site (IRES). These results provide the first insights into the molecular biology of a unique coordinated gene expression pattern in which cell architecture is markedly modified, more than in any other known eukaryotic virus, to promote viral reproduction and transmission. Copyright © 2017 American Society for Microbiology.

  6. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  7. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  9. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  10. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  11. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  12. Genetic analyses of ribosomal loci of Anopheles minimus species from north east India.

    Science.gov (United States)

    Dutta, P; Khan, S A; Topno, R; Chowdhury, P; Baishya, M; Prakash, A; Bhattacharyya, D R; Mahanta, J

    2013-09-01

    Anopheles minimus is one of the major vectors for transmission of malaria disease in north eastern (NE) region of India. The minimus species complex of Minimus subgroup of Myzomyia series of anophelines were studied in malaria affected states--Assam and Arunachal Pradesh (AP) of NE India. Ribosomal DNA markers--second internal transcribed spacer (ITS2) and third domain (D3) of 28S gene were used to characterize An. minimus species. Sequence homogeneity was observed in D3 sequences of An.minimus specimens throughout both the states. However, a transversion in ITS2 sequence of single specimen collected from Assam-Meghalaya border areas illustrates possibility of intra population polymorphism in ITS2 sequence within the geographical region.

  13. Vipie: web pipeline for parallel characterization of viral populations from multiple NGS samples.

    Science.gov (United States)

    Lin, Jake; Kramna, Lenka; Autio, Reija; Hyöty, Heikki; Nykter, Matti; Cinek, Ondrej

    2017-05-15

    Next generation sequencing (NGS) technology allows laboratories to investigate virome composition in clinical and environmental samples in a culture-independent way. There is a need for bioinformatic tools capable of parallel processing of virome sequencing data by exactly identical methods: this is especially important in studies of multifactorial diseases, or in parallel comparison of laboratory protocols. We have developed a web-based application allowing direct upload of sequences from multiple virome samples using custom parameters. The samples are then processed in parallel using an identical protocol, and can be easily reanalyzed. The pipeline performs de-novo assembly, taxonomic classification of viruses as well as sample analyses based on user-defined grouping categories. Tables of virus abundance are produced from cross-validation by remapping the sequencing reads to a union of all observed reference viruses. In addition, read sets and reports are created after processing unmapped reads against known human and bacterial ribosome references. Secured interactive results are dynamically plotted with population and diversity charts, clustered heatmaps and a sortable and searchable abundance table. The Vipie web application is a unique tool for multi-sample metagenomic analysis of viral data, producing searchable hits tables, interactive population maps, alpha diversity measures and clustered heatmaps that are grouped in applicable custom sample categories. Known references such as human genome and bacterial ribosomal genes are optionally removed from unmapped ('dark matter') reads. Secured results are accessible and shareable on modern browsers. Vipie is a freely available web-based tool whose code is open source.

  14. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  15. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  16. Detection of viral hemorrhagic septicemia virus

    Science.gov (United States)

    Winton, James; Kurath, Gael; Batts, William

    2007-01-01

    Viral hemorrhagic septicemia virus (VHSV) is considered to be one of the most important viral pathogens of finfish and is listed as reportable by many nations and international organizations (Office International des Epizooties 2006). Prior to 1988, VHSV was thought to be limited to Europe (Wolf 1988; Smail 1999). Subsequently, it was shown that the virus is endemic among many marine and anadromous fish species in both the Pacific and Atlantic Oceans (Meyers and Winton 1995; Skall et al. 2005). Genetic analysis reveals that isolates of VHSV can be divided into four genotypes that generally correlate with geographic location with the North American isolates generally falling into VHSV Genotype IV (Snow et al. 2004). In 2005-2006, reports from the Great Lakes region indicated that wild fish had experienced disease or, in some cases, very large die-offs from VHSV (Elsayed et al. 2006, Lumsden et al. 2007). The new strain from the Great Lakes, now identified as VHSV Genotype IVb, appears most closely related to isolates of VHSV from mortalities that occurred during 2000-2004 in rivers and near-shore areas of New Brunswick and Nova Scotia, Canada (Gagne et al. 2007). The type IVb isolate found in the Great Lakes region is the only strain outside of Europe that has been associated with significant mortality in freshwater species.

  17. Hepatitis viral aguda

    Directory of Open Access Journals (Sweden)

    Héctor Rubén Hernández Garcés

    1998-10-01

    Full Text Available Se realizó una revisión bibliográfica de las hepatitis virales agudas sobre aspectos vinculados a su etiología. Se tuvieron en cuenta además algunos datos epidemiológicos, las formas clínicas más importantes, los exámenes complementarios con especial énfasis en los marcadores virales y el diagnóstico positivoA bibliographical review of acute viral hepatitis was made taking into account those aspects connected with its etiology. Some epidemiological markers, the most important clinical forms, and the complementary examinations with special emphasis on the viral markers and the positive diagnosis were also considered

  18. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  19. Virale commercials: de consument als marketeer. Onderzoek naar de redenen waarom consumenten virale commercials doorsturen: hun motieven, de inhoudskenmerken van viral commercials en de mediumcontext waarin virale commercials verschijnen

    NARCIS (Netherlands)

    Ketelaar, P.E.; Lucassen, P.; Kregting, G.H.J.

    2010-01-01

    Research into the reasons why consumers pass along viral commercials: their motives, the content characteristics of viral commercials and the medium context in which viral commercials appear. Based on the uses and gratifications perspective this study has determined which motives of consumers,

  20. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  1. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.

    Science.gov (United States)

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi

    2004-01-01

    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  3. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  4. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  5. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  6. Viral Disease Networks?

    Science.gov (United States)

    Gulbahce, Natali; Yan, Han; Vidal, Marc; Barabasi, Albert-Laszlo

    2010-03-01

    Viral infections induce multiple perturbations that spread along the links of the biological networks of the host cells. Understanding the impact of these cascading perturbations requires an exhaustive knowledge of the cellular machinery as well as a systems biology approach that reveals how individual components of the cellular system function together. Here we describe an integrative method that provides a new approach to studying virus-human interactions and its correlations with diseases. Our method involves the combined utilization of protein - protein interactions, protein -- DNA interactions, metabolomics and gene - disease associations to build a ``viraldiseasome''. By solely using high-throughput data, we map well-known viral associated diseases and predict new candidate viral diseases. We use microarray data of virus-infected tissues and patient medical history data to further test the implications of the viral diseasome. We apply this method to Epstein-Barr virus and Human Papillomavirus and shed light into molecular development of viral diseases and disease pathways.

  7. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  8. Investigating the effective factors on electronic trade by viral marketing

    Directory of Open Access Journals (Sweden)

    Nina Ghane

    2014-04-01

    Full Text Available This paper performs an investigation to explore a number of strategies underpinning virtual marketing. The study also provides several suggestions for marketers seeking to use viral marketing to position brands or to change a brand’s image, to encourage new product trials and to increase product uptake rates. In this article, we investigate the effect of external factors such as capturing the imagination, targeting credible sources, leveraging combinations of technology and easy to use product on virtual marketing. In addition, the study considers internal factors such as inclusion (the need to be part of a group, the need to be different and affection on viral marketing. The survey has been accomplished among 140 Iranian people, who were familiar with virtual marketing and they are selected, randomly. Using Pearson correlation as well as regression analysis, the study provides some evidences that there were some positive and meaningful relationship between some internal/external factors and virtual marketing.

  9. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  10. Plant Ribosome-Inactivating Proteins: Progesses, Challenges and Biotechnological Applications (and a Few Digressions

    Directory of Open Access Journals (Sweden)

    Maria Serena Fabbrini

    2017-10-01

    Full Text Available Plant ribosome-inactivating protein (RIP toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric and type II (dimeric as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA, they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications.

  11. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  12. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  13. Low variation in ribosomal DNA and internal transcribed spacers of the symbiotic fungi of leaf-cutting ants (Attini: Formicidae

    Directory of Open Access Journals (Sweden)

    Silva-Pinhati A.C.O.

    2004-01-01

    Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.

  14. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  15. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  16. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  17. Mobil Viral Pazarlama

    OpenAIRE

    Barutçu, Süleyman

    2011-01-01

    OBJECTIVE: Mobile Viral Marketing, with using mobile phones, is one of the most importantinnovations after Word of Mouth Marketing performed by face to face amongpeople and Viral Marketing performed in the İnternet. The main objective of thisstudy is to call marketing communicators’ and academicians’ attentions whowant to increase the recognition of companies’ products, services and brands tobecome a current issue in the marketplace using Mobile Viral Marketingapplications by reason of techno...

  18. Emerging infectious diseases with cutaneous manifestations: Viral and bacterial infections.

    Science.gov (United States)

    Nawas, Zeena Y; Tong, Yun; Kollipara, Ramya; Peranteau, Andrew J; Woc-Colburn, Laila; Yan, Albert C; Lupi, Omar; Tyring, Stephen K

    2016-07-01

    Given increased international travel, immigration, and climate change, bacterial and viral infections that were once unrecognized or uncommon are being seen more frequently in the Western Hemisphere. A delay in diagnosis and treatment of these diseases can lead to significant patient morbidity and mortality. However, the diagnosis and management of these infections is fraught with a lack of consistency because there is a dearth of dermatology literature on the cutaneous manifestations of these infections. We review the epidemiology, cutaneous manifestations, diagnosis, and management of these emerging bacterial and viral diseases. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  19. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  20. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  1. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  2. Understanding Image Virality

    Science.gov (United States)

    2015-06-07

    Example non-viral images. Figure 1: Top: Images with high viral scores in our dataset depict internet “celebrity” memes ex. “Grumpy Cat”; Bottom: Images...of images that is most similar to ours is the concurrently introduced viral meme generator of Wang et al., that combines NLP and Computer Vision (low...doing any of our tasks. The test included questions about widely spread Reddit memes and jargon so that anyone familiar with Reddit can easily get a high

  3. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  4. High Relaxivity Gadolinium Hydroxypyridonate-Viral Capsid Conjugates: Nano-sized MRI Contrast Agents

    Energy Technology Data Exchange (ETDEWEB)

    Meux, Susan C.; Datta, Ankona; Hooker, Jacob M.; Botta, Mauro; Francis, Matthew B.; Aime, Silvio; Raymond, Kenneth N.

    2007-08-29

    High relaxivity macromolecular contrast agents based on the conjugation of gadolinium chelates to the interior and exterior surfaces of MS2 viral capsids are assessed. The proton nuclear magnetic relaxation dispersion (NMRD) profiles of the conjugates show up to a five-fold increase in relaxivity, leading to a peak relaxivity (per Gd{sup 3+} ion) of 41.6 mM{sup -1}s{sup -1} at 30 MHz for the internally modified capsids. Modification of the exterior was achieved through conjugation to flexible lysines, while internal modification was accomplished by conjugation to relatively rigid tyrosines. Higher relaxivities were obtained for the internally modified capsids, showing that (1) there is facile diffusion of water to the interior of capsids and (2) the rigidity of the linker attaching the complex to the macromolecule is important for obtaining high relaxivity enhancements. The viral capsid conjugated gadolinium hydroxypyridonate complexes appear to possess two inner-sphere water molecules (q = 2) and the NMRD fittings highlight the differences in the local motion for the internal ({tau}{sub RI} = 440 ps) and external ({tau}{sub RI} = 310 ps) conjugates. These results indicate that there are significant advantages of using the internal surface of the capsids for contrast agent attachment, leaving the exterior surface available for the installation of tissue targeting groups.

  5. The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites

    International Nuclear Information System (INIS)

    Rivas-Aravena, Andrea; Ramdohr, Pablo; Vallejos, Maricarmen; Valiente-Echeverria, Fernando; Dormoy-Raclet, Virginie; Rodriguez, Felipe; Pino, Karla; Holzmann, Cristian; Huidobro-Toro, J. Pablo; Gallouzi, Imed-Eddine; Lopez-Lastra, Marcelo

    2009-01-01

    The human embryonic-lethal abnormal vision (ELAV)-like protein, HuR, has been recently found to be involved in the regulation of protein synthesis. In this study we show that HuR participates in the translational control of the HIV-1 and HCV IRES elements. HuR functions as a repressor of HIV-1 IRES activity and acts as an activator of the HCV IRES. The effect of HuR was evaluated in three independent experimental systems, rabbit reticulocyte lysate, HeLa cells, and Xenopus laevis oocytes, using both overexpression and knockdown approaches. Furthermore, results suggest that HuR mediated regulation of HIV-1 and HCV IRESes does not require direct binding of the protein to the RNA nor does it need the nuclear translocation of the IRES-containing RNAs. Finally, we show that HuR has a negative impact on post-integration steps of the HIV-1 replication cycle. Thus, our observations yield novel insights into the role of HuR in the post-transcriptional regulation of HCV and HIV-1 gene expression.

  6. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  8. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  9. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  10. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  11. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  13. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  14. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  15. An exit cavity was crucial to the polymerase activity of the early ribosome.

    Science.gov (United States)

    Fox, George E; Tran, Quyen; Yonath, Ada

    2012-01-01

    The emergence of an RNA entity capable of synthesizing peptides was a key prebiotic development. It is hypothesized that a precursor of the modern ribosomal exit tunnel was associated with this RNA entity (e.g., "protoribosome" or "bonding entity") from the earliest time and played an essential role. Various compounds that can bind and activate amino acids, including extremely short RNA chains carrying amino acids, and possibly di- or tripeptides, would have associated with the internal cavity of the protoribosome. This cavity hosts the site for peptide bond formation and adjacent to it a relatively elongated feature that could have evolved to the modern ribosomal exit tunnel, as it is wide enough to allow passage of an oligopeptide. When two of the compounds carrying amino acids or di- or tripeptides (to which we refer, for simplicity, as small aminoacylated RNAs) were in proximity within the heart of the protoribosome, a peptide bond could form spontaneously. The growing peptide would enter the nearby cavity and would not disrupt the attachment of the substrates to the protoribosome or interfere with the subsequent attachment of additional small aminoacylated RNAs. Additionally, the presence of the peptide in the cavity would increase the lifetime of the oligopeptide in the protoribosome. Thus, subsequent addition of another amino acid would be more likely than detachment from the protoribosome, and synthesis could continue. The early ability to synthesize peptides may have resulted in an abbreviated RNA World.

  16. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  17. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  18. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  19. Emergence of robust growth laws from optimal regulation of ribosome synthesis.

    Science.gov (United States)

    Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence

    2014-08-22

    Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  20. Bile acids for viral hepatitis

    DEFF Research Database (Denmark)

    Chen, Weikeng; Liu, J; Gluud, C

    2003-01-01

    The viral hepatitides are common causes of liver diseases globally. Trials have assessed bile acids for patients with viral hepatitis, but no consensus was reached regarding their usefulness.......The viral hepatitides are common causes of liver diseases globally. Trials have assessed bile acids for patients with viral hepatitis, but no consensus was reached regarding their usefulness....

  1. Viral hemorrhagic septicemia

    Science.gov (United States)

    Batts, William N.; Winton, James R.

    2012-01-01

    Viral hemorrhagic septicemia (VHS) is one of the most important viral diseases of finfish worldwide. In the past, VHS was thought to affect mainly rainbow trout Oncorhynchus mykiss reared at freshwater facilities in Western Europe where it was known by various names including Egtved disease and infectious kidney swelling and liver degeneration (Wolf 1988). Today, VHS is known as an important source of mortality for cultured and wild fish in freshwater and marine environments in several regions of the northern hemisphere (Dixon 1999; Gagné et al. 2007; Kim and Faisal 2011; Lumsden et al. 2007; Marty et al. 1998, 2003; Meyers and Winton 1995; Skall et al. 2005b; Smail 1999; Takano et al. 2001). Viral hemorrhagic septicemia is caused by the fish rhabdovirus, viral hemorrhagic septicemia virus (VHSV), a member of the genus Novirhabdovirus of the family Rhabdoviridae

  2. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  3. ViralORFeome: an integrated database to generate a versatile collection of viral ORFs.

    Science.gov (United States)

    Pellet, J; Tafforeau, L; Lucas-Hourani, M; Navratil, V; Meyniel, L; Achaz, G; Guironnet-Paquet, A; Aublin-Gex, A; Caignard, G; Cassonnet, P; Chaboud, A; Chantier, T; Deloire, A; Demeret, C; Le Breton, M; Neveu, G; Jacotot, L; Vaglio, P; Delmotte, S; Gautier, C; Combet, C; Deleage, G; Favre, M; Tangy, F; Jacob, Y; Andre, P; Lotteau, V; Rabourdin-Combe, C; Vidalain, P O

    2010-01-01

    Large collections of protein-encoding open reading frames (ORFs) established in a versatile recombination-based cloning system have been instrumental to study protein functions in high-throughput assays. Such 'ORFeome' resources have been developed for several organisms but in virology, plasmid collections covering a significant fraction of the virosphere are still needed. In this perspective, we present ViralORFeome 1.0 (http://www.viralorfeome.com), an open-access database and management system that provides an integrated set of bioinformatic tools to clone viral ORFs in the Gateway(R) system. ViralORFeome provides a convenient interface to navigate through virus genome sequences, to design ORF-specific cloning primers, to validate the sequence of generated constructs and to browse established collections of virus ORFs. Most importantly, ViralORFeome has been designed to manage all possible variants or mutants of a given ORF so that the cloning procedure can be applied to any emerging virus strain. A subset of plasmid constructs generated with ViralORFeome platform has been tested with success for heterologous protein expression in different expression systems at proteome scale. ViralORFeome should provide our community with a framework to establish a large collection of virus ORF clones, an instrumental resource to determine functions, activities and binding partners of viral proteins.

  4. UGGT1 enhances enterovirus 71 pathogenicity by promoting viral RNA synthesis and viral replication.

    Directory of Open Access Journals (Sweden)

    Peng-Nien Huang

    2017-05-01

    Full Text Available Positive-strand RNA virus infections can induce the stress-related unfolded protein response (UPR in host cells. This study found that enterovirus A71 (EVA71 utilizes host UDP-glucose glycoprotein glucosyltransferase 1 (UGGT1, a key endoplasmic reticulum protein (ER involved in UPR, to enhance viral replication and virulence. EVA71 forms replication complexes (RCs on cellular membranes that contain a mix of host and viral proteins to facilitate viral replication, but the components and processes involved in the assembly and function of RCs are not fully understood. Using EVA71 as a model, this study found that host UGGT1 and viral 3D polymerase co-precipitate along with other factors on membranous replication complexes to enhance viral replication. Increased UGGT1 levels elevated viral growth rates, while viral pathogenicity was observed to be lower in heterozygous knockout mice (Uggt1 +/- mice. These findings provide important insight on the role of UPR and host UGGT1 in regulating RNA virus replication and pathogenicity.

  5. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  6. Oblongifolin M, an active compound isolated from a Chinese medical herb Garcinia oblongifolia, potently inhibits enterovirus 71 reproduction through downregulation of ERp57.

    Science.gov (United States)

    Wang, Mengjie; Dong, Qi; Wang, Hua; He, Yaqing; Chen, Ying; Zhang, Hong; Wu, Rong; Chen, Xinchun; Zhou, Boping; He, Jason; Kung, Hsiang-Fu; Huang, Canhua; Wei, Yuquan; Huang, Jian-dong; Xu, Hongxi; He, Ming-Liang

    2016-02-23

    There is no effective drug to treat EV71 infection yet. Traditional Chinese herbs are great resources for novel antiviral compounds. Here we showed that Oblongifolin M (OM), an active compound isolated from Garcinia oblongifolia, potently inhibited EV71 infection in a dose dependent manner. To identify its potential effectors in the host cells, we successfully identified 18 proteins from 52 differentially expressed spots by comparative proteomics studies. Further studies showed that knockdown of ERp57 inhibited viral replication through downregulating viral IRES (internal ribosome entry site) activities, whereas ectopic expression of ERp57 increased IRES activity and partly rescued the inhibitory effects of OM on viral replication. We demonstrated that OM is an effective antiviral agent; and that ERp57 is one of its cellular effectors against EV71 infection.

  7. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Viral Marketing

    OpenAIRE

    Sorina Raula Gîrboveanu; Silvia Puiu

    2008-01-01

    With consumers showing increasing resistance to traditional forms of advertising such as TV or newspaper ads, marketers have turned to alternate strategies, including viral marketing. Viral marketing exploits existing social networks by encouraging customers to share product information with their friends.In our study we are able to directly observe the effectiveness of person to person word of mouth advertising for hundreds of thousands of products for the first time

  10. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  11. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  12. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  13. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  15. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  16. Value of Sharing: Viral Advertisement

    OpenAIRE

    Duygu Aydın; Aşina Gülerarslan; Süleyman Karaçor; Tarık Doğan

    2013-01-01

    Sharing motivations of viral advertisements by consumers and the impacts of these advertisements on the perceptions for brand will be questioned in this study. Three fundamental questions are answered in the study. These are advertisement watching and sharing motivations of individuals, criteria of liking viral advertisement and the impact of individual attitudes for viral advertisement on brand perception respectively. This study will be carried out via a viral advertise...

  17. Viral Marketing and Academic Institution

    OpenAIRE

    Koktová, Silvie

    2010-01-01

    This bachelor thesis examines modern and constantly developing kind of internet marketing -- the so called viral marketing. It deals with its origin, principle, process, advantages and disadvantages, types of viral marketing and presumptions of creating successful viral campaign. The aim of the theoretical part is especially the understanding of viral marketing as one of the effective instruments of contemporary marketing. In this theoretical part the thesis also elaborates a marketing school...

  18. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    Science.gov (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  19. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  20. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  1. [Emergent viral infections

    NARCIS (Netherlands)

    Galama, J.M.D.

    2001-01-01

    The emergence and re-emergence of viral infections is an ongoing process. Large-scale vaccination programmes led to the eradication or control of some viral infections in the last century, but new viruses are always emerging. Increased travel is leading to a rise in the importation of exotic

  2. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  3. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  4. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

    Science.gov (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

    2017-12-01

    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  5. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  6. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  8. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  9. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  11. The epidemiology of viral hepatitis in Qatar

    Directory of Open Access Journals (Sweden)

    Bener Abdulbari

    2009-01-01

    Full Text Available Viral hepatitis is a major public health problem in many countries all over the world and especially in Middle East, Asia, East-Europe, and Africa. The aim of our study was to assess the incidence of viral hepatitis A, B and C in Qatar and compare it with other countries. This is a retrospective cohort study, which was conducted at Hamad General Hospital, State of Qatar from 2002-2006. Patients who were screened and diagnosed with viral hepatitis were included in this study. The diagnostic classification of definite viral hepatitis was made in accordance with criteria based on the International Classification of Disease tenth revision (ICD-10. A total of 527 cases of hepatitis C, 396 cases of hepatitis B, 162 cases of hepatitis A and 108 cases of unspecified were reported during the year 2006. Reported incidence rate per 10,000 populations during the year 2006 for hepatitis A was 1.9, hepatitis B 4.7, and Hepatitis C 6.3. The proportion of hepatitis B and C was significantly higher in male population than females across the years (2002-2006. Hepatitis A was more prevalent in children below 15 years (72.3%, hepatitis B in adults aged above 15 years, and hepatitis C in the population above 35 years of age. The incidence of hepatitis A has been declining in Qataris and increasing in expatriates. There was a significant relationship in gender and age group of the patients with hepatitis A, B and C. We conclude that hepatitis has become a national health issue in Qatar. The incidence rate of hepatitis in Qatar is comparable to its neighboring countries, United Arab Emirates and Saudi Arabia. There is a need for further research on hepatitis and the associated risk factors.

  12. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  13. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  14. Safety of the novel influenza viral vector Brucella abortus vaccine in pregnant heifers

    Directory of Open Access Journals (Sweden)

    Kaissar Tabynov

    2016-01-01

    Full Text Available ABSTRACT: The present study provides the first information about the safety of a new influenza viral vector vaccine expressing the Brucella ribosomal protein L7/L12 or Omp16 containing the adjuvant Montanide Gel01 in pregnant heifers. Immunization of pregnant heifers was conducted via the conjunctival (n=10 or subcutaneous (n=10 route using cross prime and booster vaccination schedules at an interval of 28 days. The vector vaccine was evaluated in comparison with positive control groups vaccinated with B. abortus S19 (n=10 or B. abortus RB51 (n=10 and a negative (PBS+Montanide Gel01; n=10 control group. Clinical studies, thermometry, assessment of local reactogenicity and observation of abortion showed that the vector vaccine via the conjunctival or subcutaneous route was completely safe for pregnant heifers compared to the commercial vaccines B. abortus S19 or B. abortus RB51. The only single adverse event was the formation of infiltration at the site of subcutaneous injection; this reaction was not observed for the conjunctival route.

  15. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  16. Viral tRNA Mimicry from a Biocommunicative Perspective

    Directory of Open Access Journals (Sweden)

    Ascensión Ariza-Mateos

    2017-12-01

    Full Text Available RNA viruses have very small genomes which limits the functions they can encode. One of the strategies employed by these viruses is to mimic key factors of the host cell so they can take advantage of the interactions and activities these factors typically participate in. The viral RNA genome itself was first observed to mimic cellular tRNA over 40 years ago. Since then researchers have confirmed that distinct families of RNA viruses are accessible to a battery of cellular factors involved in tRNA-related activities. Recently, potential tRNA-like structures have been detected within the sequences of a 100 mRNAs taken from human cells, one of these being the host defense interferon-alpha mRNA; these are then additional to the examples found in bacterial and yeast mRNAs. The mimetic relationship between tRNA, cellular mRNA, and viral RNA is the central focus of two considerations described below. These are subsequently used as a preface for a final hypothesis drawing on concepts relating to mimicry from the social sciences and humanities, such as power relations and creativity. Firstly, the presence of tRNA-like structures in mRNAs indicates that the viral tRNA-like signal could be mimicking tRNA-like elements that are contextualized by the specific carrier mRNAs, rather than, or in addition to, the tRNA itself, which would significantly increase the number of potential semiotic relations mediated by the viral signals. Secondly, and in particular, mimicking a host defense mRNA could be considered a potential new viral strategy for survival. Finally, we propose that mRNA’s mimicry of tRNA could be indicative of an ancestral intracellular conflict in which species of mRNAs invaded the cell, but from within. As the meaning of the mimetic signal depends on the context, in this case, the conflict that arises when the viral signal enters the cell can change the meaning of the mRNAs’ internal tRNA-like signals, from their current significance to that

  17. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  19. Viral Management as a New Type of Enterprise Management in Coal Industry

    Science.gov (United States)

    Garafonova, Olga; Grigashkina, Svetlana; Zhosan, Anna

    2017-11-01

    The article considers the evolution of the concept of "management". The Internet analysis of the concept of "viral management" was conducted, the results of which testify to the positive trend, the growing interest in scientific circles, the relevance of the chosen direction for further research and the increasing popularity of the viral management among business leaders. The indices of coal and brown coal extraction in Ukraine and Russia for 2010-2016 are analyzed. Among the problems that exist in the coal industry are the following: mine assets have a high degree of deterioration; the equipment is rather obsolete and does not correspond to the world level; among the existing face equipment, the specific weight of longwall mining equipment, road headers, loading machines, and belt conveyors of the new generation is only several percent. Five steps of introduction of the virus management at the enterprise are identified: opening, development, participation, diffusion, sustainability. The principles of introduction of the viral management in the enterprises of the coal industry are offered. It is established that the main idea of the viral management is to "infect" the organization and, mainly, employees with one or another "virus" in the form of a common idea or goal. It is indicated that the viral management assumes a certain automaticity of changes, internal "obsession" with this or other innovation, involvement of an informal personal factor.

  20. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  1. Identification of an internal ribosome entry segment in the 5' region of the mouse VL30 retrotransposon and its use in the development of retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Ulrici, S; Gabus, C; Darlix, J L

    1999-10-01

    Mouse virus-like 30S RNAs (VL30m) constitute a family of retrotransposons, present at 100 to 200 copies, dispersed in the mouse genome. They display little sequence homology to Moloney murine leukemia virus (MoMLV), do not encode virus-like proteins, and have not been implicated in retroviral carcinogenesis. However, VL30 RNAs are efficiently packaged into MLV particles that are propagated in cell culture. In this study, we addressed whether the 5' region of VL30m could replace the 5' leader of MoMLV functionally in a recombinant vector construct. Our data confirm that the putative packaging sequence of VL30 is located within the 5' region (nucleotides 362 to 1149 with respect to the cap structure) and that it can replace the packaging sequence of MoMLV. We also show that VL30m contains an internal ribosome entry segment (IRES) in the 5' region, as do MoMLV, Friend murine leukemia virus, Harvey murine sarcoma virus, and avian reticuloendotheliosis virus type A. Our data show that both the packaging and IRES functions of the 5' region of VL30m RNA can be efficiently used to develop retrotransposon-based vectors.

  2. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  3. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  4. Analysis of host genetic diversity and viral entry as sources of between-host variation in viral load

    Science.gov (United States)

    Wargo, Andrew R.; Kell, Alison M.; Scott, Robert J.; Thorgaard, Gary H.; Kurath, Gael

    2012-01-01

    Little is known about the factors that drive the high levels of between-host variation in pathogen burden that are frequently observed in viral infections. Here, two factors thought to impact viral load variability, host genetic diversity and stochastic processes linked with viral entry into the host, were examined. This work was conducted with the aquatic vertebrate virus, Infectious hematopoietic necrosis virus (IHNV), in its natural host, rainbow trout. It was found that in controlled in vivo infections of IHNV, a suggestive trend of reduced between-fish viral load variation was observed in a clonal population of isogenic trout compared to a genetically diverse population of out-bred trout. However, this trend was not statistically significant for any of the four viral genotypes examined, and high levels of fish-to-fish variation persisted even in the isogenic trout population. A decrease in fish-to-fish viral load variation was also observed in virus injection challenges that bypassed the host entry step, compared to fish exposed to the virus through the natural water-borne immersion route of infection. This trend was significant for three of the four virus genotypes examined and suggests host entry may play a role in viral load variability. However, high levels of viral load variation also remained in the injection challenges. Together, these results indicate that although host genetic diversity and viral entry may play some role in between-fish viral load variation, they are not major factors. Other biological and non-biological parameters that may influence viral load variation are discussed.

  5. Laboratory procedures to generate viral metagenomes.

    Science.gov (United States)

    Thurber, Rebecca V; Haynes, Matthew; Breitbart, Mya; Wegley, Linda; Rohwer, Forest

    2009-01-01

    This collection of laboratory protocols describes the steps to collect viruses from various samples with the specific aim of generating viral metagenome sequence libraries (viromes). Viral metagenomics, the study of uncultured viral nucleic acid sequences from different biomes, relies on several concentration, purification, extraction, sequencing and heuristic bioinformatic methods. No single technique can provide an all-inclusive approach, and therefore the protocols presented here will be discussed in terms of hypothetical projects. However, care must be taken to individualize each step depending on the source and type of viral-particles. This protocol is a description of the processes we have successfully used to: (i) concentrate viral particles from various types of samples, (ii) eliminate contaminating cells and free nucleic acids and (iii) extract, amplify and purify viral nucleic acids. Overall, a sample can be processed to isolate viral nucleic acids suitable for high-throughput sequencing in approximately 1 week.

  6. Hepatitis A through E (Viral Hepatitis)

    Science.gov (United States)

    ... Treatment Eating, Diet, & Nutrition Clinical Trials Wilson Disease Hepatitis (Viral) View or Print All Sections What is Viral Hepatitis? Viral hepatitis is an infection that causes liver inflammation ...

  7. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  8. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C

    2012-10-01

    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  9. Adsorption of viral particles from the blood plasma of patients with viral hepatitis on nanodiamonds.

    Science.gov (United States)

    Baron, A V; Osipov, N V; Yashchenko, S V; Kokotukha, Yu A; Baron, I J; Puzyr, A P; Olkhovskiy, I A; Bondar, V S

    2016-07-01

    Adsorption of viral particles from the blood plasma of patients with viral hepatitis B and C on modified nanodiamonds (MNDs) was shown in the in vitro experiments. PCR method showed the treatment of plasma with MNDs leads to a decrease in the viral load by 2-3 orders of magnitude or more in both cases studied. These results make it possible to predict the applicability of MNDs for the development of new technologies of hemodialysis and plasmapheresis for binding and removal of viral particles from the blood of infected patients.

  10. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  11. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  12. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  13. Faktor Risiko Non Viral Pada Karsinoma Nasofaring

    Directory of Open Access Journals (Sweden)

    Sukri Rahman

    2015-09-01

    Full Text Available Abstrak           Latar belakang: Karsinoma nasofaring adalah tumor ganas epitel nasofaring yang sampai saat ini penyebabnya belum diketahui, infeksi virus Epstein Barr dilaporkan sebagai faktor dominan terjadinya karsinoma nasofaring tetapi faktor non viral juga berperan untuk timbulnya keganasan nasofaring. Tujuan: Untuk mengetahui faktor non viral  yang dapat meningkatkan kejadian karsinoma nasofaring sehingga dapat mencegah dan menghindari faktor-faktor non viral tersebut. Tinjauan Pustaka: Karsinoma nasofaring merupakan tumor ganas epitel nasofaring yang penyebabnya berhubungan dengan faktor viral dan non viral diantaranya asap rokok, ikan asin, formaldehid, genetik, asap kayu bakar , debu kayu, infeksi kronik telinga hidung tenggorok, alkohol dan obat tradisional. Kesimpulan: Pembuktian secara klinis dan ilmiah terhadap faktor non viral sebagai penyebab timbulnya karsinoma nasofaring masih belum dapat dijelaskan secara pasti. Faktor non viral merupakan salah satu faktor risiko yang dapat meningkatkan angka kejadian timbulnya keganasan nasofaring Kata kunci: karsinoma nasofaring, faktor risiko, non viral AbstractBackground: Nasopharyngeal carcinoma is a malignant epithelial nasopharyngeal tumor that until now the cause still unknown, Epstein barr virus infection had reported as predominant occurance of nasopharyngeal carcinoma but non viral factors may also contribute to the onset of the incidence of nasopharyngeal malignancy. Purpose: To find non viral factors that may increase the incidence of nasopharyngel carcinoma in order to prevent and avoid non-viral factors Literature: Nasopharyngeal carcinoma is a malignant tumor that causes nasopharyngeal epithelium associated with viral and non-viral factors such as cigarette smoke, salt fish, formaldehyde, genetic, wood smoke ,wood dust, ear nose throat chronic infections, alcohol, and traditional medicine. Conclusion: Clinically and scientifically proving the non-viral factors as

  14. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  15. Metabolism goes viral.

    Science.gov (United States)

    Miyake-Stoner, Shigeki J; O'Shea, Clodagh C

    2014-04-01

    Viral and cellular oncogenes converge in targeting critical protein interaction networks to reprogram the cellular DNA and protein replication machinery for pathological replication. In this issue, Thai et al. (2014) show that adenovirus E4ORF1 activates MYC glycolytic targets to induce a Warburg-like effect that converts glucose into nucleotides for viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  17. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  18. Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

    Energy Technology Data Exchange (ETDEWEB)

    deLivron, M.; Robinson, V

    2008-01-01

    BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

  19. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Scientific rationale for antiretroviral therapy in 2005: viral reservoirs and resistance evolution.

    Science.gov (United States)

    Siliciano, Robert F

    2005-01-01

    Hope for a cure for HIV-1 infection was dampened by the discovery of a latent form of the virus that persists in resting CD4+ cells. This reservoir of latently HIV-infected resting memory T cells represents an archive of viral genotypes produced in an individual from the onset of infection. Entry into the reservoir is stopped with suppressive antiretroviral therapy, but the archived viruses are capable of re-initiating active infections, are released continuously from this reservoir, and can cause viral rebound if antiretroviral therapy is stopped. Studies of residual low-level viremia (Robert F. Siliciano, MD, PhD, at the International AIDS Society-USA course in New York in March 2005.

  1. Viral Management as a New Type of Enterprise Management in Coal Industry

    Directory of Open Access Journals (Sweden)

    Garafonova Olga

    2017-01-01

    Full Text Available The article considers the evolution of the concept of “management”. The Internet analysis of the concept of “viral management” was conducted, the results of which testify to the positive trend, the growing interest in scientific circles, the relevance of the chosen direction for further research and the increasing popularity of the viral management among business leaders. The indices of coal and brown coal extraction in Ukraine and Russia for 2010-2016 are analyzed. Among the problems that exist in the coal industry are the following: mine assets have a high degree of deterioration; the equipment is rather obsolete and does not correspond to the world level; among the existing face equipment, the specific weight of longwall mining equipment, road headers, loading machines, and belt conveyors of the new generation is only several percent. Five steps of introduction of the virus management at the enterprise are identified: opening, development, participation, diffusion, sustainability. The principles of introduction of the viral management in the enterprises of the coal industry are offered. It is established that the main idea of the viral management is to “infect” the organization and, mainly, employees with one or another “virus” in the form of a common idea or goal. It is indicated that the viral management assumes a certain automaticity of changes, internal “obsession” with this or other innovation, involvement of an informal personal factor.

  2. Identification of Nematodirus species (Nematoda: Molineidae) from wild ruminants in Italy using ribosomal DNA markers.

    Science.gov (United States)

    Gasser, R B; Rossi, L; Zhu, X

    1999-11-01

    The sequence of the second internal transcribed spacer of ribosomal DNA was determined for four species of Nematodirus (Nematodirus rupicaprae, Nematodirus oiratianus, Nematodirus davtiani alpinus and Nematodirus europaeus) from roe deer or alpine chamois. The second internal transcribed spacer of the four species varied in length from 228 to 236 bp, and the G + C contents ranged from 41 to 44%. While no intraspecific sequence variation was detected among multiple samples representing three of the taxa, sequence differences of 5.9-9.7% were detected among the four species, Nematodirus davtiani alpinus and N. rupicaprae were genetically most similar (94.1%), followed by N. oiratianus, N. europaeus and N. rupicaprae (91.1-91.5%), whereas N. oiratianus was genetically most different from N. davtiani alpinus. The interspecific sequence differences were exploited for the delineation of the four species by PCR-based restriction fragment length polymorphism (using two enzymes) and single-strand conformation polymorphism. The results have implications for diagnosis, epidemiology and for studying the systematics of the Nematodirinae.

  3. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  4. The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity.

    Science.gov (United States)

    Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K

    2018-04-15

    The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral

  5. Viral Haemorrhagic Septicaemia Virus

    DEFF Research Database (Denmark)

    Olesen, Niels Jørgen; Skall, Helle Frank

    2013-01-01

    This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus.......This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus....

  6. TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

    Directory of Open Access Journals (Sweden)

    Abhishek Ghosh

    2014-10-01

    Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

  7. Assembly of viral genomes from metagenomes

    NARCIS (Netherlands)

    S.L. Smits (Saskia); R. Bodewes (Rogier); A. Ruiz-Gonzalez (Aritz); V. Baumgärtner (Volkmar); M.P.G. Koopmans D.V.M. (Marion); A.D.M.E. Osterhaus (Albert); A. Schürch (Anita)

    2014-01-01

    textabstractViral infections remain a serious global health issue. Metagenomic approaches are increasingly used in the detection of novel viral pathogens but also to generate complete genomes of uncultivated viruses. In silico identification of complete viral genomes from sequence data would allow

  8. Viral commercials: the consumer as marketeer

    NARCIS (Netherlands)

    Ketelaar, P.E.; Lucassen, P.; Kregting, G.H.J.

    2010-01-01

    Research into the reasons why consumers pass along viral commercials: their motives, the content characteristics of viral commercials and the medium context in which viral commercials appear. Based on the uses and gratifications perspective this study has determined which motives of consumers,

  9. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  10. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  11. Viral Infection in Renal Transplant Recipients

    Directory of Open Access Journals (Sweden)

    Jovana Cukuranovic

    2012-01-01

    Full Text Available Viruses are among the most common causes of opportunistic infection after transplantation. The risk for viral infection is a function of the specific virus encountered, the intensity of immune suppression used to prevent graft rejection, and other host factors governing susceptibility. Although cytomegalovirus is the most common opportunistic pathogen seen in transplant recipients, numerous other viruses have also affected outcomes. In some cases, preventive measures such as pretransplant screening, prophylactic antiviral therapy, or posttransplant viral monitoring may limit the impact of these infections. Recent advances in laboratory monitoring and antiviral therapy have improved outcomes. Studies of viral latency, reactivation, and the cellular effects of viral infection will provide clues for future strategies in prevention and treatment of viral infections. This paper will summarize the major viral infections seen following transplant and discuss strategies for prevention and management of these potential pathogens.

  12. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  13. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  14. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  15. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  16. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  17. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  18. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  19. Viral Metagenomics: MetaView Software

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, C; Smith, J

    2007-10-22

    The purpose of this report is to design and develop a tool for analysis of raw sequence read data from viral metagenomics experiments. The tool should compare read sequences of known viral nucleic acid sequence data and enable a user to attempt to determine, with some degree of confidence, what virus groups may be present in the sample. This project was conducted in two phases. In phase 1 we surveyed the literature and examined existing metagenomics tools to educate ourselves and to more precisely define the problem of analyzing raw read data from viral metagenomic experiments. In phase 2 we devised an approach and built a prototype code and database. This code takes viral metagenomic read data in fasta format as input and accesses all complete viral genomes from Kpath for sequence comparison. The system executes at the UNIX command line, producing output that is stored in an Oracle relational database. We provide here a description of the approach we came up with for handling un-assembled, short read data sets from viral metagenomics experiments. We include a discussion of the current MetaView code capabilities and additional functionality that we believe should be added, should additional funding be acquired to continue the work.

  20. Acute Pancreatitis in acute viral hepatitis

    Directory of Open Access Journals (Sweden)

    S K.C.

    2011-03-01

    Full Text Available Introduction: The association of acute viral hepatitis and acute pancreatitis is well described. This study was conducted to find out the frequency of pancreatic involvement in acute viral hepatitis in the Nepalese population. Methods: Consecutive patients of acute viral hepatitis presenting with severe abdominal pain between January 2005 and April 2010 were studied. Patients with history of significant alcohol consumption and gall stones were excluded. Acute viral hepatitis was diagnosed by clinical examination, liver function test, ultrasound examination and confirmed by viral serology. Pancreatitis was diagnosed by clinical presentation, biochemistry, ultrasound examination and CT scan. Results: Severe abdominal pain was present in 38 of 382 serologically-confirmed acute viral hepatitis patients. Twenty five patients were diagnosed to have acute pancreatitis. The pancreatitis was mild in 14 and severe in 11 patients. The etiology of pancreatitis was hepatitis E virus in 18 and hepatitis A virus in 7 patients. Two patients died of complications secondary to shock. The remaining patients recovered from both pancreatitis and hepatitis on conservative treatment. Conclusions: Acute pancreatitis occurred in 6.5 % of patients with acute viral hepatitis. Cholelithiasis and gastric ulcers are the other causes of severe abdominal pain. The majority of the patients recover with conservative management. Keywords: acute viral hepatitis, acute pancreatitis, pain abdomen, hepatitis E, hepatitis A, endemic zone

  1. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  2. Viral O-GalNAc peptide epitopes

    DEFF Research Database (Denmark)

    Olofsson, Sigvard; Blixt, Klas Ola; Bergström, Tomas

    2016-01-01

    Viral envelope glycoproteins are major targets for antibodies that bind to and inactivate viral particles. The capacity of a viral vaccine to induce virus-neutralizing antibodies is often used as a marker for vaccine efficacy. Yet the number of known neutralization target epitopes is restricted o...

  3. RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2010-01-01

    Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130

  4. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  5. Molecular Mechanisms of Attenuation of the Sabin Strain of Poliovirus Type 3

    OpenAIRE

    Guest, Stephen; Pilipenko, Evgeny; Sharma, Kamal; Chumakov, Konstantin; Roos, Raymond P.

    2004-01-01

    Mutations critical for the central nervous system (CNS) attenuation of the Sabin vaccine strains of poliovirus (PV) are located within the viral internal ribosome entry site (IRES). We examined the interaction of the IRESs of PV type 3 (PV3) and Sabin type 3 (Sabin3) with polypyrimidine tract-binding protein (PTB) and a neural cell-specific homologue, nPTB. PTB and nPTB were found to bind to a site directly adjacent to the attenuating mutation, and binding at this site was less efficient on t...

  6. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  7. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  8. Viral infections in transplant recipients.

    Science.gov (United States)

    Razonable, R R; Eid, A J

    2009-12-01

    Solid organ and hematopoietic stem cell transplant recipients are uniquely predisposed to develop clinical illness, often with increased severity, due to a variety of common and opportunistic viruses. Patients may acquire viral infections from the donor (donor-derived infections), from reactivation of endogenous latent virus, or from the community. Herpes viruses, most notably cytomegalovirus and Epstein Barr virus, are the most common among opportunistic viral pathogens that cause infection after solid organ and hematopoietic stem cell transplantation. The polyoma BK virus causes opportunistic clinical syndromes predominantly in kidney and allogeneic hematopoietic stem cell transplant recipients. The agents of viral hepatitis B and C present unique challenges particularly among liver transplant recipients. Respiratory viral illnesses due to influenza, respiratory syncytial virus, and parainfluenza virus may affect all types of transplant recipients, although severe clinical disease is observed more commonly among lung and allogeneic hematopoietic stem cell transplant recipients. Less common viral infections affecting transplant recipients include those caused by adenoviruses, parvovirus B19, and West Nile virus. Treatment for viruses with proven effective antiviral drug therapies should be complemented by reduction in the degree of immunosuppression. For others with no proven antiviral drugs for therapy, reduction in the degree of immunosuppression remains as the sole effective strategy for management. Prevention of viral infections is therefore of utmost importance, and this may be accomplished through vaccination, antiviral strategies, and aggressive infection control measures.

  9. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  10. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  11. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  12. Assembly of viral genomes from metagenomes

    Directory of Open Access Journals (Sweden)

    Saskia L Smits

    2014-12-01

    Full Text Available Viral infections remain a serious global health issue. Metagenomic approaches are increasingly used in the detection of novel viral pathogens but also to generate complete genomes of uncultivated viruses. In silico identification of complete viral genomes from sequence data would allow rapid phylogenetic characterization of these new viruses. Often, however, complete viral genomes are not recovered, but rather several distinct contigs derived from a single entity, some of which have no sequence homology to any known proteins. De novo assembly of single viruses from a metagenome is challenging, not only because of the lack of a reference genome, but also because of intrapopulation variation and uneven or insufficient coverage. Here we explored different assembly algorithms, remote homology searches, genome-specific sequence motifs, k-mer frequency ranking, and coverage profile binning to detect and obtain viral target genomes from metagenomes. All methods were tested on 454-generated sequencing datasets containing three recently described RNA viruses with a relatively large genome which were divergent to previously known viruses from the viral families Rhabdoviridae and Coronaviridae. Depending on specific characteristics of the target virus and the metagenomic community, different assembly and in silico gap closure strategies were successful in obtaining near complete viral genomes.

  13. Viral marketing as epidemiological model

    OpenAIRE

    Rodrigues, Helena Sofia; Fonseca, Manuel

    2015-01-01

    In epidemiology, an epidemic is defined as the spread of an infectious disease to a large number of people in a given population within a short period of time. In the marketing context, a message is viral when it is broadly sent and received by the target market through person-to-person transmission. This specific marketing communication strategy is commonly referred as viral marketing. Due to this similarity between an epidemic and the viral marketing process and because the understanding of...

  14. Ethical Considerations in Research Participation Virality.

    Science.gov (United States)

    Ellis-Barton, Carol

    2016-07-01

    This article seeks to commence and encourage discussion around the upcoming ethical challenges of virality in network structures. When the call for participation in a research project on lupus in Ireland went from an advertisement in a newsletter to a meme (unit of transmissible information) on a closed Facebook page, the ethical considerations of virality were raised. The article analyzes the Association of Internet Researchers guidelines, Facebook policies, and the context of privacy in relation to virality. Virality creates the leverage for methodological pluralism. The nature of the inquiry can determine the method rather than the other way around. Viral ethical considerations are evolving due to the cyber world becoming the primary meme of communication, with flexibility in the researcher's protocol providing opportunities for efficient, cost-effective, and diverse recruitment. © The Author(s) 2016.

  15. The N-Terminal of Aquareovirus NS80 Is Required for Interacting with Viral Proteins and Viral Replication.

    Directory of Open Access Journals (Sweden)

    Jie Zhang

    Full Text Available Reovirus replication and assembly occurs within viral inclusion bodies that formed in specific intracellular compartments of cytoplasm in infected cells. Previous study indicated that aquareovirus NS80 is able to form inclusion bodies, and also can retain viral proteins within its inclusions. To better understand how NS80 performed in viral replication and assembly, the functional regions of NS80 associated with other viral proteins in aquareovirus replication were investigated in this study. Deletion mutational analysis and rotavirus NSP5-based protein association platform were used to detect association regions. Immunofluorescence images indicated that different N-terminal regions of NS80 could associate with viral proteins VP1, VP4, VP6 and NS38. Further co-immunoprecipitation analysis confirmed the interaction between VP1, VP4, VP6 or NS38 with different regions covering the N-terminal amino acid (aa, 1-471 of NS80, respectively. Moreover, removal of NS80 N-terminal sequences required for interaction with proteins VP1, VP4, VP6 or NS38 not only prevented the capacity of NS80 to support viral replication in NS80 shRNA-based replication complementation assays, but also inhibited the expression of aquareovirus proteins, suggesting that N-terminal regions of NS80 are necessary for viral replication. These results provided a foundational basis for further understanding the role of NS80 in viral replication and assembly during aquareovirus infection.

  16. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  17. How Can Viral Dynamics Models Inform Endpoint Measures in Clinical Trials of Therapies for Acute Viral Infections?

    Directory of Open Access Journals (Sweden)

    Carolin Vegvari

    Full Text Available Acute viral infections pose many practical challenges for the accurate assessment of the impact of novel therapies on viral growth and decay. Using the example of influenza A, we illustrate how the measurement of infection-related quantities that determine the dynamics of viral load within the human host, can inform investigators on the course and severity of infection and the efficacy of a novel treatment. We estimated the values of key infection-related quantities that determine the course of natural infection from viral load data, using Markov Chain Monte Carlo methods. The data were placebo group viral load measurements collected during volunteer challenge studies, conducted by Roche, as part of the oseltamivir trials. We calculated the values of the quantities for each patient and the correlations between the quantities, symptom severity and body temperature. The greatest variation among individuals occurred in the viral load peak and area under the viral load curve. Total symptom severity correlated positively with the basic reproductive number. The most sensitive endpoint for therapeutic trials with the goal to cure patients is the duration of infection. We suggest laboratory experiments to obtain more precise estimates of virological quantities that can supplement clinical endpoint measurements.

  18. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  19. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  20. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  1. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  2. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  3. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  4. Constrained pattern of viral evolution in acute and early HCV infection limits viral plasticity.

    Directory of Open Access Journals (Sweden)

    Katja Pfafferott

    2011-02-01

    Full Text Available Cellular immune responses during acute Hepatitis C virus (HCV and HIV infection are a known correlate of infection outcome. Viral adaptation to these responses via mutation(s within CD8+ T-cell epitopes allows these viruses to subvert host immune control. This study examined HCV evolution in 21 HCV genotype 1-infected subjects to characterise the level of viral adaptation during acute and early HCV infection. Of the total mutations observed 25% were within described CD8+ T-cell epitopes or at viral adaptation sites. Most mutations were maintained into the chronic phase of HCV infection (75%. The lack of reversion of adaptations and high proportion of silent substitutions suggests that HCV has structural and functional limitations that constrain evolution. These results were compared to the pattern of viral evolution observed in 98 subjects during a similar phase in HIV infection from a previous study. In contrast to HCV, evolution during acute HIV infection is marked by high levels of amino acid change relative to silent substitutions, including a higher proportion of adaptations, likely reflecting strong and continued CD8+ T-cell pressure combined with greater plasticity of the virus. Understanding viral escape dynamics for these two viruses is important for effective T cell vaccine design.

  5. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  6. Bile acids for viral hepatitis

    DEFF Research Database (Denmark)

    Chen, Weikeng; Liu, J; Gluud, C

    2007-01-01

    Trials have assessed bile acids for patients with viral hepatitis, but no consensus has been reached regarding their usefulness.......Trials have assessed bile acids for patients with viral hepatitis, but no consensus has been reached regarding their usefulness....

  7. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

    Science.gov (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

    2003-09-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  8. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  9. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

    Science.gov (United States)

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

    2017-07-01

    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  10. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  11. Viral Hepatitis: A through E and Beyond

    Science.gov (United States)

    ... National Digestive Diseases Information Clearinghouse What is viral hepatitis? Viral hepatitis is inflammation of the liver caused by ... and serious. Drugs are available to treat chronic hepatitis. 4 Viral Hepatitis: A through E and Beyond What else ...

  12. Viral Hepatitis: Information for Gay and Bisexual Men

    Science.gov (United States)

    VIRAL HEPATITIS Information for Gay and Bisexual Men What is viral hepatitis? Viral hepatitis is an infection of the liver caused by one of several ... each virus is spread in different ways. Are gay and bisexual men at risk for viral hepatitis? ...

  13. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  14. Potential Natural Products for Alzheimer’s Disease: Targeted Search Using the Internal Ribosome Entry Site of Tau and Amyloid-β Precursor Protein

    Directory of Open Access Journals (Sweden)

    Yun-Chieh Tasi

    2015-04-01

    Full Text Available Overexpression of the amyloid precursor protein (APP and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer’s disease (AD. As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES elements flanked by β-galactosidase gene (cap-dependent and secreted alkaline phosphatase (SEAP (cap-independent to discern the mechanism of action of memantine, an N-methyl-d-aspartate (NMDA receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE−/− mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD.

  15. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  16. Identification of an Internal Ribosome Entry Segment in the 5′ Region of the Mouse VL30 Retrotransposon and Its Use in the Development of Retroviral Vectors

    Science.gov (United States)

    López-Lastra, Marcelo; Ulrici, Sandrine; Gabus, Caroline; Darlix, Jean-Luc

    1999-01-01

    Mouse virus-like 30S RNAs (VL30m) constitute a family of retrotransposons, present at 100 to 200 copies, dispersed in the mouse genome. They display little sequence homology to Moloney murine leukemia virus (MoMLV), do not encode virus-like proteins, and have not been implicated in retroviral carcinogenesis. However, VL30 RNAs are efficiently packaged into MLV particles that are propagated in cell culture. In this study, we addressed whether the 5′ region of VL30m could replace the 5′ leader of MoMLV functionally in a recombinant vector construct. Our data confirm that the putative packaging sequence of VL30 is located within the 5′ region (nucleotides 362 to 1149 with respect to the cap structure) and that it can replace the packaging sequence of MoMLV. We also show that VL30m contains an internal ribosome entry segment (IRES) in the 5′ region, as do MoMLV, Friend murine leukemia virus, Harvey murine sarcoma virus, and avian reticuloendotheliosis virus type A. Our data show that both the packaging and IRES functions of the 5′ region of VL30m RNA can be efficiently used to develop retrotransposon-based vectors. PMID:10482590

  17. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  18. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  19. Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load.

    NARCIS (Netherlands)

    Arnaiz, J.A.; Mallolas, J.; Podzamczer, D.; Gerstoft, J.; Lundgren, J.D.; Cahn, P.; Fatkenheuer, G.; D'Arminio-Monforte, A.; Casiro, A.; Reiss, P.; Burger, D.M.; Stek Jr, M.; Gatell, J.M.

    2003-01-01

    OBJECTIVE: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). DESIGN: Multicentre, international,

  20. Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load

    NARCIS (Netherlands)

    Arnaiz, Juan A.; Mallolas, Josep; Podzamczer, Daniel; Gerstoft, Jan; Lundgren, Jens D.; Cahn, Pedro; Fätkenheuer, Gerd; D'Arminio-Monforte, Antonella; Casiró, Arnaldo; Reiss, Peter; Burger, David M.; Stek, Michael; Gatell, José M.

    2003-01-01

    Objective: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). Design: Multicentre, international,

  1. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  2. Contagious Content: Viral Video Ads Identification of Content Characteristics that Help Online Video Advertisements Go Viral

    Directory of Open Access Journals (Sweden)

    Yentl Knossenburg

    2016-12-01

    Full Text Available Why do some online video advertisements go viral while others remain unnoticed? What kind of video content keeps the viewer interested and motivated to share? Many companies have realized the need to innovate their marketing strategies and have embraced the newest ways of using technology, as the Internet, to their advantage as in the example of virality. Yet few marketers actually understand how, and academic literature on this topic is still in development. This study investigated which content characteristics distinguish successful from non-successful online viral video advertisements by analyzing 641 cases using Structural Equation Modeling. Results show that Engagement and Surprise are two main content characteristics that significantly increase the chance of online video advertisements to go viral.  

  3. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  4. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  5. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  6. Diversitas Genetik Anopheles balabacensis, Baisas di Berbagai Daerah Indonesia Berdasarkan Sekuen Gen ITS 2 DNA Ribosom

    Directory of Open Access Journals (Sweden)

    Widiarti Widiarti

    2016-05-01

    Full Text Available AbstractMalaria control is remain a challenge although various attempts have been conducted. One of the issues in controlling the vectors is the presence of species complex. The species complex is an example of genetic diversity. Anopheles balabacensis, Baisas reported as complex species in various countries, but has not been widely reported in Indonesia. In order to enhance malaria control, it is important to understand the vectors and its bioecology. The aim of the study were a. to identify An. balabacensis, Baisas suspected as species complex based on ribosomal DNA the second internal transcribed spacer (ITS2 gene sequences, b. to understand the genetic diversity of An. balabacensis, Baisas collected from endemic and non endemic regions distincted by geographical distance, c. to understand the genetic relationships (taxonomi distance among An. balabacensis, Baisas from difference regions in Indonesia through reconstructing the phylogenetic trees. The results showed that An. balabacensis, Baisas in Indonesia is identified as sympatric and allopatrik complex species. There were differences which was far enough in the genetic relationships among An. balabacensis populations collected from Pusuk Lestari in the area of Meninting Health Center, West Lombok, NTB. This differences were identified as sympatric complex. In addition, base on the relationship among An. leucosphyrus group, An balabacensis, Baisas collected from Berjoko Nunukan Regency showed that the species quite far compare to An. balabacensis, Baisas originally from Central Java and Lombok NTB.Keywords : An. balabacensis, genetic variation, the second Internal Transcribed Spacer (ITS2.AbstrakPenanggulangan malaria masih banyak menemui kendala walaupun berbagai upaya telah dilakukan. Salah satu kendala yang menyulitkan dalam pengendalian vektor adalah adanya spesies kompleks pada populasi nyamuk vektor. Spesies kompleks merupakan contoh diversitas genetik. Anopheles balabacensis

  7. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  8. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  9. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  10. MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW

    Directory of Open Access Journals (Sweden)

    Tobias von der Haar

    2012-04-01

    Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

  11. CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2011-01-01

    Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

  12. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Science.gov (United States)

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  13. Kinetics of viral shedding provide insights into the epidemiology of viral hemorrhagic septicemia in Pacific herring

    Science.gov (United States)

    Hershberger, Paul K.; Gregg, Jacob L.; Winton, James R.; Grady, Courtney; Collins, Rachael

    2010-01-01

    Losses from infectious diseases are an important component of natural mortality among marine fish species, but factors controlling the ecology of these diseases and their potential responses to anthropogenic changes are poorly understood. We used viral hemorrhagic septicemia virus (VHSV) and a laboratory stock of Pacific herring Clupea pallasii to investigate the kinetics of viral shedding and its effect on disease transmission and host mortality. Outbreaks of acute disease, accompanied by mortality and viral shedding, were initiated after waterborne exposure of herring to concentrations of VHSV as low as 101 plaque-forming units (pfu) ml–1. Shed virus in flow-through tanks was first detected 4 to 5 d post-exposure, peaked after 6 to 10 d, and was no longer detected after 16 d. Shedding rates, calculated from density, flow and waterborne virus titer reached 1.8 to 5.0 × 108 pfu fish–1 d–1. Onset of viral shedding was dose-dependent and preceded initial mortality by 2 d. At 21 d, cumulative mortality in treatment groups ranged from 81 to 100% and was dependent not on challenge dose, but on the kinetics and level of viral shedding by infected fish in the tank. Possible consequences of the viral shedding and disease kinetics are discussed in the context of epizootic initiation and perpetuation among populations of wild Pacific herring.

  14. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  15. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  16. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  17. Virus del dengue: estructura y ciclo viral Dengue virus: structure and viral cycle

    Directory of Open Access Journals (Sweden)

    Myriam L Velandia

    2011-03-01

    Full Text Available El virus del dengue (DENV es el agente causal de la enfermedad conocida como dengue, que es la principal enfermedad viral transmitida por artrópodos en el mundo. El DENV es un flavivirus que ingresa por endocitosis y se replica en el citoplasma de la célula infectada, originando tres proteínas estructurales y siete proteínas no estructurales, sobre las cuales se conocen sólo algunas de sus funciones en la replicación viral o en la infección. El ciclo viral que ocurre en las células infectadas hasta ahora está comenzando a aclararse y su conocimiento permitirá en el futuro próximo diseñar racionalmente moléculas que lo intervengan y eviten la replicación del virus. Durante la infección, el individuo puede presentar fiebre indiferenciada o, en otros casos, puede presentar un proceso generalizado de activación de la respuesta inmunitaria innata y adquirida, lo cual provoca la liberación de factores inflamatorios solubles que alteran la fisiología de los tejidos, principalmente el endotelio, conllevando al desarrollo de manifestaciones clínicas graves. Aunque se ha identificado un gran número de factores del individuo asociados al desarrollo de la enfermedad por DENV, queda por identificar el papel de las diferentes proteínas virales en la patogenia de la enfermedad. En la presente revisión, se presenta una breve actualización sobre la estructura y biología del DENV, de su ciclo viral intracelular y, finalmente, se introducen algunos conceptos sobre la inmunopatogenia de la enfermedad producida por este agente.Dengue virus (DENV is responsible for the clinical entity known as dengue that is a great concern for economy and public health of tropical countries. This flavivirus is a single strand RNA virus that after their translation and replication in host cells produces three structural and seven non-structural proteins with specific function in replication or cell binding process that we will describe here. Intracellular

  18. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  19. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  20. APOBEC3 Interference during Replication of Viral Genomes

    Directory of Open Access Journals (Sweden)

    Luc Willems

    2015-06-01

    Full Text Available Co-evolution of viruses and their hosts has reached a fragile and dynamic equilibrium that allows viral persistence, replication and transmission. In response, infected hosts have developed strategies of defense that counteract the deleterious effects of viral infections. In particular, single-strand DNA editing by Apolipoprotein B Editing Catalytic subunits proteins 3 (APOBEC3s is a well-conserved mechanism of mammalian innate immunity that mutates and inactivates viral genomes. In this review, we describe the mechanisms of APOBEC3 editing during viral replication, the viral strategies that prevent APOBEC3 activity and the consequences of APOBEC3 modulation on viral fitness and host genome integrity. Understanding the mechanisms involved reveals new prospects for therapeutic intervention.

  1. Enterovirus 71 contains a type I IRES element that functions when eukaryotic initiation factor eIF4G is cleaved

    International Nuclear Information System (INIS)

    Thompson, Sunnie R.; Sarnow, Peter

    2003-01-01

    Human enterovirus 71 (EV71) is a member of the Enterovirus genus of the Picornaviridae family. Other members of this family utilize an unusual mechanism of translation initiation whereby ribosomes are recruited internally to the viral RNA by an internal ribosome site (IRES) located in their 5' noncoding regions (5' NCR). Using dicistronic reporter constructs, we demonstrate that the 5' NCRs of the 7423/MS/87 and BrCr strains of EV71 function as an IRES both in extracts and in cultured cells. Preincubation of translation extracts with purified coxsackievirus 2A protease cleaved elF4G, a component of the cap binding complex, resulting in a significant decrease in translation of capped mRNAs. In contrast, the translational efficiency of the EV71 IRES was enhanced under this condition, demonstrating that the EV71 IRES functions similar to other enterovirus IRES elements when components of the cap binding protein complex are cleaved. Finally, insertion of an upstream, out-of-frame start codon in the 5' NCR of the EV71 genome inhibited IRES activity, suggesting that EV71 can be classified as a type I IRES, in which ribosomes first bind upstream of the initiation codon and then scan the mRNA until an appropriate downstream AUG start codon is encountered and protein synthesis commences

  2. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  3. Initiation of translation in bacteria by a structured eukaryotic IRES RNA.

    Science.gov (United States)

    Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S

    2015-03-05

    The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.

  4. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  5. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  6. Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

    Directory of Open Access Journals (Sweden)

    Haiwei Cheng

    Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

  7. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  8. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  9. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  10. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  11. Switch from cap- to factorless IRES-dependent 0 and +1 frame translation during cellular stress and dicistrovirus infection.

    Directory of Open Access Journals (Sweden)

    Qing S Wang

    Full Text Available Internal ribosome entry sites (IRES are utilized by a subset of cellular and viral mRNAs to initiate translation during cellular stress and virus infection when canonical cap-dependent translation is compromised. The intergenic region (IGR IRES of the Dicistroviridae uses a streamlined mechanism in which it can directly recruit the ribosome in the absence of initiation factors and initiates translation using a non-AUG codon. A subset of IGR IRESs including that from the honey bee viruses can also direct translation of an overlapping +1 frame gene. In this study, we systematically examined cellular conditions that lead to IGR IRES-mediated 0 and +1 frame translation in Drosophila S2 cells. Towards this, a novel bicistronic reporter that exploits the 2A "stop-go" peptide was developed to allow the detection of IRES-mediated translation in vivo. Both 0 and +1 frame translation by the IGR IRES are stimulated under a number of cellular stresses and in S2 cells infected by cricket paralysis virus, demonstrating a switch from cap-dependent to IRES-dependent translation. The regulation of the IGR IRES mechanism ensures that both 0 frame viral structural proteins and +1 frame ORFx protein are optimally expressed during virus infection.

  12. A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

    Directory of Open Access Journals (Sweden)

    Andrea Ciammaruconi

    2008-01-01

    Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

  13. The Pacific Ocean virome (POV: a marine viral metagenomic dataset and associated protein clusters for quantitative viral ecology.

    Directory of Open Access Journals (Sweden)

    Bonnie L Hurwitz

    Full Text Available Bacteria and their viruses (phage are fundamental drivers of many ecosystem processes including global biogeochemistry and horizontal gene transfer. While databases and resources for studying function in uncultured bacterial communities are relatively advanced, many fewer exist for their viral counterparts. The issue is largely technical in that the majority (often 90% of viral sequences are functionally 'unknown' making viruses a virtually untapped resource of functional and physiological information. Here, we provide a community resource that organizes this unknown sequence space into 27 K high confidence protein clusters using 32 viral metagenomes from four biogeographic regions in the Pacific Ocean that vary by season, depth, and proximity to land, and include some of the first deep pelagic ocean viral metagenomes. These protein clusters more than double currently available viral protein clusters, including those from environmental datasets. Further, a protein cluster guided analysis of functional diversity revealed that richness decreased (i from deep to surface waters, (ii from winter to summer, (iii and with distance from shore in surface waters only. These data provide a framework from which to draw on for future metadata-enabled functional inquiries of the vast viral unknown.

  14. The Pacific Ocean virome (POV): a marine viral metagenomic dataset and associated protein clusters for quantitative viral ecology.

    Science.gov (United States)

    Hurwitz, Bonnie L; Sullivan, Matthew B

    2013-01-01

    Bacteria and their viruses (phage) are fundamental drivers of many ecosystem processes including global biogeochemistry and horizontal gene transfer. While databases and resources for studying function in uncultured bacterial communities are relatively advanced, many fewer exist for their viral counterparts. The issue is largely technical in that the majority (often 90%) of viral sequences are functionally 'unknown' making viruses a virtually untapped resource of functional and physiological information. Here, we provide a community resource that organizes this unknown sequence space into 27 K high confidence protein clusters using 32 viral metagenomes from four biogeographic regions in the Pacific Ocean that vary by season, depth, and proximity to land, and include some of the first deep pelagic ocean viral metagenomes. These protein clusters more than double currently available viral protein clusters, including those from environmental datasets. Further, a protein cluster guided analysis of functional diversity revealed that richness decreased (i) from deep to surface waters, (ii) from winter to summer, (iii) and with distance from shore in surface waters only. These data provide a framework from which to draw on for future metadata-enabled functional inquiries of the vast viral unknown.

  15. Viral-specific T-cell transfer from HSCT donor for the treatment of viral infections or diseases after HSCT.

    Science.gov (United States)

    Qian, C; Wang, Y; Reppel, L; D'aveni, M; Campidelli, A; Decot, V; Bensoussan, D

    2018-02-01

    Allogeneic hematopoietic stem cell transplantation (HSCT) is a curative option for treatment of some malignant and non-malignant hematological diseases. However, post-HSCT patients are severely immunocompromised and susceptible to viral infections, which are a major cause of morbidity and mortality. Although antiviral agents are now available for most types of viral infections, they are not devoid of side effects and their efficacy is limited when there is no concomitant antiviral immune reconstitution. In recent decades, adoptive transfer of viral-specific T cells (VSTs) became an alternative treatment for viral infection after HSCT. However, two major issues are concerned in VST transfer: the risk of GVHD and antiviral efficacy. We report an exhaustive review of the published studies that focus on prophylactic and/or curative therapy by donor VST transfer for post-HSCT common viral infections. A low incidence of GVHD and a good antiviral efficacy was observed after adoptive transfer of VSTs from HSCT donor. Viral-specific T-cell transfer is a promising approach for a broad clinical application. Nevertheless, a randomized controlled study in a large cohort of patients comparing antiviral treatment alone to antiviral treatment combined with VSTs is still needed to demonstrate efficacy and safety.

  16. Viral membrane fusion

    International Nuclear Information System (INIS)

    Harrison, Stephen C.

    2015-01-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism

  17. Viral membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

    2015-05-15

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  18. Viral Advertising on Facebook in Vietnam

    OpenAIRE

    Tran, Phuong

    2014-01-01

    The purpose of this thesis is to explore which factors affect the effectiveness of viral advertising on Facebook in Vietnam. The quantitative research method is applied in this research and the sample is Vietnamese Facebook users. After the data analysis stage using SPSS, it became clear that weak ties, perceptual affinity and emotions have an impact on the effectiveness of viral advertising. The results provide a pratical implication of how to make an Ad which can go viral on Facebook. Moreo...

  19. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  20. HIV Viral Load: MedlinePlus Lab Test Information

    Science.gov (United States)

    ... this page: https://medlineplus.gov/labtests/hivviralload.html HIV Viral Load To use the sharing features on this page, please enable JavaScript. What is an HIV Viral Load? An HIV viral load is a ...

  1. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  2. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  3. Origins and challenges of viral dark matter.

    Science.gov (United States)

    Krishnamurthy, Siddharth R; Wang, David

    2017-07-15

    The accurate classification of viral dark matter - metagenomic sequences that originate from viruses but do not align to any reference virus sequences - is one of the major obstacles in comprehensively defining the virome. Depending on the sample, viral dark matter can make up from anywhere between 40 and 90% of sequences. This review focuses on the specific nature of dark matter as it relates to viral sequences. We identify three factors that contribute to the existence of viral dark matter: the divergence and length of virus sequences, the limitations of alignment based classification, and limited representation of viruses in reference sequence databases. We then discuss current methods that have been developed to at least partially circumvent these limitations and thereby reduce the extent of viral dark matter. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Detection of carriers and genetic counseling in duchenne muscular dystrophy by ribosomal protein synthesis.

    Science.gov (United States)

    Ionasescu, V; Zellweger, H; Burmeister, L

    1976-11-01

    The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.

  5. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  6. Good Friends, Bad News - Affect and Virality in Twitter

    DEFF Research Database (Denmark)

    Hansen, Lars Kai; Arvidsson, Adam; Nielsen, Finn Årup

    2011-01-01

    The link between affect, defined as the capacity for sentimental arousal on the part of a message, and virality, defined as the probability that it be sent along, is of significant theoretical and practical importance, e.g. for viral marketing. The basic measure of virality in Twitter is the prob......The link between affect, defined as the capacity for sentimental arousal on the part of a message, and virality, defined as the probability that it be sent along, is of significant theoretical and practical importance, e.g. for viral marketing. The basic measure of virality in Twitter...

  7. Chlamydia abortus YhbZ, a truncated Obg family GTPase, associates with the Escherichia coli large ribosomal subunit.

    Science.gov (United States)

    Polkinghorne, Adam; Vaughan, Lloyd

    2011-01-01

    The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Viral and vector zoonotic exploitation of a homo-sociome memetic complex.

    Science.gov (United States)

    Rupprecht, C E; Burgess, G W

    2015-05-01

    As most newly characterized emerging infectious diseases are considered to be zoonotic, a modern pre-eminence ascribed within this classification lies clearly within the viral taxonomic realm. In particular, RNA viruses deserve special concern given their documented impact on conservation biology, veterinary medicine and public health, with an unprecedented ability to promote an evolutionary host-pathogen arms race from the ultimate infection and immunity perspective. However, besides the requisite molecular/gross anatomical and physiological bases for infectious diseases to transmit from one host to another, both viral pathogens and their reservoirs/vectors exploit a complex anthropological, cultural, historical, psychological and social suite that specifically defines the phylodynamics within Homo sapiens, unlike any other species. Some of these variables include the ecological benefits of living in groups, decisions on hunting and foraging behaviours and dietary preferences, myths and religious doctrines, health economics, travel destinations, population planning, political decisions on agricultural product bans and many others, in a homo-sociome memetic complex. Taken to an extreme, such complexities elucidate the underpinnings of explanations as to why certain viral zoonoses reside in neglected people, places and things, whereas others are chosen selectively and prioritized for active mitigation. Canine-transmitted rabies serves as one prime example of how a neglected viral zoonosis may transition to greater attention on the basis of renewed advocacy, social media, local champions and vested international community engagement. In contrast, certain bat-associated and arboviral diseases suffer from basic ignorance and perpetuated misunderstanding of fundamental reservoir and vector ecology tenets, translated into failed control policies that only exacerbate the underlying environmental conditions of concern. Beyond applied biomedical knowledge, epidemiological

  9. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  10. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  11. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  12. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  13. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  14. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  15. Time to viral load suppression in antiretroviral-naive and -experienced HIV-infected pregnant women on highly active antiretroviral therapy: implications for pregnant women presenting late in gestation.

    Science.gov (United States)

    Aziz, N; Sokoloff, A; Kornak, J; Leva, N V; Mendiola, M L; Levison, J; Feakins, C; Shannon, M; Cohan, D

    2013-11-01

    To compare time to achieve viral load HIV-infected antiretroviral (ARV) -naive versus ARV-experienced pregnant women on highly active antiretroviral therapy (HAART). Retrospective cohort study. Three university medical centers, USA. HIV-infected pregnant women initiated or restarted on HAART during pregnancy. We calculated time to viral load HIV-infected pregnant women on HAART who reported at least 50% adherence, stratifying based on previous ARV exposure history. Time to HIV viral load HIV-infected pregnant women, comprising 76 ARV-naive and 62 ARV-experienced. Ninety-three percent of ARV-naive women achieved a viral load HIV log10 viral load was associated with a later time of achieving viral load HIV log10 viral load was associated with a longer time of achieving viral load Pregnant women with ≥50% adherence, whether ARV-naive or ARV-experienced, on average achieve a viral load HIV log10 viral load were all statistically significant predictors of earlier time to achieve viral load <400 copies/ml and <1000 copies/ml. Increased CD4 count was statistically significant as a predictor of earlier time to achieve viral load <1000 copies/ml. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

  16. The antituberculosis antibiotic capreomycin inhibits protein synthesis by disrupting interaction between ribosomal proteins L12 and L10.

    Science.gov (United States)

    Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong

    2014-01-01

    Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.

  17. What makes a marketing campaing a viral success? : A descriptive model exploring the mechanisms of viral marketing

    OpenAIRE

    Stålnacke Larsson, Richard; Odén, Niklas

    2011-01-01

    What makes some marketing campaigns so immensely big and well known when they are marketed through social media or with a viral approach? How can a company reach out to customers through viral marketing and how can they make use of today’s social media to achieve it? In this article we will try to understand and further explore what a campaign have to accomplish in order to achieve a viral spread, using a descriptive model which uses a number of factors and terms necessary in order to properl...

  18. Emerging Viral Diseases of Tomato Crops

    NARCIS (Netherlands)

    Hanssen, I.M.; Lapidot, M.; Thomma, B.P.H.J.

    2010-01-01

    Viral diseases are an important limiting factor in many crop production systems. Because antiviral products are not available, control strategies rely on genetic resistance or hygienic measures to prevent viral diseases, or on eradication of diseased crops to control such diseases. Increasing

  19. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  20. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed